JCB logo
PeproTech: Cell Culture Supplements
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 452K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vleminckx, K.
Right arrow Articles by Gumbiner, B. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vleminckx, K.
Right arrow Articles by Gumbiner, B. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
J. Cell Biol.
© The Rockefeller University Press
0021-9525/97/01/411/10 $2.00
Volume 136, Number 2, January 27, 1997 411-420

Adenomatous Polyposis Coli Tumor Suppressor Protein Has Signaling Activity in Xenopus laevis Embryos Resulting in the Induction of an Ectopic Dorsoanterior Axis

Kris Vleminckx,* Ellen Wong,* Kathy Guger,* Bonnee Rubinfeld,Dagger Paul Polakis,Dagger and Barry M. Gumbiner*

* Cellular Biochemistry and Biophysics Program, Memorial Sloan-Kettering Cancer Center, New York 10021; and Dagger  Onyx Pharmaceuticals, Richmond, California 94806

Abstract
Materials and Methods
Results
Discussion
Footnotes
Acknowledgements
Abbreviations used in this paper
References


Abstract

Mutations in the adenomatous polyposis coli (APC) tumor suppressor gene are linked to both familial and sporadic human colon cancer. So far, a clear biological function for the APC gene product has not been determined. We assayed the activity of APC in the early Xenopus embryo, which has been established as a good model for the analysis of the signaling activity of the APC-associated protein beta -catenin. When expressed in the future ventral side of a four-cell embryo, full-length APC induced a secondary dorsoanterior axis and the induction of the homeobox gene Siamois. This is similar to the phenotype previously observed for ectopic beta -catenin expression. In fact, axis induction by APC required the availability of cytosolic beta -catenin. These results indicate that APC has signaling activity in the early Xenopus embryo. Signaling activity resides in the central domain of the protein, a part of the molecule that is missing in most of the truncating APC mutations in colon cancer. Signaling by APC in Xenopus embryos is not accompanied by detectable changes in expression levels of beta -catenin, indicating that it has direct positive signaling activity in addition to its role in beta -catenin turnover. From these results we propose a model in which APC acts as part of the Wnt/beta -catenin signaling pathway, either upstream of, or in conjunction with, beta -catenin.


The adenomatous polyposis coli (APC)1 gene is a tumor suppressor gene linked to familial adenomatous polyposis (FAP) and to the initiation of sporadic human colorectal cancer (9, 18, 20, 32, 40). Most FAP patients carry one allelic APC mutation in the 5' half of the coding sequence, which usually causes chain termination and results in the expression of truncated proteins. Colon polyps appear after the loss or mutation of the remaining wild-type allele, indicating that the mutant truncated APC does not act in a dominant-negative fashion by inactivating the wild type (34, 35). All mutant proteins lack the COOH-terminal half, suggesting that some growthsuppressing or growth-regulating activity is present in this part of the molecule (39).

The structure of the APC protein provides many hints about its possible cellular function. The APC gene encodes a 300-kD protein, consisting of 2,843 amino acids, which has several structural domains. The NH2-terminal third contains an oligomerization domain, followed by seven armadillo repeats (imperfect repeats also found in proteins like armadillo, beta -catenin, plakoglobin, and importins). The middle part of the protein contains three successive 15-amino acid (aa) repeats, followed by seven related but distinct 20-aa repeats. Both types of repeats are able to bind independently to beta -catenin, a cadherin-associated protein important for intercellular adhesion (42, 43, 51). All truncated APC proteins lack most of the 20-aa repeats, but the majority of the somatic mutant APC proteins seem to have retained the 15-aa repeats and beta -catenin-binding activity (39). The COOH-terminal third of the APC protein contains a basic region and has recently been shown to bind the human homologue of the Drosophila disc large (Dlg) tumor suppressor protein (23) and a novel protein EB1 (52). In addition, the COOH terminus can bind to microtubules and promote their assembly in vitro (28, 48).

The discovery that APC interacts with beta -catenin leads to the proposal that it functions as a regulator of adhesion (14, 42, 51). beta -Catenin binds to cadherins and is required for full cadherin activity. In the meantime, however, beta -catenin has also been shown to have signal transduction activity. Its homologue in Drosophila, armadillo, is a segment polarity gene that acts as a component of the Wingless signaling pathway (36). Furthermore, beta -catenin has been found to be involved in axial patterning of early Xenopus embryos (8, 24). The formation of the dorsoanterior axis in Xenopus results from localized signaling activities in the dorsal vegetal zone (the Nieuwkoop center) of an early embryo. Injection of synthetic beta -catenin mRNA in the future ventral side of an early embryo mimics the Nieuwkoop center and results in the formation of a secondary dorsal axis, manifested by the appearance of doubleheaded embryos. Induction of a secondary axis by beta -catenin is cadherin independent, and by implication independent of cell-cell adhesion (6).

In the Xenopus embryo, beta -catenin seems to be part of a Wnt signaling pathway, which was first identified as the Wingless pathway in Drosophila (21, 36). Many components of this signaling pathway were identified and epistatically ordered using genetic screens of Drosophila mutants that show aberrant embryonic pattern formation. These so-called segment polarity genes include wingless (wg, encoding the Drosophila homologue of the Wnt growth factors), disheveled (dsh, encoding a protein with unknown function), zeste white 3/shaggy (zw3/shaggy, homologue of glycogen synthase kinase 3 [GSK-3]), armadillo (homologue of beta -catenin), and engrailed (a transcription factor). Wingless signaling leads to the accumulation of cytoplasmic armadillo through the inactivation of zeste white 3, a kinase that promotes the turnover of cytoplasmic armadillo protein. The Wg-induced increase in cytoplasmic armadillo protein then results in the induction of target genes, including engrailed. The Wingless/Wnt pathway has been remarkably well conserved in vertebrates, as evident in early Xenopus embryogenesis. Wnt, XDsh and beta -catenin can all induce an ectopic dorsoanterior axis (8, 11, 33, 49, 50), while the Zeste White 3 homologue GSK-3 antagonizes axis formation (4, 12, 38).

Recent findings suggest that APC may also be part of the Wnt signaling pathway. APC can physically interact with both beta -catenin and GSK-3, two components of the Wnt pathway (44). Also, APC seems to be a good substrate for GSK-3 in vitro, and phosphorylation of its central 20-aa repeat region promotes the binding of beta -catenin. Earlier observations implicated this central region of APC in the regulation of beta -catenin levels (29). However, it has not yet been shown directly that APC participates in a signaling pathway in vivo. Also, the significance of the effect of beta -catenin turnover for signaling has not been determined. We used the induction of an ectopic dorsal axis in early Xenopus embryos as a model system to test whether APC has signaling activity and whether it influences beta -catenin in vivo.


Materials and Methods

cDNA Cloning and Vector Construction

Degenerate primers flanking the beta -catenin binding sites of human APC were used to generate a PCR fragment from a Xenopus gt-10 lambda  cDNA library. About 5 µl of the library, which had a titer of 1.5 × 105, was boiled for 5 min and directly used as a PCR template in a 100-µl reaction consisting of 1 × PCR buffer containing Mg2+ (Promega Corp., Madison, WI), dNTPs, 100 mM each, 100 pmol of each primer, and 5 U Taq polymerase (Boehringer Mannheim Biochemicals, Indianapolis, IN). The sense primer corresponded to the peptide sequence NHMDDND with a 32-fold degeneracy. The antisense primer, corresponding to the peptide sequence YCVEDTP, was 132-fold degenerate. Using 30 cycles of 1-min denaturing, annealing, and extension steps of 94°, 51°, and 72°C, respectively, we obtained a 750-bp fragment that when sequenced confirmed its homology to the human APC cDNA. This PCR fragment was then used to screen the Xenopus gt-10 lambda  cDNA library. We first obtained clone 6A, encompassing the NH2-terminal third (including 100 bp of untranslated region) of the Xenopus APC cDNA and clone 3bF1 containing the middle part of Xenopus APC cDNA. Using the 400 bp of the 3' end of 3bF1 as a probe, we rescreened the library and obtained clone 40.2, which encompassed 3bF1 but extended 450 bp futher to the 3' end, and a clone 36.2 of ~3 kb, partially overlapping with 3bF1 and 40.2 but extending 2.2 kb further to the COOH terminus, still 150 bp short of the stop codon. A final screen of the library with a 600-bp probe obtained from the 3' end of clone 36.2 ultimately generated clone 111 containing the complete COOH-terminal third, including the stop codon and 150 bp of 3' untranslated region.

The full-length Xenopus APC cDNA (XAPC FL) and cDNAs encoding APC fragments (XAPC 1, XAPC 4, and XAPC 5) were constructed by ligating clones 6A, 40.2, and 111 via their EcoRI restrictions sites. All fragments were modified at their 5' end to introduce a start codon contained in an NcoI site and NH2-terminally linked to six myc-epitope tags in the vector pCS2+MT (45, 53), which was used for in vitro transcription.

The full-length human APC (hAPC) cDNA and the cDNA fragments hAPC 21 and hAPC 25, all having an altered 5' end containing a start codon in the NcoI restriction site, were isolated out of a baculovirus transfer vector (42) with the appropriate restriction enzymes and inserted into the vectors pCS2+ or alternatively into pCS2+MT, for which the APC fragments were linked 5' with a myc-epitope tag.

Immunoprecipitations and Western Blotting

Expression of endogenous Xenopus APC and its association with beta -catenin and cadherins were analyzed by immunoprecipitation and Western blotting. About 10 embryos were lysed in 250 µl NP-40 lysis buffer (0.5% NP-40, 150 mM NaCl, 2 mM EDTA, 10 mM Hepes-NaOH, pH 7.4, 0.02% NaN3) and centrifuged for 10 min, and the supernatant was incubated either for 3 h with anti-beta -catenin pAb (serum, diluted 1:500) or overnight with anti-APC3 pAb (serum, diluted 1:250). Immunocomplexes were precipitated for 1 h with protein A-Sepharose, washed five times with NP-40 lysis buffer, and eluted in SDS sample buffer. For the detection of APC, samples were separated on 3% agarose gels that were transferred to nitrocellulose by capillary blotting as described (47). Blots were blocked in PBS supplemented with 5% dry milk and 0.2% Triton X-100 and incubated in the same buffer overnight at 4°C with anti-APC3 pAb (diluted 1:5,000) followed by HRP-conjugated anti-rabbit IgG (Bio Rad Laboratories, Melville, NY; diluted 1:3,000) for detection of Xenopus APC proteins. Blots were washed and developed with enhanced chemiluminescence (Amersham Corp., Arlington Heights, IL). For the detection of beta -catenin and cadherins, samples were loaded on 7% SDS polyacrylamide gel, separated, and blotted to nitrocellulose. For detection of beta -catenin, blots were incubated for 1 h with anti-beta -catenin pAb (serum, diluted 1: 5,000) followed by HRP-conjugated anti-rabbit IgG (Bio Rad Laboratories; diluted 1:3,000). Cadherins were detected either with a mixture of C-cadherin-specific mAbs 6B6 and 5G5 (hybridoma supernatant, 1:3 diluted) or with a mixture of E-cadherin-specific mAbs 19A2 and 5D3 (hybridoma supernatant, 1:3 diluted), followed by HRP-conjugated anti- mouse IgG (Bio Rad Laboratories; diluted 1:3,000).

Expression of exogenous APC fragments was also analyzed by Western blotting. Typically, 5-10 embryos were lysed in 250 µl NP-40 lysis buffer. Lysates were supplemented with an equal volume of 2 × SDS sample buffer for analysis of total lysates. Samples were loaded on 3% agarose gels, separated, and immunoblotted as described above. Blots were incubated for 1 h at room temperature with anti-myc tag mAb 9E10 (5) (ascites, diluted 1:1,000) followed by HRP-conjugated anti-mouse IgG (Bio Rad Laboratories; diluted 1:3,000) for detection of myc-tagged APC proteins.

Reverse Transcriptase-PCR Assay

Reverse transcriptase (RT)-PCR was performed as described (3, 45). Typically two embryos or four animal caps were homogenized in 100 µl lysis buffer (0.5% SDS, 5 mM EDTA, 50 mM NaCl, and 50 mM Tris, pH 7.5) containing 250 µg/ml proteinase K (Boehringer Mannheim Biochemicals), incubated 30 min at 45°C, and extracted with phenol/chloroform. After the addition of 10 µg clean yeast tRNA as carrier, nucleic acids were precipitated with 1 M NH4OAc and EtOH. DNA was removed from the samples by RNase-free DNase (Boehringer Mannheim Biochemicals) at a concentration of 2 U/25 ml in DNase buffer (10 mM NaCl, 6 mM MgCl2, 100 mM CaCl2, 40 mM Tris, pH 7.9) containing 1 mM DTT and 15 U RNasin (Promega). After a phenol/chloroform extraction, RNA was precipitated with NH4OAc and EtOH. Half of the RNA samples were then denatured at 65°C, and hybridized with random hexamers (Boehringer Mannheim Biochemicals), and cDNA was made using the Superscript Preamplification System (GIBCO BRL, Gaithersburg, MD). A 20-µl reaction mixture consisted of 1× first strand buffer (GIBCO BRL), a dNTP mix of 500 mM of each nucleotide, 100 mM DTT, 15 U RNasin (Promega), and 25 U RT (GIBCO BRL). Reactions were incubated for 30 min at 42°C. One fifth of the cDNA samples was then used for PCR amplification using either primers for the Siamois cDNA or the ubiquitous expressed elongation factor 1 (EF-1) cDNA, using a hot start of 93°C for 2.5 min and 25 cycles of 93°C for 30 s, 55°C for 1 min, and 72°C for 30 s. The reaction was terminated with an incubation of 5 min at 72°C. A 25-µl reaction consisted of 1 × PCR buffer with Mg2+ (Boehringer Mannheim Biochemicals), dNTPs at 1 mM each, 1 µCi of [32P]dCTP (Amersham Corp.), and 1.25 U of Taq DNA polymerase (Boehringer Mannheim Biochemicals). The sense and antisense primers for Siamois detection were TTGTCTCTACCGCACTGA and TCCTGTTGACTGCAGACT, respectively, which should generate a 307-bp fragment. However, we always obtained a double band, the higher of which was always proportional to the 307-bp band. The sense and antisense primers for EF-1 detection were CAGATTGGTGCTGGATATGC and ACTGCCTTGATGACTCCTAG, respectively, generating a 268-bp fragment. PCR samples were separated on a 5% acrylamide gel and run in 0.5 × Tris borate EDTA buffer, and PCR fragments were visualized by autoradiography.

RNA and Protein Injections

All APC constructs were linearized and capped RNAs were synthesized in vitro using SP6 RNA polymerase (Promega). mRNAs were dissolved in diethyl pyrocarbonate-treated water at a concentration of 0.125-0.5 ng/nl and injected in a volume of ~15 nl into the equatorial region of a single prospective ventral (or two dorsal) blastomere of a four-cell stage embryo. During injection, embryos were kept in a solution of 1 × Marc's Modified Ringer solution (MMR; 100 mM NaCl, 2 mM KCl, 5 mM Hepes-NaOH, pH 7.8, 2 mM CaCl2, and 1 mM MgSO4) supplemented with 6% ficoll to improve healing, 100 U/ml penicillin, and 100 µg/ml streptomycin. After injection, embryos were further incubated in 0.1 × MMR supplemented with antibiotics and scored at stage 16-18 for duplicated axis, visible by the presence of two darkly pigmented neural folds. Staging was according to Nieuwkoop and Faber (31).

Recombinant APC proteins, eluted in a buffer containing 20 mM Tris, pH 8.0, 1 mM EDTA, 150 mM NaCl, 1 mM DTT, 10 µg/ml pepstatin, 10 µg/ml leupeptin, 0.5 mM Pefabloc, and 1 µM aprotinin, were concentrated to 2-4 mg/ml (except for APC 22 for which the final concentration was 0.2 mg/ml) using amicon filters, and then injected as described above for the synthetic mRNA.


Results

Xenopus APC Is Expressed in Early Embryos and Is Associated with beta -Catenin But Not with Cadherins

To determine whether APC is expressed in early Xenopus embryos, the APC protein was detected by immunoprecipitation of samples of unfertilized eggs and early embryos at different developmental stages. Immunocomplexes, separated on a polyacrylamide gel, were immunoblotted with anti-APC 3 antibodies, revealing a 300-kD band at all stages analyzed (Fig. 1 A). Signals for endogenous APC were increased at least twofold when the embryos were lysed in buffer containing deoxycholate (data not shown). To determine whether Xenopus APC interacts with beta -catenin or cadherins, samples from stage 11 embryos were immunoprecipitated with either anti-APC 3 or anti-beta -catenin antibodies, and subsequently immunoblotted with either anti-APC 3, anti-beta -catenin, anti-E-cadherin, or anti- C-cadherin antibodies. APC coimmunoprecipitated with beta -catenin (Fig. 1 B). However, although cadherins coimmunoprecipitated with beta -catenin, they did not coimmunoprecipitate with APC (Fig. 1 B). Therefore, in early embryos, Xenopus APC is apparently complexed with beta -catenin but not with cadherins, just as it is in mammalian cell lines (16, 43).


Fig. 1. Xenopus APC is expressed throughout early embryogenesis and is associated with beta -catenin but not with cadherins. (A) Immunoprecipitation and immunoblotting of endogenous Xenopus APC protein by anti- APC 3 antibodies. Xenopus APC is present in the egg and at least until neurula stage. (B) Interaction of APC with beta -catenin but not with cadherins. Stage 11 embryos were lysed in NP-40 buffer and immunoprecipitated (IP) with either APC 3 or beta -catenin antibodies. Immunocomplexes were blotted (Blot) for either APC, beta -catenin, E-cadherin, or C-cadherin.
[View Larger Version of this Image (29K GIF file)]

Cloning of Xenopus APC cDNA

We cloned and sequenced APC from a stage 17 Xenopus gt-10 lambda  cDNA library. The Xenopus APC cDNA encoded a protein with an estimated molecular mass of 311 kD that showed 75% sequence similarity with its human counterpart. High sequence conservation was observed in the currently described structural motifs, including the oligomerization domain (85% similarity), the armadillo repeats (97%), the 15-aa repeats (80 and 100%), and the 20-aa repeats (90-100%) (Fig. 2). Only two of the three 15-aa repeats found in human APC, which were first identified as the beta -catenin binding sites, are present. In these, the consensus sequence EX(D/E)XPXNYSX(K/R)YX(D/E)E was conserved (51). All seven 20-aa repeats found in human APC, which can also mediate beta -catenin binding, were conserved and showed the (E/D)XXPXX(F/Y)S consensus sequence (43). The basic domain was less conserved (67%). The COOH-terminal 15 aa, which have recently been shown to interact with the human homologue of the Drosophila Dlg tumor suppressor protein (23), were 100% conserved. We conclude that we have indeed cloned the Xenopus homologue of the human APC tumor suppressor gene.


Fig. 2. Comparison of Xenopus and human APC sequences. Linear representation of the amino acid sequence similarities between human and Xenopus APC. Numbers indicate the similarity of the sequences that were aligned by the Clustal method (PAM matrix 250, MegAlign; DNASTAR, Inc., Madison, WI). The described structural domains including the oligomerization domain (oligom.), armadillo repeats (arm. repeats), 15-aa repeats, 20-aa repeats, basic domain, and Dlg binding site are shown. Numbers beneath the sequences indicate the sequence similarity of the whole protein, or of the NH2-terminal 1,000 amino acids, the middle 1,000 amino acids, and the COOH-terminal 850 amino acids, respectively. The Xenopus APC sequence data are available from EMBL/GenBank/DDBJ under accession number U64442.
[View Larger Version of this Image (18K GIF file)]

Full-Length Xenopus APC Induces a Secondary Dorsoanterior Axis

For expression experiments, the partial Xenopus APC cDNA clones were subcloned separately or linked together to form a cDNA encoding the entire open reading frame (Fig. 3 A). To validate the expression in embryos, full-length XAPC and all partial constructs had an NH2terminal myc tag. Synthetic mRNA was injected into fourcell stage embryos. All fragments were very well expressed as analyzed by immunoblotting with antibodies against the myc-epitope tag (Fig. 3 B; not shown for XAPC 5). The lower molecular weight bands detected during expression of full-length XAPC FL seem to be degradation products generated during sample preparation, because extraction of endogenous Xenopus APC from embryos always results in similar prominent bands of lower molecular weight when blotted with anti-APC 3 antibodies (data not shown). Thus, the exogenous APC mRNA is expressed and its product behaves like endogenous APC.


Fig. 3. Full-length Xenopus APC or fragments containing the central domain induce an ectopic dorsoanterior axis. (A) Linear representation of the full-length Xenopus APC (xAPC FL) and the various fragments used (xAPC 1, 4, and 5). The amino acid positions of each fragment are indicated by the flanking numbers. The motifs, identified in the human APC and conserved in the Xenopus APC cDNA, are shown on top, including the oligomerization domain (oligom.), armadillo repeats (arm. repeats), 15- and 20-aa repeats, basic domain, and Dlg binding site. (B) Expression levels of APC fragments resulting from the injection of mRNA of XAPC 1, XAPC 4, and XAPC FL, respectively. Expression was detected by immunoblotting using the anti-myc tag mAb. (C) Bar graph summarizing the frequency of axis induction by the different Xenopus APC fragments, expressed from injected synthetic mRNA in four-cell stage embryos. Secondary axis formation is plotted as a percentage, and the total number of embryos analyzed is indicated to the right of each bar (n).
[View Larger Version of this Image (23K GIF file)]

Injection of XAPC FL mRNA into the ventral side of four-cell embryos very efficiently induced the formation of secondary dorsoanterior axes (Fig. 3 C). This often resulted in the generation of Siamese twins connected by trunk and tail. The phenotype was most clear at the neurula stage (stage 14-15) when the nascent neural tubes are visible as darkly pigmented lines. Accordingly, this stage was used for scoring the frequency of axis duplication. Axis induction occurred >90% of the time with 5-10 ng of XAPC FL mRNA (Fig. 3 C) and resulted in the development of double-headed tadpoles. Ectopic dorsal axes were also induced by expression of the fragments XAPC 4 and, even more efficiently, XAPC 5. These findings indicate that APC is able to induce an ectopic dorsoanterior axis, and consequently has signal transduction activity. Moreover, the central part of the APC is the minimal requirement for axis induction.

The NH2-terminal fragment XAPC 1, which is similar to a truncated human APC molecule frequently found in colon cancer, caused only a very low background of secondary axis induction (6%), and, when observed, the extra axes were always very short and incomplete. The truncated XAPC 1 fragment still contains a beta -catenin binding site and actually binds beta -catenin much more efficiently than the central part of the APC protein that is required and sufficient for axis induction (data not shown). This excludes a model in which axis induction by APC results from simply binding up beta -catenin.

Expression of the NH2-terminal beta -catenin binding Xenopus APC fragment in the future dorsal side of a fourcell stage embryo did not interfere with the formation of the endogenous dorsal axis (data not shown), and therefore this fragment does not inhibit signal transduction processes involved in axis determination. Furthermore, NH2terminal APC fragments that lack the central domain were unable to antagonize the axis-inducing APC fragments when coinjected (data not shown), indicating that they have no dominant-negative properties.

The Central Domain of Human APC Also Has Signaling Activity

Since human APC has been well characterized in terms of the domains participating in various molecular interactions and truncations associated with colon carcinogenesis, we also injected human APC fragments, either as recombinant protein or as synthetic mRNA (Fig. 4, A and B). Unfortunately, we were unable to get efficient expression of the full-length human APC (Fig. 4 D). However, fragments representing the central part of the molecule induced an ectopic dorsoanterior axis very efficiently. 80-90% of the embryos injected with hAPC 2 or hAPC 25 in the ventral site showed a second axis (Fig. 4 B), many of which had complete new head structures, including a cement gland and pigmented eyes (Fig. 4 C). Formation of a weak partial secondary axis was observed in only 7% of the embryos injected with mRNA encoding the NH2-terminal fragment hAPC 21, and the few embryos scored as positive had only very short and incomplete secondary axes. A COOH-terminal fragment hAPC3 was also unable to induce an ectopic dorsoanterior axis. Therefore, similar to the results with Xenopus APC, the central domain of the human APC protein has signal transduction activity in the early Xenopus embryo. Fragments that lack the central domain, like the NH2-terminal hAPC 21, which corresponds to a mutant APC frequently observed in colon cancer, do not show this signal transduction activity.


Fig. 4. Human APC fragments induce an ectopic dorsoanterior axis in early Xenopus embryos. (A) Linear representation of the fulllength human APC (hAPC FL) and the various fragments used (hAPC 2, 3, 21, 22, and 25). The amino acid positions of each fragment are indicated by the flanking numbers. Several known motifs are shown on top, including the oligomerization domain (oligom.), armadillo repeats (arm. repeats), the 15- and 20-aa repeats (both known to bind beta -catenin), basic domain, and Dlg binding site. (B) Bar graph summarizing the frequency of axis induction by the different APC fragments, either injected as recombinant protein (upper) or expressed from synthetic mRNA (lower) in four-cell stage embryos. Secondary axis formation is plotted as a percentage, and the total number of embryos (n) analyzed is indicated to the right of each bar. (C) Micrographs showing the double axis phenotype in embryos injected with recombinant hAPC 2 protein. Embryos are shown at stage 14 (neurula stage), where the forming neural tubes are visible as darkly pigmented lines, and at the tadpole stage, showing embryos with two complete heads, including two eye pairs. (D) Expression levels of APC fragments resulting from the injection of mRNA for hAPC 25, hAPC 21, and hAPC FL, respectively. APC fragments were detected by immunoblots using the anti-myc tag mAb.
[View Larger Version of this Image (45K GIF file)]

APC Induces the Expression of a Marker of the Nieuwkoop Center, the Homeobox Gene Siamois

Dorsoanterior axis induction by APC is very similar to the phenotype observed for beta -catenin mRNA injections, and therefore they may act at a similar site in the embryo. beta -Catenin participates in the early signaling events in a region called the Nieuwkoop center (11). Activation of the Nieuwkoop center by beta -catenin and Wnt growth factors induces the expression of the homeobox protein Siamois, which itself causes axis duplication when injected in the ventral side of an embryo (22). beta -Catenin signaling activity seems to directly induce Siamois (Nelson, R., personal communication). Induction of Siamois is selective, however, because it is not induced by other factors that induce markers of a later signaling center, the Spemann organizer, such as noggin, activin, and Vg-1 (7). To determine whether APC, like beta -catenin and Wnt, can act in the Nieuwkoop center, we determined whether ectopic expression of Xenopus APC or human APC could induce Siamois expression. APC fragments were injected into the animal pole of four-cell stage embryos. At stage 8, animal caps were dissected and cultured as explants to remove the endogenous Nieuwkoop center in which Siamois is normally expressed. Expression of Siamois in animal caps was assayed by RTPCR. Full-length Xenopus APC clearly induced Siamois expression (Fig. 5 A). In contrast, the XAPC 1 fragment, which corresponds to a truncated APC mutant that has no major axis-inducing activity, did not induce Siamois expression. Injection of the human hAPC 25 mRNA also induced Siamois expression in the animal caps in a dose- dependent manner (Fig. 5 B). Therefore, like beta -catenin and Wnt, the axis-inducing APC fragments mimic the Nieuwkoop center in the early embryo, suggesting that APC and beta -catenin act in the same signaling pathway.


Fig. 5. APC induces the expression of the Hox gene, Siamois. (A) Siamois expression is induced only by APC fragments with axis-inducing activity. RNA was extracted from animal caps injected with synthetic RNA encoding either Xenopus fulllength APC (XAPC FL) or the NH2-terminal third of the APC cDNA (XAPC 1) and analyzed for Siamois expression by RT-PCR. The ubiquitously expressed elongation factor 1 (EF-1) was also included as a loading control. As a positive control, RTPCR reactions from whole embryos were loaded. To rule out the possible contamination of genomic DNA, a sample that was not treated with reverse transcriptase was included (-RT). (B) RT-PCR analysis of the expression of Siamois in animal caps injected with increasing amounts of synthetic RNA encoding human hAPC 25 mRNA. Whole embryo and uninjected animal caps were loaded as positive and negative controls, respectively.
[View Larger Version of this Image (34K GIF file)]

Role of beta -Catenin in Axis Induction by APC

To determine whether induction of a secondary axis by APC actually depends on beta -catenin, we used overexpression of C-cadherin as a competitive inhibitor. C-Cadherin is the major cadherin expressed in the early embryo, and it binds beta -catenin with high affinity. Overexpression of C-cadherin in early embryos depletes the blastomeres of free, non-membrane-bound beta -catenin and inhibits its signaling activity (6). C-Cadherin overexpression in oocytes or in the dorsal vegetal region of embryos results in completely ventralized embryos (6, 13), and, when coexpressed with beta -catenin, C-cadherin strongly antagonizes the induction of a secondary axis (6). Therefore, to test the requirement of beta -catenin for APC signaling, we injected 4 ng of hAPC 25 or XAPC FL mRNA either alone or in the presence of 2-5 ng of C-cadherin mRNA. Coexpression of C-cadherin completely abolished axis duplication by hAPC 25 and XAPC FL mRNA (Fig. 6). Therefore, free cytosolic beta -catenin seems to be required for hAPC 25 and XAPC FL to induce axis duplication. The simplest interpretation of this epistasis experiment is either that APC and beta -catenin act together as a complex or that beta -catenin acts downstream of APC. However, a more complex model in which beta -catenin influences the active state of APC cannot be ruled out.


Fig. 6. The induction of an ectopic dorsal axis by APC requires free cytosolic beta -catenin. APC signaling is inhibited by coinjected C-cadherin, which sequesters beta -catenin at the membrane. Bar graph summarizing the frequency of axis induction of embryos injected at the four-cell stage at their ventral site with 4 ng of hAPC 25 and XAPC FL mRNA, injected either alone or in combination with 2 ng of C-cadherin mRNA.
[View Larger Version of this Image (11K GIF file)]

Levels of beta -Catenin Are Not Influenced by Overexpressed APC

Certain colon cell lines that express mutant APC contain high levels of beta -catenin. Transfection of these cell lines with full-length human APC, or fragments containing the central 20-aa repeats, significantly reduces total beta -catenin levels (29). From these results it has been proposed that APC is able to increase the turnover of beta -catenin, thereby regulating its cytoplasmic levels and its availability to interact with other proteins. Interestingly, the same or similar APC fragments that reduce beta -catenin levels in these colon cancer cell lines are able to induce an ectopic dorsal body axis in Xenopus. This seems contradictory, since ectopic APC expression causes a phenotype resembling the one caused by overexpressed beta -catenin rather than reduced levels of beta -catenin. Therefore, we asked whether full-length Xenopus XAPC and the active human hAPC 25 fragment were able to influence beta -catenin levels in early Xenopus embryos.

To achieve uniform expression of exogenous APC, APC mRNA was injected into the animal pole of all four blastomeres of the four-cell embryo, and animal caps were explanted at stage 8. Expression levels of beta -catenin in these animal caps were determined by immunoblotting. For a loading control, C-cadherin was also detected. As shown in Fig. 7 A, beta -catenin levels were largely unchanged in the animal caps expressing XAPC FL. Similarly, no changes in beta -catenin levels were observed after expression of the axis-inducing human APC fragment hAPC 25 (Fig. 7 A). We also examined the effects of APC expression on exogenously expressed beta -catenin, to be sure that the levels of beta -catenin were being measured in the same cells that expressed exogenous APC. Myc-tagged beta -catenin mRNA was coinjected with the full-length Xenopus APC mRNA or with hAPC 25 mRNA, and embryos were lysed after 2.5 h (stage 7) or 4 h (stage 9). The levels of exogenously expressed beta -catenin were determined by immunoblotting using anti-myc antibodies. As shown in Fig. 7 B, expression levels of beta -catenin were not significantly influenced by XAPC FL or by hAPC 25. Apparently, the dorsoanterior axis induction by APC is not associated with any major changes in expression levels of the endogenous beta -catenin.


Fig. 7. Overexpression of APC in Xenopus does not cause major changes in levels of beta -catenin. (A) Levels of endogenous beta -catenin in animal caps that were isolated from embryos injected four times in their animal pole with either hAPC 25 or XAPC FL. beta -Catenin expression was detected by immunoblotting. For a loading control, samples were blotted for C-cadherin. (B) Expression levels of myc-tagged beta -catenin from exogenous mRNA in stage 7 and stage 9 embryos that were injected earlier at four-4-cell stage either with 1 ng of myc-tagged beta -catenin mRNA alone or in combination with 4 ng of hAPC 25 or XAPC FL mRNA.
[View Larger Version of this Image (26K GIF file)]

It is formally possible that APC acts through regulating the levels of plakoglobin, a protein that is very similar to beta -catenin. Like beta -catenin, plakoglobin is found to associate with both cadherins and APC and is also able to induce an ectopic dorsoanterior axis in Xenopus (19). Therefore, we examined endogenous plakoglobin levels in animal caps injected with XAPC FL mRNA. No differences between the levels of plakoglobin in uninjected or XAPC FL-expressing animal caps were observed (data not shown). Thus, it is unlikely that dorsoanterior axis induction by APC is mediated by changes in plakoglobin levels.


Discussion

Our findings implicate the APC tumor suppressor gene in the process of axial patterning in Xenopus. Since induction of the dorsoanterior axis involves the activities of embryonic signaling centers (or organizers), these findings demonstrate that APC has signal transduction activity. APC seems to act in the same signaling pathway as beta -catenin. They have similar characteristics, including induction of the homeobox protein Siamois. Furthermore, APC signaling is strongly dependent on the availability of a free cytosolic pool of beta -catenin, which by itself has axis-inducing activity. Moreover, APC or APC/beta -catenin complexes seem to have direct positive signaling activity, since APC does not act indirectly simply by binding up beta -catenin or by changing the levels of beta -catenin. We propose, therefore, that axis induction by APC is due to its role in a signal transduction process in which beta -catenin has been strongly implicated.

The induction of a dorsoanterior axis in Xenopus results from localized signaling activity in the early embryo. After fertilization of the egg, an early dorsalizing zone, called the Nieuwkoop center, becomes localized and activated in a vegetal region of the embryo. Later in development, after the onset of transcription, the Nieuwkoop center induces overlying mesoderm to form a second dorsalizing center, called the Spemann organizer. In the last decade, several factors have been identified that can mimic or inhibit either of the two dorsalizing centers. These factors include secreted signaling molecules, cytoplasmic factors that act as signal transducers, and transcription factors. Frequently, these different factors are components of a unique signaling pathway; e.g., Wnt, Dsh, Gsk-3, and beta -catenin are all part of the Wnt pathway. Here we demonstrate that APC is able to mimic a dorsalizing center, probably the Nieuwkoop center, suggesting that it also has signal transducing activity.

Comparison of the axis-inducing activities of the different Xenopus and human APC fragments indicates that the central domain of the APC protein is both sufficient and essential for ectopic axis induction. Truncated APC mutants that lack this central domain of the protein are ineffective in dorsoanterior axis induction, indicating that they lack the signaling activity. The central domain of APC is missing in the majority of the truncating APC mutations expressed in tumors from FAP patients and in spontaneous colon tumors, suggesting that some growth-suppressive or growth-regulatory activity is present in this region (39). We hypothesize that the loss of growth-regulatory activity results from the loss of the signaling activity present in the central part of APC.

Polyp formation in the colon occurs after a loss of heterozygosity or a mutation of the remaining APC allele, indicating that the truncated APC mutants are not dominant-negative proteins (34, 35). Consistent with the data from colon carcinogenesis, the COOH-terminally truncated APC mutants have no dominant-negative properties in the Xenopus embryo, since they cannot interfere with the formation of the endogenous dorsal axis and cannot antagonize the effects of axis-inducing APC fragments when coinjected (data not shown).

The cellular function of the APC protein was a complete mystery until the discovery that it binds catenins, proteins associated with cadherin adhesion molecules. The association of APC with catenins initially led to the proposal that APC has a role in regulating the activity of the catenin/ cadherin complex and thus intercellular adhesion (14, 42, 51). This seemed to have implications for colon carcinogenesis because changes in cell adhesion could affect processes like cell migration and shedding, which could be important for the development of colon polyps. Also, it has been proposed that APC is involved in cell migration (30). However, the discovery that beta -catenin and plakoglobin have signal transducing activity in Xenopus embryos (8, 13, 19), independent of their role in cell adhesion, raised the possibility that the observed APC/catenin association reflects a role for APC in signal transduction. Although a role for APC in cell adhesion cannot be ruled out, our data demonstrate that the cellular function of APC is certainly not limited to the regulation of the adhesiveness and migration of cells. Axis induction in Xenopus by APC is identical to the phenotype resulting from overexpressed beta -catenin, and therefore involves a related signal transduction activity.

APC may be involved in a Wnt-like signaling pathway. Ectopically expressed beta -catenin is known to mimic the Nieuwkoop center (11). Similarly, APC induces expression of Siamois, a marker for this Nieuwkoop center (22). This signaling activity is shared by several components of the Wnt signaling pathway, including Wnts themselves and a kinase-mutant form of GSK-3. Our findings suggest that APC and beta -catenin act at the same place in this signaling pathway. Not only do they form complexes in the early Xenopus embryo, but axis induction by APC also depends on the availability of free cytosolic beta -catenin. Overexpression of C-cadherin, which sequesters the cytosolic beta -catenin to the membrane, strongly inhibits axis induction by APC. In fact, C-cadherin injection can inhibit axis formation induced by the different components of the Wnt/Wg signaling pathway that act upstream of beta -catenin, like XWnt 8 and kinase-defective GSK-3, but it is not able to suppress axis formation by factors that act independently from the Wnt signaling pathway (e.g., Vg-1, activin, and noggin) or that act downstream of beta -catenin (e.g., Siamois) (7). The inhibition of APC signaling by depletion of cytosolic beta -catenin suggests that APC acts either upstream of beta -catenin or that APC and beta -catenin act together as a complex.

Our findings do not directly address whether APC is a component of a Wnt pathway rather than, for example, an independent or parallel regulator of beta -catenin. However, there are biochemical data showing that APC can physically interact with another component of the Wnt/Wg pathway, GSK-3 (homologue of the Drosophila zw-3) (44). Moreover, APC seems to be a good substrate for GSK-3 in vitro. Together, these links of APC to both upstream and downstream components of the Wnt pathway suggest that it is directly involved in the signal transduction mechanism. Nevertheless, proof that APC is indeed part of the Wnt/Wg pathway will require a demonstration that the loss or inhibition of its function blocks Wnt signaling.

APC has been reported to be able to reduce beta -catenin expression levels in certain colon cancer cell lines by enhancing its turnover (29). Interestingly, the activation of the wingless pathway in Drosophila seems to result in increased stability of Armadillo protein (41, 54), and overexpression of a kinase-dead GSK-3 in Xenopus also results in increased stability of beta -catenin (56). From this finding, it has been speculated that APC, through its proposed ability to regulate the stability of beta -catenin, is a negative regulator in the Wnt/Wg pathway (25, 37). However, increased turnover of beta -catenin by APC in the colon cancer cell lines was not related to any observable cellular function. Furthermore, induction of apoptosis by APC introduction in other colon cancer cells was not accompanied by reduction of beta -catenin levels (27). Similarly, we find that the APC signaling activity in early Xenopus embryos, which is manifested by dorsal axis induction, is apparently not due to its regulation of beta -catenin levels. First, the enhanced turnover of beta -catenin by APC or the central repeats in colon cancer cell lines are inconsistent with our findings that the very same APC molecules stimulate axis induction, a process associated with increased levels of beta -catenin. Second, we could not detect changes in the levels of either endogenous beta -catenin (or plakoglobin) or beta -catenin expressed from injected mRNA, in response to expression of either full-length Xenopus APC or the axisinducing central fragment of the human APC. Our findings in Xenopus embryos suggest that APC, or APC/beta -catenin complexes, have signaling activity on their own, independent from the regulation of beta -catenin levels. It is possible that the increased turnover of beta -catenin by APC, which is observed in colon cancer cell lines, is part of a different signaling mechanism, or is the result of a feedback loop that turns off the signaling by APC and beta -catenin. Our results also suggest that APC is an activating, rather than an inhibiting, component of the Wnt/Wg pathway. More research is needed to clarify the exact function and activity of APC in this pathway.

Both overexpressed beta -catenin and plakoglobin are known to localize in the nuclei of injected Xenopus blastomeres (8, 19). Endogenous beta -catenin also has been found in the nuclei of blastomeres at the dorsal side of both Xenopus and Zebrafish embryos (46, 56). beta -Catenin lacks the classical nuclear localization sequence needed for nuclear import. However, members of the lymphoid enhancer-1/Tcf family of transcription factors have recently been identified as proteins that bind to beta -catenin and can, under certain conditions, carry beta -catenin to the nucleus (2, 15, 26). We have not yet been able to detect major changes in the subcellular localization of endogenous beta -catenin in blastomeres overexpressing ectopic full-length Xenopus APC (data not shown). This is, however, most likely due to lack of sensitivity since it was not easy to detect nuclear localization of endogenous beta -catenin either in the natural or Wnt-induced dorsal side of Xenopus embryos (8, 56).

Using axis formation in Xenopus embryogenesis as a model system to investigate signaling pathways, we have uncovered a signaling function for APC that might be relevant for understanding its role in colon carcinogenesis. One role for APC signaling in oncogenesis might be the regulation of cell proliferation or sensitivity to transformation. APC has been shown to alter the transformation properties, decrease the growth rate or induce apoptosis in colon carcinoma cells (10, 27), and block the cell cycle progression from G0/G1 to S phase in fibroblasts (1), possibly by regulating the activity of cyclin-dependent kinase complexes. beta -Catenin also has recently been implicated in oncogenesis. An NH2-terminally deleted beta -catenin was identified by its transformation potential in a screen for oncogenes (55). Furthermore, similar to the data from colon cancer cell lines, increased cytosolic and nuclear localization of beta -catenin in adenomas and carcinomas of FAP patients has been reported (17). Our findings raise the possibility that APC may regulate cell proliferation in the colon by virtue of its role as a signal transducing protein that is associated with signaling by beta -catenin. It is conceivable that the downstream targets of APC are dependent on the cell or tissue context. Thus, the same signaling activity that regulates dorsoanterior axis formation in Xenopus embryos could suppress or regulate growth in colon tissue. Lack of this signaling activity in the truncated mutant APC proteins would consequently result in hyperproliferation and polyp formation. Hence, the early Xenopus embryo might be a powerful system for elucidating mechanisms of signal transduction by APC in general.


Footnotes

Received for publication 26 September 1996 and in revised form 6 November 1996.

   Address all correspondence to Barry M. Gumbiner, Cellular Biochemistry and Biophysics Program, Memorial Sloan-Kettering Cancer Center, 1275 York Avenue, Box 564, New York 10021. Tel.: (212) 639-6146. Fax: (212) 717-3047.

We thank Dr. D.L. Turner in the laboratory of the late Dr. H. Weintraub for the gift of the pCS2+ expression vectors. We are grateful to Drs. F. Fagotto and R.W. Nelson for sharing their results on C-cadherin and Siamois and are indebted to Georges Wu and Dara Raspberry for their contributions in the cloning process. We also thank Alpha Yap, William Brieher, François Fagotto, and Anje Cauwels for critical reading of the manuscript, and other members of the Gumbiner laboratory for appreciated support.

This work was supported by National Institutes of Health grant GM37432 awarded to B.M. Gumbiner and by the Cancer Center Support grant NCI-P30-CA-08784. B.M. Gumbiner is a recipient of a Career Scientist Award from the Irma T. Hirschl Trust.


Abbreviations used in this paper

aa, amino acid; APC, adenomatous polyposis coli; hAPC, human APC; XAPC, Xenopus APC cDNA; XAPC FL, full-length Xenopus APC cDNA; Dlg, Drosophila disc large; EF-1, elongation factor 1; FAP, familial adenomatous polyposis; GSK-3, glycogen synthase kinase 3; dNTP, deoxyribonucleotidetriphosphate; RT, reverse transcriptase.


References

  1. Baeg, G.-H., A. Matsumine, T. Kuroda, R.N. Bhattacharjee, I. Miyashiro, K. Toyoshima, and T. Akiyama. 1995. The tumour suppressor gene product APC blocks cell cycle progression from G0/G1 to S phase. EMBO (Eur. Mol. Biol. Organ.) J. 14: 5618-5625 [Medline].
  2. Behrens, J., J.P. von Kries, M. Kuhl, L. Bruhn, D. Wedlich, R. Grosschedl, and W. Birchmeier. 1996. Functional interaction of beta -catenin with the transcription factor LEF-1. Nature (Lond.). 382: 638-642 [Medline].
  3. Dohrmann, C.D., A. Hemmati-Brivanlou, G.H. Thomsen, A. Fields, T.D. Woolf, and D.A. Melton. 1993. Expression of activin mRNA during early development in Xenopus laevis. Dev. Biol. 157: 474-483 [Medline].
  4. Dominguez, I., K. Itoh, and S. Sokol. 1995. Role of glycogen synthase kinase 3beta as a negative regulator of dorsoventral axis formation in Xenopus embryos. Proc. Natl. Acad. Sci. USA. 92: 8498-8502 [Abstract/Free Full Text].
  5. Evan, G.I., G.K. Lewis, G. Ramsey, and J.M. Bishop. 1985. Isolation of monoclonal antibodies specific for the human c-myc proto-oncogene product. Mol. Cell. Biol. 5: 3610-3616 [Abstract/Free Full Text].
  6. Fagotto, F., N. Funayama, U. Glück, and B.M. Gumbiner. 1996. Binding to cadherins antagonizes the signaling activity of beta -catenin during axis formation in Xenopus. J. Cell Biol. 132: 1105-1114 [Abstract/Free Full Text].
  7. Fagotto, F., K. Guger, and B. Gumbiner. Induction of the primary dorsalizing center in Xenopus by the Wnt/GSK/beta -catenin signaling pathway, but not by Vg1, Activin, or Noggin. Development (Camb.). In press.
  8. Funayama, N., F. Fagotto, P. McCrea, and B.M. Gumbiner. 1995. Embryonic axis induction by the armadillo repeat domain of beta -catenin: evidence for intracellular signaling. J. Cell Biol. 128: 959-968 [Abstract/Free Full Text].
  9. Groden, J., A. Thliveris, W. Samowitz, M. Calson, L. Gelbert, H. Albertson, G. Joslyn, J. Stevens, L. Spirio, M. Robertson, et al . 1991. Identification and characterization of the Familial Adenomatous Polyposis Coli gene. Cell. 66: 589-600 [Medline].
  10. Groden, J., G. Joslyn, W. Samowitz, D. Jones, N. Bhattacharyya, L. Spirio, A. Thliveris, M. Robertson, S. Egan, M. Meuth, and R. White. 1995. Response of colon cancer cell lines to the introduction of APC, a colon-specific tumor suppressor gene. Cancer Res. 55: 1531-1539 [Abstract/Free Full Text].
  11. Guger, K.A., and B.M. Gumbiner. 1995. beta -catenin has Wnt-like activity and mimics the Nieuwkoop signaling center in Xenopus dorsal-ventral patterning. Dev. Biol. 172: 115-125 [Medline].
  12. He, X., J.-P. Saint-Jeannet, J.R. Woodgett, H.E. Varmus, and I.B. Dawid. 1995. Glycogen synthase kinase-3 and dorsoventral patterning in Xenopus embryos. Nature (Lond.). 374: 617-622 [Medline].
  13. Heasman, J., A. Crawford, K. Goldstone, P. Garner-Hamrick, B. Gumbiner, P. McCrea, C. Kintner, C.Y. Noro, and C. Wylie. 1994. Overexpression of cadherins and underexpression of beta -catenin inhibit dorsal mesoderm induction in early Xenopus embryos. Cell. 79: 791-803 [Medline].
  14. Hinck, L., I.S. Näthke, J. Papkoff, and W.J. Nelson. 1994. beta -catenin: a common target for the regulation of cell adhesion by Wnt-1 and Src signaling pathways. Trends Biochem. Sci. 19: 538-541 [Medline].
  15. Huber, O., R. Korn, J. McLaughlin, M. Ohsugi, B.G. Herrmann, and R. Kemler. 1996. Nuclear localization of beta -catenin by interaction with transcription factor LEF-1. Mech. Dev. 59: 3-10 [Medline].
  16. Hülsken, J., W. Birchmeier, and J. Behrens. 1994. E-cadherin and APC compete for the interaction with beta -catenin and the cytoskeleton. J. Cell Biol. 127: 2061-2069 [Abstract/Free Full Text].
  17. Inomata, M., A. Ochiai, S. Akimoto, S. Kitano, and S. Hirohashi. 1996. Alterations of beta -catenin expression in colonic epithelial cells of familial adenomatous polyposis patients. Cancer Res. 56: 2213-2217 [Abstract/Free Full Text].
  18. Joslyn, G., D. Calson, A. Thliveris, H. Albertsen, L. Gelbert, W. Samowitz, J. Groden, J. Stevens, L. Spirio, M. Robertson, et al . 1992. Identification of deletion mutations and three new genes at the familial polyposis locus. Cell. 66: 601-613 .
  19. Karnovsky, A., and M.W. Klymkowsky. 1995. Anterior axis duplication in Xenopus induced by the over-expression of the cadherin-binding protein plakoglobin. Proc. Natl. Acad. Sci. USA. 92: 4522-4526 [Abstract/Free Full Text].
  20. Kinzler, K.W., M.C. Nilbert, L.K. Su, B. Vogelstein, T.M. Bryan, D.B. Levy, K.J. Smith, A.C. Preisinger, P. Hedge, D. McKechnie, et al . 1991. Identification of FAP locus genes from chromosome 5q21. Science (Wash. DC). 253: 661-665 [Abstract/Free Full Text].
  21. Klingensmith, J., and R. Nusse. 1994. Signaling by wingless in Drosophila. Dev. Biol. 166: 396-414 [Medline].
  22. Lemaire, P., N. Garrett, and J.B. Gurdon. 1995. Expression cloning of Siamois, a Xenopus homeobox gene expressed in dorsal-vegetal cells of blastulae and able to induce a complete secondary axis. Cell. 81: 85-94 [Medline].
  23. Matsumine, A., A. Ogai, T. Senda, N. Okumura, K. Satoh, G.-H. Baeg, T. Kawahara, S. Kobayashi, M. Okada, K. Toyoshima, and T. Akiyama. 1996. Binding of APC to the human homolog of the Drosophila disc large tumor suppressor protein. Science (Wash. DC). 272: 1020-1023 [Abstract].
  24. McCrea, P.D., W.M. Brieher, and B.M. Gumbiner. 1993. Induction of a secondary body axis in Xenopus by antibodies to beta -catenin. J. Cell Biol. 123: 477-484 [Abstract/Free Full Text].
  25. Miller, J.R., and R.T. Moon. 1996. Signal transduction through beta -catenin and specification of cell fate during embryogenesis. Genes & Dev. 10: 2527-2539 [Free Full Text].
  26. Moolenaar, M., M. van de Wetering, M. Oosterwegel, J. Peterson-Maduro, S. Godsave, V. Kornek, J. Roose, O. Destree, and H. Clevers. 1996. XTcf-3 transcription factor mediates beta -catenin-induced axis formation in Xenopus embryos. Cell. 86: 391-399 [Medline].
  27. Morin, P.J., B. Vogelstein, and K.W. Kinzler. 1996. Apoptosis and APC in colorectal carcinogenesis. Proc. Natl. Acad. Sci. USA. 93: 7950-7954 [Abstract/Free Full Text].
  28. Munemitsu, S., B. Souza, O. Muller, I. Albert, B. Rubinfeld, and P. Polakis. 1994. The APC gene product associates with microtubules in vivo and promotes their assembly in vitro. Cancer Res. 54: 3676-3681 [Abstract/Free Full Text].
  29. Munemitsu, S., I. Albert, B. Souza, B. Rubinfeld, and P. Polakis. 1995. Regulation of intracellular beta -catenin levels by the adenomatous polyposis coli (APC) tumor-suppressor protein. Proc. Natl. Acad. Sci. USA. 92: 3046-3050 [Abstract/Free Full Text].
  30. Nathke, I.S., C.L. Adams, P. Polakis, J.H. Sellin, and W.J. Nelson. 1996. The adenomatous polyposis coli tumor suppressor protein localizes to plasma membrane sites involved in active cell migration. J. Cell Biol. 134: 165-180 [Abstract/Free Full Text].
  31. Nieuwkoop, P.D., and J. Faber. 1967. Normal Table of Xenopus laevis (Daudin). Elsevier North-Holland Biomedical Press, Amsterdam.
  32. Nishisho, I., Y. Nakamura, Y. Miyoshi, Y. Miki, H. Ando, I. Horii, Y. Koyama, J. Utsumomiya, J. Baba, P. Hedge, et al . 1991. Mutations of chromosome 5q21 genes in FAP and colorectal patients. Science (Wash. DC). 253: 665-669 [Abstract/Free Full Text].
  33. Nusse, R., and H.E. Varmus. 1992. Wnt genes. Cell. 69: 1073-1087 [Medline].
  34. Oshima, M., H. Oshima, K. Kitagawa, M. Kobayashi, C. Itakura, and M. Taketo. 1995. Loss of Apc heterozygosity and abnormal tissue building in nascent intestinal polyps in mice carrying a truncated Apc gene. Proc. Natl. Acad. Sci. USA. 92: 4482-4486 [Abstract/Free Full Text].
  35. Oshima, M., H. Oshima, M. Kobayashi, M. Tsutsumi, and M.M. Taketo. 1995. Evidence against dominant negative mechanisms of intestinal polyp formation by Apc gene mutations. Cancer Res. 55: 2719-2722 [Abstract/Free Full Text].
  36. Peifer, M.. 1995. Cell adhesion and signal transduction: the Armadillo connection. Trends Cell Biol. 5: 224-229 . [Medline]
  37. Peifer, M.. 1996. Regulating cell proliferation: as easy as APC. Science (Wash. DC). 272: 974-975 [Medline].
  38. Pierce, S.B., and D. Kimelman. 1995. Regulation of Spemann organizer formation by the intracellular kinase Xgsk-3. Development (Camb.). 121: 755-765 [Abstract].
  39. Polakis, P.. 1995. Mutations in the APC gene and their implications for protein structure and function. Curr. Opin. Genet. Dev. 5: 66-71 [Medline].
  40. Powell, S.M., N. Zilz, Y. Beazer-Barclay, T.M. Bryan, S.R. Hamilton, S.N. Thibodeau, B. Vogelstein, and K.W. Kinzler. 1992. APC mutations occur early during colorectal tumorigenesis. Nature (Lond.). 359: 235-237 [Medline].
  41. Riggleman, B., P. Schedl, and E. Wieschaus. 1990. Spatial expression of the Drosophila segment polarity gene armadillo is posttranscriptionally regulated by wingless. Cell. 63: 549-560 [Medline].
  42. Rubinfeld, B., B. Souza, I. Albert, O. Müller, S.H. Chamberlain, F.R. Masiarz, S. Munemitsu, and P. Polakis. 1993. Association of the APC gene product with beta -catenin. Science (Wash. DC). 262: 1731-1734 [Abstract/Free Full Text].
  43. Rubinfeld, B., B. Souza, I. Albert, S. Munemitsu, and P. Polakis. 1995. The APC protein and E-cadherin form similar but independent complexes with alpha -catenin, beta -catenin, and plakoglobin. J. Biol. Chem. 270: 5549-5555 [Abstract/Free Full Text].
  44. Rubinfeld, B., I. Albert, E. Porfiri, C. Fiol, S. Munemitsu, and P. Polakis. 1996. Binding of GSK3beta to the APC-beta -catenin complex and regulation of complex assembly. Science (Wash. DC). 272: 1023-1025 [Abstract].
  45. Rupp, R.A., L. Snider, and H. Weintraub. 1994. Xenopus embryos regulate the nuclear localization of XMyoD. Genes & Dev. 8: 1311-1323 [Abstract/Free Full Text].
  46. Schneider, S., H. Steinbeisser, R.M. Warga, and P. Hausen. 1996. beta -catenin translocation into nuclei demarcates the dorsalizing centers in frog and fish embryos. Mech. Dev. 57: 191-198 [Medline].
  47. Smith, K.J., K.A. Johnson, T.M. Bryan, D.E. Hill, S. Markowitz, J.K.V. Willson, C. Paraskeva, G.M. Petersen, S.R. Hamilton, B. Vogelstein, et al . 1993. The APC gene product in normal and tumor cells. Proc. Natl. Acad. Sci. USA. 90: 2846-2850 [Abstract/Free Full Text].
  48. Smith, K.J., D.B. Levy, P. Maupin, T.D. Pollard, B. Vogelstein, and K.W. Kinzler. 1994. Wild-type but not mutant APC associates with the microtubule cytoskeleton. Cancer Res. 54: 3672-3675 [Abstract/Free Full Text].
  49. Sokol, S., J.L. Christian, R.T. Moon, and D.A. Melton. 1991. Injected wnt RNA induces a complete body axis in Xenopus embryos. Cell. 67: 741-752 [Medline].
  50. Sokol, S.Y., J. Klingensmith, N. Perrimon, and K. Itoh. 1995. Dorsalizing and neuralizing properties of Xdsh, a maternally expressed Xenopus homolog of dishevelled. Development (Camb.). 121: 1637-1647 [Abstract].
  51. Su, L.-K., B. Vogelstein, and K.W. Kinzler. 1993. Association of the APC tumor suppressor protein with catenins. Science (Wash. DC). 262: 1734-1737 [Abstract/Free Full Text].
  52. Su, L.-K., M. Burrell, D.E. Hill, J. Gyuris, R. Brent, R. Wiltshire, J. Trent, B. Vogelstein, and K.W. Kinzler. 1995. APC binds to the novel protein EB1. Cancer Res. 55: 2972-2977 [Abstract/Free Full Text].
  53. Turner, D.L., and H. Weintraub. 1994. Expression of achaete-scute homolog 3 in Xenopus embryos converts ectodermal cells to a neuronal fate. Genes & Dev. 8: 1234-1447 .
  54. van Leeuwen, F., and R. Nusse. 1994. Biological activity of soluble wingless protein in cultured Drosophila cells. Nature (Lond.). 368: 342-344 [Medline].
  55. Whitehead, I., H. Kirk, and R. Kay. 1995. Expression cloning of oncogenes by retroviral transfer of cDNA libraries. Mol. Cell. Biol. 15: 704-710 [Abstract].
  56. Yost, C., M. Torres, J.R. Miller, E. Huang, D. Kimelman, and R.T. Moon. 1996. The axis-inducing activity, stability, and subcellular distribution of beta -catenin is regulated in Xenopus embryos by glycogen synthase kinase 3.  Genes & Dev. 10: 1443-1454 [Abstract/Free Full Text].

Copyright © 1997 by The Rockefeller University Press.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 452K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vleminckx, K.
Right arrow Articles by Gumbiner, B. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vleminckx, K.
Right arrow Articles by Gumbiner, B. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents