JCB logo
Accuri Cytometers
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 970K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barth, A. I.M.
Right arrow Articles by Nelson, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barth, A. I.M.
Right arrow Articles by Nelson, W. J.
Right arrowPubmed/NCBI databases
*Substance via MeSH
*Genetics Home Reference
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
J. Cell Biol.
© The Rockefeller University Press
0021-9525/97/02/693/14 $2.00
Volume 136, Number 3, February 10, 1997 693-706

NH2-terminal Deletion of beta -Catenin Results in Stable Colocalization of Mutant beta -Catenin with Adenomatous Polyposis Coli Protein and Altered MDCK Cell Adhesion

Angela I.M. Barth,* Anne L. Pollack,Dagger Yoram Altschuler,Dagger Keith E. Mostov,Dagger and W. James Nelson*

* Department of Molecular and Cellular Physiology, Stanford University School of Medicine, Stanford, California 94305-5426; and Dagger  Department of Anatomy, Department of Biochemistry and Cardiovascular Research Institute, University of California at San Francisco, San Francisco, California 94143-0452

Abstract
Materials and Methods
Results
Discussion
Footnotes
Acknowledgements
Abbreviations used in this paper
References


Abstract

beta -Catenin is essential for the function of cadherins, a family of Ca2+-dependent cell-cell adhesion molecules, by linking them to alpha -catenin and the actin cytoskeleton. beta -Catenin also binds to adenomatous polyposis coli (APC) protein, a cytosolic protein that is the product of a tumor suppressor gene mutated in colorectal adenomas. We have expressed mutant beta -catenins in MDCK epithelial cells to gain insights into the regulation of beta -catenin distribution between cadherin and APC protein complexes and the functions of these complexes. Full-length beta -catenin, beta -catenin mutant proteins with NH2-terminal deletions before (Delta N90) or after (Delta N131, Delta N151) the alpha -catenin binding site, or a mutant beta -catenin with a COOH-terminal deletion (Delta C) were expressed in MDCK cells under the control of the tetracycline-repressible transactivator. All beta -catenin mutant proteins form complexes and colocalize with E-cadherin at cell-cell contacts; Delta N90, but neither Delta N131 nor Delta N151, bind alpha -catenin. However, beta -catenin mutant proteins containing NH2-terminal deletions also colocalize prominently with APC protein in clusters at the tips of plasma membrane protrusions; in contrast, full-length and COOH-terminal- deleted beta -catenin poorly colocalize with APC protein. NH2-terminal deletions result in increased stability of beta -catenin bound to APC protein and E-cadherin, compared with full-length beta -catenin. At low density, MDCK cells expressing NH2-terminal-deleted beta -catenin mutants are dispersed, more fibroblastic in morphology, and less efficient in forming colonies than parental MDCK cells. These results show that the NH2 terminus, but not the COOH terminus of beta -catenin, regulates the dynamics of beta -catenin binding to APC protein and E-cadherin. Changes in beta -catenin binding to cadherin or APC protein, and the ensuing effects on cell morphology and adhesion, are independent of beta -catenin binding to alpha -catenin. These results demonstrate that regulation of beta -catenin binding to E-cadherin and APC protein is important in controlling epithelial cell adhesion.


beta -Catenin is a ubiquitous protein in multicellular organisms and was originally identified through its association with the cytoplasmic domain of cadherins, a family of Ca2+-dependent cell adhesion proteins (McCrea and Gumbiner, 1991; McCrea et al., 1991; Nagafuchi and Takeichi, 1989; Ozawa et al., 1989). Cadherin-mediated intercellular adhesion initiates structural and functional changes in cells and is important for maintaining tissue integrity during embryonic development and in adult organisms (Nelson et al., 1992; Takeichi, 1990, 1991). These functions of cadherin require intracellular attachment of cadherin to the actin cytoskeleton that is dependent on binding of cadherin to catenins (Hirano et al., 1987; Nagafuchi and Takeichi, 1988; Ozawa et al., 1990); beta -catenin mediates the linkage of cadherins to alpha -catenin, which in turn interacts with the actin cytoskeleton (Aberle et al., 1994; Hülsken et al., 1994; Jou et al., 1995; Rimm et al., 1995).

Coordination of intercellular adhesion and cell migration is important during embryonic development. For example, during gastrulation, neurulation, and organogenesis, sheets of cells move past neighboring cells without losing cell-cell contact (Gumbiner, 1992). Significantly, embryonic development of mice lacking beta -catenin is disrupted at gastrulation (Haegel et al., 1995). These embryos form a trophectoderm and develop through preimplantation stages presumably because of the contribution of maternal beta -catenin or replacement of beta -catenin in adherens junctions by its homologue plakoglobin. However, beta -catenin-deficient embryos have severe defects in cell adhesion at gastrulation (Haegel et al., 1995). It is also noteworthy that human cancer cell lines expressing a mutated form of beta -catenin, which binds E-cadherin but not alpha -catenin, are defective in E-cadherin-mediated adhesion (Oyama et al., 1994). The importance of beta -catenin in embryogenesis is also revealed in studies in Drosophila. A homologue of beta -catenin in Drosophila, armadillo, was originally identified through its role in transduction of the wingless/Wnt cell-cell signal that mediates cell fate determination. Drosophila embryos that are zygotically null for armadillo develop with severe segment polarity defects (Noordermeer et al., 1994; Peifer et al., 1991; Peifer and Wieschaus, 1990; Siegfried et al., 1994). Similar to the requirement of beta -catenin in vertebrate embryogenesis, armadillo is required for adherens junction assembly in Drosophila embryogenesis. A combination of maternal and zygotic nulls of armadillo disrupts formation of an organized epithelium early in Drosophila embryogenesis (Cox et al., 1996; Peifer et al., 1993).

In addition to binding to cadherin, beta -catenin has also been shown recently to bind to the product of the adenomatous polyposis coli (APC)1 tumor suppressor gene. The APC/beta -catenin complex contains alpha -catenin but not cadherin (Rubinfeld et al., 1993; Su et al., 1993). APC protein and E-cadherin compete for binding to beta -catenin in transient expression assays (Hülsken et al., 1994). APC protein is a 310-kD cytoplasmic protein that is mutated in patients with the inherited colon cancer syndrome familial adenomatous polyposis. Mutations in APC protein also represent an early event in a high percentage of sporadic colon cancers (Groden et al., 1991; Kinzler et al., 1991; Polakis, 1995). The cellular function(s) of APC protein are not known. In addition to binding catenins, APC protein also binds to microtubules in vitro and in vivo (Munemitsu et al., 1994; Polakis, 1995; Smith et al., 1994). In epithelial cells, APC protein localizes to the ends of microtubule bundles in actively migrating plasma membrane protrusions and to the tips of membranes involved in early cell- cell contact formation (Näthke et al., 1996). The subcellular localization of APC protein indicates that it is involved in cell migration.

To examine domains in beta -catenin that are important for regulating its subcellular distribution and function(s) in cadherin and APC protein complexes, we expressed NH2- and COOH-terminal-deleted beta -catenin in MDCK cells. Our results demonstrate that deletion of the COOH-terminal domain does not affect the subcellular distribution of beta -catenin. Deletion of the NH2-terminal domain stabilizes beta -catenin in APC protein and E-cadherin complexes. NH2-terminal-deleted beta -catenin prominently colocalizes with APC protein in clusters at the tips of plasma membrane protrusions. MDCK cells expressing NH2-terminal- deleted beta -catenin are inhibited in early cell-cell contact formation and compaction when plated at low cell densities. Both colocalization with APC protein and inhibition of adhesion by NH2-terminal-deleted beta -catenin mutant proteins are independent of beta -catenin binding to alpha -catenin.


Materials and Methods

Antibodies

A rabbit polyclonal antiserum beta -cat.N was generated in rabbits against the NH2-terminal 14 amino acids of beta -catenin. Rabbit polyclonal antibodies raised against the COOH-terminal 14 amino acids of alpha -catenin and beta -catenin (beta -cat.C) have been described previously (Hinck et al., 1994b). A mAb against the COOH-terminal 212 amino acids of beta -catenin (beta -cat.C) was obtained from Transduction Laboratories (Lexington, KY). A mouse mAb KT3 against a SV-40 large T antigen epitope was kindly provided by Gernot Walter (University of California, San Diego), and has been described previously (MacArthur and Walter, 1984). A polyclonal antibody against the cytoplasmic domain of E-cadherin has been described previously (Marrs et al., 1994). Polyclonal antibodies against APC protein were kindly provided by Paul Polakis (ONYX Pharmaceuticals, Richmond, VA) and Inke Näthke (Stanford University), and have been described previously (Näthke et al., 1996; Rubinfeld et al., 1993). Antisera were affinity purified with antigen for immunofluorescence as indicated.

Plasmid Construction

Mouse beta -catenin cDNA (Butz et al., 1992) in pBluescript SKII+ (Stratagene, La Jolla, CA) was used to generate deletion mutants (see Fig. 1). The deduced amino acid sequence is identical to a partial dog beta -catenin sequence (amino acids 51-311) and identical to the human beta -catenin sequence except for one amino acid difference at position 706 (Hülsken et al., 1994). To detect beta -catenin and beta -catenin mutants immunologically, an oligonucleotide encoding the amino acid sequence KPPTPPPEPET from SV-40 large T antigen (KT3 epitope tag) was added to the 3' termini of all cDNAs (MacArthur and Walter, 1984). Nucleotide sequences of PCR- derived sequences in constructs shown below were confirmed by direct sequencing (PAN Facility, Beckman Center, Stanford University School of Medicine). The cDNA construct for Delta N131 (see below) was found to contain a PCR-introduced point mutation at nucleotide 553 that led to a conservative amino acid change of Val175 to Leu175.


Fig. 1. Schematic representation of KT3-tagged full-size and mutant beta -catenin proteins. NH2- and COOH-terminal domains and the 13 internal armadillo-like repeats of beta -catenin are indicated. A stretch of unrepeated amino acids between repeat 10 and 11 (empty box) is shown. The binding sites for alpha -catenin, E-cadherin, APC, and the epitopes for rabbit beta -catenin antisera beta -cat.N, beta -cat.C, and mouse mAb KT3 are indicated. The epitope for antiserum beta -cat.N is deleted in Delta N90, Delta N131, and Delta N151, and these mutant proteins are not detected by beta -cat.N. A mouse mAb raised against the 212 COOH-terminal amino acids of beta -catenin was used instead of antiserum beta -cat.C, and both beta -cat.C antibodies do not detect Delta C. The following amino acids are deleted in the mutants: Delta C, 696-781; Delta N90, 1-90; Delta N131, 1-131; Delta N151, 1-151.
[View Larger Version of this Image (31K GIF file)]

Delta N131 was constructed by PCR using oligonucleotides containing suitable restriction sites (5'-SacII/3'-XbaI) for cloning into the pUDH10-3 vector (Gossen and Bujard, 1992). The oligonucleotide defining the start site of the cDNA (5'-CCATCGATTCTAGACCGCGGCCACCATGGCTTTGAAACATGCAGTTGTCAATTTG) contained a Kozak consensus sequence for translation initiation (Kozak, 1989). The oligonucleotide defining the stop site of the cDNA (5'-CCATCGATTCTAGATTAGGTCTCGGGCTCAGGAGGAGGAGTAGGAGGCTTGATATC C A G - GTCAGTATCAAACCAGGC) codes for 13 additional amino acids including the KT3 epitope after the COOH terminus of the mutant protein (indicated in italics) followed by a stop codon; the underlined sequence is derived from beta -catenin. In two cloning steps, the BglII and, subsequently, Eco47III/SpeI fragments of the original cDNA were exchanged for the respective PCR-derived fragments of Delta N131 in pUDH10-3. Delta N131 was used to construct a pBluescript KSII+ vector for addition of the KT3 epitope sequence to the 3' termini of other cDNAs. The Bsp106I/StuI fragment of Delta N131 was cloned into pBluescript KSII+-HA (Elferink et al., 1993). The EcoRV fragment containing the HA tag sequence and the complete Delta N131 sequence except for the KT3 epitope was subsequently removed. This resulted in the vector pBluescript KSII+-KT3 in which the sequence for the KT3 epitope and a stop codon are preceded 5'-upstream by EcoRV/SmaI/BamHI restriction sites to allow the addition of cDNAs in all three reading frames.

Delta NDelta C was constructed by cloning the blunted BglII fragment of the original beta -catenin cDNA into pBluescript KSII+-KT3/SmaI. The resulting EcoRI/XbaI fragment, in which the sequence for the KT3 epitope tag is fused to the sequence of the last repeat in the core region of beta -catenin, was exchanged with the respective EcoRI/XbaI fragment in pUdH10-3/ Delta N131 to obtain pUDH10-3/Delta NDelta C.

Delta C was constructed by cloning the 5' EcoRI fragment with the start codon of the original beta -catenin cDNA into pUDH10-3. The resulting vector contained the sequence encoding the NH2-terminal half of beta -catenin. The 3'-terminal BglII/XbaI fragment of this beta -catenin sequence was replaced with the 3' BglII/XbaI fragment of Delta NDelta C to obtain the expression vector pUDH10-3/Delta C.

A vector expressing full-length KT3-tagged beta -catenin* was constructed by exchanging the SpeI/BamHI fragment encoding the COOH-terminal part of Delta C in pUDH10-3/Delta C against the respective fragment encoding the COOH-terminal part of Delta N131.

Delta N90 was constructed by PCR using the oligonucleotide 5'-CCATCGATTCTAGACCGCGGCCACCATGGCTCAGAGGGTCCGAGCT for the 5' terminus of the cDNA and the same oligonucleotide as that used for the 3' terminus of the cDNA of Delta N131. The SacII/XbaI PCR fragment was cloned into pUDH10-3. To replace PCR-derived sequences with original cDNA, the SphI/XbaI fragment of Delta N90 was exchanged with the SphI/XbaI fragment of full-length KT3-tagged beta -catenin.

Delta N151 was constructed by PCR using the oligonucleotide 5'-CCATCGATTCTAGACCGCGGCCACCATGGCAATTCCTGAGCTGACA for the 5' terminus of the cDNA and the same oligonucleotide as that used for the 3' terminus of the cDNA of Delta N131. The SacII/XbaI PCR fragment was cloned into pUDH10-3. To replace PCR-derived sequences with original cDNA, the Eco47III/XbaI fragment of Delta N151 was exchanged with the Eco47III/XbaI fragment of full-length KT3-tagged beta -catenin. PCRderived sequences were confirmed by sequencing.

Cell Transfection

MDCK cells (type II) were transfected with pIgR cloned into the pCB6, which uses the cytomegalovirus promoter to drive pIgR expression and a G418 drug resistance marker. A well-polarized clone expressing a uniformly high level of pIgR was selected and designated B3. The B3 cells were then cotransfected with plasmid pUHD15-1 (Gossen and Bujard, 1992) coding for the tTa transactivator and pSV2-puro in a ratio of 10:1, respectively. Transfection was done by the calcium phosphate precipitation method, and cells were plated onto 150-mm dishes. Drug-resistant clones were selected in the presence of 5 µg/ml puromycin (Sigma Chemical Co., St. Louis, MO). 180 clones were picked using cloning rings and then expanded. Each clone was transiently transfected with plasmid pUHC13-3 consisting of the luciferase gene under control of the tetracycline-regulated promoter in the presence and absence of 1 µg/ml tetracycline, using the lipofectamine reagent (GIBCO BRL, Gaithersburg, MD). After 48 h, cells were homogenized and tested for luciferase activity. Clone T23 showed 180-fold more luciferase activity in the absence of tetracycline as compared with in its presence. This clone was chosen for further studies. T23 cells were cotransfected with vectors for expression of the tetracycline-repressible transactivator tTA (Gossen and Bujard, 1992) and a plasmid containing a gene for resistance to puromycin. Parental MDCK clone T23 was cotransfected with the respective expression vectors for beta -catenin mutant proteins (see above; Delta N90, Delta N131, Delta N151, Delta NDelta C, Delta C, beta -catenin*) and plasmid pHMR272 carrying a gene for resistance to hygromycin (Gossen and Bujard, 1992) using the lipofectamine protocol from GIBCO BRL. Clones were selected in 300 µg/ml hygromycin (Boehringer Mannheim Biochemicals, Indianapolis, IN). Low passage aliquots of drug-resistant MDCK clones were frozen and stored in liquid nitrogen; clones were passaged in DME medium containing 10% FCS (Gemini, Calabasas, CA) and 300 µg/ml hygromycin without doxycycline (Dox) for a maximum of 4-6 wk. In some experiments, expression of beta -catenin mutant proteins was repressed by addition of 1 µg/ml tetracycline (Tet) or 20 ng/ml Dox (Sigma Chemical Co.) to the culture medium. Cells were cultured 1-3 d without hygromycin before an experiment.

Immunoprecipitation and Immunoblotting

MDCK cells were maintained in DME medium supplemented with 10% FCS and passaged by mild trypsinization. For preparation of SDS lysates, MDCK cells were cultured for 4 d with or without 20 ng/ml Dox; cells were extracted in hot SDS buffer containing 1% SDS, 10 mM Tris-HCl, pH 7.5, and 2 mM EDTA, and then scraped from the petri dish with a rubber policeman. Samples were boiled for 15 min, and insoluble material was removed by centrifugation at 12,000 g for 15 min. Protein concentrations were determined using the bicinchoninic acid protein assay reagent kit (BCA; Pierce Chemical Co., Rockford, Il). Lysates were boiled for 5 min after adding an equal volume of SDS reducing sample buffer (Laemmli, 1970).

For preparation of Triton X-100 lysates, MDCK cells were cultured with or without 20 ng/ml Dox for 4 d or as indicated, and then extracted for 15 min at 4°C with 1% Triton X-100, 20 mM Tris-HCl, pH 8, 140 mM NaCl, 1.5 mM MgCl2, 1 mM EGTA, 10% glycerol (vol/vol), 10 µg/ml DNase and RNase, 1 mM sodium vanadate, 50 mM NaF, and a protease inhibitor mix (1 mM Pefabloc, 1 mM benzamidine, and 10 µg/ml each of aprotinin, pepstatin, and leupeptin); DNase, RNase, Pefabloc, pepstatin, and leupeptin were purchased from Boehringer Mannheim Biochemicals, and all other reagents were from Sigma Chemical Co. After extraction, cells were scraped from the petri dish with a rubber policeman. Insoluble material was removed by centrifugation at 12,000 g for 30 min. Protein concentrations were determined using the BCA protein assay reagent kit (Pierce Chemical Co.). Portions of lysates were boiled for 5 min after adding an equal volume of SDS reducing sample buffer. Other portions of lysates were precleared by incubation with 5 µl of nonimmune rabbit serum and 100 µl Pansorbin (Calbiochem-Novabiochem Corp., La Jolla, CA) for 1 h at 4°C. After removing the Pansorbin by centrifugation, lysates were incubated for 2-3 h at 4°C with either 30 µl protein A-Sepharose (Pharmacia Fine Chemicals, Piscataway, NJ) coupled to E-cadherin or beta -catenin antibody, or 60 µl protein A-Sepharose coupled to alpha -catenin or APC protein antibody. Immunoprecipitates were washed once with wash buffer (0.5% NP-40, 20 mM Tris-HCl, pH 8, 150 mM NaCl), once with wash buffer containing 1 M LiCl, and once with wash buffer. Immunoprecipitates were boiled in 30 or 60 µl SDS reducing sample buffer.

Lysates and immunoprecipitates were separated by SDS-PAGE in 7.5% polyacrylamide gels (Laemmli, 1970). Gels were transferred to nitrocellulose membranes with a pore size of 0.45 µm (Schleicher & Schuell Inc., Keene, NH) in a buffer containing 25 mM Tris-HCl, pH 7.4, 50 mM glycine, and 20% methanol. Membranes were stained with Ponceau S to check for protein transfer, and then destained in 20 mM Tris-HCl, pH 7.4, 0.5% Tween-20, 140 mM NaCl (TTS). Membranes were blocked overnight at 4°C in TTS with 5% powdered milk. Primary antibodies were incubated with membranes for 2 h at room temperature (RT) in TTS with 5% powdered milk. Membranes were washed four times for 10 min each with TTS, and then incubated with the appropriate secondary antibodies coupled to HRP (Amersham Corp., Arlington Heights, IL) in TTS, 5% powdered milk, and 5% serum from the animal species that was used to generate the secondary antibody. Membranes were washed for at least 2 h with six changes of TTS, and antibody reactivity was visualized with enhanced chemiluminescence reagent (Amersham Corp.). Bands on ECLexposed X-OMAT AR film (Eastman Kodak Co., Rochester, NY) were analyzed with a GS 300 transmittance/reflectance scanning densitometer (Hoefer Scientific Instruments, San Francisco, CA), or scanned with a ScanJet IIc (Hewlett-Packard Co., Palo Alto, CA) and analyzed with NIH Image. All reagents were from Sigma Chemical Co. unless indicated otherwise.

Immunofluorescence and Phase-Contrast Microscopy

For immunofluorescence, MDCK cells were cultured and plated on 35mm tissue-culture dishes with collagen-coated coverslips in DME medium supplemented with 10% FCS with or without Tet as indicated. For immunofluorescence of low density cultures, 1 × 105 cells were plated and fixed after 24 h. Part of a culture of clone Delta N131-D was preincubated for 24 h in 1 µg/ml Tet before plating onto coverslips and was kept in medium containing Tet until fixation. Cells were washed once in Dulbecco's PBS (0.9 mM CaCl2, 2.7 mM KCl, 1.5 mM KH2PO4, 0.5 mM MgCl2, 137 mM NaCl, and 8.1 mM NaHPO4) and fixed for 20 at RT in 2% formaldehyde in Dulbecco's PBS. Cells were washed four times for 5 min each in Dulbecco's PBS with 50 mM NH4Cl, blocked, and permeabilized for 20 min in Dulbecco's PBS with 50 mM NH4Cl, 1% BSA, 2% goat serum, and 0.05% Saponin (blocking buffer). Cells were incubated 1 h at RT with primary antibody in blocking buffer and washed four times for 5 min each in Dulbecco's PBS with 50 mM NH4Cl. Cells were incubated 1 h at RT with fluorescein- or rhodamine-conjugated goat secondary antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA) in blocking buffer, and then washed four times for 5 min each in Dulbecco's PBS with 50 mM NH4Cl. Antibodies were used in the following dilutions: affinity-purified E-cadherin antiserum 1:50; affinity-purified alpha -catenin antiserum 1:50; mouse mAb KT3 1:50; beta -cat.N antiserum 1:200; and secondary antibodies 1:200. For KT3/APC protein double immunofluorescence, 5 × 105 cells were plated onto collagen-coated coverslips in 35-mm tissue-culture dishes and fixed after 48 h. Cells were washed once in Dulbecco's PBS, fixed for 5 min at -20°C in precooled methanol, washed four times in Dulbecco's PBS, and blocked in Dulbecco's PBS with 1% BSA and 2% goat serum (blocking buffer). Cells were incubated for 1 h at RT with primary antibody in blocking buffer, washed four times for 5 min each in Dulbecco's PBS, incubated 1 h at RT with fluorescein- or rhodamine-conjugated goat secondary antibodies (Jackson ImmunoResearch Laboratories) in blocking buffer, and washed four times for 5 min each in Dulbecco's PBS. Antibodies were used in the following dilutions: mouse mAb KT3 1:50; and APC protein antiserum 1:200. Cells were mounted in a mixture of 16.7% Mowiol (Calbiochem-Novabiochem Corp.), 33% glycerol, and 0.1% phenylenediamine in Dulbecco's PBS without CaCl2 and MgCl2 and viewed with an Axiophot inverted fluorescence microscope (Carl Zeiss Inc., Thornwood, NY) using a ×63 oil immersion objective. For phase-contrast microscopy of low density cultures, each clone was split and cultured for 3 d with or without 20 ng/ml Dox. 5 × 105 cells were plated onto 100-mm tissue-culture dishes in medium with or without 20 ng/ml Dox, and photomicrographs of the cultures were taken 24 and 48 h after plating with an Axiovert 10 phase-contrast microscope (Carl Zeiss Inc.).


Results

Expression of beta -Catenin Mutant Proteins in MDCK Cells

Mutant beta -catenin proteins lacking NH2-terminal 90 (Delta N90), 131 (Delta N131), 151 (Delta N151) amino acids, or COOH-terminal 86 amino acids (Delta C), and full-length beta -catenin (beta -catenin*) were expressed in MDCK cells (Fig. 1). The sequence for the SV-40 large T antigen epitope recognized by the mAb KT3 (MacArthur and Walter, 1984) was added to the 3' termini of all cDNA constructs to distinguish protein products from endogenous beta -catenin. All constructs were expressed under the control of the Tet-repressible transactivator; in the presence of either Tet or Dox, expression of exogenous protein is completely repressed (Gossen and Bujard, 1992).

MDCK clones cultured for 4 d without or with doxycycline (-/+ Dox) were analyzed for expression of mutant beta -catenins (Fig. 2). Mutant beta -catenins (Fig. 2, a-c; marked with stars in beta -cat.C, beta -cat.N, and KT3 blots) were detected in protein extracts from clones cultured without Dox, but not in extracts from clones cultured with Dox. 15-20 clones were analyzed for every construct. Mutant beta -catenin levels in clones expressing Delta N90, Delta N131, or Delta N151 beta -catenin were on average higher than that in clones expressing beta -catenin* and Delta C beta -catenin. However, the level of Delta N151 in clone Delta N151-D was similar to beta -catenin* in clone beta -catenin*-10 (Fig. 2 c; KT3 blot). In the clones shown in Fig. 2, the ratios of Delta N90, Delta N131, Delta N151, or Delta C beta -catenin to MDCK endogenous beta -catenin were 5:1, 1:1, 0.5:1, and 1:1, respectively (Fig. 2 a, lanes 7, 9, and 11; Fig. 2 b, lane 5).


Fig. 2. Dox-repressible expression of beta -catenin mutant proteins in MDCK cells. MDCK clones were cultured for 4 d without or with Dox (-/+ Dox) and extracted with 1% SDS. 15-µg protein lysates were subjected to SDS-PAGE and immunoblotted with different antibodies (see Fig. 1). beta -catenin mutant proteins (stars in a-c) were expressed only in cultures without Dox; endogenous beta -catenin was expressed in all cultures (a and b). Expression levels of exogenous full-length beta -catenin*, Delta N90, Delta N131, and Delta N151 were compared with that of endogenous beta -catenin by immunoblotting with mAb beta -cat.C (a). Exogenous beta -catenin* and Delta C were compared with endogenous beta -catenin by immunoblotting with beta -cat.N (b). The expression levels of mutant beta -catenin proteins in different clones were compared by immunoblotting with the tag antibody KT3 (c). The beta -cat.C blot was reblotted with E-cadherin antiserum (d). The KT3 blot was reblotted with alpha -catenin antiserum (e). Molecular mass standards are indicated in kD.
[View Larger Version of this Image (65K GIF file)]

Expression of E-cadherin leads to an increase in the cellular levels of catenins (Herrenknecht et al., 1991; Weißig, 1993). Therefore, we analyzed whether expression of beta -catenin mutant proteins affected levels of endogenous beta -catenin, E-cadherin, or alpha -catenin by comparing their amounts in lysates from clones cultured without or with Dox. Expression of Delta N90, Delta N131, or Delta N151 did not significantly affect the level of endogenous beta -catenin (Fig. 2, a and b, compare lanes 7 to 8, 9 to 10, and 11 to 12, respectively). Expression of Delta C beta -catenin resulted in a small but reproducible decrease in amount of endogenous beta -catenin (Fig. 2, a and b, lanes 5 and 6). Although full-length exogenous beta -catenin* and endogenous beta -catenin were not always well separated by SDS-PAGE because of similarity in their electrophoretic mobilities, a decrease of endogenous beta -catenin in response to the expression of beta -catenin* was detectable in some of these clones (Fig. 2 a, lanes 3 and 4).

The amount of E-cadherin was slightly higher in clones expressing Delta N90 beta -catenin (Delta N90-A) and Delta N131 beta -catenin (Delta N131-D) compared with levels in beta -catenin-10* and Delta C clones (Fig. 2 d). Differences in E-cadherin levels may be the result of clonal variation since the amount of E-cadherin in a particular clone was not significantly affected after repression of mutant beta -catenin expression by addition of Dox (Fig. 2 d; compare lanes 7 to 8, 9 to 10, and 11 to 12, respectively). Expression of mutant beta -catenins did not have a significant effect on amounts of alpha -catenin in all clones except Delta N131-D in which the alpha -catenin level was slightly decreased when cells were cultured without Dox (Fig. 2 e, lanes 9 and 10).

Mutant beta -Catenin Proteins Compete with Endogenous beta -Catenin for Binding to E-Cadherin and alpha -Catenin

Binding of beta -catenin mutants to E-cadherin and alpha -catenin was analyzed by coimmunoprecipitation of protein complexes (Fig. 3). The binding site for E-cadherin in beta -catenin is located within the armadillo repeat domain of beta -catenin (Aberle et al., 1994; Hülsken et al., 1994) and was retained in all mutant proteins. Accordingly, all beta -catenin mutant proteins were coimmunoprecipitated by E-cadherin antibody (Fig. 3 a; KT3 blot). Binding of Delta N90 and Delta N131 beta -catenin to E-cadherin resulted in a reduction in amount of endogenous beta -catenin complexed with E-cadherin compared with the amount of endogenous beta -catenin in similar complexes isolated from the same clones cultured with Dox (Fig. 3 b; beta -cat.C blot; compare lanes 5 and 6, and 7 and 8, respectively). The binding site for alpha -catenin is located between amino acids 120 and 151 in beta -catenin (Aberle et al., 1994, 1996) and was incomplete or missing in Delta N131 and Delta N151 beta -catenin. Accordingly, Delta N131 and Delta N151 beta -catenin were not coimmunoprecipitated by alpha -catenin antibody (Fig. 3 c; KT3 blot). Binding of Delta N90 and Delta C beta -catenin to alpha -catenin resulted in a reduction in amount of endogenous beta -catenin bound to alpha -catenin compared with endogenous beta -catenin in complexes with alpha -catenin that were isolated from the same clones cultured in the presence of Dox (Fig. 3 d; beta -cat.C blot; compare lanes 5 and 6, and 11 and 12, respectively). These results confirm that Delta N90 and Delta C beta -catenin retained both E-cadherin and alpha -catenin binding sites, and that Delta N131 and Delta N151 beta -catenin retained the E-cadherin, but not alpha -catenin, binding site; all mutant beta -catenin proteins competed with endogenous beta -catenin for these binding partners.


Fig. 3. beta -catenin mutant proteins compete with endogenous beta -catenin for binding to E-cadherin and alpha -catenin. MDCK clones were cultured 4 d without or with Dox (-/+) and extracted with 1% Triton X-100 lysis buffer. Protein lysates were split: 400-µg lysates were immunoprecipitated with E-cadherin antiserum to analyze binding of mutant beta -catenin proteins to E-cadherin (a and b). 400 µg protein lysates were immunoprecipitated with alpha -catenin antiserum to analyze binding of mutant beta -catenin proteins to alpha -catenin (c and d). Equivalent fractions of the immunoprecipitates were subjected to SDS-PAGE and blotted with mAbs KT3 (a and c) or beta -cat.C (b and d). beta -catenin mutant proteins are indicated (stars).
[View Larger Version of this Image (58K GIF file)]

NH2-terminal-deleted Mutant Proteins of beta -Catenin Are Enriched in APC Protein Complexes

Binding of mutant beta -catenins to APC protein was also analyzed by coimmunoprecipitation. All mutant beta -catenins were coimmunoprecipitated by APC protein antibody (Fig. 4). However, Delta N90, Delta N131, and Delta N151 beta -catenin were significantly enriched in APC protein immunoprecipitates compared with endogenous beta -catenin, Delta C, or exogenous beta -catenin*. Three times more Delta N90, Delta N131, or Delta N151 was coimmunoprecipitated with APC protein than endogenous beta -catenin (Fig. 4 c). Note that total amounts of mutant beta -catenin in lysates used for immunoprecipitation were either similar to, or less than that of, endogenous beta -catenin (Fig. 4 a); the ratios of Delta N90, Delta N131, or Delta N151 beta -catenin to endogenous beta -catenin in Triton X-100 lysates were 1.6:1, 1.3:1, and 0.1:1, respectively. Very little Delta C beta -catenin was detected in APC protein complexes, although as much Delta C as Delta N151 beta -catenin was present in the Triton X-100 lysates of each clone (compare Fig. 4 b and d; KT3 blots).



Fig. 4. Delta N90, Delta N131, and Delta N151 are enriched in APC protein complexes. Aliquots of the same Triton X-100 lysates as described in Fig. 3 were either subjected to SDS-PAGE or used for immunoprecipitation with APC antiserum (a-d). 9-µg protein lysates were subjected to SDS-PAGE and immunoblotted with the indicated mAbs to compare the ratio of beta -catenin mutant proteins to endogenous beta -catenin (a), and to each other (b). 1,500-µg protein lysates were immunoprecipitated with APC antiserum. Equivalent fractions of the immunoprecipitates were subjected to SDS-PAGE and blotted with the indicated mAbs to analyze binding of mutant beta -catenin proteins to APC (c-d). beta -catenin mutant proteins are indicated (stars). A longer exposure of the blot in (d) is shown for lanes 7 and 8. Triton X-100 lysates were prepared from clones beta -catenin*-7 and Delta N131-7, and aliquots of the lysates were immunoprecipitated with antiserum beta -cat.C or APC antiserum (e). Immunoprecipitates were subjected to SDSPAGE and blotted with antiserum beta -cat.C to analyze the ratio of exogenous beta -catenin* and Delta N131 to endogenous beta -catenin. beta -catenin mutant proteins are indicated (stars).
[View Larger Versions of these Images (44 + 41K GIF file)]

These data indicate that, compared with endogenous beta -catenin, NH2-terminal-deleted beta -catenins bind preferentially to APC protein. In addition, the amount of Delta N151 beta -catenin that is complexed with APC protein is very similar to that of Delta N90 and Delta N131 beta -catenin, even though there is much less Delta N151 beta -catenin in clone Delta N151-D. Therefore, we suspect that binding of NH2-terminal-deleted beta -catenin to APC protein approaches a maximum.

To further explore the degree of enrichment of mutant beta -catenin in APC protein complexes, amounts of beta -catenin* and Delta N131 beta -catenin bound to APC protein were compared in two different clones (beta -cat.*-7 and Delta N131-7; Fig. 4 e). Portions of Triton X-100 lysates of these clones were used to immunoprecipitate both full-length and deleted beta -catenin with beta -cat.C antiserum, or to coimmunoprecipitate APC protein complexes. In beta -cat.C immunoprecipitates, the ratios of endogenous beta -catenin to beta -catenin* in the beta -catenin*-7 clone, and those of endogenous beta -catenin to Delta N131 in the Delta N131-7 clone, were ~1:1. In APC protein immunoprecipitates, the ratio of endogenous beta -catenin to beta -catenin* was also ~1:1, but, in contrast, the ratio of endogenous beta -catenin to Delta N131 beta -catenin was ~1:3. Delta N131 beta -catenin was considerably more abundant in APC protein immunoprecipitates than either endogenous beta -catenin or exogenous full-length beta -catenin* (Fig. 4 e).

NH2-terminal Deletions Result in Increased beta -Catenin Stability in APC Protein and E-Cadherin Complexes

Enrichment of Delta N90, Delta N131,and Delta N151 beta -catenins bound to APC protein could be caused by increased stability of these beta -catenins in the complex. To test this hypothesis, expression of beta -catenin mutant proteins was repressed by addition of Dox to cultures for 0, 6, 12,or 18 h. Amounts of mutant beta -catenin remaining in Triton X-100 lysates of these cells, and in E-cadherin and APC protein complexes isolated from those lysates, were analyzed by immunoprecipitation and/or Western blotting (Fig. 5).


Fig. 5. Increased stability of Delta N90, Delta N131, and Delta N151 in the E-cadherin- and APC protein-bound pools. MDCK clones were cultured 0, 6, 12, or 18 h with Dox and extracted with 1% Triton X-100 lysis buffer. Protein lysates were split: 1,500-µg protein lysates were immunoprecipitated with APC antiserum (first column), and 500-µg lysates were immunoprecipitated with E-cadherin antiserum (second column). Equivalent fractions of the immunoprecipitates and 50-µg (beta -cat.*-10,-7, Delta C-9) or 25-µg (Delta N90-A, Delta N131-D, Delta N151-D) protein lysates (third column) were subjected to SDS-PAGE and immunoblotted with mAb KT3. For beta -catenin*-10, -7, and Delta C-9 blots, three times more of the APC immunoprecipitations were used than for the Delta N90-A, Delta N131-D, and Delta N151-D blots, and the blots were exposed longer.
[View Larger Version of this Image (56K GIF file)]

A significant increase in the relative stabilities of NH2terminal-deleted beta -catenins compared with full-length beta -catenin* or Delta C beta -catenin was detected in E-cadherin and APC protein complexes from lysates. This difference in stability was most pronounced in the APC protein- bound pools. Very little or no full-length beta -catenin* or Delta C beta -catenin were detected in the APC protein complex after only 6 h of treatment with Dox. In contrast, there was little or no decrease in amounts of Delta N90, Delta N131, or Delta N151 beta -catenin in the APC protein complex after 18 h of treatment with Dox. In the E-cadherin-bound pools of lysates, 10- 12% of the original amount of full-length beta -catenin* and Delta C beta -catenin was detected after 12 h of treatment with Dox. In contrast, amounts of Delta N90, Delta N131, or Delta N151 beta -catenin bound to E-cadherin were not or little reduced after 18 h of treatment with Dox.

In the total Triton X-100 lysates, the amounts of all mutant beta -catenin proteins were reduced after 12 to 18 h of treatment with Dox. The percentage of remaining mutant protein after 12 h of treatment with Dox is 17% and 18% of beta -catenin* in clones beta -catenin*-7 and beta -catenin*-10, respectively; 18% of Delta C beta -catenin; 44% of Delta N90 beta -catenin; 32% of Delta N131 beta -catenin; and 26% of Delta N151 beta -catenin. The close similarity in the decrease in amounts of beta -catenin* in two independent clones indicates that the rate and efficiency of Dox repression of gene expression were similar in different MDCK clones. Assuming that this is also the case in other clones, the half-life of Delta C is similar to that of full-length beta -catenin*, whereas Delta N90, Delta N131, and Delta N151 beta -catenin are slightly more stable than full-length beta -catenin*. The mutant beta -catenin proteins in the total TX100 lysates represent the sum of the E-cadherin- and APC-bound, and unbound pools. Although Delta N90, Delta N131, or Delta N151 beta -catenin was very stable in E-cadherin and APC protein complexes, their overall stability in the lysates was not very different from that of full-length beta -catenin* and Delta C beta -catenin. This indicates that pools of Delta N90, Delta N131, and Delta N151 beta -catenin that are not bound to either E-cadherin or APC protein turn over at a rate similar to that of full-length beta -catenin* and Delta C beta -catenin.

The high stability of the NH2-terminal-deleted beta -catenins in the APC protein complexes correlated with the enrichment of these mutant proteins in the APC protein complexes compared with endogenous beta -catenin in the same cells (Fig. 4). Surprisingly, we could not detect an enrichment of NH2-terminal-deleted beta -catenins in the E-cadherin pool when compared with endogenous beta -catenin in the same cells (see Fig. 3 c), even though NH2-terminal-deleted beta -catenins were more stable than full-length exogenous beta -catenin* in the E-cadherin complexes of different clones (Fig. 5). We note that most of the E-cadherin in MDCK cells is normally bound to endogenous beta -catenin in a 1:1 molar ratio (Hinck et al., 1994a). In contrast, most of the APC protein appears to be free of endogenous beta -catenin (Näthke et al., 1996). Therefore, NH2-terminal- deleted beta -catenins must compete with endogenous beta -catenin to bind to E-cadherin, but they may be enriched in the APC protein pool by binding unoccupied sites and remaining stabilized in these complexes. This may explain the difference in the ratios of the mutant proteins to endogenous beta -catenin when comparing the E-cadherin- bound or APC-bound pools in the same cultures (Figs. 3 and 4).

NH2-terminal-deleted beta -Catenin Prominently Localizes in Clusters with APC Protein at Tips of Plasma Membrane Protrusions

Our immunoprecipitation studies show that NH2-terminal-deleted beta -catenin proteins form stable complexes with E-cadherin and APC protein. We examined the subcellular distribution of mutant beta -catenins by immunofluorescence microscopy. Mutant beta -catenins were epitope tagged and can be distinguished from endogenous beta -catenin with the monoclonal anti-tag antibody KT3. We examined two types of cell cultures: low density cultures in which small groups of cells had initiated cell-cell contacts (Fig. 6), and high density cultures in which mature cell-cell contacts had been established (Fig. 7).


Fig. 6. Delta N151, Delta N131, and Delta N90 localize to clusters near the plasma membrane in extending membranes of MDCK cells. MDCK clones were double stained with mAb KT3 against the epitope tag in beta -catenin mutant proteins (a-e) and antiserum against E-cadherin (a'), antiserum beta -cat.N against endogenous beta -catenin (b'), and antiserum against alpha -catenin (c'-e'). Areas with Delta N151, Delta N131, and Delta N90 clusters are indicated by arrowheads (a-d). These clusters are not detected with E-cadherin, endogenous beta -catenin, or alpha -catenin antisera (a'-d', arrowheads). Delta N131 expression was repressed in Delta N131-D by 48 h incubation with Tet before fixation (e). (Arrows) Areas of intercellular contact that are stained by antisera to E-cadherin (a'), endogenous beta -catenin (b'), alpha -catenin (c'-e'), and sometimes weakly by mAb KT3 (a-d). Bar, 10 µm.
[View Larger Version of this Image (65K GIF file)]


Fig. 7. Delta N90, Delta N131, and Delta N151 colocalize with APC protein in MDCK cells. MDCK clones were double stained with mAb KT3 against the epitope tag in beta -catenin mutant proteins and antiserum against APC protein. Full-length beta -catenin* and Delta C localize to the lateral membranes of cells and show little overlap with APC protein clusters (top and bottom panel). Delta N90, Delta N131, and Delta N151 localize to lateral membranes of cells and colocalize with APC protein in clusters (middle panels). Bar, 10 µm.
[View Larger Version of this Image (139K GIF file)]

Delta N90, Delta N131, and Delta N151 beta -catenins prominently localized to clusters at the outer boundary of cell-cell contacts and at the tips of plasma membrane protrusions (Fig. 6, a-d, arrowheads). Neither E-cadherin, endogenous beta -catenin, nor alpha -catenin colocalize with the NH2-terminal- deleted beta -catenins in theses clusters (Fig. 6, a'-d', arrowheads). This distinctive subcellular distribution is very similar to that of APC protein in MDCK cells (Näthke et al., 1996). Therefore, we examined colocalization of the mutant beta -catenin proteins with APC protein in these clusters (Fig. 7). Delta N90, Delta N131, and Delta N151 beta -catenins colocalized precisely with APC protein in almost all clusters at the tips of plasma membrane protrusions; incidences of APC protein clusters without Delta N90, Delta N131, or Delta N151 beta -catenins were very rare (Fig. 7, middle panels). However, fulllength beta -catenin* and Delta C beta -catenin localized to intercellular contacts, and there was little overlap in distributions between these proteins and APC protein (Fig. 7, top and bottom panel).

In low density cultures, Delta N90, Delta N131, and Delta N151 beta -catenins were poorly localized at intercellular contacts, compared with strong staining for E-cadherin and alpha -catenin at the same sites (Fig. 6). In these cell-cell contact areas, NH2-terminal-deleted beta -catenin mutant proteins colocalized with E-cadherin, endogenous beta -catenin, and alpha -catenin (Fig. 6, a-d, and a'-d', arrows). Localization of Delta N90, Delta N151, and Delta N131 beta -catenins to intercellular contacts was much more prominent in high density cultures (Fig. 7; KT3 immunofluorescence). The distribution of beta -catenin* and Delta C was identical to that of endogenous beta -catenin (data not shown).

Note that some nuclear staining was detected with the KT3 antibody (see Fig. 6, a-d), but that the staining persisted in the absence of mutant protein expression (see Fig. 6 e), indicating that nuclear staining was not specific to mutant beta -catenin in these cells.

Distinct Differences in Morphologies of Cells Expressing NH2-terminal-deleted beta -Catenin Compared With Cells Expressing beta -Catenin* and Delta C beta -Catenin

We examined the morphology and colony formation of cells expressing different mutant beta -catenins. In low density cultures, the morphology of cells expressing Delta N90, Delta N131, or Delta N151 beta -catenins was distinctly different from that of the same cells treated with Dox (i.e., without mutant beta -catenin expression; Fig. 8), parental MDCK cells, and cells expressing beta -catenin* or Delta C beta -catenin (data not shown). Cells treated with Dox, parental MDCK cells, and cells expressing beta -catenin* or Delta C beta -catenin produced compact cell colonies; note that cells at the edges of colonies rarely extended membrane protrusions onto the surrounding cell-free surface. In addition, we found very few individual cells that were not associated with colonies in these cultures. Neither addition of Dox to the cultures nor addition of the KT3 tag to full-length beta -catenin affected the morphology of either parental MDCK cells (Fig. 8, top panel) or beta -catenin*-expressing cells (data not shown), respectively. In contrast, the surface area of cells expressing Delta N90, Delta N131, or Delta N151 beta -catenins (i.e., in the absence of Dox) was greater than that of control cells, indicating that the former were poorly compacted. Cells loosely associated in colonies also had many membrane extensions projecting onto the surrounding cell-free surface. In addition, many individual cells were not associated directly with colonies and were dispersed throughout the culture; in general, these cells have a more fibroblastic morphology than control cells (Fig. 8). Repression of Delta N90, Delta N131, or Delta N151 beta -catenin expression by treatment with Dox reverted the morphology of cells to compacted colonies typical of parental MDCK cells (Fig. 8, top panels; see also Fig. 6, e and e').


Fig. 8. Effect of Delta N90, Delta N131, and Delta N151 expression on colony formation in low density MDCK cultures. Cultures of MDCK clones were untreated or pretreated 3 d with Dox and plated at low density without (-) or with (+) Dox. Cell morphology was analyzed 24 and 48 h after plating. Expression of Delta N90, Delta N131, and Delta N151 delayed formation of tight round colonies in low density cultures (first and third columns). This effect could be reversed by repression of expression of Delta N90, Delta N131, and Delta N151 with Dox (second and fourth columns). Dox itself had no effect on the morphology of the parental cells (top panel). Bar, 40 µm.
[View Larger Version of this Image (136K GIF file)]

At higher cell densities in which there was less free surface available for cell migration, differences in morphologies of cells expressing Delta N90, Delta N131, or Delta N151 beta -catenins and control cells were less evident. Cells expressing Delta N90, Delta N131, or Delta N151 beta -catenins established compact colonies and, eventually, formed complete monolayers similar to those of control cells (see Fig. 7).


Discussion

beta -Catenin binds independently to E-cadherin and APC protein, and one function of these interactions is to link E-cadherin to the actin cytoskeleton via alpha -catenin (Aberle et al., 1994; Hülsken et al., 1994; Jou et al., 1995; Rimm et al., 1995). In the case of E-cadherin, this hierarchy of protein interactions is important for regulating E-cadherin function in establishing cell-cell adhesion (Ozawa and Kemler, 1992). The role of catenin binding in APC protein function(s) is not known, but it has been suggested that APC protein may regulate cellular beta -catenin levels (Munemitsu et al., 1995; Papkoff et al., 1996). In this study, we examined interactions of beta -catenin mutant proteins with E-cadherin, alpha -catenin, and APC protein, and investigated their subcellular distributions and effects on the morphology of MDCK epithelial cells. Our results provide novel insights into the roles of beta -catenin in regulating E-cadherin and/or APC protein functions: (a) NH2-terminal deletion of beta -catenin results in stabilization of beta -catenin in APC protein complexes; (b) full-length beta -catenin poorly colocalizes with APC protein, but NH2-terminal-deleted beta -catenin strongly colocalizes with APC protein in clusters at the tips of membrane protrusions; (c) expression of NH2-terminal-deleted beta -catenin affects cell morphology and intercellular adhesion; (d) the effects on cell morphology are independent of beta -catenin binding to alpha -catenin; and (e) alterations in beta -catenin binding to APC protein, the subcellular location of mutant beta -catenin/APC protein complexes, and the resulting changes in cell morphology imply that APC protein is involved in cell migration and that beta -catenin binding to APC protein regulates this function.

Regulation of beta -Catenin Distribution between Different Cellular Pools

Epitope-tagged Delta N90, Delta N131, and Delta N151 and Delta C beta -catenin were expressed in MDCK cells using a Dox/Tet-repressible expression system. As an additional control, epitopetagged full-length beta -catenin (beta -catenin*) was expressed in MDCK cells. Expression of beta -catenin mutant proteins had no significant effect on cellular levels of E-cadherin and alpha -catenin. However, a small but reproducible reduction in the amount of endogenous beta -catenin was observed in cells expressing full-length beta -catenin* or Delta C beta -catenin (Fig. 2). All beta -catenin mutant proteins competed with MDCK endogenous beta -catenin for binding to E-cadherin (Figs. 3 and 4). Exogenous full-length beta -catenin*, Delta N90, and Delta C beta -catenin competed with MDCK endogenous beta -catenin for binding to alpha -catenin, whereas Delta N131 and Delta N151 beta -catenin were not associated with alpha -catenin (Fig. 3).

Comparison of the amounts of NH2-terminal-deleted and endogenous beta -catenin coimmunoprecipitated in a complex with APC protein revealed that mutant beta -catenins were specifically enriched. By comparison, endogenous beta -catenin was not enriched in the same coimmunoprecipitates (Fig. 4). The enrichment of mutant beta -catenin in the APC protein complex was independent of binding of mutant beta -catenin to alpha -catenin. Our data suggest that the NH2-terminal domain of beta -catenin is important for regulating its stability in the APC protein complex (Fig. 5). Similar observations have been reported recently by Munemitsu et al. (1996). APC protein stimulates beta -catenin degradation in some cell lines (Munemitsu et al., 1995). Although the mechanism regulating the dynamics of beta -catenin interactions with APC protein remains to be elucidated, phosphorylation of APC protein (Rubinfeld et al., 1996) and/or beta -catenin by glycogen synthase kinase 3beta (GSK3beta ) may be important. GSK3beta associates with the APC protein/beta catenin complex in some cell lines (Rubinfeld et al., 1996). The NH2 terminus of beta -catenin contains a GSK3beta phosphorylation site, and we are currently investigating the role of this site for beta -catenin stability in the APC complex. Interestingly, beta -catenin mutants lacking this site are more stable than wild-type beta -catenin in Xenopus embryos (Yost et al., 1996), indicating that the phosphorylation state of beta -catenin regulates beta -catenin turnover. Our data also show that NH2-terminal-deleted beta -catenin is more stable in E-cadherin complexes than full-length and Delta C beta -catenin (Fig. 5). Regulation of beta -catenin stability in E-cadherin complexes may be determined by mechanism(s) similar to those in the APC protein complexes.

NH2-terminal-deleted beta -Catenin Mutant Proteins Colocalize with APC Protein in Clusters at Tips of Plasma Membrane Protrusions

Recent studies by Näthke et al (1996) demonstrated that APC protein localizes to clusters of puncta at the tip of actively migrating cellular protrusions and at the outer boundaries of newly formed cell-cell contacts. This distribution indicates that one function of APC protein is to regulate specific types of cell migration. Whereas endogenous beta -catenin is seldom detected in the APC protein clusters, Delta N90, Delta N131, and Delta N151 beta -catenin prominently colocalized with APC protein in these clusters (Fig. 7). This colocalization was independent of mutant beta -catenin binding to alpha -catenin, since neither Delta N131 nor Delta N151 beta -catenin bound alpha -catenin. Surprisingly, localization of Delta N90 beta -catenin to APC protein clusters was not accompanied by strong colocalization of alpha -catenin, even though this mutant beta -catenin retained an alpha -catenin binding site and formed complexes with alpha -catenin (Fig. 6, c and c').

Preliminary studies show that localization of Delta N90, Delta N131, and Delta N151 beta -catenin in APC protein clusters is disrupted by nocodazole but not by cytochalasin D (data not shown), suggesting that linkage of the APC protein complex to microtubules, rather than to actin filaments, may be more important for APC protein localization and, perhaps, function (see also Näthke et al., 1996).

Expression of NH2-terminal-deleted beta -Catenin Inhibits Colony Formation in Low Density Cultures

We examined the effects of mutant beta -catenin expression on MDCK cell morphology. Cultures of cells were initiated from single cells that normally migrate, form contacts with other cells, and, by 24 h, establish small colonies. Three general differences in morphology were detected in cells expressing Delta N90, Delta N131, or Delta N151 beta -catenin compared with control cells. At low density, cells were dispersed, more fibroblastic in morphology, and less efficient at forming colonies. At high density, cells formed monolayers similar in morphology to those of controls (data not shown). Differences in morphology of cells expressing mutant beta -catenin compared with control cells may be due to a combination of decreased cell-cell adhesion and either decreased movement resulting in a lower probability of cells contacting each other, or increased migration resulting in dispersion of cells.

Poor colony formation and decreased compaction of cells within colonies may be caused by interference of E-cadherin function by beta -catenin mutants. E-cadherin plays a key role in the initial formation of cell-cell contacts in MDCK cells (Gumbiner et al., 1988; McNeill et al., 1993), and linkage of E-cadherin to the cortical actin cytoskeleton via beta -catenin and alpha -catenin is essential for cell-cell adhesion (Hirano et al., 1987; Nagafuchi and Takeichi, 1988; Ozawa et al., 1990). Delta N131 and Delta N151 beta -catenin may disrupt E-cadherin function because these mutant proteins cannot bind alpha -catenin and, hence, the actin cytoskeleton to E-cadherin. This inhibitory effect may be overcome at higher cell densities because cells are forced into contacts and there is sufficient E-cadherin bound to endogenous beta -catenin to function in cell-cell contact. However, cells expressing Delta N90 beta -catenin, which does bind alpha -catenin, exhibited the same morphology as that of Delta N131 and Delta N151 beta -catenin-expressing cells. This result indicates that expression of NH2-terminal-deleted beta -catenin affects colony formation in low density cultures independently of the binding of beta -catenin to alpha -catenin. Furthermore, this phenotype correlates with the dominant colocalization of all three NH2-terminal-deleted beta -catenin mutant proteins with APC protein in clusters at the ends of membrane protrusions. Previous studies have shown that these APC protein clusters localize to the ends of microtubules, and that this localization is independent of the actin cytoskeleton (Näthke et al., 1996). A role of clusters of APC protein in cell migration and/or early contact formation has been suggested (Näthke et al., 1996). Based upon the results of the present study, we suggest that stable binding of beta -catenin to APC protein may affect a function of APC protein in these clusters in microtubule organization and/or cell migration. Thus, in low density cultures, altered migratory behavior of cells may reduce the time and/or number of intercellular contacts that enable cells to initiate stable cell- cell adhesion, thereby giving rise to the observed defect in colony formation. Furthermore, APC protein may be directly involved in the initiation of stable adhesion between extending membranes of these cells (Näthke et al., 1996). A detailed analysis of the role of the APC/beta -catenin complex underlying this phenotype is currently under investigation.

Role of beta -Catenin in Signaling Pathways and Embryonic Development

NH2-terminal-deleted beta -catenin mutant proteins have been used to study the function of beta -catenin in cell signaling during embryonic development (Fagotto et al., 1996; Funayama et al., 1995). In Drosophila, the beta -catenin homologue armadillo was originally identified through its role in transduction of the wingless/Wnt cell-cell signal that mediates cell fate determination (Noordermeer et al., 1994; Peifer et al., 1991; Peifer and Wieschaus, 1990; Siegfried et al., 1994). In vertebrates, the wingless/Wnt signaling pathway may be involved in the formation of the dorsal-ventral axis during Xenopus embryogenesis, and beta -catenin seems to be a downstream component of this pathway (Cui et al., 1995; Funayama et al., 1995; Heasman et al., 1994; McCrea et al., 1993; Sokol et al., 1991). The cellular mechanisms by which beta -catenin receives or transmits the wingless/Wnt signal are not well understood. There is evidence that beta -catenin has distinct roles in Wingless/Wnt signaling and cell adhesion, and that beta -catenin binding to cadherin antagonizes its signaling function (Cox et al., 1996; Fagotto et al., 1996; Orsulic and Peifer, 1996). In contrast to these results, ectopic Wnt expression in mammalian cell lines leads to stabilization of beta -catenin or its homologue plakoglobin in the cadherin/catenin complex and to increased adhesion (Bradley et al., 1993; Hinck et al., 1994b). Ectopic expression of NH2-terminal-deleted beta -catenin mutant proteins similar to the ones used in this study or of beta -catenin with a mutated GSK3beta phosphorylation site induced formation of a secondary dorsal body axis in Xenopus embryos (Fagotto et al., 1996; Funayama et al., 1995; Guger and Gumbiner, 1995; Yost et al., 1996). These investigators noted that mutant beta -catenin protein was found in the nucleus. Yost et al. (1996) showed also that inhibition of GSK3beta by overexpression of a dominant negative mutant causes nuclear localization of endogenous beta -catenin in Xenopus embryos. This localization may be important for regulating cell fate determination at the gene transcription level.

In this study, we have shown that mutant beta -catenin proteins form stable complexes with cadherin and APC protein. Although we have not directly analyzed the function of endogenous beta -catenin in APC protein complexes, our results indicate strongly that a change in the dynamics of beta -catenin binding to APC protein resulting in stabilization of the beta -catenin/APC protein complex coincides with alterations in cell adhesion, migration, and morphology. Given the possibility that one function of APC protein is in regulating cell migration (Näthke et al., 1996), we suggest that the dynamics of beta -catenin binding to APC protein plays a key role in regulating APC protein function in these events during complex cell movements. In support of this idea, we have shown recently (Pollack, A., A. Barth, W.J. Nelson, and K.E. Mostov, manuscript submitted for publication) that expression of these mutant beta -catenins inhibits hepatocyte growth factor/scatter factor-induced tubulogenesis of MDCK cysts. The initial stage of tubulogenesis involves migration of long cell extensions from the cyst into the surrounding matrix; subsequently, these extensions reorganize into tubules. Expression of NH2-terminal-deleted beta -catenin inhibits formation of these cell extensions and subsequent tubule formation. Significantly, mutant beta -catenin and APC protein colocalize prominently at the tips of short membrane extensions that do not migrate further. Precise control of cell-cell adhesion and migration is important during complex morphogenetic processes such as gastrulation and neurulation. Thus, in addition to affecting signaling pathways, beta -catenin mutant proteins may alter morphogenetic movements of cells by impairing the functions of E-cadherin and/or APC protein in cell adhesion and migration.


Footnotes

Address all correspondence to Angela I.M. Barth, Department of Molecular and Cellular Physiology, Stanford University School of Medicine, Stanford, CA 94305-5426. Tel.: (415) 723-9788. Fax: (415) 725-8021. e-mail: angelab{at}leland.stanford.edu

Received for publication 17 September 1996 and in revised form 13 November 1996.

   We are very thankful to Drs. Inke Näthke and Paul Polakis for providing APC protein antisera and for helpful discussions. We also thank Dr. Rolf Kemler for providing the beta -catenin cDNA; Dr. Hermann Bujard for providing the plasmids for the tetracycline-repressible expression system; Dr. Gernot Walter for providing the mAb KT3; and Drs. Helen McNeill and Eugenio de Hostos for their advice during preparation of the manuscript.
   A.I.M. Barth and A.L. Pollack contributed equally to this work.

This work was supported by grants to W.J. Nelson from the National Institutes of Health (NIH) and American Cancer Society, and by grants to K.E. Mostov from the NIH. A. Barth was supported by a NATO fellowship from the Deutscher Akademischer Austauschdienst and an American Heart Association fellowship.


Abbreviations used in this paper

APC, adenomatous polyposis coli; Dox, doxycycline; GSK3beta , glycogen synthase kinase 3beta ; RT, room temperature; Tet, tetracycline.


References

  1. Aberle, H., S. Butz, J. Stappert, H. Weissig, R. Kemler, and H. Hoschuetzky. 1994. Assembly of the cadherin-catenin complex in vitro with recombinant proteins. J. Cell Sci. 3655-3663.
  2. Aberle, H., H. Schwartz, H. Hoschuetzky, and R. Kemler. 1996. Single amino acid substitutions in proteins of the armadillo gene family abolish their binding to alpha -catenin. J. Biol. Chem. 271: 1520-1526 [Abstract/Free Full Text].
  3. Bradley, R.S., P. Cowin, and A.M.C. Brown. 1993. Expression of Wnt-1 in PC12 cells results in modulation of plakoglobin and E-cadherin and increased cellular adhesion. J. Cell Biol. 123: 1857-1866 [Abstract/Free Full Text].
  4. Butz, S., J. Stappert, H. Weissig, and R. Kemler. 1992. Plakoglobin and betacatenin: distinct but closely related [letter]. Science (Wash. DC). 257: 1142-1144 [Free Full Text].
  5. Cox, R.T., C. Kirkpatrick, and M. Peifer. 1996. Armadillo is required for adherens junction assembly, cell polarity, and morphogenesis during Drosophila embryogenesis. J. Cell Biol. 134: 133-148 [Abstract/Free Full Text].
  6. Cui, Y., J.D. Brown, R.T. Moon, and J.L. Christian. 1995. Xwnt-8b: a maternally expressed Xenopus Wnt gene with a potential role in establishing the dorsoventral axis. Development (Camb.). 121: 2177-2186 [Abstract].
  7. Elferink, L.A., M.R. Peterson, and R.H. Scheller. 1993. A role for synaptotag- min (p65) in regulated exocytosis. Cell. 72: 153-159 [Medline].
  8. Fagotto, F., N. Funayama, U. Gluck, and B.M. Gumbiner. 1996. Binding to cadherins antagonizes the signaling activity of beta -catenin during axis formation in Xenopus. J. Cell Biol. 132: 1105-1114 [Abstract/Free Full Text].
  9. Funayama, N., F. Fagotto, P. McCrea, and B.M. Gumbiner. 1995. Embryonic axis induction by the armadillo repeat domain of beta -catenin: evidence for intracellular signaling. J. Cell Biol. 128: 959-968 [Abstract/Free Full Text].
  10. Gossen, M., and H. Bujard. 1992. Tight control of gene expression in mammalian cells by tetracycline-responsive promoters. Proc. Natl. Acad. Sci. USA. 89: 5547-5551 [Abstract/Free Full Text].
  11. Groden, J., A. Thliveris, W. Samowitz, M. Carlson, L. Gelbert, H. Albertsen, G. Joslyn, J. Stevens, L. Spirio, M. Robertson, et al . 1991. Identification and characterization of the familial adenomatous polyposis coli gene. Cell. 66: 589-600 [Medline].
  12. Guger, K.A., and B.M. Gumbiner. 1995. beta -catenin has Wnt-like activity and mimics the Nieuwkoop signaling center in Xenopus dorsal-ventral patterning. Dev. Biol. 172: 115-125 [Medline].
  13. Gumbiner, B.M.. 1992. Epithelial morphogenesis. Cell. 69: 385-387 [Medline].
  14. Gumbiner, B., B. Stevenson, and A. Grimaldi. 1988. The role of the cell adhesion molecule uvomorulin in the formation and maintenance of the epithelial junctional complex. J. Cell Biol. 107: 1575-1587 [Abstract/Free Full Text].
  15. Haegel, H., L. Larue, M. Ohsugi, L. Fedorov, K. Herrenknecht, and R. Kemler. 1995. Lack of beta-catenin affects mouse development at gastrulation. Development (Camb.). 121: 3529-3537 [Abstract].
  16. Heasman, J., A. Crawford, K. Goldstone, H.P. Garner, B. Gumbiner, P. McCrea, C. Kintner, C.Y. Noro, and C. Wylie. 1994. Overexpression of cadherins and underexpression of beta-catenin inhibit dorsal mesoderm induction in early Xenopus embryos. Cell. 79: 791-803 [Medline].
  17. Herrenknecht, K., M. Ozawa, C. Eckerskorn, F. Lottspeich, M. Lenter, and R. Kemler. 1991. The uvomorulin-anchorage protein alpha-catenin is a vinculin homologue. Proc. Natl. Acad. Sci. USA. 88: 9156-9160 [Abstract/Free Full Text].
  18. Hinck, L., I.S. Näthke, J. Papkoff, and W.J. Nelson. 1994a. Dynamics of cadherin/catenin complex formation: novel protein interactions and pathways of complex assembly. J. Cell Biol. 125: 1327-1340 [Abstract/Free Full Text].
  19. Hinck, L., W.J. Nelson, and J. Papkoff. 1994b. Wnt-1 modulates cell-cell adhesion in mammalian cells by stabilizing beta -catenin binding to the cell adhesion protein cadherin. J. Cell Biol. 124: 729-741 [Abstract/Free Full Text].
  20. Hirano, S., A. Nose, K. Hatta, A. Kawakami, and M. Takeichi. 1987. Calciumdependent cell-cell adhesion molecules (cadherins): subclass specificities and possible involvement of actin bundles. J. Cell Biol. 105: 2501-2510 [Abstract/Free Full Text].
  21. Hülsken, J., W. Birchmeier, and J. Behrens. 1994. E-cadherin and APC compete for the interaction with beta -catenin and the cytoskeleton. J. Cell Biol. 127: 2061-2069 [Abstract/Free Full Text].
  22. Jou, T.S., D.B. Stewart, J. Stappert, W.J. Nelson, and J.A. Marrs. 1995. Genetic and biochemical dissection of protein linkages in the cadherin-catenin complex. Proc. Natl. Acad. Sci. USA. 92: 5067-5071 [Abstract/Free Full Text].
  23. Kinzler, K.W., M.C. Nilbert, L.K. Su, B. Vogelstein, T.M. Bryan, D.B. Levy, K.J. Smith, A.C. Preisinger, P. Hedge, and D. McKechnie. 1991. Identification of FAP locus genes from chromosome 5q21. Science (Wash. DC). 253: 661-665 [Abstract/Free Full Text].
  24. Kozak, M.. 1989. The scanning model for translation: an update. J. Cell Biol. 108: 229-241 [Abstract/Free Full Text].
  25. Laemmli, U.K.. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature (Lond.). 227: 680-687 [Medline].
  26. MacArthur, H., and G. Walter. 1984. Monoclonal antibodies specific for the carboxy terminus of simian virus 40 large T antigen. J. Virol. 52: 483-491 [Abstract/Free Full Text].
  27. Marrs, J.A., C. Andersson-Fisone, M.C. Jeong, I.R. Nabi, C. Zurzolo, E. Rodriguez-Boulan, and W.J. Nelson. 1994. Plasticity in epithelial cell phenotype: modulation by differential expression of cadherin cell adhesion molecules. J. Cell Biol. 129: 509-517 .
  28. McCrea, P.D., and B. Gumbiner. 1991. Purification of a 92-kD cytoplasmic protein tightly associated with the cell-cell adhesion molecule E-cadherin (uvomorulin). J. Biol. Chem. 266: 4514-4520 [Abstract/Free Full Text].
  29. McCrea, P.D., C.W. Turck, and B. Gumbiner. 1991. A homolog of the armadillo protein in Drosophila (plakoglobin) associated with E-cadherin. Science (Wash. DC). 254: 1359-1361 [Abstract/Free Full Text].
  30. McCrea, P.D., W.M. Brieher, and B.M. Gumbiner. 1993. Induction of a secondary body axis in Xenopus by antibodies to beta -catenin. J. Cell Biol. 123: 477-484 [Abstract/Free Full Text].
  31. McNeill, H., T.A. Ryan, S.J. Smith, and W.J. Nelson. 1993. Spatial and temporal dissection of immediate and early events following cadherin-mediated epithelial cell adhesion. J. Cell Biol. 120: 1217-1226 [Abstract/Free Full Text].
  32. Munemitsu, S., B. Souza, O. Muller, I. Albert, B. Rubinfeld, and P. Polakis. 1994. The APC gene product associates with microtubules in vivo and promotes their assembly in vitro. Cancer Res. 54: 3676-3681 [Abstract/Free Full Text].
  33. Munemitsu, S., I. Albert, B. Souza, B. Rubinfeld, and P. Polakis. 1995. Regulation of intracellular beta-catenin levels by the adenomatous polyposis coli (APC) tumor-suppressor protein. Proc. Natl. Acad. Sci. USA. 92: 3046-3050 [Abstract/Free Full Text].
  34. Munemitsu, S., I. Albert, B. Rubinfeld, and P. Polakis. 1996. Deletion of aminoterminal structure stabilizes beta -catenin in vivo and promotes the hyperphosphorylation of the APC tumor suppressor protein. Mol. Cell. Biol. 16: 4088-4094 [Abstract].
  35. Nagafuchi, A., and M. Takeichi. 1988. Cell binding function of E-cadherin is regulated by the cytoplasmic domain. EMBO (Eur. Mol. Biol. Organ.) J. 7: 3679-3684 [Medline].
  36. Nagafuchi, A., and M. Takeichi. 1989. Transmembrane control of cadherin- mediated cell adhesion: a 94-Kd protein functionally associates with a specific region of the cytoplasmic domain of E-cadherin. Cell Regul. 1: 37-44 [Medline].
  37. Näthke, I.S., C.L. Adams, P. Polakis, J.H. Sellin, and W.J. Nelson. 1996. The adenomatous polyposis coli tumor suppressor protein localizes to plasma membrane sites involved in active cell migration. J. Cell Biol. 134: 165-179 [Abstract/Free Full Text].
  38. Nelson, W.J., R. Wilson, D. Wollner, R. Mays, H. McNeill, and K. Siemers. 1992. Regulation of epithelial cell polarity: a view from the cell surface. Cold Spring Harbor Symp. Quant. Biol. 57: 621-630 [Abstract/Free Full Text].
  39. Noordermeer, J., J. Klingensmith, N. Perrimon, and R. Nusse. 1994. Dishevelled and armadillo act in the wingless signalling pathway in Drosophila. Nature (Lond.). 367: 80-83 [Medline].
  40. Orsulic, S., and M. Peifer. 1996. An in vivo structure-function study of armadillo, the beta -catenin homologue, reveals both separate and overlapping regions of the protein required for cell adhesion and for wingless signaling. J. Cell Biol. 134: 1283-1300 [Abstract/Free Full Text].
  41. Oyama, T., Y. Kanai, A. Ochiai, S. Akimoto, T. Oda, K. Yanagihara, A. Nagafuchi, S. Tsukita, S. Shibamoto, F. Ito, et al . 1994. A truncated beta-catenin disrupts the interaction between E-cadherin and alpha-catenin: a cause of loss of intercellular adhesiveness in human cancer cell lines. Cancer Res. 54: 6282-6287 [Abstract/Free Full Text].
  42. Ozawa, M., and R. Kemler. 1992. Molecular organization of the uvomorulin- catenin complex. J. Cell Biol. 116: 989-996 [Abstract/Free Full Text].
  43. Ozawa, M., H. Baribault, and R. Kemler. 1989. The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species. EMBO (Eur. Mol. Biol. Organ.) J. 8: 1711-1717 [Medline].
  44. Ozawa, M., M. Ringwald, and R. Kemler. 1990. Uvomorulin-catenin complex formation is regulated by a specific domain in the cytoplasmic region of the cell adhesion molecule. Proc. Natl. Acad. Sci. USA. 87: 4246-4250 [Abstract/Free Full Text].
  45. Papkoff, J., B. Rubinfeld, B. Schryver, and P. Polakis. 1996. Wnt-1 regulates free pools of catenins and stabilizes APC-catenin complexes. Mol. Cell. Biol. 16: 2128-2134 [Abstract].
  46. Peifer, M., and E. Wieschaus. 1990. The segment polarity gene armadillo encodes a functionally modular protein that is the Drosophila homolog of human plakoglobin. Cell. 63: 1167-1178 [Medline].
  47. Peifer, M., C. Rauskolb, M. Williams, B. Riggleman, and E. Wieschaus. 1991. The segment polarity gene armadillo interacts with the wingless signaling pathway in both embryonic and adult pattern formation. Development (Camb.). 111: 1029-1043 [Abstract/Free Full Text].
  48. Peifer, M., S. Orsulic, D. Sweeton, and E. Wieschaus. 1993. A role for the Drosophila segment polarity gene armadillo in cell adhesion and cytoskeletal integrity during oogenesis. Development (Camb.). 118: 1191-1207 [Abstract].
  49. Polakis, P.. 1995. Mutations in the APC gene and their implications for protein structure and function. Curr. Opin. Genet. Dev. 5: 66-71 [Medline].
  50. Rimm, D.L., E. Koslov, P. Kebriaei, D. Cianci, and S.J. Morrow. 1995. Alpha1(E)-catenin is an actin binding and bundling protein mediating the attachment of F-actin to the membrane adhesion complex. Proc. Natl. Acad. Sci. USA. 92: 8813-8817 [Abstract/Free Full Text].
  51. Rubinfeld, B., B. Souza, I. Albert, O. Muller, S.H. Chamberlain, F.R. Masiarz, S. Munemitsu, and P. Polakis. 1993. Association of the APC gene product with beta-catenin. Science (Wash. DC). 262: 1731-1734 [Abstract/Free Full Text].
  52. Rubinfeld, B., I. Albert, E. Porfiri, C. Fiol, S. Munemitsu, and P. Polakis. 1996. Binding of GSK3beta to the APC-beta -catenin complex and regulation of complex assembly. Science (Wash. DC). 272: 1023-1026 [Abstract].
  53. Siegfried, E., E.L. Wilder, and N. Perrimon. 1994. Components of wingless signaling in Drosophila. Nature (Lond.). 367: 76-80 [Medline].
  54. Smith, K.J., D.B. Levy, P. Maupin, T.D. Pollard, B. Vogelstein, and K.W. Kinzler. 1994. Wild-type but not mutant APC associates with the microtubule cytoskeleton. Cancer Res. 54: 3672-3675 [Abstract/Free Full Text].
  55. Sokol, S., J.L. Christian, R.T. Moon, and D.A. Melton. 1991. Injected Wnt RNA induces a complete body axis in Xenopus embryos. Cell. 67: 741-752 [Medline].
  56. Su, L.K., B. Vogelstein, and K.W. Kinzler. 1993. Association of the APC tumor suppressor protein with catenins. Science (Wash. DC). 262: 1734-1737 [Abstract/Free Full Text].
  57. Takeichi, M.. 1990. Cadherins: a molecular family important in selective cell- cell adhesion. Annu. Rev. Biochem. 59: 237-252 [Medline].
  58. Takeichi, M.. 1991. Cadherin cell adhesion receptors as a morphogenetic regulator. Science (Wash. DC). 251: 1451-1455 [Abstract/Free Full Text].
  59. Weißig, H. 1993. Expressions- und Strukturanalysen an beta -catenin, einem zytoplasmatischen Ankerprotein des Zelladhäsionsmoleküls Uvomorulin. Diplomarbeit, Fakultät für Biologie der Alberts-Ludwigs-Universität Freiburg.
  60. Yost, C., M. Torres, J.R. Miller, E. Huang, D. Kimelman, and R.T. Moon. 1996. The axis-inducing activity, stability, and subcellular distribution of beta -catenin is regulated in Xenopus embryos by glycogen synthase kinase 3.  Genes & Dev. 10: 1443-1454 [Abstract/Free Full Text].

Copyright © 1997 by The Rockefeller University Press.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 970K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Barth, A. I.M.
Right arrow Articles by Nelson, W. J.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Barth, A. I.M.
Right arrow Articles by Nelson, W. J.
Right arrowPubmed/NCBI databases
*Substance via MeSH
*Genetics Home Reference
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents