|
||
-Catenin Results in
Stable Colocalization of Mutant
-Catenin with
Adenomatous Polyposis Coli Protein and
Altered MDCK Cell Adhesion



* Department of Molecular and Cellular Physiology, Stanford University School of Medicine, Stanford, California 94305-5426;
and
Department of Anatomy, Department of Biochemistry and Cardiovascular Research Institute, University of California at
San Francisco, San Francisco, California 94143-0452
-Catenin is essential for the function of cadherins, a family of Ca2+-dependent cell-cell adhesion
molecules, by linking them to
-catenin and the actin
cytoskeleton.
-Catenin also binds to adenomatous polyposis coli (APC) protein, a cytosolic protein that is
the product of a tumor suppressor gene mutated in
colorectal adenomas. We have expressed mutant
-catenins in MDCK epithelial cells to gain insights
into the regulation of
-catenin distribution between cadherin and APC protein complexes and the functions
of these complexes. Full-length
-catenin,
-catenin
mutant proteins with NH2-terminal deletions before
(
N90) or after (
N131,
N151) the
-catenin binding
site, or a mutant
-catenin with a COOH-terminal deletion (
C) were expressed in MDCK cells under the
control of the tetracycline-repressible transactivator.
All
-catenin mutant proteins form complexes and
colocalize with E-cadherin at cell-cell contacts;
N90,
but neither
N131 nor
N151, bind
-catenin. However,
-catenin mutant proteins containing NH2-terminal deletions also colocalize prominently with APC
protein in clusters at the tips of plasma membrane protrusions; in contrast, full-length and COOH-terminal- deleted
-catenin poorly colocalize with APC protein.
NH2-terminal deletions result in increased stability of
-catenin bound to APC protein and E-cadherin, compared with full-length
-catenin. At low density,
MDCK cells expressing NH2-terminal-deleted
-catenin mutants are dispersed, more fibroblastic in morphology, and less efficient in forming colonies than parental MDCK cells. These results show that the NH2
terminus, but not the COOH terminus of
-catenin,
regulates the dynamics of
-catenin binding to APC protein and E-cadherin. Changes in
-catenin binding
to cadherin or APC protein, and the ensuing effects
on cell morphology and adhesion, are independent of
-catenin binding to
-catenin. These results demonstrate that regulation of
-catenin binding to E-cadherin and APC protein is important in controlling epithelial cell adhesion.
Coordination of intercellular adhesion and cell migration is important during embryonic development. For example, during gastrulation, neurulation, and organogenesis, sheets of cells move past neighboring cells without
losing cell-cell contact (Gumbiner, 1992 In addition to binding to cadherin, To examine domains in Antibodies
A rabbit polyclonal antiserum Plasmid Construction
Mouse
A vector expressing full-length KT3-tagged Cell Transfection
MDCK cells (type II) were transfected with pIgR cloned into the pCB6,
which uses the cytomegalovirus promoter to drive pIgR expression and a
G418 drug resistance marker. A well-polarized clone expressing a uniformly high level of pIgR was selected and designated B3. The B3 cells
were then cotransfected with plasmid pUHD15-1 (Gossen and Bujard,
1992 Immunoprecipitation and Immunoblotting
MDCK cells were maintained in DME medium supplemented with 10%
FCS and passaged by mild trypsinization. For preparation of SDS lysates,
MDCK cells were cultured for 4 d with or without 20 ng/ml Dox; cells
were extracted in hot SDS buffer containing 1% SDS, 10 mM Tris-HCl,
pH 7.5, and 2 mM EDTA, and then scraped from the petri dish with a rubber policeman. Samples were boiled for 15 min, and insoluble material
was removed by centrifugation at 12,000 g for 15 min. Protein concentrations were determined using the bicinchoninic acid protein assay reagent
kit (BCA; Pierce Chemical Co., Rockford, Il). Lysates were boiled for 5 min after adding an equal volume of SDS reducing sample buffer (Laemmli, 1970 For preparation of Triton X-100 lysates, MDCK cells were cultured
with or without 20 ng/ml Dox for 4 d or as indicated, and then extracted
for 15 min at 4°C with 1% Triton X-100, 20 mM Tris-HCl, pH 8, 140 mM
NaCl, 1.5 mM MgCl2, 1 mM EGTA, 10% glycerol (vol/vol), 10 µg/ml
DNase and RNase, 1 mM sodium vanadate, 50 mM NaF, and a protease
inhibitor mix (1 mM Pefabloc, 1 mM benzamidine, and 10 µg/ml each of
aprotinin, pepstatin, and leupeptin); DNase, RNase, Pefabloc, pepstatin,
and leupeptin were purchased from Boehringer Mannheim Biochemicals,
and all other reagents were from Sigma Chemical Co. After extraction,
cells were scraped from the petri dish with a rubber policeman. Insoluble
material was removed by centrifugation at 12,000 g for 30 min. Protein
concentrations were determined using the BCA protein assay reagent kit
(Pierce Chemical Co.). Portions of lysates were boiled for 5 min after adding an equal volume of SDS reducing sample buffer. Other portions of lysates were precleared by incubation with 5 µl of nonimmune rabbit serum
and 100 µl Pansorbin (Calbiochem-Novabiochem Corp., La Jolla, CA) for
1 h at 4°C. After removing the Pansorbin by centrifugation, lysates were
incubated for 2-3 h at 4°C with either 30 µl protein A-Sepharose (Pharmacia Fine Chemicals, Piscataway, NJ) coupled to E-cadherin or Lysates and immunoprecipitates were separated by SDS-PAGE in
7.5% polyacrylamide gels (Laemmli, 1970 Immunofluorescence and Phase-Contrast Microscopy
For immunofluorescence, MDCK cells were cultured and plated on 35mm tissue-culture dishes with collagen-coated coverslips in DME medium
supplemented with 10% FCS with or without Tet as indicated. For immunofluorescence of low density cultures, 1 × 105 cells were plated and fixed
after 24 h. Part of a culture of clone Expression of Mutant MDCK clones cultured for 4 d without or with doxycycline (
Expression of E-cadherin leads to an increase in the cellular levels of catenins (Herrenknecht et al., 1991 The amount of E-cadherin was slightly higher in clones
expressing Mutant Binding of
NH2-terminal-deleted Mutant Proteins of Binding of mutant
These data indicate that, compared with endogenous
To further explore the degree of enrichment of mutant
NH2-terminal Deletions Result in Increased Enrichment of
A significant increase in the relative stabilities of NH2terminal-deleted In the total Triton X-100 lysates, the amounts of all mutant The high stability of the NH2-terminal-deleted NH2-terminal-deleted Our immunoprecipitation studies show that NH2-terminal-deleted
In low density cultures, Note that some nuclear staining was detected with the
KT3 antibody (see Fig. 6, a-d), but that the staining persisted in the absence of mutant protein expression (see
Fig. 6 e), indicating that nuclear staining was not specific to
mutant Distinct Differences in Morphologies of Cells
Expressing NH2-terminal-deleted We examined the morphology and colony formation of
cells expressing different mutant
At higher cell densities in which there was less free surface available for cell migration, differences in morphologies of cells expressing Regulation of Epitope-tagged Comparison of the amounts of NH2-terminal-deleted and
endogenous NH2-terminal-deleted Recent studies by Näthke et al (1996) demonstrated that
APC protein localizes to clusters of puncta at the tip of
actively migrating cellular protrusions and at the outer
boundaries of newly formed cell-cell contacts. This distribution indicates that one function of APC protein is to
regulate specific types of cell migration. Whereas endogenous Preliminary studies show that localization of Expression of NH2-terminal-deleted We examined the effects of mutant Poor colony formation and decreased compaction of cells
within colonies may be caused by interference of E-cadherin function by Role of NH2-terminal-deleted In this study, we have shown that mutant
-Catenin is a ubiquitous protein in multicellular organisms and was originally identified through its association
with the cytoplasmic domain of cadherins, a family of
Ca2+-dependent cell adhesion proteins (McCrea and Gumbiner, 1991
; McCrea et al., 1991
; Nagafuchi and Takeichi,
1989
; Ozawa et al., 1989
). Cadherin-mediated intercellular
adhesion initiates structural and functional changes in cells
and is important for maintaining tissue integrity during
embryonic development and in adult organisms (Nelson et
al., 1992
; Takeichi, 1990
, 1991
). These functions of cadherin
require intracellular attachment of cadherin to the actin cytoskeleton that is dependent on binding of cadherin to
catenins (Hirano et al., 1987
; Nagafuchi and Takeichi,
1988
; Ozawa et al., 1990
);
-catenin mediates the linkage
of cadherins to
-catenin, which in turn interacts with the
actin cytoskeleton (Aberle et al., 1994
; Hülsken et al.,
1994
; Jou et al., 1995
; Rimm et al., 1995
).
). Significantly, embryonic development of mice lacking
-catenin is disrupted at gastrulation (Haegel et al., 1995
). These embryos
form a trophectoderm and develop through preimplantation stages presumably because of the contribution of maternal
-catenin or replacement of
-catenin in adherens
junctions by its homologue plakoglobin. However,
-catenin-deficient embryos have severe defects in cell adhesion
at gastrulation (Haegel et al., 1995
). It is also noteworthy
that human cancer cell lines expressing a mutated form
of
-catenin, which binds E-cadherin but not
-catenin,
are defective in E-cadherin-mediated adhesion (Oyama
et al., 1994
). The importance of
-catenin in embryogenesis is also revealed in studies in Drosophila. A homologue of
-catenin in Drosophila, armadillo, was originally identified through its role in transduction of the wingless/Wnt
cell-cell signal that mediates cell fate determination.
Drosophila embryos that are zygotically null for armadillo
develop with severe segment polarity defects (Noordermeer et al., 1994
; Peifer et al., 1991
; Peifer and Wieschaus,
1990
; Siegfried et al., 1994
). Similar to the requirement of
-catenin in vertebrate embryogenesis, armadillo is required for adherens junction assembly in Drosophila embryogenesis. A combination of maternal and zygotic nulls
of armadillo disrupts formation of an organized epithelium early in Drosophila embryogenesis (Cox et al., 1996
;
Peifer et al., 1993
).
-catenin has also
been shown recently to bind to the product of the adenomatous polyposis coli (APC)1 tumor suppressor gene. The
APC/
-catenin complex contains
-catenin but not cadherin (Rubinfeld et al., 1993
; Su et al., 1993
). APC protein
and E-cadherin compete for binding to
-catenin in transient expression assays (Hülsken et al., 1994
). APC protein
is a 310-kD cytoplasmic protein that is mutated in patients
with the inherited colon cancer syndrome familial adenomatous polyposis. Mutations in APC protein also represent an early event in a high percentage of sporadic colon
cancers (Groden et al., 1991
; Kinzler et al., 1991
; Polakis,
1995
). The cellular function(s) of APC protein are not
known. In addition to binding catenins, APC protein also binds to microtubules in vitro and in vivo (Munemitsu
et al., 1994
; Polakis, 1995
; Smith et al., 1994
). In epithelial
cells, APC protein localizes to the ends of microtubule
bundles in actively migrating plasma membrane protrusions and to the tips of membranes involved in early cell-
cell contact formation (Näthke et al., 1996
). The subcellular localization of APC protein indicates that it is involved
in cell migration.
-catenin that are important for
regulating its subcellular distribution and function(s) in
cadherin and APC protein complexes, we expressed NH2-
and COOH-terminal-deleted
-catenin in MDCK cells.
Our results demonstrate that deletion of the COOH-terminal domain does not affect the subcellular distribution of
-catenin. Deletion of the NH2-terminal domain stabilizes
-catenin in APC protein and E-cadherin complexes.
NH2-terminal-deleted
-catenin prominently colocalizes
with APC protein in clusters at the tips of plasma membrane protrusions. MDCK cells expressing NH2-terminal-
deleted
-catenin are inhibited in early cell-cell contact
formation and compaction when plated at low cell densities. Both colocalization with APC protein and inhibition
of adhesion by NH2-terminal-deleted
-catenin mutant
proteins are independent of
-catenin binding to
-catenin.
Materials and Methods
-cat.N was generated in rabbits against
the NH2-terminal 14 amino acids of
-catenin. Rabbit polyclonal antibodies raised against the COOH-terminal 14 amino acids of
-catenin and
-catenin (
-cat.C) have been described previously (Hinck et al., 1994b
).
A mAb against the COOH-terminal 212 amino acids of
-catenin (
-cat.C)
was obtained from Transduction Laboratories (Lexington, KY). A mouse
mAb KT3 against a SV-40 large T antigen epitope was kindly provided by
Gernot Walter (University of California, San Diego), and has been described previously (MacArthur and Walter, 1984
). A polyclonal antibody
against the cytoplasmic domain of E-cadherin has been described previously (Marrs et al., 1994
). Polyclonal antibodies against APC protein were
kindly provided by Paul Polakis (ONYX Pharmaceuticals, Richmond,
VA) and Inke Näthke (Stanford University), and have been described
previously (Näthke et al., 1996
; Rubinfeld et al., 1993
). Antisera were affinity purified with antigen for immunofluorescence as indicated.
-catenin cDNA (Butz et al., 1992
) in pBluescript SKII+ (Stratagene, La Jolla, CA) was used to generate deletion mutants (see Fig. 1).
The deduced amino acid sequence is identical to a partial dog
-catenin
sequence (amino acids 51-311) and identical to the human
-catenin sequence except for one amino acid difference at position 706 (Hülsken et al.,
1994
). To detect
-catenin and
-catenin mutants immunologically, an oligonucleotide encoding the amino acid sequence KPPTPPPEPET from
SV-40 large T antigen (KT3 epitope tag) was added to the 3
termini of all
cDNAs (MacArthur and Walter, 1984
). Nucleotide sequences of PCR-
derived sequences in constructs shown below were confirmed by direct sequencing (PAN Facility, Beckman Center, Stanford University School of
Medicine). The cDNA construct for
N131 (see below) was found to contain a PCR-introduced point mutation at nucleotide 553 that led to a conservative amino acid change of Val175 to Leu175.
Fig. 1.
Schematic representation of KT3-tagged full-size and
mutant
-catenin proteins. NH2- and COOH-terminal domains
and the 13 internal armadillo-like repeats of
-catenin are indicated. A stretch of unrepeated amino acids between repeat 10 and 11 (empty box) is shown. The binding sites for
-catenin,
E-cadherin, APC, and the epitopes for rabbit
-catenin antisera
-cat.N,
-cat.C, and mouse mAb KT3 are indicated. The epitope
for antiserum
-cat.N is deleted in
N90,
N131, and
N151, and
these mutant proteins are not detected by
-cat.N. A mouse mAb
raised against the 212 COOH-terminal amino acids of
-catenin
was used instead of antiserum
-cat.C, and both
-cat.C antibodies
do not detect
C. The following amino acids are deleted in the
mutants:
C, 696-781;
N90, 1-90;
N131, 1-131;
N151, 1-151.
[View Larger Version of this Image (31K GIF file)]
N131 was constructed by PCR using oligonucleotides containing suitable restriction sites (5
-SacII/3
-XbaI) for cloning into the pUDH10-3
vector (Gossen and Bujard, 1992
). The oligonucleotide defining the start
site of the cDNA (5
-CCATCGATTCTAGACCGCGGCCACCATGGCTTTGAAACATGCAGTTGTCAATTTG) contained a Kozak consensus sequence for translation initiation (Kozak, 1989
). The oligonucleotide
defining the stop site of the cDNA (5
-CCATCGATTCTAGATTAGGTCTCGGGCTCAGGAGGAGGAGTAGGAGGCTTGATATC C A G - GTCAGTATCAAACCAGGC) codes for 13 additional amino acids including the KT3 epitope after the COOH terminus of the mutant protein
(indicated in italics) followed by a stop codon; the underlined sequence is
derived from
-catenin. In two cloning steps, the BglII and, subsequently,
Eco47III/SpeI fragments of the original cDNA were exchanged for the respective PCR-derived fragments of
N131 in pUDH10-3.
N131 was used
to construct a pBluescript KSII+ vector for addition of the KT3 epitope
sequence to the 3
termini of other cDNAs. The Bsp106I/StuI fragment of
N131 was cloned into pBluescript KSII+-HA (Elferink et al., 1993
). The
EcoRV fragment containing the HA tag sequence and the complete
N131 sequence except for the KT3 epitope was subsequently removed.
This resulted in the vector pBluescript KSII+-KT3 in which the sequence
for the KT3 epitope and a stop codon are preceded 5
-upstream by
EcoRV/SmaI/BamHI restriction sites to allow the addition of cDNAs in
all three reading frames.
N
C was constructed by cloning the blunted BglII fragment of the
original
-catenin cDNA into pBluescript KSII+-KT3/SmaI. The resulting
EcoRI/XbaI fragment, in which the sequence for the KT3 epitope tag is
fused to the sequence of the last repeat in the core region of
-catenin,
was exchanged with the respective EcoRI/XbaI fragment in pUdH10-3/
N131 to obtain pUDH10-3/
N
C.
C was constructed by cloning the 5
EcoRI fragment with the start
codon of the original
-catenin cDNA into pUDH10-3. The resulting vector contained the sequence encoding the NH2-terminal half of
-catenin.
The 3
-terminal BglII/XbaI fragment of this
-catenin sequence was replaced with the 3
BglII/XbaI fragment of
N
C to obtain the expression
vector pUDH10-3/
C.
-catenin* was constructed
by exchanging the SpeI/BamHI fragment encoding the COOH-terminal
part of
C in pUDH10-3/
C against the respective fragment encoding the
COOH-terminal part of
N131.
N90 was constructed by PCR using the oligonucleotide 5
-CCATCGATTCTAGACCGCGGCCACCATGGCTCAGAGGGTCCGAGCT for
the 5
terminus of the cDNA and the same oligonucleotide as that used for
the 3
terminus of the cDNA of
N131. The SacII/XbaI PCR fragment was cloned into pUDH10-3. To replace PCR-derived sequences with original cDNA, the SphI/XbaI fragment of
N90 was exchanged with the
SphI/XbaI fragment of full-length KT3-tagged
-catenin.
N151 was constructed by PCR using the oligonucleotide 5
-CCATCGATTCTAGACCGCGGCCACCATGGCAATTCCTGAGCTGACA for
the 5
terminus of the cDNA and the same oligonucleotide as that used for
the 3
terminus of the cDNA of
N131. The SacII/XbaI PCR fragment was cloned into pUDH10-3. To replace PCR-derived sequences with original cDNA, the Eco47III/XbaI fragment of
N151 was exchanged with
the Eco47III/XbaI fragment of full-length KT3-tagged
-catenin. PCRderived sequences were confirmed by sequencing.
) coding for the tTa transactivator and pSV2-puro in a ratio of 10:1,
respectively. Transfection was done by the calcium phosphate precipitation method, and cells were plated onto 150-mm dishes. Drug-resistant
clones were selected in the presence of 5 µg/ml puromycin (Sigma Chemical Co., St. Louis, MO). 180 clones were picked using cloning rings and
then expanded. Each clone was transiently transfected with plasmid pUHC13-3 consisting of the luciferase gene under control of the tetracycline-regulated promoter in the presence and absence of 1 µg/ml tetracycline, using the lipofectamine reagent (GIBCO BRL, Gaithersburg, MD).
After 48 h, cells were homogenized and tested for luciferase activity.
Clone T23 showed 180-fold more luciferase activity in the absence of tetracycline as compared with in its presence. This clone was chosen for further studies. T23 cells were cotransfected with vectors for expression of
the tetracycline-repressible transactivator tTA (Gossen and Bujard, 1992
)
and a plasmid containing a gene for resistance to puromycin. Parental
MDCK clone T23 was cotransfected with the respective expression vectors for
-catenin mutant proteins (see above;
N90,
N131,
N151,
N
C,
C,
-catenin*) and plasmid pHMR272 carrying a gene for resistance to hygromycin (Gossen and Bujard, 1992
) using the lipofectamine
protocol from GIBCO BRL. Clones were selected in 300 µg/ml hygromycin (Boehringer Mannheim Biochemicals, Indianapolis, IN). Low passage
aliquots of drug-resistant MDCK clones were frozen and stored in liquid nitrogen; clones were passaged in DME medium containing 10% FCS (Gemini, Calabasas, CA) and 300 µg/ml hygromycin without doxycycline (Dox) for a maximum of 4-6 wk. In some experiments, expression of
-catenin mutant proteins was repressed by addition of 1 µg/ml tetracycline (Tet) or 20 ng/ml Dox (Sigma Chemical Co.) to the culture medium.
Cells were cultured 1-3 d without hygromycin before an experiment.
).
-catenin
antibody, or 60 µl protein A-Sepharose coupled to
-catenin or APC protein antibody. Immunoprecipitates were washed once with wash buffer
(0.5% NP-40, 20 mM Tris-HCl, pH 8, 150 mM NaCl), once with wash
buffer containing 1 M LiCl, and once with wash buffer. Immunoprecipitates were boiled in 30 or 60 µl SDS reducing sample buffer.
). Gels were transferred to nitrocellulose membranes with a pore size of 0.45 µm (Schleicher & Schuell
Inc., Keene, NH) in a buffer containing 25 mM Tris-HCl, pH 7.4, 50 mM
glycine, and 20% methanol. Membranes were stained with Ponceau S to
check for protein transfer, and then destained in 20 mM Tris-HCl, pH 7.4, 0.5% Tween-20, 140 mM NaCl (TTS). Membranes were blocked overnight at 4°C in TTS with 5% powdered milk. Primary antibodies were incubated with membranes for 2 h at room temperature (RT) in TTS with
5% powdered milk. Membranes were washed four times for 10 min each
with TTS, and then incubated with the appropriate secondary antibodies
coupled to HRP (Amersham Corp., Arlington Heights, IL) in TTS, 5%
powdered milk, and 5% serum from the animal species that was used to
generate the secondary antibody. Membranes were washed for at least 2 h
with six changes of TTS, and antibody reactivity was visualized with enhanced chemiluminescence reagent (Amersham Corp.). Bands on ECLexposed X-OMAT AR film (Eastman Kodak Co., Rochester, NY) were
analyzed with a GS 300 transmittance/reflectance scanning densitometer
(Hoefer Scientific Instruments, San Francisco, CA), or scanned with a
ScanJet IIc (Hewlett-Packard Co., Palo Alto, CA) and analyzed with NIH
Image. All reagents were from Sigma Chemical Co. unless indicated otherwise.
N131-D was preincubated for 24 h
in 1 µg/ml Tet before plating onto coverslips and was kept in medium
containing Tet until fixation. Cells were washed once in Dulbecco's PBS
(0.9 mM CaCl2, 2.7 mM KCl, 1.5 mM KH2PO4, 0.5 mM MgCl2, 137 mM
NaCl, and 8.1 mM NaHPO4) and fixed for 20 at RT in 2% formaldehyde
in Dulbecco's PBS. Cells were washed four times for 5 min each in Dulbecco's PBS with 50 mM NH4Cl, blocked, and permeabilized for 20 min in
Dulbecco's PBS with 50 mM NH4Cl, 1% BSA, 2% goat serum, and 0.05%
Saponin (blocking buffer). Cells were incubated 1 h at RT with primary
antibody in blocking buffer and washed four times for 5 min each in Dulbecco's PBS with 50 mM NH4Cl. Cells were incubated 1 h at RT with fluorescein- or rhodamine-conjugated goat secondary antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA) in blocking buffer, and
then washed four times for 5 min each in Dulbecco's PBS with 50 mM
NH4Cl. Antibodies were used in the following dilutions: affinity-purified
E-cadherin antiserum 1:50; affinity-purified
-catenin antiserum 1:50;
mouse mAb KT3 1:50;
-cat.N antiserum 1:200; and secondary antibodies 1:200. For KT3/APC protein double immunofluorescence, 5 × 105 cells
were plated onto collagen-coated coverslips in 35-mm tissue-culture dishes and fixed after 48 h. Cells were washed once in Dulbecco's PBS,
fixed for 5 min at
20°C in precooled methanol, washed four times in
Dulbecco's PBS, and blocked in Dulbecco's PBS with 1% BSA and 2%
goat serum (blocking buffer). Cells were incubated for 1 h at RT with primary antibody in blocking buffer, washed four times for 5 min each in
Dulbecco's PBS, incubated 1 h at RT with fluorescein- or rhodamine-conjugated goat secondary antibodies (Jackson ImmunoResearch Laboratories) in blocking buffer, and washed four times for 5 min each in Dulbecco's PBS. Antibodies were used in the following dilutions: mouse mAb
KT3 1:50; and APC protein antiserum 1:200. Cells were mounted in a mixture of 16.7% Mowiol (Calbiochem-Novabiochem Corp.), 33% glycerol,
and 0.1% phenylenediamine in Dulbecco's PBS without CaCl2 and MgCl2 and viewed with an Axiophot inverted fluorescence microscope (Carl Zeiss Inc., Thornwood, NY) using a ×63 oil immersion objective. For
phase-contrast microscopy of low density cultures, each clone was split
and cultured for 3 d with or without 20 ng/ml Dox. 5 × 105 cells were
plated onto 100-mm tissue-culture dishes in medium with or without 20 ng/ml Dox, and photomicrographs of the cultures were taken 24 and 48 h
after plating with an Axiovert 10 phase-contrast microscope (Carl Zeiss
Inc.).
Results
-Catenin Mutant Proteins
in MDCK Cells
-catenin proteins lacking NH2-terminal 90 (
N90),
131 (
N131), 151 (
N151) amino acids, or COOH-terminal
86 amino acids (
C), and full-length
-catenin (
-catenin*)
were expressed in MDCK cells (Fig. 1). The sequence for
the SV-40 large T antigen epitope recognized by the mAb
KT3 (MacArthur and Walter, 1984
) was added to the 3
termini of all cDNA constructs to distinguish protein
products from endogenous
-catenin. All constructs were expressed under the control of the Tet-repressible transactivator; in the presence of either Tet or Dox, expression of
exogenous protein is completely repressed (Gossen and
Bujard, 1992
).
/+ Dox) were analyzed for expression of mutant
-catenins (Fig. 2). Mutant
-catenins (Fig. 2, a-c; marked
with stars in
-cat.C,
-cat.N, and KT3 blots) were detected
in protein extracts from clones cultured without Dox,
but not in extracts from clones cultured with Dox. 15-20
clones were analyzed for every construct. Mutant
-catenin
levels in clones expressing
N90,
N131, or
N151
-catenin were on average higher than that in clones expressing
-catenin* and
C
-catenin. However, the level of
N151
in clone
N151-D was similar to
-catenin* in clone
-catenin*-10 (Fig. 2 c; KT3 blot). In the clones shown in Fig. 2,
the ratios of
N90,
N131,
N151, or
C
-catenin to
MDCK endogenous
-catenin were 5:1, 1:1, 0.5:1, and 1:1,
respectively (Fig. 2 a, lanes 7, 9, and 11; Fig. 2 b, lane 5).
Fig. 2.
Dox-repressible expression of
-catenin mutant proteins in MDCK cells. MDCK clones were cultured for 4 d without
or with Dox (
/+ Dox) and extracted with 1% SDS. 15-µg protein lysates were subjected to SDS-PAGE and immunoblotted
with different antibodies (see Fig. 1).
-catenin mutant proteins
(stars in a-c) were expressed only in cultures without Dox; endogenous
-catenin was expressed in all cultures (a and b). Expression levels of exogenous full-length
-catenin*,
N90,
N131,
and
N151 were compared with that of endogenous
-catenin by
immunoblotting with mAb
-cat.C (a). Exogenous
-catenin* and
C were compared with endogenous
-catenin by immunoblotting with
-cat.N (b). The expression levels of mutant
-catenin
proteins in different clones were compared by immunoblotting
with the tag antibody KT3 (c). The
-cat.C blot was reblotted with
E-cadherin antiserum (d). The KT3 blot was reblotted with
-catenin antiserum (e). Molecular mass standards are indicated in kD.
[View Larger Version of this Image (65K GIF file)]
; Weißig,
1993
). Therefore, we analyzed whether expression of
-catenin mutant proteins affected levels of endogenous
-catenin, E-cadherin, or
-catenin by comparing their amounts
in lysates from clones cultured without or with Dox. Expression of
N90,
N131, or
N151 did not significantly
affect the level of endogenous
-catenin (Fig. 2, a and b,
compare lanes 7 to 8, 9 to 10, and 11 to 12, respectively).
Expression of
C
-catenin resulted in a small but reproducible decrease in amount of endogenous
-catenin (Fig. 2, a and b, lanes 5 and 6). Although full-length exogenous
-catenin* and endogenous
-catenin were not always
well separated by SDS-PAGE because of similarity in
their electrophoretic mobilities, a decrease of endogenous
-catenin in response to the expression of
-catenin* was
detectable in some of these clones (Fig. 2 a, lanes 3 and 4).
N90
-catenin (
N90-A) and
N131
-catenin (
N131-D) compared with levels in
-catenin-10* and
C clones (Fig. 2 d). Differences in E-cadherin levels may
be the result of clonal variation since the amount of E-cadherin in a particular clone was not significantly affected after repression of mutant
-catenin expression by addition of Dox (Fig. 2 d; compare lanes 7 to 8, 9 to 10, and 11 to 12, respectively). Expression of mutant
-catenins did not
have a significant effect on amounts of
-catenin in all
clones except
N131-D in which the
-catenin level was
slightly decreased when cells were cultured without Dox
(Fig. 2 e, lanes 9 and 10).
-Catenin Proteins Compete with Endogenous
-Catenin for Binding to E-Cadherin and
-Catenin
-catenin mutants to E-cadherin and
-catenin
was analyzed by coimmunoprecipitation of protein complexes (Fig. 3). The binding site for E-cadherin in
-catenin
is located within the armadillo repeat domain of
-catenin
(Aberle et al., 1994
; Hülsken et al., 1994
) and was retained
in all mutant proteins. Accordingly, all
-catenin mutant proteins were coimmunoprecipitated by E-cadherin antibody
(Fig. 3 a; KT3 blot). Binding of
N90 and
N131
-catenin
to E-cadherin resulted in a reduction in amount of endogenous
-catenin complexed with E-cadherin compared
with the amount of endogenous
-catenin in similar complexes isolated from the same clones cultured with Dox
(Fig. 3 b;
-cat.C blot; compare lanes 5 and 6, and 7 and 8,
respectively). The binding site for
-catenin is located between amino acids 120 and 151 in
-catenin (Aberle et al.,
1994
, 1996) and was incomplete or missing in
N131 and
N151
-catenin. Accordingly,
N131 and
N151
-catenin were not coimmunoprecipitated by
-catenin antibody (Fig. 3 c; KT3 blot). Binding of
N90 and
C
-catenin to
-catenin resulted in a reduction in amount of endogenous
-catenin bound to
-catenin compared with endogenous
-catenin in complexes with
-catenin that were isolated
from the same clones cultured in the presence of Dox (Fig.
3 d;
-cat.C blot; compare lanes 5 and 6, and 11 and 12, respectively). These results confirm that
N90 and
C
-catenin retained both E-cadherin and
-catenin binding sites,
and that
N131 and
N151
-catenin retained the E-cadherin, but not
-catenin, binding site; all mutant
-catenin
proteins competed with endogenous
-catenin for these
binding partners.
Fig. 3.
-catenin mutant proteins compete with endogenous
-catenin for binding to E-cadherin and
-catenin. MDCK clones
were cultured 4 d without or with Dox (
/+) and extracted with
1% Triton X-100 lysis buffer. Protein lysates were split: 400-µg
lysates were immunoprecipitated with E-cadherin antiserum to
analyze binding of mutant
-catenin proteins to E-cadherin (a and
b). 400 µg protein lysates were immunoprecipitated with
-catenin
antiserum to analyze binding of mutant
-catenin proteins to
-catenin (c and d). Equivalent fractions of the immunoprecipitates were subjected to SDS-PAGE and blotted with mAbs KT3
(a and c) or
-cat.C (b and d).
-catenin mutant proteins are indicated (stars).
[View Larger Version of this Image (58K GIF file)]
-Catenin
Are Enriched in APC Protein Complexes
-catenins to APC protein was also analyzed by coimmunoprecipitation. All mutant
-catenins
were coimmunoprecipitated by APC protein antibody
(Fig. 4). However,
N90,
N131, and
N151
-catenin were
significantly enriched in APC protein immunoprecipitates compared with endogenous
-catenin,
C, or exogenous
-catenin*. Three times more
N90,
N131, or
N151 was
coimmunoprecipitated with APC protein than endogenous
-catenin (Fig. 4 c). Note that total amounts of mutant
-catenin in lysates used for immunoprecipitation were
either similar to, or less than that of, endogenous
-catenin (Fig. 4 a); the ratios of
N90,
N131, or
N151
-catenin to endogenous
-catenin in Triton X-100 lysates were
1.6:1, 1.3:1, and 0.1:1, respectively. Very little
C
-catenin
was detected in APC protein complexes, although as much
C as
N151
-catenin was present in the Triton X-100
lysates of each clone (compare Fig. 4 b and 4 d; KT3 blots).
Fig. 4.
N90,
N131, and
N151 are enriched in APC protein
complexes. Aliquots of the same Triton X-100 lysates as described in Fig. 3 were either subjected to SDS-PAGE or used for
immunoprecipitation with APC antiserum (a-d). 9-µg protein lysates were subjected to SDS-PAGE and immunoblotted with the
indicated mAbs to compare the ratio of
-catenin mutant proteins to endogenous
-catenin (a), and to each other (b). 1,500-µg
protein lysates were immunoprecipitated with APC antiserum.
Equivalent fractions of the immunoprecipitates were subjected to
SDS-PAGE and blotted with the indicated mAbs to analyze
binding of mutant
-catenin proteins to APC (c-d).
-catenin
mutant proteins are indicated (stars). A longer exposure of the
blot in (d) is shown for lanes 7 and 8. Triton X-100 lysates were
prepared from clones
-catenin*-7 and
N131-7, and aliquots of
the lysates were immunoprecipitated with antiserum
-cat.C or
APC antiserum (e). Immunoprecipitates were subjected to SDSPAGE and blotted with antiserum
-cat.C to analyze the ratio of
exogenous
-catenin* and
N131 to endogenous
-catenin.
-catenin mutant proteins are indicated (stars).
[View Larger Versions of these Images (44 + 41K GIF file)]
-catenin, NH2-terminal-deleted
-catenins bind preferentially to APC protein. In addition, the amount of
N151
-catenin that is complexed with APC protein is very similar to that of
N90 and
N131
-catenin, even though
there is much less
N151
-catenin in clone
N151-D. Therefore, we suspect that binding of NH2-terminal-deleted
-catenin to APC protein approaches a maximum.
-catenin in APC protein complexes, amounts of
-catenin* and
N131
-catenin bound to APC protein were
compared in two different clones (
-cat.*-7 and
N131-7;
Fig. 4 e). Portions of Triton X-100 lysates of these clones were
used to immunoprecipitate both full-length and deleted
-catenin with
-cat.C antiserum, or to coimmunoprecipitate APC protein complexes. In
-cat.C immunoprecipitates, the ratios of endogenous
-catenin to
-catenin* in
the
-catenin*-7 clone, and those of endogenous
-catenin
to
N131 in the
N131-7 clone, were ~1:1. In APC protein immunoprecipitates, the ratio of endogenous
-catenin to
-catenin* was also ~1:1, but, in contrast, the ratio of endogenous
-catenin to
N131
-catenin was ~1:3.
N131
-catenin was considerably more abundant in APC
protein immunoprecipitates than either endogenous
-catenin or exogenous full-length
-catenin* (Fig. 4 e).
-Catenin
Stability in APC Protein and E-Cadherin Complexes
N90,
N131,and
N151
-catenins bound
to APC protein could be caused by increased stability of
these
-catenins in the complex. To test this hypothesis,
expression of
-catenin mutant proteins was repressed by
addition of Dox to cultures for 0, 6, 12,or 18 h. Amounts of
mutant
-catenin remaining in Triton X-100 lysates of
these cells, and in E-cadherin and APC protein complexes
isolated from those lysates, were analyzed by immunoprecipitation and/or Western blotting (Fig. 5).
Fig. 5.
Increased stability of
N90,
N131, and
N151 in the
E-cadherin- and APC protein-bound pools. MDCK clones were
cultured 0, 6, 12, or 18 h with Dox and extracted with 1% Triton
X-100 lysis buffer. Protein lysates were split: 1,500-µg protein lysates were immunoprecipitated with APC antiserum (first column), and 500-µg lysates were immunoprecipitated with E-cadherin antiserum (second column). Equivalent fractions of the
immunoprecipitates and 50-µg (
-cat.*-10,-7,
C-9) or 25-µg
(
N90-A,
N131-D,
N151-D) protein lysates (third column)
were subjected to SDS-PAGE and immunoblotted with mAb
KT3. For
-catenin*-10, -7, and
C-9 blots, three times more of
the APC immunoprecipitations were used than for the
N90-A,
N131-D, and
N151-D blots, and the blots were exposed longer.
[View Larger Version of this Image (56K GIF file)]
-catenins compared with full-length
-catenin* or
C
-catenin was detected in E-cadherin
and APC protein complexes from lysates. This difference
in stability was most pronounced in the APC protein-
bound pools. Very little or no full-length
-catenin* or
C
-catenin were detected in the APC protein complex after
only 6 h of treatment with Dox. In contrast, there was little or no decrease in amounts of
N90,
N131, or
N151
-catenin in the APC protein complex after 18 h of treatment
with Dox. In the E-cadherin-bound pools of lysates, 10-
12% of the original amount of full-length
-catenin* and
C
-catenin was detected after 12 h of treatment with Dox.
In contrast, amounts of
N90,
N131, or
N151
-catenin
bound to E-cadherin were not or little reduced after 18 h
of treatment with Dox.
-catenin proteins were reduced after 12 to 18 h of
treatment with Dox. The percentage of remaining mutant
protein after 12 h of treatment with Dox is 17% and 18%
of
-catenin* in clones
-catenin*-7 and
-catenin*-10,
respectively; 18% of
C
-catenin; 44% of
N90
-catenin;
32% of
N131
-catenin; and 26% of
N151
-catenin.
The close similarity in the decrease in amounts of
-catenin* in two independent clones indicates that the rate and efficiency of Dox repression of gene expression were similar in different MDCK clones. Assuming that this is also
the case in other clones, the half-life of
C is similar to
that of full-length
-catenin*, whereas
N90,
N131, and
N151
-catenin are slightly more stable than full-length
-catenin*. The mutant
-catenin proteins in the total TX100 lysates represent the sum of the E-cadherin- and
APC-bound, and unbound pools. Although
N90,
N131,
or
N151
-catenin was very stable in E-cadherin and
APC protein complexes, their overall stability in the lysates was not very different from that of full-length
-catenin* and
C
-catenin. This indicates that pools of
N90,
N131, and
N151
-catenin that are not bound to either
E-cadherin or APC protein turn over at a rate similar to
that of full-length
-catenin* and
C
-catenin.
-catenins in the APC protein complexes correlated with the enrichment of these mutant proteins in the APC protein
complexes compared with endogenous
-catenin in the
same cells (Fig. 4). Surprisingly, we could not detect an
enrichment of NH2-terminal-deleted
-catenins in the E-cadherin pool when compared with endogenous
-catenin in the same cells (see Fig. 3 c), even though NH2-terminal-deleted
-catenins were more stable than full-length
exogenous
-catenin* in the E-cadherin complexes of different clones (Fig. 5). We note that most of the E-cadherin
in MDCK cells is normally bound to endogenous
-catenin in a 1:1 molar ratio (Hinck et al., 1994a
). In contrast, most of the APC protein appears to be free of endogenous
-catenin (Näthke et al., 1996
). Therefore, NH2-terminal-
deleted
-catenins must compete with endogenous
-catenin to bind to E-cadherin, but they may be enriched in the
APC protein pool by binding unoccupied sites and remaining stabilized in these complexes. This may explain the difference in the ratios of the mutant proteins to endogenous
-catenin when comparing the E-cadherin-
bound or APC-bound pools in the same cultures (Figs. 3
and 4).
-Catenin Prominently
Localizes in Clusters with APC Protein at Tips of
Plasma Membrane Protrusions
-catenin proteins form stable complexes with
E-cadherin and APC protein. We examined the subcellular distribution of mutant
-catenins by immunofluorescence microscopy. Mutant
-catenins were epitope tagged
and can be distinguished from endogenous
-catenin with
the monoclonal anti-tag antibody KT3. We examined two
types of cell cultures: low density cultures in which small
groups of cells had initiated cell-cell contacts (Fig. 6), and
high density cultures in which mature cell-cell contacts
had been established (Fig. 7).
Fig. 6.
N151,
N131, and
N90 localize to clusters near the plasma membrane in extending membranes of MDCK cells. MDCK clones
were double stained with mAb KT3 against the epitope tag in
-catenin mutant proteins (a-e) and antiserum against E-cadherin (a
),
antiserum
-cat.N against endogenous
-catenin (b
), and antiserum against
-catenin (c
-e
). Areas with
N151,
N131, and
N90 clusters are indicated by arrowheads (a-d). These clusters are not detected with E-cadherin, endogenous
-catenin, or
-catenin antisera
(a
-d
, arrowheads).
N131 expression was repressed in
N131-D by 48 h incubation with Tet before fixation (e). (Arrows) Areas of intercellular contact that are stained by antisera to E-cadherin (a
), endogenous
-catenin (b
),
-catenin (c
-e
), and sometimes weakly by
mAb KT3 (a-d). Bar, 10 µm.
[View Larger Version of this Image (65K GIF file)]
Fig. 7.
N90,
N131, and
N151 colocalize with APC protein in MDCK cells. MDCK clones were double stained with mAb KT3
against the epitope tag in
-catenin mutant proteins and antiserum against APC protein. Full-length
-catenin* and
C localize to the
lateral membranes of cells and show little overlap with APC protein clusters (top and bottom panel).
N90,
N131, and
N151 localize
to lateral membranes of cells and colocalize with APC protein in clusters (middle panels). Bar, 10 µm.
[View Larger Version of this Image (139K GIF file)]
N90,
N131, and
N151
-catenins prominently localized to clusters at the outer boundary of cell-cell contacts
and at the tips of plasma membrane protrusions (Fig. 6,
a-d, arrowheads). Neither E-cadherin, endogenous
-catenin, nor
-catenin colocalize with the NH2-terminal-
deleted
-catenins in theses clusters (Fig. 6, a
-d
, arrowheads). This distinctive subcellular distribution is very
similar to that of APC protein in MDCK cells (Näthke et al.,
1996
). Therefore, we examined colocalization of the mutant
-catenin proteins with APC protein in these clusters
(Fig. 7).
N90,
N131, and
N151
-catenins colocalized
precisely with APC protein in almost all clusters at the tips
of plasma membrane protrusions; incidences of APC protein clusters without
N90,
N131, or
N151
-catenins
were very rare (Fig. 7, middle panels). However, fulllength
-catenin* and
C
-catenin localized to intercellular contacts, and there was little overlap in distributions
between these proteins and APC protein (Fig. 7, top and
bottom panel).
N90,
N131, and
N151
-catenins were poorly localized at intercellular contacts, compared with strong staining for E-cadherin and
-catenin at
the same sites (Fig. 6). In these cell-cell contact areas,
NH2-terminal-deleted
-catenin mutant proteins colocalized with E-cadherin, endogenous
-catenin, and
-catenin (Fig. 6, a-d, and a
-d
, arrows). Localization of
N90,
N151, and
N131
-catenins to intercellular contacts was
much more prominent in high density cultures (Fig. 7; KT3 immunofluorescence). The distribution of
-catenin* and
C was identical to that of endogenous
-catenin (data
not shown).
-catenin in these cells.
-Catenin Compared
With Cells Expressing
-Catenin* and
C
-Catenin
-catenins. In low density
cultures, the morphology of cells expressing
N90,
N131,
or
N151
-catenins was distinctly different from that of the
same cells treated with Dox (i.e., without mutant
-catenin
expression; Fig. 8), parental MDCK cells, and cells expressing
-catenin* or
C
-catenin (data not shown).
Cells treated with Dox, parental MDCK cells, and cells expressing
-catenin* or
C
-catenin produced compact
cell colonies; note that cells at the edges of colonies rarely
extended membrane protrusions onto the surrounding
cell-free surface. In addition, we found very few individual
cells that were not associated with colonies in these cultures. Neither addition of Dox to the cultures nor addition
of the KT3 tag to full-length
-catenin affected the morphology of either parental MDCK cells (Fig. 8, top panel) or
-catenin*-expressing cells (data not shown), respectively. In contrast, the surface area of cells expressing
N90,
N131, or
N151
-catenins (i.e., in the absence of
Dox) was greater than that of control cells, indicating that
the former were poorly compacted. Cells loosely associated in colonies also had many membrane extensions projecting onto the surrounding cell-free surface. In addition,
many individual cells were not associated directly with colonies and were dispersed throughout the culture; in general, these cells have a more fibroblastic morphology than control cells (Fig. 8). Repression of
N90,
N131, or
N151
-catenin expression by treatment with Dox reverted
the morphology of cells to compacted colonies typical of parental MDCK cells (Fig. 8, top panels; see also Fig. 6, e and e
).
Fig. 8.
Effect of
N90,
N131, and
N151 expression on colony formation in low density MDCK cultures. Cultures of MDCK clones
were untreated or pretreated 3 d with Dox and plated at low density without (
) or with (+) Dox. Cell morphology was analyzed 24 and 48 h after plating. Expression of
N90,
N131, and
N151 delayed formation of tight round colonies in low density cultures (first and
third columns). This effect could be reversed by repression of expression of
N90,
N131, and
N151 with Dox (second and fourth columns). Dox itself had no effect on the morphology of the parental cells (top panel). Bar, 40 µm.
[View Larger Version of this Image (136K GIF file)]
N90,
N131, or
N151
-catenins
and control cells were less evident. Cells expressing
N90,
N131, or
N151
-catenins established compact colonies
and, eventually, formed complete monolayers similar to
those of control cells (see Fig. 7).
Discussion
-Catenin binds independently to E-cadherin and APC
protein, and one function of these interactions is to link
E-cadherin to the actin cytoskeleton via
-catenin (Aberle
et al., 1994
; Hülsken et al., 1994
; Jou et al., 1995
; Rimm
et al., 1995
). In the case of E-cadherin, this hierarchy of
protein interactions is important for regulating E-cadherin
function in establishing cell-cell adhesion (Ozawa and
Kemler, 1992
). The role of catenin binding in APC protein
function(s) is not known, but it has been suggested that
APC protein may regulate cellular
-catenin levels (Munemitsu et al., 1995
; Papkoff et al., 1996
). In this study, we
examined interactions of
-catenin mutant proteins with
E-cadherin,
-catenin, and APC protein, and investigated
their subcellular distributions and effects on the morphology of MDCK epithelial cells. Our results provide novel
insights into the roles of
-catenin in regulating E-cadherin and/or APC protein functions: (a) NH2-terminal deletion of
-catenin results in stabilization of
-catenin in APC protein complexes; (b) full-length
-catenin poorly
colocalizes with APC protein, but NH2-terminal-deleted
-catenin strongly colocalizes with APC protein in clusters
at the tips of membrane protrusions; (c) expression of
NH2-terminal-deleted
-catenin affects cell morphology
and intercellular adhesion; (d) the effects on cell morphology are independent of
-catenin binding to
-catenin; and (e) alterations in
-catenin binding to APC protein,
the subcellular location of mutant
-catenin/APC protein
complexes, and the resulting changes in cell morphology
imply that APC protein is involved in cell migration and that
-catenin binding to APC protein regulates this function.
-Catenin Distribution between Different
Cellular Pools
N90,
N131, and
N151 and
C
-catenin
were expressed in MDCK cells using a Dox/Tet-repressible expression system. As an additional control, epitopetagged full-length
-catenin (
-catenin*) was expressed in
MDCK cells. Expression of
-catenin mutant proteins had
no significant effect on cellular levels of E-cadherin and
-catenin. However, a small but reproducible reduction in
the amount of endogenous
-catenin was observed in cells
expressing full-length
-catenin* or
C
-catenin (Fig. 2).
All
-catenin mutant proteins competed with MDCK
endogenous
-catenin for binding to E-cadherin (Figs. 3
and 4). Exogenous full-length
-catenin*,
N90, and
C
-catenin competed with MDCK endogenous
-catenin for
binding to
-catenin, whereas
N131 and
N151
-catenin
were not associated with
-catenin (Fig. 3).
-catenin coimmunoprecipitated in a complex
with APC protein revealed that mutant
-catenins were
specifically enriched. By comparison, endogenous
-catenin was not enriched in the same coimmunoprecipitates
(Fig. 4). The enrichment of mutant
-catenin in the APC
protein complex was independent of binding of mutant
-catenin to
-catenin. Our data suggest that the NH2-terminal domain of
-catenin is important for regulating its
stability in the APC protein complex (Fig. 5). Similar observations have been reported recently by Munemitsu et
al. (1996). APC protein stimulates
-catenin degradation
in some cell lines (Munemitsu et al., 1995
). Although the
mechanism regulating the dynamics of
-catenin interactions with APC protein remains to be elucidated, phosphorylation of APC protein (Rubinfeld et al., 1996
) and/or
-catenin by glycogen synthase kinase 3
(GSK3
) may
be important. GSK3
associates with the APC protein/
catenin complex in some cell lines (Rubinfeld et al., 1996
).
The NH2 terminus of
-catenin contains a GSK3
phosphorylation site, and we are currently investigating the
role of this site for
-catenin stability in the APC complex. Interestingly,
-catenin mutants lacking this site are more
stable than wild-type
-catenin in Xenopus embryos (Yost
et al., 1996
), indicating that the phosphorylation state of
-catenin regulates
-catenin turnover. Our data also
show that NH2-terminal-deleted
-catenin is more stable
in E-cadherin complexes than full-length and
C
-catenin (Fig. 5). Regulation of
-catenin stability in E-cadherin complexes may be determined by mechanism(s) similar to those in the APC protein complexes.
-Catenin Mutant Proteins
Colocalize with APC Protein in Clusters at Tips of
Plasma Membrane Protrusions
-catenin is seldom detected in the APC protein clusters,
N90,
N131, and
N151
-catenin prominently colocalized with APC protein in these clusters (Fig. 7). This colocalization was independent of mutant
-catenin binding to
-catenin, since neither
N131 nor
N151
-catenin
bound
-catenin. Surprisingly, localization of
N90
-catenin to APC protein clusters was not accompanied by strong
colocalization of
-catenin, even though this mutant
-catenin retained an
-catenin binding site and formed complexes with
-catenin (Fig. 6, c and c
).
N90,
N131, and
N151
-catenin in APC protein clusters is
disrupted by nocodazole but not by cytochalasin D (data
not shown), suggesting that linkage of the APC protein
complex to microtubules, rather than to actin filaments,
may be more important for APC protein localization and,
perhaps, function (see also Näthke et al., 1996
).
-Catenin Inhibits
Colony Formation in Low Density Cultures
-catenin expression
on MDCK cell morphology. Cultures of cells were initiated from single cells that normally migrate, form contacts
with other cells, and, by 24 h, establish small colonies.
Three general differences in morphology were detected in
cells expressing
N90,
N131, or
N151
-catenin compared with control cells. At low density, cells were dispersed, more fibroblastic in morphology, and less efficient at forming colonies. At high density, cells formed monolayers similar in morphology to those of controls (data not
shown). Differences in morphology of cells expressing mutant
-catenin compared with control cells may be due to a
combination of decreased cell-cell adhesion and either decreased movement resulting in a lower probability of cells
contacting each other, or increased migration resulting in
dispersion of cells.
-catenin mutants. E-cadherin plays a
key role in the initial formation of cell-cell contacts in
MDCK cells (Gumbiner et al., 1988
; McNeill et al., 1993
),
and linkage of E-cadherin to the cortical actin cytoskeleton via
-catenin and
-catenin is essential for cell-cell adhesion (Hirano et al., 1987
; Nagafuchi and Takeichi, 1988
;
Ozawa et al., 1990
).
N131 and
N151
-catenin may disrupt E-cadherin function because these mutant proteins
cannot bind
-catenin and, hence, the actin cytoskeleton
to E-cadherin. This inhibitory effect may be overcome at
higher cell densities because cells are forced into contacts
and there is sufficient E-cadherin bound to endogenous
-catenin to function in cell-cell contact. However, cells
expressing
N90
-catenin, which does bind
-catenin, exhibited the same morphology as that of
N131 and
N151
-catenin-expressing cells. This result indicates that expression of NH2-terminal-deleted
-catenin affects colony
formation in low density cultures independently of the
binding of
-catenin to
-catenin. Furthermore, this phenotype correlates with the dominant colocalization of all
three NH2-terminal-deleted
-catenin mutant proteins with
APC protein in clusters at the ends of membrane protrusions. Previous studies have shown that these APC protein
clusters localize to the ends of microtubules, and that this
localization is independent of the actin cytoskeleton (Näthke et al., 1996
). A role of clusters of APC protein in
cell migration and/or early contact formation has been
suggested (Näthke et al., 1996
). Based upon the results of
the present study, we suggest that stable binding of
-catenin to APC protein may affect a function of APC protein
in these clusters in microtubule organization and/or cell
migration. Thus, in low density cultures, altered migratory
behavior of cells may reduce the time and/or number of intercellular contacts that enable cells to initiate stable cell-
cell adhesion, thereby giving rise to the observed defect in
colony formation. Furthermore, APC protein may be directly involved in the initiation of stable adhesion between
extending membranes of these cells (Näthke et al., 1996
).
A detailed analysis of the role of the APC/
-catenin complex underlying this phenotype is currently under investigation.
-Catenin in Signaling Pathways and
Embryonic Development
-catenin mutant proteins have
been used to study the function of
-catenin in cell signaling during embryonic development (Fagotto et al., 1996
;
Funayama et al., 1995
). In Drosophila, the
-catenin homologue armadillo was originally identified through its
role in transduction of the wingless/Wnt cell-cell signal
that mediates cell fate determination (Noordermeer et al.,
1994
; Peifer et al., 1991
; Peifer and Wieschaus, 1990
; Siegfried et al., 1994
). In vertebrates, the wingless/Wnt signaling pathway may be involved in the formation of the
dorsal-ventral axis during Xenopus embryogenesis, and
-catenin seems to be a downstream component of this
pathway (Cui et al., 1995
; Funayama et al., 1995
; Heasman
et al., 1994
; McCrea et al., 1993
; Sokol et al., 1991
). The
cellular mechanisms by which
-catenin receives or transmits the wingless/Wnt signal are not well understood. There is evidence that
-catenin has distinct roles in Wingless/Wnt signaling and cell adhesion, and that
-catenin
binding to cadherin antagonizes its signaling function (Cox
et al., 1996
; Fagotto et al., 1996
; Orsulic and Peifer, 1996
).
In contrast to these results, ectopic Wnt expression in
mammalian cell lines leads to stabilization of
-catenin or
its homologue plakoglobin in the cadherin/catenin complex and to increased adhesion (Bradley et al., 1993
; Hinck
et al., 1994b
). Ectopic expression of NH2-terminal-deleted
-catenin mutant proteins similar to the ones used in this
study or of
-catenin with a mutated GSK3
phosphorylation site induced formation of a secondary dorsal body
axis in Xenopus embryos (Fagotto et al., 1996
; Funayama
et al., 1995
; Guger and Gumbiner, 1995
; Yost et al., 1996
).
These investigators noted that mutant
-catenin protein
was found in the nucleus. Yost et al. (1996)
showed also that inhibition of GSK3
by overexpression of a dominant
negative mutant causes nuclear localization of endogenous
-catenin in Xenopus embryos. This localization may be
important for regulating cell fate determination at the
gene transcription level.
-catenin proteins form stable complexes with cadherin and APC protein. Although we have not directly analyzed the function
of endogenous
-catenin in APC protein complexes, our
results indicate strongly that a change in the dynamics of
-catenin binding to APC protein resulting in stabilization
of the
-catenin/APC protein complex coincides with alterations in cell adhesion, migration, and morphology. Given the possibility that one function of APC protein is
in regulating cell migration (Näthke et al., 1996
), we suggest that the dynamics of
-catenin binding to APC protein plays a key role in regulating APC protein function in
these events during complex cell movements. In support of
this idea, we have shown recently (Pollack, A., A. Barth,
W.J. Nelson, and K.E. Mostov, manuscript submitted for publication) that expression of these mutant
-catenins inhibits hepatocyte growth factor/scatter factor-induced tubulogenesis of MDCK cysts. The initial stage of tubulogenesis involves migration of long cell extensions from the
cyst into the surrounding matrix; subsequently, these extensions reorganize into tubules. Expression of NH2-terminal-deleted
-catenin inhibits formation of these cell
extensions and subsequent tubule formation. Significantly, mutant
-catenin and APC protein colocalize prominently
at the tips of short membrane extensions that do not migrate further. Precise control of cell-cell adhesion and migration is important during complex morphogenetic processes such as gastrulation and neurulation. Thus, in
addition to affecting signaling pathways,
-catenin mutant
proteins may alter morphogenetic movements of cells by
impairing the functions of E-cadherin and/or APC protein in cell adhesion and migration.
Address all correspondence to Angela I.M. Barth, Department of Molecular and Cellular Physiology, Stanford University School of Medicine, Stanford, CA 94305-5426. Tel.: (415) 723-9788. Fax: (415) 725-8021. e-mail: angelab{at}leland.stanford.edu
Received for publication 17 September 1996 and in revised form 13 November 1996.
We are very thankful to Drs. Inke Näthke and Paul Polakis for providing APC protein antisera and for helpful discussions. We also thank Dr. Rolf Kemler for providing the
-catenin cDNA; Dr. Hermann Bujard for providing the plasmids for the tetracycline-repressible expression system; Dr.
Gernot Walter for providing the mAb KT3; and Drs. Helen McNeill and
Eugenio de Hostos for their advice during preparation of the manuscript.
This work was supported by grants to W.J. Nelson from the National Institutes of Health (NIH) and American Cancer Society, and by grants to K.E. Mostov from the NIH. A. Barth was supported by a NATO fellowship from the Deutscher Akademischer Austauschdienst and an American Heart Association fellowship.
APC, adenomatous polyposis coli;
Dox, doxycycline;
GSK3
, glycogen synthase kinase 3
;
RT, room temperature;
Tet, tetracycline.
-catenin.
J. Biol. Chem.
271:
1520-1526
-catenin during axis formation
in Xenopus.
J. Cell Biol.
132:
1105-1114
-catenin: evidence for intracellular signaling.
J. Cell Biol.
128:
959-968
-catenin has Wnt-like activity and
mimics the Nieuwkoop signaling center in Xenopus dorsal-ventral patterning.
Dev. Biol.
172:
115-125
[Medline].
-catenin binding to the cell adhesion
protein cadherin.
J. Cell Biol.
124:
729-741
-catenin and the cytoskeleton.
J. Cell Biol.
127:
2061-2069
-catenin.
J. Cell Biol.
123:
477-484
-catenin in vivo and promotes the hyperphosphorylation of the APC tumor suppressor protein.
Mol. Cell. Biol.
16:
4088-4094
[Abstract].
-catenin homologue, reveals both separate and overlapping regions of the protein required for cell adhesion and for wingless signaling.
J.
Cell Biol.
134:
1283-1300
to the APC-
-catenin complex and regulation of complex
assembly.
Science (Wash. DC).
272:
1023-1026
[Abstract].
-catenin, einem zytoplasmatischen Ankerprotein des Zelladhäsionsmoleküls Uvomorulin. Diplomarbeit, Fakultät für Biologie der Alberts-Ludwigs-Universität Freiburg.
-catenin
is regulated in Xenopus embryos by glycogen synthase kinase 3.
Genes & Dev.
10:
1443-1454
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|