|
|
|
|
|
|
|
||
© The Rockefeller University Press,
0021-9525/1997//935 $5.00
The Journal of Cell Biology, Volume 136, Number 4,
, 1997 935-944
Article |
Growth-inhibitory Activity and Downregulation of the Class II Tumor-suppressor Gene H-rev107 in Tumor Cell Lines and Experimental Tumors
Institute of Pathology, University Hospital Charite, D-10729 Berlin, Germany; and Division of Clinical and Experimental Research, University of Berne, CH-3004 Berne, Switzerland
The H-rev107 gene is a new class II tumor suppressor, as defined by its reversible downregulation and growth-inhibiting capacity in HRAS transformed cell lines. Overexpression of the H-rev107 cDNA in HRAS-transformed ANR4 hepatoma cells or in FE-8 fibroblasts resulted in 75% reduction of colony formation. Cell populations of H-rev107 transfectants showed an attenuated tumor formation in nude mice. Cells explanted from tumors or maintained in cell culture for an extended period of time no longer exhibited detectable levels of the H-rev107 protein, suggesting strong selection against H-rev107 expression in vitro and in vivo. Expression of the truncated form of H-rev107 lacking the COOH-terminal membrane associated domain of 25 amino acids, had a weaker inhibitory effect on proliferation in vitro and was unable to attenuate tumor growth in nude mice. The H-rev107 mRNA is expressed in most adult rat tissues, and immunohistochemical analysis showed expression of the protein in differentiated epithelial cells of stomach, of colon and small intestine, in kidney, bladder, esophagus, and in tracheal and bronchial epithelium. H-rev107 gene transcription is downregulated in rat cell lines derived from liver, kidney, and pancreatic tumors and also in experimental mammary tumors expressing a RAS transgene. In colon carcinoma cell lines only minute amounts of protein were detectable. Thus, downregulation of H-rev107 expression may occur at the level of mRNA or protein.
RAS gene mutations contribute to a large proportion of human cancers. Point mutations activating one of the three RAS genes are detected in 50% of colon carcinomas and adenomas >1 cm in size (Vogelstein et al., 1988), in 
90% of pancreatic tumors, in 30% of lung carcinomas and myeloid leukemias, and in 50% of thyroid tumors (for review see Bos, 1989). In most of these tumors, RAS mutations are present in early stages of the neoplastic disease, suggesting a role in the initiation of malignant transformation. The normal RAS protein is activated by GDP/GTP nucleotide exchange factors in response to the binding of different ligands to their cognate receptors. Thereby, RAS couples extracellular stimuli with the activation of genes controlling proliferation, differentiation, and growth arrest (for review see Marshall, 1995). In its active, GTP-bound form, RAS targets the protein kinase, Raf, to the cell membrane, where Raf initiates a protein kinase cascade resulting in transcription factor activation (Leevers et al., 1994; Stokoe et al., 1994). RAS is inactivated by hydrolysis of GTP to GDP. Mutations affecting amino acids 12, 13, or 61 within the RAS protein not only lead to a reduction of its intrinsic GTPase activity but also to its resistance to the action of various GTPase activating proteins that highly enhance the GTP to GDP conversion of normal RAS. These RAS mutants are trapped in the active GTP-bound state and constitutively stimulate downstream kinases. Similar effects can also be achieved by mutations in one of these GAPs, such as NF1. Mutations within the coding sequence of the NF-1 gene disrupt this activity and are thought to contribute to neoplasia associated with neurofibromatosis type I (Cawthon et al., 1990; Viskochil et al., 1990). Recently, considerable progress has been made in the elucidation of the pathways activated by GTP-bound RAS (for review see Marshall, 1995). Several different protein kinases, including Raf-1, PI-3-kinase, PKC-
, and MEK kinase, have been identified as downstream effectors of RAS. All of them stimulate distinct protein kinase cascades, resulting in mitogenic stimulation and morphological alterations (Marshall, 1995). These effects are thought to be mediated via distinct transcriptional targets of the protein kinase cascades. Two well known genes activated in response to oncogenic RAS-activation are the immediate–early genes Fos and Jun encoding the heterodimeric AP-1 transcription factor. The AP-1 complex stimulates the transcription of genes encoding tissue remodeling enzymes relevant for the metastatic phenotype such as type IV collagenase and the metalloprotease stromelysin (Scher et al., 1983; Muller et al., 1988; Chauhan et al., 1991). Gene products involved in cellular metabolism, such as glucose transporters or ornithine-decarboxylase, are also found at increased levels in RAS-transformed cells and may contribute to the increased division rate of tumor cells (for review see Aoyama and Klemenz, 1993).
Oncogenic mutations of Ras also lead to the transcriptional downregulation of critical genes. They encode the F-actin capping proteins such as gelsolin (Müllauer et al., 1993), matrix modifying enzymes such as rrg-1 (Contente et al., 1990), and the F-actin bundling proteins tropomyosin (Prasad et al., 1993) and vinculin (Fernandez et al., 1992). In addition, the expression of protein kinase C family isoforms is abrogated after activation of oncogenic HRAS (Geiges et al., 1995), and some downregulated genes have been described with as yet unknown function, e.g., the 322 gene (Lin et al., 1995). Several of those genes were shown to be reexpressed in the revertant cell lines derived from HRAS-transformed fibroblasts (for review see Schäfer, 1994). Therefore, the reversible functional loss of these gene activities may be causally involved in the process of neoplastic transformation. These observations suggest a specific interference of the proteins encoded by downregulated genes with the oncogenic signaling pathways.
We have established a series of closely related immortal, nontumorigenic 208F rat fibroblasts, HRAS-transformed FE-8 cells, and phenotypic revertants for the identification of transcriptional targets suppressed by an activated HRAS gene (Schäfer et al., 1988). Using cDNA subtraction and differential hybridization, we analyzed the expression pattern of known transformation-sensitive genes in these cells (Oberhuber et al., 1995) and isolated new sequences, designated H-rev genes, associated with the normal and the revertant phenotype (Hajnal et al., 1993, 1994; Kiess et al., 1995). One of these genes, H-rev107, a novel, 16-kD protein without known sequence homologies, is expressed in immortal rat fibroblasts, downregulated after HRAS-transformation, reexpressed in the revertant clone F9, and also highly expressed in two independent RAS- resistant fibroblast lines (Hajnal et al., 1994). This result suggested that the H-rev107 gene was directly involved in the resistance toward HRAS-mediated transformation. In this study, we demonstrate the growth-inhibitory effects of H-rev107 overexpression on HRAS-transformed cells in vitro and in vivo. Furthermore, we show the ubiquitous expression of H-rev107 in normal tissues and its downregulation in rat tumor cell lines and in experimental tumors.
 |
Material and Methods |
|---|
 TopAbstract Material and Methods ResultsDiscussionReferences |
|---|
Northern Blot Analysis
Total cellular RNA was isolated as described (Chomczynski and Sacchi, 1987). 10 µg of RNA was denatured using glyoxal and separated in 1% agarose gels (McMaster and Carmichael, 1977), and transferred to nylon membranes (Genscreen plus, New England Nuclear, Boston, MA). Northern blots were hybridized with a 523-bp H-rev107 cDNA fragment encoding the 5' untranslated sequence and part of the coding sequence as a probe. Fragments were 32P labeled by random priming (Feinberg and Vogelstein, 1983), and hybridization was carried out either in 50% formamide, 10% dextran sulfate, 1 M sodium chloride, 5X Denhardt's solution, and 100 µg/ml denatured salmon sperm DNA at 42°C, or in the Quickhyb solution from Stratagene (La Jolla, CA) at 65°C.
H-rev107 Expression Plasmids
H-rev107 cDNA was cloned into expression vectors in which transcription of the inserted DNA is driven by the cytomegalovirus promoter. Plasmids pCMVTK107+ and pCMVTK107– encode H-rev107 mRNA in sense and in antisense orientation, respectively (Hajnal et al., 1994). Plasmid pCDNA-107+ was constructed by cloning the 900-bp BamHI insert, obtained from the cDNA clone pBS107C, into the BamHI site of pCDNA3 (Invitrogen, San Diego, CA). This fragment contains the complete coding region of H-rev107, 33 bp of 5' untranslated region, and 386 bp of 3' untranslated region. Plasmid pCDNA-107– drives transcription of antisense H-rev107 mRNA. The pCDNA107 
C vector was constructed by PCR amplification of a 416-bp fragment obtained from pBS107C using the H-rev107 specific primers 5' TTGAATTCAT GCCCATACCAGAACCCAAG 3' and 5' GGGAGCTCTCGCCACCTTGACGATGTCT 3', followed by insertion of the PCR product into the EcoRI and XhoI sites of pCDNA3. The termination codon is just downstream of the XhoI site in the vector. This cDNA clone expresses only the first 135 amino acids of the H-rev107 protein. For the production of a tetracycline-inducible H-rev107 (pUHD107), a 714-bp BamHI fragment from cDNA clone pBS107B (Hajnal et al., 1994) was cloned into the BamHI site of the plasmid pUHD 10-3 (Gossen & Bujard, 1992).
DNA Transfections and In Vivo Tumorigenicity Assays
Plasmid DNA was transfected into 208F, FE-8, and ANR4 cells by calcium– phosphate precipitation, as described (Wigler et al., 1978). 5 µg of linearized recombinant vector DNA, 1 µg of linearized plasmid pY3 carrying the hygromycin B resistance gene, and 20 µg genomic carrier DNA were used for transfection of 106 recipient cells. 48 h after transfection, cells were subjected to selection in standard medium containing 400 µg/ml hygromycin B. When colonies had reached a size of 500–1,000 cells, the cells were trypsinized and pooled. H-rev107 protein expression was analyzed by immunofluorescence using the anti-H-rev107 antibody. To obtain FE-8 cells harboring a tetracyclin-inducible H-rev107, the cells were first transfected with the plasmid pUHD172-1neo and stable clones selected as described above. This plasmid expresses the modified tetracycline repressor which was turned into an activator (Gossen et al., 1995). These clones were analyzed by transient transfection using the plasmid pUHC13-3 containing the luciferase-reporter gene under the control of a tet operator (Gossen and Bujard, 1992). Clones showing a preferable ratio of induction to background luciferase actvity were chosen for further transfection with the pUHD-107 plasmid and clones selected by cotransfection with the pY3 plasmid as described above. 48 h after induction of H-rev107 expression using 2 µg/ml doxycyclin, protein expression was monitored either by Western blot analysis or by immunofluorescence. For control cells (10-3-3), the pUDH10-3 vector alone was used instead of pUHD-107. For tumorigenicity assays, 106 cells were injected subcutanously into either side of ICR nu/nu mice. Tumor growth was controlled daily. After the indicated time the animals were killed, tumors removed, and either frozen in liquid nitrogen or explanted in tissue culture medium after digestion with trypsin/EDTA. Tumor cells were incubated in standard medium containing 50 µg/ml gentamicin.
Preparation of Cell Extracts and Western Blot Analysis
For subcellular fractionation, adherent cells were washed twice in PBS, incubated in hypotonic lysis buffer (10 mM Tris, 0.1 mM dithiothretiol, 1 mM PMSF, 5 µg/ml aprotinin, 5 µg/ml leupeptin, 50 µg/ml TLCK, pH 8) for 5–10 min on ice, and lysed using a Dounce homogenizer. Nuclei were obtained after centrifugation at 500 g at 4°C for 10 min, washed twice in PBS, and purified via centrifugation through a sucrose gradient (Blobel and Potter, 1966). The 500 g supernatant was centrifuged at 100,000 g at 4°C for 30 min to obtain the membrane fraction. Cytoplasmic proteins were precipitated from the 100,000 g supernatant using methanol/chloroform (Wessel and Függe, 1984). All pellets were resuspended in SDS sample buffer, boiled for 5 min, and stored at –20°C. Protein concentration was determined using amido black staining of protein extracts on nitrocellulose filters (Schaffner and Weissmann, 1973). Equal amounts of protein were separated on 16% polyacrylamide gels by SDS-gel electrophoresis (Laemmli, 1970) and transferred to nitrocellulose membranes (Immobilon P; Millipore Corp., Milford, MA). Membranes were blocked overnight in TBST (10 mM Tris, pH 8, 150 mM NaCl, 0.05% Tween 20) containing 1% BSA, incubated with affinity purified anti-H-rev107 antibody (Hajnal et al., 1994) diluted 1:1,000 in TBST for 4 h. Membranes were washed three times for 5 min in TBST and incubated for 45 min with an anti–rabbit horse-radish peroxidase coupled antibody and processed according to the manufacturer's instructions (ECL-Kit; Amersham Intl., Buckinghamshire, England).
Immunohistochemistry and Immunofluorescence
Indirect immunoperoxidase staining on frozen tissue sections was performed using the Vectastain-kit (Vector Laboratories, Burlingame, CA) according to the protocol of the manufacturer. In blocking experiments, the H-rev107 antiserum was preabsorbed with 8 µg/ml of bacterially expressed H-rev107 protein prior to incubation with the sections. For immunofluorescence analysis, cells were grown on glass coverslips coated with polyornithine (100 µg/ml). After fixation in 3% paraformaldehyde in phosphate-buffered saline for 20 min, cells were permeabilized using 0.5% Triton X-100 in PBS for 2 min. Coverslips were incubated with the H-rev 107 antiserum, diluted 1:100 in PBS/1% BSA, washed in PBS, incubated with a DTAF-conjugated goat anti–rabbit antibody (Dianova GmbH, Hamburg, Germany), washed in PBS, mounted in 5% Mowiol and analyzed with a fluorescence microscope (Zeiss Inc., Oberkochen, Germany). For nuclear staining, cells were incubated with 1 µg/ml Hoechst 33258 fluorescent dye together with the second antibody.
|
Results |
|---|
|
TopAbstractMaterial and MethodsResultsDiscussionReferences |
|---|
C expressing the truncated H-rev107 cDNA, and the plasmid pCDNA3 were used as controls. The cloning efficiencies of FE-8 and ANR4 cells, following the introduction of the plasmid pCDNA107+, were reduced by 62 and 75%, respectively, as compared to control transfections (Table I).
|
|
C expressed the truncated form of the H-rev107 protein (Fig. 1 B). Immunofluorescence analysis of the five independent pCDNA107+ transfectant clones using the H-rev107 antiserum, revealed that only 20–50% of the cells were positive for the protein. Within a few weeks of culture, the fraction of H-rev107 positive cells decreased to <10% (data not shown). A significant reduction of colony formation was not observed in transfections of nontumorigenic 208F cells excluding an unspecific toxicity of H-rev107 expression plasmids (Table I). These experiments showed that the level of H-rev107 expression inversely correlated with the clonogenicity of HRAS-transformed cells transfected with the full-length H-rev107 cDNA. Moreover, there was a strong selection against H-rev107 expressing cells during continued culture of transfectants. To confirm this, we also transfected the pCMVTK107+ vector, which yields very high H-rev107 protein levels in the transfected cells due to the presence of the thymidine kinase leader sequence cloned in front of the H-rev107 cDNA. Transfection of this H-rev107 expression vector did not yield individual stable ANR4 transfectant clones, while only few colonies were formed after selection of FE-8 cells. None of 11 clones tested expressed H-rev107, whereas HRAS protein expression was maintained, indicating that a very high H-rev107 expression in the presence of HRAS does not permit permanent proliferation of transfectants in vitro. In addition to the stably transfected cells, FE-8 fibroblasts harboring the H-rev107 cDNA under the control of a tetracycline-inducible promoter (pUHD107), were tested for their cloning efficiencies with or without induction of the H-rev107 protein (Fig. 2). A reduction in cloning efficiency similar to that observed with constitutively expressed H-rev107 was obvious in cells with pUHD-107 (Fig. 2). Upon prolonged culture of these cells in the presence of doxycycline, there was again a selection against H-rev107 expressing cells (data not shown).
|
C) did not suppress tumor growth in vivo (Fig. 4). After 14 or 20 d the mice were killed, and cells from the tumors were explanted, grown in tissue culture, and analyzed for H-rev107 protein by immunofluorescence. The proportion of transfected tumor cells positive for H-rev107 protein was reduced as compared to the original cells. A representative culture of tumor explants is shown in Fig. 3 (B and D). Counting of independent microscopic fields of FE-8 transfectants (866 cells counted) and ANR4 transfectants (784 cells counted) revealed an average of 15% of cells staining positive with the H-rev107 antibody. These results suggest that either H-rev107 expression was downregulated in most of the cells during in vivo passaging or that the H-rev107 expressing cells are efficiently overgrown by the nonexpressing cells.
|
|
|
C), lacking the last 25 codons, was also overexpressed in COS cells. The missing region encodes predominantly hydrophobic amino acids and is probably responsible for membrane association. Deletion of this hydrophobic region leads to a loss of the H-rev107 protein in the nuclear and in the crude membrane fractions. The shortened H-rev107 C protein is entirely found in the cytoplasmic fraction (Fig. 5 A), suggesting that the COOHterminal hydrophobic domain mediates the binding of H-rev107 to an intracellular membrane. In cells overexpressing full-length H-rev107, immunofluorescence analysis revealed no staining within the nucleus and at the plasma membrane. Rather, the H-rev107 protein appears to be linked to the nuclear membrane and to membranes in the perinuclear space (Fig. 5, B and C). As a considerable amount of the protein is present in the cytoplasm, staining of the free protein presumably masks the exact localization of the membrane-bound polypeptide.
Expression of H-rev107 mRNA in Normal Adult Rat Tissues, Tumor Cell Lines, and Experimental Tumors
High levels of H-rev107 mRNA expression have been observed in the RAS-transformation-resistant fibroblasts REF 52 and EK3 and in the phenotypic revertant cell line F9 obtained from HRAS-transformed cells. To further investigate the role of H-rev107 in neoplasia, we compared the expression of the gene in various normal rat tissues and tumor cell lines. Northern blot analysis of mRNA obtained from adult rat tissue showed ubiquitous expression of the H-rev107 gene (Fig. 6). Strong expression was observed in brain, kidney, liver, stomach, large intestine, spleen, muscle, and heart. A weaker expression was detected in breast and small intestine, and a very weak signal was observed in placenta. The H-rev107 protein is detectable in protein extracts from epithelial tissues of adult rats (Hajnal et al., 1994). Immunohistochemistry on cryosections of normal rat tissues using the H-rev107 antibody was used to localize H-rev107 expression in the tissues. In the colon, strong H-rev107-specific staining was limited to the differentiated epithelial cells. Similarly, epithelial specific expression was found in stomach, small intestine, and esophagus, in tracheal and bronchial epithelium, in testis, and in transitional epithelium of the bladder (Fig. 7). Weaker expression was also observed in the cardiac muscle and in spleen (data not shown).
|
|
To find out if H-rev107 expression is altered in malignant tissues, we analyzed tumors derived from transgenic mice carrying an activated HRAS oncogene controlled by the whey acidic protein promoter. The whey acidic protein promoter is activated upon onset of lactation in the mammary epithelial cells, leading to the development of mammary tumors in certain transgenic lines (Andres et al., 1987). H-rev107 mRNA expression was absent or very low in tumors L 25, 25.33G, and 25.72 (Fig. 8). Compared to the two control samples (Fig. 8; normal-A, normal-B), also the tumors 25.81, 25III13B, and 25.89 show a clear reduction in H-rev107 mRNA levels. Immunohistochemical analysis of the same malignant tissues failed to detect expression of the H-rev107 protein in spite of detectable mRNA. Western blot analysis of preneoplastic 208F rat fibroblasts and mouse NIH3T3 cells had shown a weak signal derived from the endogenous protein (Hajnal et al., 1994 and Sers, C., unpublished observations), but detection of the protein in individual cells was not possible. This is most likely due to a very low protein level, a phenomenon also observed in the rat colon carcinoma line WB2054, substantiating the notion that H-rev107 downregulation can occur at the RNA and the protein level.
|
|
Discussion |
|---|
|
TopAbstractMaterial and MethodsResultsDiscussionReferences |
|---|
What is the mechanism of growth suppression due to the overexpression of the H-rev107 gene? Only a minor reduction of colony formation was observed in cells transfected with the truncated H-rev107 gene (Table I). Expression of the truncated gene can be maintained stably in culture and did not result in a reduction of tumor growth (Fig. 1 B and Fig. 4). This suggests that the membrane attachment of the protein plays an important role in the proliferation–suppressive function in vivo. The H-rev107 protein is clearly not associated with the plasma membrane in 208F fibroblasts but rather with yet undefined intracellular membranes and presumably with the nuclear membrane. An attractive speculation is that the H-rev107 protein may serve as a negative regulator of an oncogenic HRAS- mediated signal by sequestration of kinases or of other growth-regulatory proteins. Members of the signal transduction kinase cascade have been shown to bind to anchoring proteins. These proteins target their catalytically active partners to specific subcellular sites and thereby control activation and phosphorylation of specific substrates (Mochly-Rosen et al., 1991; Coghlan et al., 1995). To understand the role of the H-rev107 protein in growth suppression in molecular detail, it is important to identify the target membrane and interacting proteins.
With constitutive expression of oncogenic RAS, slow growing cell populations overexpressing the H-rev107 gene are easily taken over by the fast-growing, nonexpressing cell populations. Thus, a detailed analysis of growth arrest in specific stages of the cell cycle was hampered by such an instability of H-rev107 high-expressers among RAS-transformants and by the low concentrations of the endogenous H-rev107 protein in cultured cells. The endogenous H-rev107 protein was detected exclusively in differentiated epithelial cells of several tissues, suggesting that it plays a role in differentiation-related growth arrest. We did not observe a significant fraction of apoptotic cells in transfected cell cultures (data not shown). Thus, the reduction of colony formation of transfected HRAS-transformed cells and the replacement of H-rev107-expressing cells by negative cells in vivo and in vitro may be explained by induced senescence, which is regarded as an important mechanism of tumor suppression (O'Brien et al., 1986; Shay and Wright, 1991).
The H-rev107 gene can be categorized as a class II tumor suppressor gene which has lost a growth-constraining function in tumor cells due to an expression block (Lee et al., 1991). In class I tumor suppressor genes such as TP53 or RB (for review see Vogelstein and Kinzler, 1992; Riley et al., 1994), loss of function results from mutation or deletion of DNA. Furthermore, the concept of two classes of tumor suppressor genes suggests that some class II genes are the targets of class I genes encoding transcriptional regulators (Lee et al., 1991). An increasing number of class II tumor suppressor genes have been identified on the basis of their downregulation in tumorigenic cells and owing to their transformation-inhibiting activity. The product of the K-rev gene, a Ras-like GTP-binding protein, was shown to interfere with oncogenic signaling (Kitayama et al., 1989; Frech et al., 1990; Culine et al., 1992). Other class II genes encode the cytoskeletal proteins tropomyosin (Fernandez et al., 1992) and vinculin (Prasad et al., 1993), the matrixmodifying enzyme lysyl oxidase (Contente et al., 1990; Krzyzoziak et al., 1992; Hajnal et al., 1993), gap junction proteins (Lee et al., 1992), and the invasion modulating serine protease maspin (Zou et al., 1994).
We have observed a concerted expression block to several H-rev genes in HRAS-transformed cells. Downregulation affected the H-rev107 gene (Hajnal et al., 1994), the H-rev142 gene encoding lysyl oxidase (Hajnal et al., 1993; Oberhuber et al., 1995), the H-rev18 gene encoding Ril, a novel member of LIM double zinc finger proteins involved in differentiation (Kiess et al., 1995), and Tsp-1 encoding the angiogenesis inhibitor thrombospondin (Shäfer, R., unpublished observations). These findings support the notion that continuous mitogenic signaling by mutated RAS specifically results in the coordinated downregulation of critical genes.
The repression of class II suppressor gene activity mediated by onco-proteins provides an important novel link between the activity of oncogenes and anti-oncogenes. The most intriguing feature of class II tumor suppressor inactivation is perhaps its reversibility triggered by various agents (Contente et al., 1990; Krzyzosiak et al., 1992; Oberhuber et al., 1995). Upregulation of H-rev gene expression in phenotypic revertants may occur in a coordinated fashion (Hajnal et al., 1993; Oberhuber et al., 1995). Several drugs have been identified that are able to reestablish the expression of downregulated genes and revert the transformed phenotype (Krzyzosiak et al., 1992; Kumar et al., 1995). The further development of those drugs may provide new therapeutic options for interfering with the activity of oncogenes commonly activated in human neoplasia.
|
Acknowledgments |
|---|
This work was supported by the Schweizerischer Nationalfonds (grant 31.37525.93) and by the Krebsliga des Kantons Zürich.
Submitted: 15 May 1996
Revised: 19 November 1996
Please address correspondence to Christine Sers, Institute of Pathology, Charité, Humboldt University Berlin, Schumannstr. 20/21, D-10117 Berlin, Germany. Tel.: (49) 30-2802-5181. Fax.: (49) 30-2802-8206. E-mail: chsers{at}rz.charite.hu-berlin.de
|
References |
|---|
|
TopAbstractMaterial and MethodsResultsDiscussionReferences |
|---|
Andres A-C, Schönenberger C-A, Groner B, Henninghausen L, LeMeurs M & Gerlinger P. Ha-ras oncogene expression directed by a milk protein gene promoter: tissue specificity, hormonal regulation, and tumor induction in transgenic mice, Proc Natl Acad Sci USA, 1987, 84, 1299–1303.
Aoyama A & Klemenz R. Oncogene-mediated effects on cellular gene expression, Crit Rev Oncog, 1993, 4, 53–94.[Medline]
Blobel G & Potter VR. Nuclei from rat liver: isolation method that combines purity with high yield, Science (Wash DC), 1966, 154, 1662–1665.
Bos JL. Ras oncogenes in human cancer: a review, Cancer Res, 1989, 49, 4682–4689.
Cawthon RM, Weiss R, Xu G, Viskochil D, Culver M, Stevens J, Robertson M, Dunn D, Gesteland R, O'Connell P et al.. A major segment of the neurofibromatosis type 1 gene: cDNA sequence, genomic structure, and point mutations, Cell, 1990, 62, 193–201.[Medline]
Chauhan SS, Goldstein LJ & Gottesman MM. Expression of cathepsin L in human tumors, Cancer Res, 1991, 51, 1478–1481.
Chomzcynski P & Sacchi N. Single step method of RNA isolation by acid guanidinium–thiocyonate–phenol–chloroform extraction, Anal Biochem, 1987, 162, 156–159.[Medline]
Coghlan VM, Perrino BA, Howard M, Langeberg LK, Hicks JB, Gallatin WM & Scott JD. Association of protein kinase A and a protein phosphatase 2B with a common anchoring protein, Science (Wash DC), 1995, 267, 108–111.
Contente S, Kenyon K, Rimoldi D & Friedman RM. Expression of gene rrg is associated with reversion of NIH 3T3 transformed by LTR-c-Ha-ras, Science (Wash DC), 1990, 249, 796–798.
Culine S, Olofsson B, Gosselin S, Honore N & Tavitian A. Expression of the ras-related rap genes in human tumors, Int J Cancer, 1989, 44, 990–994.[Medline]
Feinberg AP & Vogelstein B. A technique for radiolabeling DNA restriction endonuclease fragments to high specific activity, Anal Biochem, 1983, 132, 6–13.[Medline]
Fernandez JLR, Geiger B, Salomon D, Sabanay I, Zoller M & Ben Ze-ev A. Suppression of tumorigenicity in transformed cells after transfection with vinculin cDNA, J Cell Biol, 1992, 119, 427–438.
Franza BR, Jr, Maruyama K, Garrels JI & Ruley HE. In vitro establishment is not a sufficient prerequisite for transformation by activated ras oncogenes, Cell, 1986, 44, 409–418.[Medline]
Frech M, John J, Pizon V, Chardin P, McCormick F, Tavitian A, Wittinghofer A & Clark R. Inhibition of GTPase activating protein stimulation of Ras-p21 GTPase by the Krev-1 gene product, Science (Wash DC), 1990, 249, 169–171.
Geiges D, Marks F & Gschwendt M. Loss of protein kinase C
from human HaCaT keratinocytes upon Ras transfection is mediated by TGF
, Exp Cell Res, 1995, 219, 299–303.[Medline]
Gossen M & Bujard H. Tight control of gene expression in mammalian cells by tetracycline responsive promoters, Proc Natl Acad Sci USA, 1992, 89, 5547–5551.
Gossen M, Freundlieb S, Bender G, Müller G, Hillen W & Bujard H. Transcriptional activation by tetracycline in mammalian cells, Science (Wash DC), 1995, 268, 1766–1769.
Griegel S, Traub O, Willecke K & Schäfer R. Suppression and re- expression of transformed phenotype in hybrids of Ha-ras1 transformed Rat-1 cells and early passage rat embryo fibroblasts, Int J Cancer, 1986, 38, 697–705.[Medline]
Hajnal A, Klemenz R & Schäfer R. Upregulation of lysyl oxidase in spontaneous revertants of H-rastransformed rat fibroblasts, Canc Res, 1993, 53, 4670–4675.
Hajnal A, Klemenz R & Schäfer R. Subtraction cloning of H-rev107, a gene specifically expressed in H-rasresistant fibroblasts, Oncogene, 1994, 9, 479–490.[Medline]
Hirakawa T & Ruley HE. Rescue of cells from oncogene-induced apoptosis by a second, complementing oncogene, Proc Natl Acad Sci USA, 1988, 85, 1519–1523.
Kiess M, Scharm B, Aguzzi A, Hajnal A, Klemenz R, Schwarte-Waldhoff I & Schäfer R. Expression of ril, a novel LIM domain gene, is downregulated in HRAS-transformed cells and restored in phenotypic revertants, Oncogene, 1995, 10, 61–68.[Medline]
Kitayama H, Sugimoto Y, Matsuzaki T, Ikawa Y & Noda M. A rasrelated gene with transformation suppressor activity, Cell, 1989, 56, 77–84.[Medline]
Krzyzosiak WJ, Shindookada N, Teshima H, Nakajima K & Nishimura S. Isolation of genes specifically expressed in flat revertant cells derived from activated ras-transformed NIH-3T3 cells by treatment with azatyrosine, Proc Natl Acad Sci USA, 1992, 89, 4879–4883.
Kumar CC, Prorock-Rogers C, Kelly J, Dong Z, Lin J-J, Armstrong L, Kung H-F, Weber MJ & Afonso A. SCH 51344 inhibits ras transformation by a novel mechanism, Canc Res, 1995, 55, 5106–5117.
Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature (Lond), 1970, 227, 680–685.[Medline]
Lee SW, Tomasetto C & Sager R. Positive selection of candidate tumor-suppressor genes by subtractive hybridization, Proc Natl Acad Sci USA, 1991, 88, 2825–2829.
Lee SW, Tomasetto C, Paul D, Keyomarsi K & Sager R. Transcriptional downregulation of gap-junctional proteins blocks junctional communication in human mammary tumor cell lines, J Cell Biol, 1992, 118, 1213–1221.
Leevers SJ, Paterson HF & Marshall CJ. Requirement for Ras in Raf activation is overcome by targeting Raf to the plasma membrane, Nature (Lond), 1994, 369, 411–414.[Medline]
Lin XY, Nelson PJ, Frankfort B, Tombler E, Johnson R & Gelman IH. Isolation and characterization of a novel mitogenic regulatory gene, 322, which is transcriptionally suppressed in cells transformed by src and ras, Mol Cell Biol, 1995, 15, 2754–2762.[Abstract]
Marshall MS. Ras target proteins in eukaryotic cells, FASEB (Fed Am Soc Exp Biol) J, 1995, 9, 1311–1318.[Abstract]
McMaster GK & Carmichael GG. Analysis of single- and doublestranded nucleic acids on polacrylamide and agarose gels using glyoxal and acridine orange, Proc Natl Acad Sci USA, 1977, 74, 4835–4838.
Mochly-Rosen D, Khaner H & Lopez J. Identification of intracellular receptor proteins for activated protein kinase C, Proc Natl Acad Sci USA, 1991, 88, 3997–3400.
Muller D, Quantin B, Gesnel M-C, Matrisian LM & Breathnach R. The collagenase gene family in humans consists of at least four members, Biochem J, 1988, 253, 187–192.[Medline]
Müllauer L, Fujita H, Ishizaki A & Kuzumaki N. Tumor-suppressive function of mutated gelsolin in ras-transformed cells, Oncogene, 1993, 8, 2531–2536.[Medline]
O'Brien W, Stenman G & Sager R. Suppression of tumor growth by senescence in virally transformed human fibroblasts, Proc Natl Acad Sci USA, 1986, 83, 8659–8663.
Oberhuber H, Seliger B & Schäfer R. Partial restoration of pretransformation levels of lysyl oxidase and transin mRNAs in phenotypic ras revertants, Mol Carcinog, 1995, 12, 198–204.[Medline]
Prasad GL, Fuldner RA & Cooper HL. Expression of transduced tropomyosin-1 cDNA suppresses neoplastic growth of cells transformed by the ras oncogene, Proc Natl Acad Sci USA, 1993, 90, 7039–7043.
Quade K. Transformation of mammalian cells by avian myelocytomatosis virus and avian erythroblastosis virus, Virology, 1979, 98, 461–465.[Medline]
Riley DJ, Lee EY-HP & Lee WH. The retinoblastoma protein: more than a tumor suppressor, Annu Rev Cell Biol, 1994, 10, 1–29.
Schaffner W & Weissmann C. A rapid and sensitive method for the determination of protein in dilute solution, Anal Biochem, 1973, 56, 502–514.[Medline]
Schäfer R, Iyer J, Iten E & Nirkko AC. Partial reversion of the transformed phenotype in HRAS-transfected tumorigenic cells by transfer of a human gene, Proc Natl Acad Sci USA, 1988, 85, 1590–1594.
Schäfer R. Suppression of ras oncogene-mediated transformation, Rev Physiol Biochem Pharmacol, 1994, 124, 29–9.[Medline]
Scher CD, Dick RL, Whipple AP & Locatell KL. Identification of a BALB/c-3T3 cell protein modulated by platelet-derived growth factor, Mol Cell Biol, 1983, 3, 70–81.
Shay JW & Wright WE. Both Rb and P53 are potential regulators of human cellular senescence, Hereditary Tumors, 1991, 83, 173–182.
Stanbridge EJ. Human tumor suppressor genes, Annu Rev Genet, 1991, 24, 615–657.[Medline]
Stokoe D, Macdonald SD, Cadwallader K, Symons M & Hancock JF. Activation of Raf as a result of recruitment to the plasma membrane, Science (Wash DC), 1994, 264, 1463–1467.
Viskochil D, Buchberg AM, Xu G, Cawthon RM, Stevens J, Wolff RK, Culver M, Carey JC, Copeland NG, Jenkins NA et al.. Deletions and a translocation interrupt a cloned gene at the neurofibromatosis type 1 locus, Cell, 1990, 62, 187–192.[Medline]
Vogelstein B, Fearon ER, Hamilton SR, Kern SE, Presinger AC, Leppert M, Nakmura Y, White R, Smits AMM & Bos JL. Genetic alterations during colorectal-tumor development, N Engl J Med, 1988, 319, 526–532.
Vogelstein B & Kinzler KW. p53 function and dysfunction, Cell, 1992, 70, 523–526.[Medline]
Wessel D & Függe UI. A method for quantitative recovery of protein in dilute solution in the presence of detergents and lipids, Anal Biochem, 1984, 138, 141–143.[Medline]
Wigler M, Pellicer A, Silverstein S & Axel R. Biochemical transfer of single-copy eukaryotic genes using total cellular DNA as donor, Cell, 1978, 14, 725–731.[Medline]
Zou Z, Anisowicz A, Hendrix MJC, Thor A, Neveu M, Sheng S, Rafidi K, Seftor E & Sager R. Maspin, a serpin with tumor-suppressing activity in human mammary epithelial cells, Science (Wash DC), 1994, 263, 526–529.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
) and ANR 4 cells (•) stably transfected with the following plasmids: 1, pCMVTK-107+ (sense); 2, pCMVTK107- (antisense); 3, pCNDA 107 
