JCB logo
MBL International Tel: 800.200.5459 CLICK HERE
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article
Right arrow Full Text
Right arrow Full Text (PDF, 686K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Chuang, J.-Z.
Right arrow Articles by Sung, C.-H.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Chuang, J.-Z.
Right arrow Articles by Sung, C.-H.
Right arrowPubmed/NCBI databases
*Compound via MeSH
*Substance via MeSH
Hazardous Substances DB
*CYCLOPENTANE
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

© The Rockefeller University Press, 0021-9525/1998//1245 $5.00
The Journal of Cell Biology, Volume 142, Number 5, , 1998 1245-1256


Articles

The Cytoplasmic Tail of Rhodopsin Acts as a Novel Apical Sorting Signal in Polarized MDCK Cells



Jen-Zen Chuang* and Ching-Hwa Sung*,{ddagger}

* Department of Ophthalmology, {ddagger} Department of Cell Biology and Anatomy, The Margaret M. Dyson Vision Research Institute, Cornell University Medical College, New York 10021

All basolateral sorting signals described to date reside in the cytoplasmic domain of proteins, whereas apical targeting motifs have been found to be lumenal. In this report, we demonstrate that wild-type rhodopsin is targeted to the apical plasma membrane via the TGN upon expression in polarized epithelial MDCK cells. Truncated rhodopsin with a deletion of 32 COOH-terminal residues shows a nonpolar steady-state distribution. Addition of the COOH-terminal 39 residues of rhodopsin redirects the basolateral membrane protein CD7 to the apical membrane. Fusion of rhodopsin's cytoplasmic tail to a cytosolic protein glutathione S-transferase (GST) also targets this fusion protein (GST–Rho39Tr) to the apical membrane. The targeting of GST–Rho39Tr requires both the terminal 39 amino acids and the palmitoylation membrane anchor signal provided by the rhodopsin sequence. The apical transport of GST–Rho39Tr can be reversibly blocked at the Golgi complex by low temperature and can be altered by brefeldin A treatment. This indicates that the membrane-associated GST–Rho39Tr protein may be sorted along a yet unidentified pathway that is similar to the secretory pathway in polarized MDCK cells. We conclude that the COOH-terminal tail of rhodopsin contains a novel cytoplasmic apical sorting determinant. This finding further indicates that cytoplasmic sorting machinery may exist in MDCK cells for some apically targeted proteins, analogous to that described for basolaterally targeted proteins.

Key Words: MDCK • rhodopsin • apical sorting signal • cytoplasmic amino acids • photoreceptor



Abbreviations used in this paper: BFA, brefeldin A; GPI, glycosyl phosphatidylinositol; GST, glutathione S-transferase; PFA, paraformaldehyde.

Address all correspondence to Dr. Ching-Hwa Sung, Dyson Vision Research Institute, Cornell University Medical College, 1300 York Avenue, New York, NY 10021. Tel.: (212) 746-2291. Fax: (212) 746-8101. E-mail: chsung{at}mail.med.cornell.edu

2. Multiple-step constructions were carried out to generate the plasmid pDB-Rho39Tr. First, the coding sequence for rhodopsin's terminal 39 amino acids was PCR amplified from human rhodopsin cDNA (forward: 5'CGGAATTCCGACGAGCATCAGT TGAGAAGCGACGAGCAT-CAGTTGAGTTCAACAAGCAGTTCCGGAACTGCATGC; reverse: 5'-ATGCTCTAGAAGTCCTAGGCAGGTCTTAGGC), digested with EcoRI/XbaI, and subcloned into EcoRI/XbaI-digested pMAL-cRI (NEB, Beverly, MA) to generate a maltose binding protein–Rho39 fusion construct. The rhodopsin sequence and its flanking restriction sites were then amplified from the maltose binding protein–Rho39 fusion construct (forward: 5'-GGTCGTCAGACTGTCGATGAAGCC; reverse: 5'-AATGTACAGCCGGGGCCACCTGGCTCG), digested with SacI/BsrGI, and ligated into SacI/Acc65I-digested maltose binding protein–Rho39 to generate a maltose binding protein–Rho39Di construct. This procedure was repeated once more to transfer another rhodopsin PCR fragment into SacI/Acc65I-digested maltose binding protein–Rho39Di construct to generate maltose binding protein–Rho39Tr construct. Finally, a PCR fragment containing the coding sequences for a triple repeat of rhodopsin's terminal 39 residues was amplified using maltose binding protein– Rho39Tr as a template (forward: 5'-CATGCCATGGCCAGCGGTCGTCAGACTGTCG; reverse: 5'-GTTGTAAAACGACGGCCAGTGCC) and subcloned into a NcoI/SalI-digested pAS2 vector (CLONTECH Labs, Palo Alto, CA) to obtain pDB-Rho39Tr. All inserts generated by PCR reactions were sequenced to confirm.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?


This article has been cited by other articles:



  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents