|
||
Department of Cell Biology and Physiology, Washington University School of Medicine, St. Louis, Missouri 63110
While much is known about the role of nuclear pore complexes (NPCs) in nucleocytoplasmic transport, the mechanism of NPC assembly into pores formed through the double lipid bilayer of the nuclear envelope is not well defined. To investigate the dynamics of NPCs, we developed a live-cell assay in the yeast Saccharomyces cerevisiae. The nucleoporin Nup49p was fused to the green fluorescent protein (GFP) of Aequorea victoria and expressed in nup49 null haploid yeast cells. When the GFP-Nup49p donor cell was mated with a recipient cell harboring only unlabeled Nup49p, the nuclei fused as a consequence of the normal mating process. By monitoring the distribution of the GFP-Nup49p, we could assess whether NPCs were able to move from the donor section of the nuclear envelope to that of the recipient nucleus. We observed that fluorescent NPCs moved and encircled the entire nucleus within 25 min after fusion. When assays were done in mutant kar1-1 strains, where nuclear fusion does not occur, GFP-Nup49p appearance in the recipient nucleus occurred at a very slow rate, presumably due to new NPC biogenesis or to exchange of GFP- Nup49p into existing recipient NPCs. Interestingly, in a number of existing mutant strains, NPCs are clustered together at permissive growth temperatures. This has been explained with two different hypotheses: by movement of NPCs through the double nuclear membranes with subsequent clustering at a central location; or, alternatively, by assembly of all NPCs at a central location (such as the spindle pole body) with NPCs in mutant cells unable to move away from this point. Using the GFP-Nup49p system with a mutant in the NPCassociated factor Gle2p that exhibits formation of NPC clusters only at 37°C, it was possible to distinguish between these two models for NPC dynamics. GFP- Nup49p-labeled NPCs, assembled at 23°C, moved into clusters when the cells were shifted to growth at 37°C. These results indicate that NPCs can move through the double nuclear membranes and, moreover, can do so to form NPC clusters in mutant strains. Such clusters may result by releasing NPCs from a nuclear tether, or by disappearance of a protein that normally prevents pore aggregation. This system represents a novel approach for identifying regulators of NPC assembly and movement in the future.
Nuclear pore complexes (NPCs)1 regulate the exchange of macromolecules across the nuclear envelope (Forbes, 1992 Considerable progress has been achieved using fractionated Xenopus egg extracts to characterize the assembly of
nuclear envelopes in vitro (Lohka and Masui, 1983 NPC and/or nuclear envelope structural perturbations
have been observed in many different yeast mutants
(Wente et al., 1996 Several fundamental aspects of NPC physiology also have
not been adequately examined. Integral membrane proteins can diffuse within the lipid bilayer of the yeast outer
nuclear membrane (Latterich and Schekman, 1994 Strains and Plasmids
General yeast manipulations were conducted by standard methods (Sherman et al., 1986 Table I.
Yeast Strain Genotypes
GFP-Nup49p under control of the galactose-inducible promoter
(GAL10) was integrated at the NUP49 locus by the gene deletion method
of Baudin et al. (1993) Characterization of GFP-Nup49p and 2 µ NUP49
To determine doubling times, cells were grown in YEP (1% yeast extract,
2% bactopeptone) containing 2% glucose, diluted to 106 cells per ml, and
incubated at 23°, 30°, or 37°C. Aliquots were taken from cultures every
hour for 12 h, and finally after 23 h. Cell number was determined by measuring the optical density at 600 nm and by counting. Colocalization of
GFP-Nup49p with Nup116p was performed by indirect immunofluorescence in wild-type (SWY809) cells as described previously (Wente et al.,
1992 To compare expression levels of Nup49p, total yeast cell extracts and
immunoblotting were conducted as described (Iovine et al., 1995 Movement and Assembly Assays
For live-time experiments with mating cells, ADE2 cells were grown in
synthetic complete (SC) media lacking tryptophan and containing 2% glucose and 0.1 mg/ml 4 Visualization of NPC Clusters in Live Cells
To monitor formation of NPC clusters using indirect immunofluorescence, gle2-1 cells expressing GFP-Nup49p under the control of the
GAL10 promoter and NUP49 on a 2 µ plasmid (SWY1324) were grown at
23°C overnight in SC media lacking histidine ( Experimental Rationale for an NPC Movement Assay
To characterize NPC dynamics, an approach was designed
based on GFP technology (Stearns, 1995
Besides the movement of preexisting NPCs, an increase
in GFP-Nup signal in the recipient nuclear envelope may
also be due to assembly of new NPCs from individual components including GFP-Nup or to the exchange of individual
GFP-Nup for unlabeled Nup components between existing NPC structures. To measure the rate of such assembly/ exchange, a modification of the movement assay was designed (Fig. 1, right). The unilateral karyogamy mutant
kar1-1 was incorporated into the genotype of the donor
strain. Kar1p is a well-characterized component of yeast
spindle pole bodies, and it is required for early nuclear migration steps in karyogamy (Conde and Fink, 1976 GFP-Nup49p Is Functional and Localizes to NPCs
Previous studies have shown that the carboxy-terminal domain of Nup49p is sufficient for NPC function (Iovine et al.,
1995 Wild-Type NPCs Move within the Nuclear Envelope
To monitor changes in NPC distribution after nuclear fusion, cells expressing GFP-Nup49p were mated at 30°C to
wild-type cells expressing both chromosomal unlabeled
Nup49p and excess unlabeled Nup49p from a 2 µ plasmid.
Matings were conducted in synthetic minimal media containing 0.1 mg/ml DAPI and lacking tryptophan (to ensure
maintenance of the 2 µ NUP49 plasmid). Cells were concentrated onto an agarose-coated slide and scanned at
room temperature using Nomarski optics and DAPI filters
for the presence of zygotes in which the two nuclei had not
fused. Time-lapse videos of GFP-Nup49p fluorescence
were acquired by projecting 10 focal planes 0.5 µm apart
onto a single two-dimensional image every 2 min until the new diploid nucleus budded. The objective was to standardize each zygote video by the following criteria: the
zero time point was at or before the point of nuclear fusion, and the last time point was at or after the point of nuclear division. Fig. 3 shows an example of two zygotes that
were found in the same field with representative frames
over a 98-min video shown. The bottom zygote had already undergone nuclear fusion at time 0. The nuclei in the top zygote fused at 8 min (between the 6- and 12-min
time points shown). By the end of the video, the diploid
nucleus had undergone mitosis, and the new daughter nucleus was entering the bud (98-min frame). At this point,
the top nucleus was also starting to divide.
Since key nuclear fusion events take place in a time
scale of minutes, we monitored NPC dynamics over the
same time scale. At the 0-min time point of the video in
Fig. 3, the GFP-Nup49p signal was just beginning to distribute around the entire circumference of the diploid nucleus in the bottom zygote. At later times (24 min), it is
clear that the diploid nucleus of the bottom zygote was
entirely encircled by GFP-labeled NPCs. The top zygote
appeared to follow similar kinetics for acquiring GFPlabeled NPCs around the entire new diploid nucleus: fusion occurred at ~8 min and complete redistribution was
achieved at ~34 min. Data from observing 19 other independent zygotes were identical in terms of the time frame
for redistribution of the GFP-Nup49p signal. In general, the entire nuclear surface area of the newly formed diploid
was encircled in GFP fluorescence within 25 min after nuclear fusion. The distinct shape of the fused diploid nucleus served as a marker for nuclear movements, and focusing through the z-axis confirmed an even distribution
of GFP-Nup49p signal over the entire nuclear surface. Because the signal did not stay confined to the area of the nuclear envelope from the donor nucleus, this suggested that
NPCs move over the surface of the nucleus in the nuclear envelope.
NPC Movement Is Distinguishable from NPC Assembly
Inherent in the NPC movement hypothesis is the assumption that the redistribution of GFP-Nup49p was not simply due to assembly of GFP-Nup49p into NPCs in the nuclear surface of the recipient nucleus. Several experiments
were conducted to test this possibility. First, if the redistribution was due to movement, the GFP fluorescent signal
should spread across the surface of the recipient nucleus with the point in the recipient nucleus farthest from the fusion junction acquiring GFP fluorescent signal last. In contrast,
incorporation of either newly synthesized GFP-Nup49p or
GFP-Nup49p disassembled from donor NPCs would likely
be random and appear uniformly over the entire surface of
the recipient nucleus. To test this hypothesis, the redistribution of signal for the top zygote in the Fig. 3 video was
quantified. At time points during the redistribution, measurements of the fluorescence signal intensity were taken
at ~0.3-µm increments across a line spanning the fused
diploid nucleus. An image of the zygote at time 0 is shown
in Fig. 4 with a representative line for data collection designated. The data from multiple time points during the
video are displayed in a compiled histogram (Fig. 4). Each
colored ribbon represents a time point. Over time (y-axis),
the total donor signal decreased while the recipient signal
increased. However, it is clear that the signal over the entire surface area of the recipient did not increase uniformly. The region closest to the nuclear membrane fusion
point was the first region to begin increasing, and the far
edge of the recipient nuclear surface (Fig. 4, right) was the
last to gain signal. Moreover, the far edge of the donor nucleus (left) was the last region to decrease in signal. These
redistribution results suggest that preexisting donor GFPlabeled NPCs are moving over the surface of the recipient.
Second, the rate of GFP-Nup49p incorporation into
NPCs was directly determined in experiments with a kar1-1
donor strain expressing GFP-Nup49p. When kar1-1 nup49
Rate of NPC Movement
To compare apparent NPC movement rates in wild-type
zygotes to apparent NPC assembly rates in kar1-1 zygotes,
videos were quantified for the total relative fluorescence
values of the recipient and donor nuclei (or the relevant nuclear surface from each). The fluorescence ratio (recipient
to donor) was plotted vs time, and the data from one representative video for each zygote type are shown in Fig. 6.
Data collection began at a similar relative time point (when
the donor nucleus was approximately four times as bright
as the recipient nucleus). In zygotes with a wild-type background, the recipient nucleus acquired GFP fluorescence
to equal the GFP fluorescence of the donor nucleus (ratio
of 1) before nuclear division occurred (top arrow). In the
kar1-1 zygotes, however, the two haploid nuclei divided
(lower arrow) before the recipient nucleus acquired GFP
fluorescence comparable to that associated with the donor
nucleus. The change in the fluorescence ratio (F.R.) per
min was calculated from the slopes of multiple data sets.
The rate of apparent movement (in wild-type cell experiments with the Nup49p 2 µ plasmid, n = 19) was 0.017 ± 0.009 F.R./min. In comparison, the relative rate of GFP-
Nup49p incorporation (in kar1-1 cell experiments with the
Nup49p 2 µ plasmid, n = 5) was only 0.0025 ± 0.0006 F.R./
min. Therefore, the rate of apparent NPC movement was
at least sixfold greater than the rate of GFP-Nup49p incorporation into NPCs.
Similar experiments were also performed using a recipient strain with only chromosomally expressed levels of unlabeled Nup49p. In such zygotes formed by crossing kar1-1
nup49 NPCs Move to Form Clusters in Temperature-arrested
gle2-1 Cells
Mutations in the gene encoding the NPC-associated factor
Gle2p have recently been characterized (Murphy et al.,
1996 First, we tested if clusters in gle2-1 cells were formed from
preexisting NPCs. GFP-Nup49p was placed under control
of the GAL10 promoter in gle2-1 cells, allowing GFP-
Nup49p synthesis to be strictly controlled by specific galactose induction and glucose repression of the GAL10
promoter (Fig. 8 B). With GAL-GFP-nup49 as the only
source of Nup49p, wild-type growth was obtained in media
containing 0.5% galactose and 1.5% raffinose (data not
shown). A 2 µ plasmid harboring NUP49 was transformed
into the GAL-GFP-nup49 gle2-1 cells to ensure that any
phenotypes detected after addition of glucose were not
simply due to the depletion of Nup49p (an essential nucleoporin). The NUP49 2 µ plasmid supported growth of the
GAL-GFP-nup49 gle2-1 cells in media containing glucose as the sole carbon source (data not shown). The GALGFP-nup49 gle2-1 cells were grown at 23°C in media containing galactose, and then maintained in galactose media
or washed into media containing 2% glucose for 1 h before
a 5-h temperature shift to 37°C. Cells were processed for
direct visualization and indirect immunofluorescence using the anti-Nup116p antibody as described for Fig. 2 C. As shown in Fig. 8 A, cells grown in either glucose- or galactose-containing media at 23°C did not exhibit the clustering phenotype (first and third columns). In contrast,
cells shifted to 37°C for 5 h exhibit the NPC clustering phenotype whether they were grown in glucose- or galactosecontaining media (second and fourth columns). Similar
results were seen for cells grown at 23°C in glucose or galactose media for 5 h before the 37°C shift (data not shown). These results suggested that NPC clusters in gle2-1 cells
formed by movement of preexisting NPCs into aggregates
rather than by the assembly of new NPCs into a distinct
area of the nuclear envelope.
To directly monitor NPC movement into clusters, cluster formation in live gle2-1 cells was observed. The gle2-1
cells expressing GFP-Nup49p under control of the GAL10
promoter were grown in galactose media as for the fixed
cell experiment in Fig. 8 A. Cells were washed into media
containing 2% glucose for 5 h before being concentrated onto an agarose-coated slide. Cells were shifted to 37°C
using a temperature-controlled microscope stage. Videos
of GFP fluorescence were acquired as in the movement
and assembly assays, with time points taken every 20 min
for 5 h. Selected frames are shown in Fig. 9. At time points
up to 100 min after the 37°C shift, no GFP-labeled clusters
were observed. However, by 140 min, NPC clusters were
detectable (Fig. 9, arrowheads) and appeared to become
larger at later time points (300 min). To determine if NPC
cluster formation was reversible, gle2-1 cells grown at 37°C
were shifted back to growth at 23°C for extended time periods. The GAL-GFP-nup49 gle2-1 cells were grown in
media containing galactose, and then shifted for 5 h to
37°C in media containing 2% glucose. Cells were prepared for live microscopy, and the temperature-controlled microscope stage was used to shift to growth at 23°C. A field
of cells is shown in Fig. 10. Four cells each with distinct
NPC clusters were present at the 0 time point (after the
5-h shift to 37°C). After 8 h at 23°C, the cells had clearly
divided (compare the Nomarski images in the first and last
panels). However, the NPC clusters were still present.
Therefore, the clusters did not disassemble over the same
time frame that they assembled.
We have developed a new assay to measure NPC dynamics in live yeast cells. The assay involves mating a cell expressing a GFP-Nup with a cell expressing an unlabeled
Nup and monitoring GFP-labeled NPC distribution in the
zygotic nucleus. Studies using this assay have yielded two
important conclusions concerning NPC physiology: first,
that NPCs have a remarkable degree of mobility within
the double nuclear membrane; and, second, that NPC clustering in at least one mutant results from the migration of
existing NPCs into groups rather than NPC biogenesis at a
fixed site on the envelope. The fact that NPCs can move
over the nuclear surface presents a significant change in
thinking about NPC dynamics.
Previous studies of yeast clustering mutants have suggested two different mechanisms for NPC cluster formation. If NPCs are assembled at a single site on the nuclear
surface (such as near the spindle pole body), the clusters
may arise from the inability of these newly assembled
NPCs to migrate away. Alternatively, clusters may form
via aggregation of mutant NPCs moving in the nuclear envelope. Using the GFP-Nup49p system and the temperature-dependent gle2-1 clustering mutant, we were able to
distinguish between these two models for pore dynamics.
Clusters in gle2-1 cells form by the movement of preexisting NPCs. The movement of NPCs into such clusters occurs after release from a nuclear tether. Alternatively, the
clusters may result from the disappearance of a protein
that normally prevents pore aggregation. Interestingly, the
NPC clusters formed in gle2-1 cells at 37°C did not rapidly
disappear after shifting back to growth at 23°C. This suggests that once clusters were formed in gle2-1 cells, the
NPCs in those clusters lost the ability to move. Incorporation of newly synthesized Gle2p at 23°C may be required
for movement of the NPCs out of clusters. If this occurs at
a rate similar to that for GFP-Nup49p incorporation into
NPCs, the observed slow reversibility would be expected.
Understanding the mechanism of NPC cluster formation is especially important because clustering has thus far
proven a fairly prevalent phenotype for mutations in NPCassociated factors. At this point, roughly one-third of the
identified genes encoding NPC-associated proteins have
mutant alleles that result in NPC cluster formation. It is
possible that the mechanism for cluster formation may be
different among the known yeast mutants and will reflect
distinct functional roles for the individual components. Three
general types of clustering phenotypes have been reported: nup145, nup133, nup120, nup84, and nup85 mutants form clusters constitutively at all growth temperatures (Doye et al., 1994 Rapid movement (up to 1.48 µm/min) has been previously characterized for the spindle pole body, a large organelle embedded in the yeast nuclear envelope (Kahana
et al., 1995 There are several interesting functional consequences to
consider, knowing that NPCs have the capacity to move
within the nuclear membrane. If de novo assembly of NPCs
occurs at one or a few sites of the nuclear envelope, the
ability of NPCs to move within the nuclear envelope may
serve to distribute NPCs around the nuclear periphery. It
is also possible that the cell may respond to environmental
or developmental stimuli by allowing NPCs to move, e.g.,
to active sites of transcription. The localized patches of NPCs
in spermatocytes (Fawcett, 1981 Several independent criteria were used to distinguish
between NPC movement and incorporation of GFP-
Nup49p into NPCs. These include experiments with kar1-1
cells, the addition of excess unlabeled Nup49p, and quantitative analysis of the signal spreading over the surface of
the fused nuclei. In the kar1-1 assay, the incorporation of
GFP-Nup49p into NPCs was directly monitored. Measurements of the rate of redistribution in wild-type vs
kar1-1 cell types were clearly distinct, and thus support the
hypothesis that NPCs move. In fact, the GFP-labeled
NPCs moved over the surface of the nuclear envelope at a
rate approximately sixfold faster than the rate for incorporating GFP-Nup49p into NPCs. However, the kar1-1 experimental strategy could not distinguish between incorporation due to exchange into preexisting NPCs vs that
due to new NPC assembly. Therefore, the analysis yields a
combined assembly rate from both sources. In wild-type
yeast cells, no cytoplasmic pool of nucleoporins from either the GLFG or the FXFG family has been detected
(Aris and Blobel, 1989 What is the mechanism of NPC movement? Because
limitations on in vivo microscopy do not allow resolution
of individual NPCs, the rate of NPC movement in this report has been inferred from the redistribution of a population of NPCs. Using this assay, we will be able to directly
test whether NPC movement requires energy or any known
motor proteins. Constraints on freedom of movement can
also be examined, such as in areas where the nucleus abuts
the vacuole (Severs et al., 1976
; Melchior and Gerace, 1995
;
Gorlich and Mattaj, 1996
). These large proteinaceous assemblies are presumably anchored via integral membrane
proteins in ~90-nm-diam pores that join the inner and
outer nuclear membranes. High resolution EM studies of
amphibian oocyte NPCs have yielded a three-dimensional
reconstruction of NPC ultrastructure. The NPC is a cylindrical entity with a superficial octagonal symmetry that is
characterized by distinct substructures referred to as spokes,
rings, a central plug, cytoplasmic fibrils, and a nuclear basket (Ris, 1991
; Stewart, 1992
; Akey, 1995
; Goldberg and
Allen, 1995
; Pante and Aebi, 1996
). To account for this organizational complexity, NPC biogenesis is likely a highly
regulated process that coordinates the formation of the
nuclear pore with the assembly of soluble NPC proteins
(nucleoporins). In addition, formation of NPCs is finely
controlled to account for the maintenance of NPC density
over the nuclear surface during cell growth and for reversible NPC disassembly during mitosis in higher eukaryotic cells (Maul, 1977
; Forbes, 1992
; Wiese and Wilson, 1993
;
Gerace and Foisner, 1994
).
). Both
vesicular and soluble components are necessary for the in
vitro assembly of transport-competent NPCs (Sheehan et
al., 1988
; Dabauvalle et al., 1990
; Finlay and Forbes, 1990
;
Finlay et al., 1991
; Vigers and Lohka, 1991
). Moreover, nuclear vesicle fusion requires energy, an N-ethylmaleimide-sensitive factor, and possibly localized Ca+2 gradients (Newport, 1987
; Newmeyer and Forbes, 1990
; Pfaller et
al., 1991
; Boman et al., 1992a,b; Newport and Dunphy,
1992
; Vigers and Lohka, 1992
; Sullivan et al., 1993
). To order the steps of NPC assembly, Macaulay and Forbes
(1996)
developed an anchored nuclear assembly assay using Xenopus egg extracts. Their work demonstrated that
the formation of the double nuclear membrane precedes
the Ca+2-dependent, GTP
S-sensitive assembly of NPCs
(Macaulay and Forbes, 1996
). However, in all cell types,
the components required for NPC assembly into intact nuclear envelopes remain largely undefined.
). In some cases, these phenotypes may
reflect effects on NPC biogenesis such that NPC assembly
is inhibited or an accumulation of NPC assembly intermediates results. Depletion of the nucleoporin Nsp1p or of
mutant alleles of the gene encoding the nucleoporin Nic96p results in a reduction of NPC density over the nuclear surface (Mutvei et al., 1992
; Zabel et al., 1996
). In nup116 null
mutants or when NUP170 is overexpressed in a pom152
null mutant, stacks of intranuclear double membranes
with NPC-like structures are observed (Wente and Blobel,
1993
; Aitchison et al., 1995b
). These stacks resemble the
intranuclear annulate lamellae found in vertebrate cells
(Kessel, 1983
), which possibly serve as a storage form for NPCs. Mutations in several nucleoporin genes can also alter the distribution of NPCs over the nuclear surface. In
wild-type yeast cells, NPCs are distributed over the nuclear surface at a density of ~15 NPC per µm2, and they
are excluded from areas where the vacuolar and nuclear membranes abut (Severs et al., 1976
). This distribution is
altered in cells expressing mutant alleles of nup145, nup133,
nup159, nup120, nup84, nup85, and gle2 (Doye et al., 1994
;
Wente and Blobel, 1994
; Aitchison et al., 1995a
; Gorsch et al.,
1995
; Heath et al., 1995
; Li et al., 1995
; Pemberton et al.,
1995
; Goldstein et al., 1996
; Murphy et al., 1996
; Siniossoglou et al., 1996
), where large clusters of NPCs in localized patches of nuclear envelope are observed. Vertebrate
NPCs are also found in localized patches in certain specialized cell types, such as spermatocytes (Fawcett, 1981
). Further analysis will be required to demonstrate whether any
of these yeast nucleoporins are bona fide NPC assembly
factors.
). Do the
NPCs anchored in the nuclear pore via integral membrane
proteins move over the nuclear surface? Alternatively, is
NPC position fixed after assembly (are they locked in place)?
Moreover, studies have not directly monitored the rate of
NPC assembly. This information is important for a molecular understanding of the cellular control of NPC biogenesis. To address these issues, we developed assays to monitor NPC dynamics in live cells of the yeast Saccharomyces
cerevisiae. NPCs in wild-type and mutant yeast cells were
fluorescently labeled by a functional fusion of the green
fluorescent protein (GFP) of Aequorea victoria to the nucleoporin Nup49p. Rates of NPC movement were assessed by monitoring GFP-Nup49p location during mating and
nuclear membrane fusion with an unlabeled yeast strain.
We found that wild-type NPCs moved freely within the
nuclear envelope at a rate distinct from that for incorporating GFP-Nup49p into NPCs. Finally, cluster formation
in gle2 cells was due to the movement of NPCs into a localized area of the nuclear envelope. The development of this technology has allowed the first analysis of NPC dynamics
in live cells.
Materials and Methods
), with transformations by the lithium acetate method (Ito
et al., 1983
). DH5
was used as the bacterial host for all plasmids. The S. cerevisiae strains used in this study are described in Table I. The kar1-1 allele was identified by quantitative mating assays (Meluh and Rose, 1990
).
The gle2-1 allele was identified by monitoring the temperature sensitivity of the mutants. All plasmids were made by standard methods (Sambrook et al., 1989
). Chromosomal integration of the ADE2 gene used pSW286 (an ~3,600-bp BamHI ADE2 fragment from pLSD257 in the integrating vector pRS306; Sikorski and Hieter, 1989
). pSW240 and pSW241 were constructed by ligating a 2,415-bp BamHI/SalI fragment containing the
entire NUP49 locus from pSW40 (Wente et al., 1992
) into the 2 µ plasmids
pRS423 and pRS424 (Christianson et al., 1992
), respectively. pSW441 was
made by insertion of the 735-bp GFP-S65T BamHI fragment from
pBJ646 (Waddle et al., 1996
) into pNLS-E1 (Underwood and Fried,
1990
). A BamHI/PstI-digested 715-bp PCR product (containing the
NUP49 promoter and initiation methionine) and a BamHI/KpnI PCR
product (containing the last 764 bp of the NUP49 coding sequence [corresponding to amino acids 473-726] and 211 bp of 3
sequence) were ligated
into PstI/KpnI-digested pRS304 (Sikorski and Hieter, 1989
) to yield
pSW420. pSW442 was made by inserting the BamHI GFP-S65T fragment
into BamHI-digested pSW420.
Fig. 2.
GFP-Nup49p is
functional and localizes to
NPCs. (A) Plasmid DNA encoding for GFP-Nup49p fusion protein was cut with
AvrII for chromosomal integration into a diploid strain
heterozygous for the NUP49
null allele, nup49
::URA3.
Haploids expressing GFP- Nup49p were obtained by
sporulation and dissection of
Trp+ Ura+ diploids in which
TRP1 and URA3 markers
cosegregated. (B) Cells expressing GFP-Nup49p grow
at rates comparable to wildtype cells at all temperatures.
Growth curves are plotted as
the log10 of the cell concentration over time. (Circles)
SWY809, nup49
GLFG:: GFP-S65T cells; (squares)
SWY518, wild-type cells. (C)
GFP-Nup49p colocalizes with
the nucleoporin Nup116p.
Immunofluorescence was performed on cells expressing GFP-Nup49p using an
affinity-purified polyclonal
antibody against Nup116p.
GFP fluorescence was visualized directly, and the antiNup116p antibody was visualized using a Texas red-
conjugated goat anti-rabbit
antibody. Nuclear DNA was visualized by DAPI staining.
Bar, 10 µm.
[View Larger Versions of these Images (14 + 10 + 64K GIF file)]
Fig. 7.
Cells harboring the 2 µ NUP49 plasmid have elevated
levels of Nup49p. Yeast strains SWY459 (wild type, lane 1) and
SWY759 (SWY459 cells harboring the 2 µ NUP49 plasmid, lane
2) were grown in synthetic media lacking uracil or tryptophan, respectively. Total protein extracts were prepared from equivalent
numbers of cells, separated on a 9% SDS polyacrylamide gel, and
transferred to nitrocellulose. Blots were probed with an affinitypurified polyclonal antibody raised against the GLFG region of
Nup116p that also recognizes Nup49p (gift of K. Iovine and J. Watkins, Washington University, St. Louis, MO).
[View Larger Version of this Image (33K GIF file)]
. Wild-type SWY595 cells were transformed with a
PCR product generated with oligos GFB (5
TCCTGCAGGTTTAGAGCCAAATAGTCCAGCGCTTGCATTATTCATCCCTTT GT A T AGTTCATCC 3
) and 49U (5
CGATAAAAACAGTAATTGAGAGGGTTTTCACGGGTAGTGGGCACACAATTCAATTCATCATTTT 3
) using pSW441 as template. This template contained the 1,173-bp URA3 gene and GFP-S65T in frame with the initiation ATG supplied by
a portion of CYC1 under control of GAL10. Sequences flanking the PCR
product are complimentary to nucleotides of the NUP49 locus and placed
GAL10 GFP-S65T in frame with the NUP49 open reading frame. Integration at the NUP49 locus was confirmed by genomic colony PCR.
), using a 1:10 dilution of affinity-purified rabbit polyclonal antibody
against the carboxy terminus of Nup116p (Iovine et al., 1995
). Texas red- conjugated goat anti-rabbit IgG at a 1:200 dilution was used to visualize
bound antibody. Photographs were taken using a microscope (Olympus
Corp., Lake Success, NY) with a ×100 oil-immersion objective, a CCD
camera, and the public domain NIH Image 1.59 program (developed at
the United States National Institutes of Health and available from the Internet by anonymous FTP from zippy.nimh.gov) on a Power Macintosh
9500/132 with a framegrabber card (LG-3; Scion Corp., Frederick, MD).
). Bands
were visualized by developing with nitro blue tetrazolium and 5-bromo-4chloro-3-indolyl-1-phosphate (Promega, Madison, WI).
,6-diamidino-2-phenylindole (DAPI). Matings were
performed by mixing ~107 cells of each mating type for 5 h in a 25-ml culture. Mating mixtures were concentrated by centrifugation and briefly
sonicated. Slide preparation was conducted as described (Waddle et al.,
1996
). Briefly, cells were dispensed onto a pad containing 2% agarose and
2% glucose in SC media (Bio101, Vista, CA) that was mounted onto a
double-well Teflon-coated slide (Cell-Line Associates, Newfield, NJ).
Coverslips with a thin line of Vaseline at the edges were used to disperse
the small drop of culture and to prevent drying. Slides at room temperature were scanned for zygotes or schmooing cells. Cells of opposite mating
types were distinguishable because one strain expressed the directly visible
GFP-Nup49p, whereas the other did not. Uptake of DAPI into cells of
both mating types was used to determine if nuclear fusion had occurred in the zygotes. Videos of GFP fluorescence were taken as described (Waddle
et al., 1996
) by scanning z-axis focal planes, 0.5 µm apart (typically ten total), at each 2-min time point using the Olympus microscope and NIH Image 1.59. Image Math was used to project all the z-axis focal planes onto
one two-dimensional image. In this final image, each pixel represents the
brightest value for that position in all of the focal planes ("min" operator). The microscope was equipped with optivars allowing magnifications of
up to 6,000 with the ×100 objective and an ISIT-68 camera (Dage-MTI Inc., Wabash, MI). The stage and shutters were controlled by a Ludl box
(MAC2000; Ludl Electronic Products Ltd., Hawthorne, NY). Photobleaching was minimized using neutral density filters. Videos ranged from 1-4 h
and selected frames are shown in the figures. Complete time-lapse videos
can be viewed on our World Wide Web page at http://www.wentelab.
wustl.edu. NIH Image 1.60 was used to quantify fluorescence values of areas encircling half-nuclei in the case of wild-type zygotes or entire nuclei
in the case of kar1-1 zygotes, resulting in average pixel brightness values. For quantifying, pixel values were first inverted such that grayscale values
ranged from 0-256, with 0 being no fluorescence signal and 256 being the
maximum fluorescence value. There were no saturated pixels in the images used for quantification (theoretically above 256 or below 0). The fluorescence ratio is defined as the ratio of the average fluorescence value of
pixels contained within the recipient nucleus divided by the average fluorescence value of pixels contained within the donor nucleus.
his) and containing 0.5%
galactose and 1.5% raffinose. Cells were then shifted for 1 h to SC
his
containing 2% glucose. Samples were processed for indirect immunofluorescence before and after a shift to 37°C. GFP fluorescence was visualized
directly, and Nup116p was visualized using the polyclonal antibody derived against the carboxy terminus as described above. Photographs were
taken on an Olympus microscope with T-Max 400 film (Eastman Kodak
Co., Rochester, NY). To monitor formation of NPC clusters in live cells, gle2-1 cells expressing GFP-Nup49p from the GAL10 promoter were grown at 23°C in media containing 0.5% galactose and 1.5% raffinose. After a 5-h shift into media containing 2% glucose, cells were mounted on an
agarose pad as described for the movement assay. The slide was shifted to
37°C using a temperature-controlled stage (MicroIncubator 5000; 20/20
Technology, Inc., Wilmington, NC) on the Olympus microscope described
above. Videos were taken as described for the movement assay with
frames every 20 min. To monitor the disappearance of gle2-1 clusters in
live cells, gle2-1 GAL-GFP-nup49 cells were grown in SC
his with 0.5%
galactose and 1.5% raffinose at 23°C. Cells were then washed into SC
his with 2% glucose and simultaneously shifted to 37°C for 5 h. Slides were prepared as for the movement assay. The temperature-controlled stage maintained the slide at 37°C until the videos were started and the
stage was returned to 23°C. The videos monitored GFP fluorescence in
the cells at 23°C as described above.
Results
) and the observation that nucleoporins (NUP) can be functionally fused to
a heterologous polypeptide sequence (Nehrbass et al., 1990
;
Wente et al., 1992
; Grandi et al., 1993
). If an in-frame fusion of an NUP to the coding sequence for GFP was expressed in yeast cells, we predicted that NPCs could be
monitored by direct fluorescence microscopy of live cells. To detect NPC movement, we exploited an aspect of the
budding yeast life cycle. In yeast, the nuclear envelope remains intact throughout all stages of the life cycle. Upon
mating to form a diploid, the nuclear envelopes of the two
haploid nuclei fuse. For the NPC movement assay (Fig. 1,
left), one haploid strain expresses a GFP-labeled Nup (donor nucleus), whereas the strain of the opposite mating
type (recipient nucleus) expresses only unlabeled Nup.
Movement of GFP-labeled NPCs would be detected by
the spreading of fluorescent signal over the entire surface of the newly formed diploid nucleus. If the fluorescent signal remained confined to the portion of the nuclear envelope from the donor nucleus, this would reflect a lack of
NPC movement. This approach is similar to that used by
Latterich and Schekman (1994)
to monitor the fate of two
proteins of the ER (which is contiguous with the outer nuclear membrane). Using differentially epitope-tagged haploid strains and indirect immunofluorescence microscopy,
Sec61p (an integral membrane protein of the outer nuclear membrane) and Eug1p (a soluble protein in the lumen of the nuclear envelope) both diffuse over the entire
surface of a newly formed diploid nucleus.
Fig. 1.
NPC movement and assembly assay. A haploid yeast
strain expressing only GFP-Nup49p (Donor) is mated with a
haploid strain expressing unlabeled Nup49p (Recipient). In the
case where both strains are otherwise wild type (WT), the labeled
nucleus (thick circle) will fuse with the recipient nucleus (thin circle) upon mating. Movement of NPCs can then be monitored by
watching GFP-Nup49p redistribution in live cells. In a kar1-1
background (kar1-1), the nuclei are unable to fuse and GFP-
labeled NPCs are obtained by the recipient nucleus only by incorporation into preexisting/new NPCs. The rate of acquisition of
GFP-NPCs in the recipient nuclei reflects either the movement
of NPCs or the assembly of NPCs, respectively.
[View Larger Version of this Image (16K GIF file)]
; Rose
and Fink, 1987
; Vallen et al., 1992
; Kurihara et al., 1994
). Since the nuclear envelopes do not fuse in zygotes formed
from the mating of a wild-type and a kar1-1 cell, redistribution of the GFP signal would only be observed from direct assembly/exchange of the GFP-Nup into NPCs. Thus,
in kar1-1 cells, the rate of GFP signal appearance in the
NPCs of the unlabeled recipient nucleus will reflect the assembly/exchange of GFP-Nup into NPCs. An assumption in this strategy is that the kar1-1 mutant does not perturb
NPC biogenesis. In all cases, the kar1-1 mutant was incorporated into the genotype of the donor strain. Both
schemes in Fig. 1 could also be conducted in the presence
of excess unlabeled Nup expressed in the recipient cells on
a multicopy (2 µ) plasmid. The excess unlabeled Nup
would effectively act as a "chase" during and after cell fusion, and lower the apparent contribution of GFP-Nup
assembly/exchange. Thus, any change in GFP-Nup distribution in the movement assay would likely not be due to
incorporation of GFP-Nup into NPCs of the recipient nucleus.
). Therefore, the amino-terminal glycine-leucine-phenylalanine-glycine (GLFG) region of Nup49p was replaced with the S65T variant of GFP (Heim and Tsien,
1996
) as diagrammed in Fig. 2 A. The nup49
GLFG:: GFP-S65T allele was integrated into the nup49 null chromosome by transformation and homologous recombination. Three criteria were used to test whether the GFP-
labeled protein had the ability to function in place of the
wild-type protein. First, the nup49
GLFG::GFP-S65T allele rescued the lethal phenotype of the null mutant. Second, the nup49
GLFG::GFP-S65T haploid strains grew at
rates comparable to wild-type strains at 23°, 30°, or 37°C
(Fig. 2 B). Finally, GFP-Nup49p localization was determined by fluorescence microscopy. The GFP signal showed
a nuclear rim staining pattern typical of nucleoporin localization. Moreover, indirect immunofluorescence with a
polyclonal antibody against Nup116p showed that the
GFP-Nup49p colocalized with the nucleoporin Nup116p
(Fig. 2 C). These data suggested that GFP-Nup49p maintained the full functionality of wild-type Nup49p and was
an appropriate marker for analyzing NPC dynamics.
Fig. 3.
Wild-type NPCs move within the nuclear envelope. Cells expressing GFP-Nup49p (SWY809) were mixed with cells of the opposite mating type expressing wild-type Nup49p from the chromosome and a high copy number plasmid (SWY759). After 5 h in culture,
cells were prepared for video microscopy by incubating mating mixtures on an agarose-covered slide. Both Nomarski and fluorescence
images for the 0- and 98-min time points are shown. Two newly formed zygotes are shown. GFP-Nup49p distribution was recorded every 2 min for 98 min, and selected frames are shown here. Each fluorescent image is a two-dimensional projection of all z-axis planes.
By the end of the sequence (98 min panel), the two zygotes are at various stages of nuclear division, allowing nuclear segregation into
the newly formed daughter buds (Nomarski image, 98 min). Numbers indicate time in min. Bar, 5 µm.
[View Larger Version of this Image (110K GIF file)]
Fig. 4.
Time course of GFP-Nup49p redistribution in the zygotic nucleus. A representative image is shown from early in the video of the top wild-type zygote in Fig. 3. At each time point during the video (y-axis), a line spanning the donor and recipient nuclear surfaces
was designated (shown in white with the dot marking the fusion junction). Distance along the line is graphed on the x-axis. For each line
in the respective zygotic nucleus, NIH Image 1.60 was used to quantify the fluorescence intensity at 28 points ~0.3 µm apart. The fluorescence values of each two sequential measurements along the x-axis were averaged, and the 14 resulting relative fluorescence data
points were graphed on the z-axis. The first time point at 8 min in the video (blue ribbon) represents the approximate time of nuclear fusion. Later time points are shown in different colors along the y-axis. Microsoft Excel 4.0 (Seattle, WA) was used to display the graph.
[View Larger Version of this Image (36K GIF file)]
GLFG::GFP-S65T cells were mated with wild-type cells
expressing both chromosomal unlabeled Nup49p and excess unlabeled Nup49p on a 2 µ plasmid, the nuclei did not fuse. Fig. 5 shows frames from a representative 98-min video, with the 0 time point representing the point at which the
zygote was found. The recipient and donor nuclei were
both dividing by the last time point (98 min). With continued incubation, the zygotes in the kar1-1 crosses typically
acquired multiple haploid nuclei as a result of continued
nuclear division in the absence of nuclear fusion (data not
shown). Thus, after division, assembly into a single nucleus
could not be assessed and the video was terminated. GFP
fluorescence signal was monitored over this time frame.
At time 0, the recipient (unlabeled) nucleus was barely visible by GFP staining (arrow in the zygote). With time, the
recipient nucleus slowly gained GFP fluorescence signal.
Data was collected from seven independent trials. In all
cases with kar1-1 cells (Fig. 1, right), the time course for
fluorescence accumulation in the recipient nucleus was notably longer than when wild-type cells were mated (Fig. 1,
left). By the 30-min time point shown in Fig. 5, the recipient nucleus was only one-fourth as bright as the kar1-1 donor nucleus (a fluorescence ratio of 0.26 recipient to donor; see below). In contrast, at the 30-min time point in the wild-type video (Fig. 3), the fluorescence signal over the
surface area of the recipient nucleus was equivalent to that
of the donor nucleus. The recipient nuclei in the kar1-1 experiments actually divided before they reached the GFP
fluorescence level of the donor nuclei. Overall, the fluorescence signal increase in the nuclear surface area of the
recipient nucleus was significantly more rapid when fused
to a donor nucleus harboring GFP-Nup49p-NPCs. Therefore, the fluorescence signal redistribution observed in the
wild-type zygotes of Fig. 3 was probably due to the movement of NPCs with minimal contribution from the assembly of GFP-Nup49p into NPCs.
Fig. 5.
NPC assembly follows a slower time course than NPC movement. kar1-1 mutant cells expressing GFP-Nup49p (SWY1308) were
mixed with cells of the opposite mating type expressing both genomic unlabeled Nup49p and unlabeled Nup49p from a high copy 2 µ plasmid (SWY757). GFP-NPC distribution was recorded in two-dimensional projection videos as described in Fig. 3. Selected frames
from a 98-min video are shown. The first and last frames are Nomarski images taken at the beginning and end of the video: note that the
two nuclei in the zygote have not fused. The recipient nucleus (arrows) slowly acquired GFP fluorescence but divided before it reached
the intensity of the GFP-Nup49p donor nucleus. Numbers indicate time in min. Bar, 5 µm.
[View Larger Version of this Image (122K GIF file)]
Fig. 6.
NPC movement rates are distinct from GFP-Nup49p
incorporation rates. Quantification of NPC movement and assembly was conducted using NIH Image to calculate the average
pixel brightness value of an area encircling the donor or recipient
nucleus. The fluorescence ratio was determined by dividing the
average brightness value of the recipient nucleus by the average
brightness value of the donor nucleus. The data for one zygote
for each type of mating are shown. (Circles) Wild-type zygote
with 2 µ NUP49 plasmid; (diamonds) kar1-1 zygote with 2 µ NUP49 plasmid; (squares) kar1-1 zygote with no plasmid. The
Cricket Graph program was used to fit a line through the linear
portion of the wild-type data set, and through all the points for
the kar1-1 experiments. (Arrows) Approximate time of nuclear
division for wild-type (top arrow) and kar1-1 zygotes (bottom arrow).
[View Larger Version of this Image (19K GIF file)]
GLFG::GFP-S65T cells to wild-type cells, the recipient nucleus never acquired GFP-Nup49p to the same
level as was associated with the donor nucleus (Fig. 6).
The relative rate of GFP-Nup49p incorporation in the absence of excess unlabeled Nup49p was 0.005 ± 0.002 F.R./ min (n = 6). This rate is approximately twofold greater
than in the presence of excess unlabeled Nup49p. Immunoblot analysis was conducted to measure the relative levels
of unlabeled Nup49p (Fig. 7). The strain with the 2 µ plasmid (+, lane 2) expressed approximately threefold more
unlabeled Nup49p compared with a similar strain expressing only chromosomal Nup49p (
, lane 1). In both strains, the levels of Nup116p were the same. Therefore, the decreased assembly/exchange rate correlated with increased unlabeled Nup49p expression levels. This suggested that the excess
unlabeled Nup49p served as an inhibitor of GFP-Nup49p
incorporation into NPCs of the recipient nucleus.
). Interestingly, gle2-1 cells show temperature-dependent formation of NPC clusters. This clustering phenotype
may result from perturbations of NPC dynamics. If NPCs
are assembled at one location on the nuclear surface, the
clusters may arise from the lack of movement by the mutant NPCs. In contrast, if NPCs are inserted randomly
over the surface, clusters may form via aggregation of mutant NPCs moving in the nuclear envelope. To determine
if the gle2-1 phenotype was due to the movement of randomly distributed NPCs into clusters, we monitored NPC
distribution with GFP-Nup49p in gle2-1 cells. In contrast
with the experiments conducted with mating cells, these
experiments monitored redistribution of GFP-Nup49p in
single cells.
Fig. 8.
NPCs move into
clusters in the gle2-1 temperature-sensitive mutant. (A)
gle2-1 cells expressing GFP-
Nup49p under control of
the galactose-inducible promoter and Nup49p from a 2 µ plasmid (SWY1324) were
grown in synthetic minimal
medium lacking histidine and
containing 0.5% galactose
and 1.5% raffinose. Half of
the cells were washed out of
galactose and into glucosecontaining media for 1 h before a shift to the nonpermissive temperature of 37°C.
Cells were maintained at
37°C in glucose or galactose for 5 h before processing for
direct visualization and immunofluorescence as described for Fig. 2 C. Clusters of NPCs appear in cells shifted to glucose as well as those maintained in galactose.
(B) PCR was performed on pSW441 to create a fragment flanked by sequences complementary to NUP49. The fragment was transformed into wild-type SWY595 cells for integration onto the chromosome. Bar, 10 µm.
[View Larger Versions of these Images (84 + 16K GIF file)]
Fig. 9.
Monitoring movement of NPCs into clusters. SWY1324 cells were grown as in Fig. 8 A to induce expression of GFP-Nup49p.
Cells were then washed into media containing 2% glucose for 5 h. Cells were shifted to 37°C on a slide set on a temperature-controlled microscope stage. Videos were taken with time points every 20 min for 5 h as described for Fig. 3. Selected frames 40 min apart are
shown. The first and last frames are Nomarski images before and after the video. Numbers indicate time after the 37°C shift in min. (Arrowheads) NPC clusters formed by NPC movement. Bar, 5 µm.
[View Larger Version of this Image (125K GIF file)]
Fig. 10.
Cluster formation in gle2-1 cells is not rapidly reversed. SWY1324 cells were induced at 23°C to express GFP-Nup49p by
growing in SC
his containing 0.5% galactose/1.5% raffinose. Cells were then shifted to 37°C in SC
his with 2% glucose for 5 h before a return to 23°C. Videos were taken as described for the movement assay in Fig. 3. Frames were taken every 30 min for 8 h after returning the cells to 23°C. Both Nomarski and fluorescence images were taken at the 0- and 8-h time points. Selected frames are shown
here. Bar, 5 µm.
[View Larger Version of this Image (62K GIF file)]
Discussion
; Wente and Blobel, 1994
; Aitchison
et al., 1995a
; Heath et al., 1995
; Li et al., 1995
; Pemberton
et al., 1995
; Goldstein et al., 1996
; Siniossoglou et al., 1996
);
the rat7-1/nup159 mutant has clusters at 23°C that disappear after ~1 h at 37°C (Gorsch et al., 1995
); and gle2 mutants exhibit cluster formation at 37°C (Murphy et al.,
1996
). The GFP-Nup assay system could be used to test
whether rat7-1/nup159 cluster disappearance at 37°C is due to disassembly of NPCs within the cluster or to movement of NPCs out of clusters.
; Yeh et al., 1995
). With respect to the complexity of NPC ultrastructure, it is surprising that NPCs also
move in the nuclear envelope across the surface of the nucleus. Vertebrate NPCs have extensive connections to intranuclear filamentous networks (including the lamins and the lattice) as well as proposed connections to the cytoskeleton (for review see Goldberg and Allen, 1995
). Nuclear basket-like structures and cytoplasmic filaments have
also been observed on yeast NPCs (Rout and Blobel, 1993
),
but searches of the complete yeast DNA sequence database have not revealed any predicted polypeptides with
significant similarity to the vertebrate nuclear lamins. Thus,
if the presence of lamins inhibits movement, vertebrate NPCs may not move over the nuclear surface. Alternatively, vertebrate NPCs may move, but the rate of movement could be cell type specific. Interestingly, the vertebrate lamins are not required for the assembly of NPCs in
Xenopus annulate lamellae (Dabauvalle et al., 1991
; Meier
et al., 1995
). Measurement of vertebrate NPC movement will require the development of analogous assays in vertebrate cells.
) may reflect constraints on NPC movement in this specialized cell type.
; Wente et al., 1992
), and it is presumed that, after synthesis of the polypeptides, the nucleoporins are rapidly assembled into NPCs. In this report the incorporation rate for GFP-Nup49p into NPCs has
been inferred from measuring incorporation over the entire nuclear surface. To test whether other nucleoporins
exhibit the same relative incorporation rate as GFP-Nup49p,
additional nucleoporins must be tagged and similarly assayed. If all GFP-Nups display similar incorporation rates,
this behavior may reflect that of the entire NPC. It should also be noted that apparent assembly rates may vary at different points in the cell cycle, given that measurements of
total pore number per cell have suggested yeast NPC formation peaks during and after mitosis (Jordan et al., 1977
).
Since vertebrate nuclear pore and NPC assembly requires
the prior formation of a double nuclear membrane
(Macaulay and Forbes, 1996
) and NPCs are architecturally and functionally similar in all eukaryotic organisms (Maul,
1977
; Forbes, 1992
; Osborne and Silver, 1993
; Davis, 1995
),
NPC assembly into the intact nuclear envelope of budding
yeast could occur by a similar mechanism. We predict that
studying NPC dynamics in yeast will lend insight into NPC
biogenesis in all organisms.
), in yeast cells that overexpress HMG-CoA reductase and produce extensive nuclear
envelope-associated karmellae (Wright et al., 1988
; Hampton et al., 1996
), or in yeast cells that overexpress vertebrate lamins (Smith and Blobel, 1994
). Moreover, existing
mutants can be analyzed for perturbations of NPC movement or assembly rates, and genetic screens can be conducted to isolate novel NPC assembly mutants on the basis
of their distinct fluorescent properties as compared with
wild-type cells. Our long range goal is to define the network of structural interactions that mediate NPC biogenesis by testing the involvement of particular nucleoporins in
NPC assembly and movement.
Received for publication 31 October 1996 and in revised form 23 December 1996.
We are indebted to J. Waddle and J. Cooper for advice in monitoring GFP in live yeast cells, and to J. Waddle and G. Baxter for writing the computer macros for collecting and analyzing the data. We thank M. Rose for the kar1-1 strain; R. Murphy for the gle2-1 strain; L. Riles, J. Waddle, R. Heim, and R. Tsien for plasmids; and J. Cooper, J. Waddle, K. Wilson, M. Winey, and colleagues in the Wente laboratory for insightful discussion and comments on the manuscript.This work was supported by a Beckman Young Investigator grant to S.R. Wente from the Arnold and Mabel Beckman Foundation, and an American Cancer Society Junior Faculty Research Award to S.R. Wente.
DAPI, 4
,6-diamidino-2-phenylindole;
F.R., fluorescence ratio;
GLFG, glycine-leucine-phenylalanine-glycine;
NPC, nuclear pore complex;
NUP, nucleoporin;
SC, synthetic complete
medium.
S, and BAPTA.
J. Cell Biol.
132:
5-20
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|