|
||

* Department of Bacterial Toxinology and
Department of Immunoregulation, Research Institute for Microbial Diseases, Osaka
University, Osaka 565, Japan
A cDNA encoding the Clostridium perfringens enterotoxin receptor gene (CPE-R) was cloned from an expression library of enterotoxin-sensitive Vero cells. The nucleotide sequence of CPE-R showed that the enterotoxin receptor consists of 209 amino acids with a calculated molecular mass of 22,029 D. This receptor is highly hydrophobic, contains four putative transmembrane segments, and has significant similarity to the rat androgen withdrawal apoptosis protein RVP1 and the mouse oligodendrocyte specific protein, the functions of which are unknown. The expression of CPE-R was detected in the enterotoxin-sensitive Vero, Hep3B, and Intestine 407 cell lines, but not in the enterotoxin-insensitive K562 and JY cell lines. The CPE-R gene product expressed in enterotoxin-resistant L929 cells bound to enterotoxin specifically and directly and with high affinity and rendered the cells sensitive to the toxin, indicating that the cloned receptor is functional. Results showed that enterotoxin could not assemble into a complex with a defined structure unless it interacted with the receptor. From these results, it is proposed that the enterotoxin receptor is required for both target cell recognition and poreformation in the cell membrane.
CLOSTRIDIUM perfringens enterotoxin (CPE)1, which
consists of a single polypeptide chain and has a
molecular weight of ~35,000, is the causative
agent of symptoms associated with C. perfringens food
poisoning in man (McClane et al., 1988a The sensitivities of different cell types to CPE vary.
Rabbit small intestinal epithelial cells (McDonel, 1980 Cellular proteins of 50-60 kD derived from sensitive
cells were reported to have affinity to CPE (Wnek and
McClane, 1983 To understand the molecular mechanism of the action
of CPE, we isolated the CPE-receptor gene (CPE-R) and
examined the function of the gene product. Here we report the identification and characterization of a functional
CPE receptor.
Plasmid Construction
Genomic DNA was isolated from C. perfringens strain NCTC8239 (a gift
from Dr. T. Asao, Osaka Prefectural Institute of Public Health, Osaka, Japan)
by the method described by Marmur (1961)
For constructing pCMV For sequencing, the clone 706 encoding CPE-R was isolated by XhoI
digestion followed by treatment with T4 DNA polymerase, and the fragment obtained was introduced into the EcoRV site of pBluescript SK( The CPE receptor cDNA was introduced into pMEneo vector (Watanabe et al., 1996 For construction of a COOH-terminal FLAG peptide tagged CPE receptor expression plasmid, CPE-R in pBS70614 was amplified by PCR using
the oligonucleotides 5 Plasmids pS7neo (Takahashi et al., 1996 Expression of the CPE COOH-terminal Fragment in
Escherichia coli
pETH10PER was introduced into the E. coli BL21 (DE3) strain, and expression of the CPE COOH-terminal fragment was induced by 1 mM isopropyl Flow Cytometric Analysis
Expression of the CPE receptor was examined by flow cytometric analysis
after treatment of cells with biotinylated H10PER (0.01 mg/ml) followed
by phycoerythrin (PE)-conjugated streptavidin (0.02 mg/ml; Biomeda
Corp., Foster City, CA). The fluorescence intensity of the cells was examined in a FACS®can (Becton Dickinson, Mountain View, CA).
Cell Culture and Establishment of Stable Cell Lines
Cells were cultured in DMEM supplemented with 10% FCS at 37°C under
5% CO2 in air. Clonal L929 cell lines stably expressing the polyoma large
T antigen were established by electroporation of linearized plasmid
pS7neo, followed by G418 (Geneticin; GIBCO BRL, Gaithersburg, MD)
selection. Of 20 cell lines tested, the L929 cell line, which exhibited the
highest cDNA Libraries
A cDNA library was constructed by the method of Gubler and Hoffmann
(1983) Expression Cloning
The cDNA library was introduced into the L929pyT18 cell line by electroporation and cultured for 2 d before subsequent analysis. Expression of
the CPE receptor was examined by flow cytometric analysis as described.
Positive cells (the 0.1% most fluorescent of the transfected cells) were initially sorted by FACS®Vantage (Becton Dickinson) and pooled, and the
transfected plasmids were recovered by the method of Hirt (1967) DNA Sequencing and Sequence Analysis
The nucleotide sequences of both strands of the cloned gene were determined by the dideoxy chain termination method using Thermo Sequenase
(Amersham International, Amersham, UK) and a DNA sequencer (model
373A; Applied Biosystems, Foster City, CA). Sequence comparisons were
made using the BLAST search program (Altschul et al., 1990 Northern Blot Analysis
Total RNA was extracted from various cell lines by guanidinium thiocyanate-CsTFA isopycnic centrifugation using a QuickPrep Total RNA Extraction Kit (Pharmacia Biotech). Samples of 15 µg of total RNAs were
subjected to agarose/formaldehyde gel electrophoresis. Northern blot analysis was performed by the method of Sambrook et al. (1989) Antibodies
Mouse monoclonal anti-FLAG peptide antibody M2 and M2-conjugated
Sepharose were purchased from Eastman Kodak Co. (New Haven, CT).
Alkaline phosphatase-conjugated goat anti-mouse IgG and streptavidin were from Organon Teknika (Turnhout, Belgium) and Oncogene Science Inc. (Uniondale, NY), respectively. Rabbit polyclonal antibody was raised
against CPE toxoid and purified by protein A-Sepharose chromatography
(Senda et al., 1995 Purification of CPE, Cytotoxicity Assay, and
Binding Assay
CPE was purified by the method of Sakaguchi et al. (1973) Ligand Overlay Assay
Binding of CPE to the CPE-R gene product in vitro was examined by
ligand overlay assay (Manser et al., 1992 Immunoprecipitation
706FLAG cells (1 × 106) were labeled for 8 h with 50 µCi/ml of [35S]methionine. Cells were harvested after brief trypsinization and suspended in
1 ml of DME-10% FCS. 150 pM of purified CPE or H10PER was then
added to the cell suspension. After incubating at 4° or 37°C for 30 min, the
cells were pelleted and lysed with 400 µl of PBS containing 0.5% NP-40
(PBS-N), and the mixture was centrifuged at 12,000 g for 15 min to remove cell debris. The lysate was mixed with 5 µl of anti-FLAG antibody-
conjugated Sepharose which had been blocked with PBS-N containing 5%
skim milk. The mixtures were incubated at 4°C for 3 h with mild agitation,
and the beads were washed three times with PBS-N at 4°C. The precipitated proteins were boiled in SDS-PAGE sample buffer containing 5%
In immunological studies, L929 and 706FLAG cells were harvested and
treated with CPE or H10PER at 37°C. Cell lysates were prepared and immunoprecipitated as described. The precipitated proteins were separated
by electrophoresis on SDS-15% polyacrylamide gel or SDS-2-15% polyacrylamide gradient gel (Multi Gel 2/15; Daiichi Pure Chemicals Co., Tokyo, Japan) and transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were probed with biotinylated anti-FLAG or
anti-CPE antibodies and then treated with alkaline phosphatase-conjugated streptavidin; and color was developed with NBT/BCIP.
Detection of the CPE-R Expressed on the Surface of
CPE-sensitive Cell Lines by Flow Cytometric Analysis
with a Recombinant CPE COOH-terminal Fragment
We attempted to identify a putative CPE-R by expression
cloning. For this, we used flow cytometric analysis with a
biotinylated CPE COOH-terminal fragment peptide as a
probe, since intact CPE might kill cells expressing the CPE
receptor, making it difficult to isolate cells with the CPE-R.
On the basis of reports that the most COOH-terminal part
of CPE functions as the receptor binding domain (Horiguchi et al., 1986 The purified H10PER was biotinylated, and its cell surface binding ability was examined by flow cytometric analysis. When Vero cells were treated with biotinylated H10PER
followed by phycoerythrin-conjugated streptavidin, the
intensity of fluorescence increased markedly, whereas no
increase was observed when biotinylated H10PER was omitted from the reaction (Fig. 2 A). The intensity of fluorescence decreased after pretreatment of the cells with
unlabeled H10PER (Fig. 2 A, thin line). When the human
hepatoma cell line Hep3B (Fig. 2 B) or the human intestinal epithelial cell line Henle Intestine 407 (Fig. 2 C), which
are sensitive to CPE (data not shown), was used as target
cells in this analysis, the intensity of fluorescence increased, although the levels of intensity were somewhat
lower than those of Vero cells. The binding of biotinylated H10PER to L929 cells, which are known to be CPE-insensitive (Horiguchi et al., 1985
CPE-R Encodes a Highly Hydrophobic
Membrane Protein
To identify CPE-R, we performed expression cloning. A
cDNA library from the CPE-sensitive Vero cell line was
introduced into 107 L929pyT18 cells that stably express
polyoma virus large T antigen (data not shown; see Materials and Methods) and do not bind CPE (Fig. 3 A, thick
line). 48 h after transfection, expression of CPE receptor
was monitored by flow cytometric analysis, as described, and bright cells were sorted. By this screening, the brightest 1,000 cells among 107 transfected cells were initially selected. After three rounds of screening (Fig. 3 A, thin line),
several positive clones were obtained. Clone 706 contained a fragment of ~1.7-kb DNA. Other positive clones
were screened by Southern blot analysis using the 1.7-kb
XhoI fragment from clone 706 as a probe and found to encode the same gene (data not shown).
Sequence analysis revealed that the longest open reading frame of this clone was 630 bp and that it contained a
polyadenylation signal followed by a polyA tail at its 3 We examined the expression of CPE-R in various cell
lines by Northern blot analysis with the clone 706 probe.
Of five primate cell lines tested, Vero cells expressed the
highest level of a transcript of about 1.8 kb. Its expression
was also observed in CPE-sensitive Hep3B and Intestine
407 cell lines but at considerably lower levels than in Vero
cells. No expression of CPE-R was detectable in the CPEinsensitive K562 and JY cell lines (Fig. 4, upper panel). The levels of expression of human elongation factor 1
Both CPE Binding Ability and CPE Sensitivity of an
L929 Cell Line Stably Expressing CPE-R
To determine whether the CPE-R product was functional,
we established an L929 cell line stably expressing CPE-R
(designated as the Neo706 cell line). Flow cytometric analysis revealed that the H10PER probe specifically bound to
the cell surface of Neo706 cells (Fig. 5 A, thick line). Then
we examined the CPE sensitivity of the Neo706 cell line.
Purified CPE at 100 ng/ml caused Neo706 cells to form
bleb balloons (compare Fig. 5 B, upper left with right)
which were indistinguishable from those observed in CPEsensitive cell lines (Matsuda and Sugimoto, 1979
To analyze the biochemical properties of CPE and CPE
receptor interaction, we prepared radioiodinated CPE and
performed binding studies as described by Horiguchi et al.
(1985). Equilibrium binding data (Fig. 5 C, inset) analyzed
by Scatchard plots (Fig. 5 C) showed the presence of a single order of binding sites with high affinity (Ka = 1.49 × 108 M Direct Interaction of the CPE-R Gene Product
with CPE
We performed a ligand overlay assay to prove that the
CPE-R gene product interacts directly with CPE. For this,
an L929 cell line stably expressing COOH-terminal FLAG
peptide tagged CPE receptor (706FLAG cell line) was established. The 706FLAG cells formed bleb balloons to the
same extent as Neo706 cells (data not shown) on treatment with 100 ng/ml of native CPE. This indicates that introduction of the FLAG peptide sequence into its COOHterminal end did not affect the function of CPE receptor.
The parental cell line L929 and 706FLAG cells were solubilized with 0.5% NP-40, and the cell lysates were separated by SDS-PAGE and immobilized on a nitrocellulose
membrane. Anti-FLAG peptide antibody specifically recognized a 22-kD band that was expressed only in the
706FLAG cell line (Fig. 6, compare lanes 1 and 2). The
membranes were blotted simultaneously and subjected to
ligand overlay assay with 125I-labeled CPE as a probe. The
labeled CPE specifically recognized the 22-kD protein from
706FLAG cells (Fig. 6, compare lanes 3 and 4), and addition
of 100-fold molar excess of cold CPE completely blocked
the interaction (Fig. 6, compare lanes 4 and 6), indicating that CPE interacts directly and specifically with the CPE-R
gene product.
Inclusion of the CPE-R Gene Product in the
CPE-induced Large Complex
After binding to the cell surface, CPE is reported to form a
large hydrophobic complex, which may possibly constitute
the pore in the cell membrane (Wieckowski et al., 1994
The present study describes a novel CPE receptor gene
product, the expression of which confers CPE-resistant
L929 cells with both ability to bind CPE and CPE sensitivity. This 22-kD receptor was essential for the cytotoxic
action of CPE, as demonstrated by induction of its stable
expression in CPE-insensitive L929 cells and showed all
the characteristics of the CPE receptor so far reported.
The present results also suggest that CPE acts through a
unique mechanism.
Functionality of the CPE-R Gene Product
Several groups have reported that CPE uses a high affinity
binding site on the target cell membrane as a specific receptor (McDonel and McClane, 1979 On analysis, the primary structure of this small 22-kD
CPE receptor was found to contain 4 putative transmembrane segments. No possible glycosylation site was identified in its primary amino acid sequence of the receptor,
indicating that it is not modified by carbohydrate. In fact,
treatment with tunicamycin did not significantly alter its electrophoretic mobility on SDS-PAGE (Katahira, J., N. Inoue, Y. Horiguchi, M. Matsuda, and N. Sugimoto, unpublished results). These characteristics of our cloned CPE-R
gene product are consistent with reports that the sensitivities and the binding abilities of CPE-sensitive cells were
not affected by neuraminidase treatment or the additions
of various sugars to the media for binding reactions (Tolleshaug et al., 1982 Most importantly, we showed here that the CPE-insensitive L929 cell line became CPE sensitive on expression
of CPE-R. Thus we conclude that the cloned gene product
is the functional CPE receptor.
Induction by CPE of a Large Protein Complex
Containing Both CPE and the CPE-Receptor
Wieckowski et al. (1994) Similarities of the CPE-R Gene Product to Several
Other Gene Products with No Known Function
The CPE-R gene product shows sequence similarities to
the rat androgen withdrawal apoptosis protein RVP1
(Briehl and Miesfeld, 1991
). CPE produced
in the intestinal tract during sporulation injures intestinal
epithelial cells and causes fluid accumulation in the intestinal cavity, resulting in diarrhea (Stark and Duncan, 1971
).
Morphological changes such as bleb balloon formation or
complete destruction of intestinal epithelial cells induced
by CPE has been observed in rat and rabbit models (McDonel and Duncan, 1975
; McDonel et al., 1978
). Similar
cytotoxic effects have also been shown in cultured mammalian cells (Matsuda and Sugimoto, 1979
; McClane and
McDonel, 1979
; McDonel, 1980
; Tolleshaug et al., 1982
).
Several lines of evidence suggest that CPE increases membrane permeability by forming small pores and induces the
release of intracellular molecules from sensitive cells (Matsuda and Sugimoto, 1979
; McClane and McDonel, 1981
;
Sugimoto et al., 1985
, 1988; Matsuda et al., 1986
). The consequent loss of osmotic equilibrium is considered to lead
to membrane destruction, resulting in morphological alterations and finally cell death.
),
rat liver cells (Tolleshaug et al., 1982
), the monkey kidney
cell line, Vero cells (McClane and McDonel, 1979
), and
HeLa cells (Matsuda and Sugimoto, 1979
) have been
shown to be sensitive to CPE. On the contrary, several
types of cells such as the mouse fibroblast cell line L929
(Horiguchi et al., 1985
) were found to show resistance to
CPE. The sensitivity of cells to CPE is thought to depend
on the presence of a specific receptor(s) for CPE on the
cell surface (McDonel and McClane, 1979
; Horiguchi et al.,
1985
). Pretreatment of CPE-sensitive cells with neuraminidase or addition of ganglioside, methyl
-galactoside,
methyl
-mannose, or N-acetylglucosamine to the medium
did not affect the binding ability of CPE, whereas extensive digestion of the sensitive cells with pronase did (McDonel, 1980
; Wnek and McClane, 1986
; Tolleshaug et al.,
1982
; McClane et al., 1988
b). These findings indicate that
CPE binds to a specific protein receptor(s) on the surface
of sensitive cells.
; Sugii and Horiguchi, 1988
). However, it is
unknown whether these proteins act as a functional membrane receptor(s) for CPE. Wieckowski et al. (1994)
reported that after its initial binding, CPE aggregates with
several cellular proteins and forms a large hydrophobic
complex with a molecular mass of 160 kD. By a simple calculation they concluded that the complex contained a 70-kD
protein besides the 50-kD CPE binding substance and
CPE (35 kD) and assumed that this complex contributed
to pore formation in the membrane of target cells. But the
composition and function of the CPE-induced complex can not be determined until the functional CPE receptor is
identified.
Materials and Methods
. Approximately 10 ng of the
genomic DNA was subjected to PCR using oligonucleotides 5
-CCGCTCGAGAGATGTGTTTTAACAGTTCCATCTAC-3
(primer-S; the
underline indicates XhoI site) and 5
-GGAAGATCTTAAAATTTTTGAAATAATATTGAATAAGGG-3
(primer-A; the underline indicates BglII site) as sense and antisense primers to amplify the DNA fragment corresponding to amino acid residues 184-319 of CPE (Czeczulin et
al., 1993
). The amplified DNA fragment was digested with XhoI and BglII
and then cloned into the XhoI-BamHI treated pET16b vector (Novagen
Inc., Madison, WI) to fuse the CPE fragment to the down stream of the
tag sequence with 10 histidine residues (Fig. 1 A). The resulting plasmid
vector was designated as pETH10PER.
Fig. 1.
Expression and purification of a histidinetagged Clostridium perfringens enterotoxin COOH-terminal fragment (H10PER).
H10PER was expressed in E. coli BL21 (DE3) and purified as described in Materials
and Methods. A total cell lysate (lane 1), flow through fraction (lane 2), and purified
H10PER (lane 3) were separated on SDS-15% polyacrylamide gel and stained with
Coomassie brilliant blue. Purified H10PER was transferred to a PVDF membrane,
and Western blot analysis
was carried out using rabbit
polyclonal anti-CPE antibody, followed by alkaline phosphatase-conjugated anti-rabbit
IgG (lane 4). The positions of molecular weight standards are indicated on the left in kD.
[View Larger Version of this Image (61K GIF file)]
-GAL, a HindIII-PstI fragment containing
Escherichia coli
-galactosidase gene was isolated from pSG
-galactosidase (Promega Biotech., Madison, WI) and was subcloned into the same site of pCDM8 (Invitrogen Corp., San Diego, CA).
)
(Stratagene Cloning Systems, La Jolla, CA). Two clones containing the
CPE-R gene in opposite orientations were obtained and named pBS70608
and pBS70614. Nested deletion mutants of these clones were prepared using a double-stranded Nested Deletion Kit (Pharmacia Biotech, Uppsala,
Sweden) according to the manufacturer's manual.
), and the resulting plasmid (pMEneo-CPE-R) was used to
establish L929 cell lines stably expressing CPE-R.
-GGGTCGACGCCTCCATGGGGCTACAGG3
(the underline indicates the SalI site) and 5
-GGTCGCGACACGTAGTTGCTGGCAGCAG-3
(the underline indicates the NruI site) as
forward and back primers. The amplified fragment was treated with T4
DNA polymerase followed by T4 polynucleotide kinase and cloned into
the EcoRV site of the pBluescript SK(
). The XhoI-FseI site of this plasmid was replaced with the fragment of the corresponding site (encoding NH2-terminal portion of native CPE receptor) of pBS70614 to generate p706NruI. The XhoI-NruI fragment of p706NruI was then isolated and
recloned into the same site of pMEEB (Watanabe et al., 1996
) into which
NruI site, FLAG sequence, and stop codon (TCGCGAGACTACAAGGACGACGATGACAAGTAA; the underline indicates NruI site) was
introduced. The resulting plasmid was named pMEEB-CPE-R-FLAG.
) was a gift from Dr. M. Takahashi (Department of Immunoregulation, Research Institute for Microbial Diseases, Osaka University). The construction of pMEPyoni18Sf(
)
is described elsewhere (Ohishi et al., 1996
). pMEPyoriLuc was constructed as described previously (Takahashi et al., 1996
).
-d-thiogalactopyranoside (Wako Pure Chemical Industry, Osaka,
Japan). The E. coli cells were harvested, resuspended in buffer A (10 mM
Tris-HCl, pH8.0, 400 mM NaCl, 5 mM MgCl2, 10% glycerol, 0.1 mM
(p-amidinophenyl)methanesulfonyl fluoride hydrochloride, 1 mM
-mercaptoethanol), and then disrupted by sonication. After removal of cell debris by centrifugation, the cell lysate was applied to a Ni2+ column (HisBind
Resin; Novagen Inc.), and the histidine-tagged COOH-terminal fragment
of CPE (H10PER) was eluted in a 0-1 M imidazole gradient in buffer A. The purified 15-kD fragment (Fig. 1) was biotinylated with sulfo-NHS-LC
biotin (Pierce, Rockford, IL) and used as a probe for flow cytometric analysis.
-galactosidase and firefly luciferase activity of the transfected
pCMV
GAL and pMEPyoriLuc, respectively, was selected. This cell line
was named L929pyT18 and used as the host cell line for cDNA library
screening. L929 cell lines expressing CPE-R and its FLAG peptide-tagged
version (CPE-R-FLAG) were established in the same manner, except that pMEneo-CPE-R and pMEEB-CPE-R-FLAG were introduced by electroporation followed by G418 or hygromycin (Wako Pure Chemical Industry) selection. The clonal cell lines expressing CPE receptor and
FLAG-tagged CPE receptor were identified by flow cytometric analysis
and were designated as 706Neo and 706FLAG, respectively.
. An exponentially growing Vero cell culture was used as an RNA
source. Total RNA was isolated by cesium trifluoroacetic acid isopycnic
centrifugation. PolyA+ RNA was purified by the spinning of two successive oligo-dT cellulose columns (Pharmacia Biotech). PolyA+ RNA was
reverse transcribed by Superscript reverse transcriptase II (GIBCO BRL)
at 45°C and then converted to double-stranded cDNA with the aid of
RNase H, E. coli DNA polymerase, and E. coli DNA ligase (Takara Shuzo
Co., Shiga, Japan). After treatment with T4 DNA polymerase (Toyobo
Inc., Osaka, Japan) followed by BstXI linker (Invitrogen Corp.) ligation,
cDNAs were size selected and inserted into BstXI treated pMEPyori18Sf(
)
vector to construct a cDNA library for eukaryotic expression.
. The
rescued plasmids were reintroduced into E. coli strain MC1061, amplified,
and then used for subsequent screening. This screening was repeated
three times. After the third screening, the rescued plasmid clones were divided into 24 pools of 24 plasmids each, and the positive pools were identified by flow cytometric analysis. Finally, positive clones were identified by
separating positive pools into single clones.
) on an nr-nt
data base. Multiple alignment was done by the CLUSTAL method (Higgins and Sharp, 1989
).
. The 1.7-kb
XhoI fragment of clone 706, containing the entire coding sequence and 5
-
and 3
-untranslated regions, was radiolabeled by the random priming
method (Megaprime DNA labeling system; Amersham Intl.) and used as
a probe. The blot was rehybridized with an elongation factor-1
probe
(Uetsuki et al., 1989
) to determine the amount of RNA applied. The blots
were exposed to an imaging plate for 18 h and analyzed with a Bioimaging
Analyzer (BAS1500; Fuji Film Co., Tokyo, Japan).
). Biotinylation of anti-CPE antibody was done as described.
. The cytotoxic
effect of CPE on cells was determined by examination of morphological
alterations. CPE was radio-iodinated as described previously (Horiguchi
et al., 1985
). The ability of CPE binding to Neo706 cells (0.4 × 106 cells/assay) expressing CPE-R was measured by the method of Horiguchi et al.
(1985), except that the binding reaction was done in PBS(
). Scatchard
analysis was performed by the SP123 program (Ikeda et al., 1991
).
). Cell lysates (200 µg protein/
lane) of L929 and 706FLAG cells were subjected to SDS-15% polyacrylamide gel electrophoresis and then transferred to nitrocellulose membranes. After a denaturation and renaturation cycle (Manser et al., 1994
),
the blots were soaked in PBS-1% BSA containing 125I-labeled CPE (5 nM)
with or without 100-fold molar excess of cold CPE. The membranes were
then washed and exposed to an imaging plate, and the radioactive band
was located with a Bioimaging Analyzer.
-mercaptoethanol for 3 min and loaded onto SDS-12% polyacrylamide
gel. Radioactive bands were visualized with a Bioimaging analyzer.
Results
, 1987; Hanna et al., 1991
, 1992), we used
amino acid residues 184-319 of CPE as a probe and constructed a CPE COOH-terminal peptide (H10PER) expression system in which the COOH-terminal fragment
was fused to 10 consecutive histidine residues followed by
linker peptides to facilitate its purification. H10PER was
expressed in E. coli and was purified by Ni2+ chelating column chromatography. As expected, a single polypeptide of ~15 kD was purified to almost homogeneity (Fig. 1,
lane 3). The purified protein was recognized by rabbit
anti-CPE serum (Fig. 1, lane 4) and protected Vero cells
from CPE-induced cell lysis (data not shown).
), did not increase the fluorescence intensity (Fig. 2 D). H10PER did not bind to several
cell lines that are resistant to CPE-induced cell lysis (data
not shown), including K562 cells (Fig. 2 E) and JY cells
(Fig. 2 F). These results show that H10PER specifically
bound to the cell surface receptors on Vero, Hep3B, and
Intestine 407 cells.
Fig. 2.
Detection of the
CPE receptor by a flow cytometric analysis. Vero (A),
Hep3B (B), Henle Intestine
407 (C), L929 (D), K562 (E),
and JY (F) cells were treated
with biotinylated H10PER
(thick lines) or buffer alone
(dotted lines) followed by
PE-conjugated streptavidin.
For (A), cells were preincubated with unlabeled H10PER
as a competitor (thin line).
The plots show cell numbers on the ordinate and relative
fluorescences on a log scale
on the abscissa.
[View Larger Version of this Image (29K GIF file)]
Fig. 3.
Cloning and sequence analysis of the CPEreceptor cDNA. (A) Cloning
of the CPE receptor.
L929pyT18 cells were transfected with 10 µg of
pME18Sf(
)pyori vector
(thick line) or 10 µg of the
Vero cDNA library rescued
after the third round of
screening (thin line). Flow cytometric analysis was done as
described in Materials and
Methods. The plot displays cell number on the ordinate and relative fluorescence on a log scale on the abscissa. (B) Nucleotide and deduced amino acid sequence of CPE-receptor cDNA. The deduced amino acid sequence (single letter code) is shown under the nucleotide sequence. The underlines indicate possible phosphorylation sites. A putative polyadenylation signal is indicated by bold letters. These sequence data are available from GenBank/EMBL/DDBJ under accession number D88492. (C) Hydrophobicity profile of CPE
receptor. The hydrophobicity index was determined by the Kyte and Doolittle algorithm (Kyte and Doolittle, 1982
). The four putative
transmembrane segments are indicated by numbers above the line. (D) Alignment of the amino acid sequence of CPE receptor with
those of the rat androgen withdrawal apoptosis protein RVP1 (Genbank/EMBL/DDBJ accession number M74067) and the mouse oligodendrocyte specific protein (GenBank/EMBL/DDBJ accession number U19582). Identical amino acids are shown by white letters in
black boxes, and conservative replacements are shadowed. Triple alignment was done by the CLUSTAL method (Higgins and Sharp,
1989
).
[View Larger Versions of these Images (17 + 75 + 14 + 61K GIF file)]
end
(Fig. 3 B), suggesting that the gene is functionally expressed in Vero cells. Two potential AUG initiation codons
are present at nucleotide positions 137-139 and 146-148 in
the same reading frame. Since the neighboring sequence of the first AUG is consistent with the consensus sequence
proposed by Kozak (1987)
, this was assigned as the initiation codon of CPE-R. Thus, CPE-R encodes a protein of
209-amino acid residues with a calculated molecular mass
of 22,029 D. The protein consists mainly of hydrophobic
amino acids and contains four putative transmembrane domains (Fig. 3 C) and several potential phosphorylation
sites in the stretches of hydrophilic residues (Fig. 3 B). A
search of data bases indicated that the amino acid sequence of the CPE-R product showed homology to proteins designated as the androgen withdrawal apoptosis
protein RVP1 (67.8% homology, 95.6% similarity) and the
oligodendrocyte-specific protein (28.7% homology, 63.8% similarity; Fig. 3 D). The latter half of the nucleotide sequence of clone 706, however, showed considerable difference from the RVP1 gene and contained a termination
codon at nucleotide position 764-766. Accordingly, clone
706 lacked about one fifth of the COOH-terminal amino
acid sequence of RVP1.
gene in these cell lines were almost the same (Fig. 4, lower
panel). The levels of expression of CPE-R correlated well
with the CPE-binding abilities of these cell lines (Fig. 2),
indicating that clone 706 encodes a functional CPE receptor protein.
Fig. 4.
Northern blot analysis of CPE-R. Total RNA
samples (15 µg/lane) from
Vero (lane 1), K562 (lane 2),
Hep3B (lane 3), JY (lane 4),
and Intestine 407 (lane 5) cell
lines were subjected to
Northern blot analysis. The
blots were hybridized with 32Plabeled DNA probes from
the entire sequence of clone
706 containing CPE-R cDNA
(top). The blots were rehybridized with 32P-labeled human
EF-1
probe (bottom) to
confirm the amounts and integrities of the samples. The
positions of 28 and 18S ribosomal RNA are indicated on
the right.
[View Larger Version of this Image (39K GIF file)]
; McClane
and McDonel, 1979
). As reported previously (Horiguchi et
al., 1985
), the parental L929 cell line did not exhibit any detectable morphological changes in the presence of even 5 µg/
ml of purified CPE (compare Fig. 5 B, lower left with right).
Fig. 5.
Functional analysis
of stable cell lines expressing
the CPE receptor. (A) Clonal
L929 cell lines expressing the
CPE receptor were isolated
as described in Materials and
Methods. Expression of the
CPE-R gene product was examined by flow cytometric
analysis in a typical cell line
expressing CPE-R (thick line,
indicated as Neo706) and parental L929 cell line (thin line,
indicated as control), as shown
in Fig. 2. Cell numbers are
shown on the ordinate and
relative fluorescence on a log
scale on the abscissa. (B) Comparison of sensitivities of typical cell line expressing the CPE receptor (top) and the
parental L929 cell line (bottom) to CPE. The cells were
not treated with CPE (top
and bottom, denoted as none)
or with CPE at 100 ng/ml (top,
denoted as CPE), or 5 µg/ml
(lower right, denoted as CPE)
in DME supplemented with
10% FCS for 30 min at 37°C.
Bar, 30 µm. (C) Scatchard plot
analysis of the binding of
125I-CPE to the L929 cell line
expressing CPE-R. Scatchard
plot analysis giving a Ka value
of 1.49 × 108 M
1 for 125I-CPE
binding. (Inset) Various concentrations of 125I-CPE were
incubated with the L929 cell
line expressing CPE-R (0.4 × 106 cells each concentration),
and specific binding was determined as described before
(Horiguchi et al., 1985
). Symbols represent means ± SD
(n = 6).
[View Larger Versions of these Images (127 + 17 + 22K GIF file)]
1). The Ka value is similar to those reported previously (Horiguchi et al., 1985
). From these results, we concluded that the CPE-R gene product was actually functional.
Fig. 6.
Specific and direct
binding of CPE to the CPEreceptor. L929 cell lines expressing the CPE receptor
with FLAG tag peptide at the COOH-terminal end
were established as described
in Materials and Methods,
and a typical cell line
(706FLAG) was selected.
Cell lysates were prepared
from the parental L929 (lanes
1, 3, and 5) and 706FLAG
(lanes 2, 4, and 6) cell lines
and subjected to Western
blot analysis with anti-FLAG antibody (lanes 1 and 2) and ligand
overlay assay (lanes 3 to 6). Ligand overlay assay was carried out
using 125I-CPE with (lanes 5 and 6) or without (lanes 3 and 4)
cold CPE. The positions of molecular weight standards are indicated on the right in kD.
[View Larger Version of this Image (65K GIF file)]
).
Therefore we examined whether CPE formed a complex
containing the CPE receptor. For this the 706FLAG cells
were labeled with [35S]methionine, treated with CPE or
H10PER at 4° or 37°C for 30 min, and then lysed. The cell
lysates were treated with anti-FLAG antibody, and the
precipitates were separated by SDS-PAGE. The CPE receptor migrated as a band of ~22 kD (Fig. 7, A and B,
lanes 5-7). In addition to this band, a higher molecular
weight protein band was observed when CPE was incubated with the 706FLAG cells (Fig. 7 A, lanes 5 and 6),
suggesting that cellular proteins form a complex with CPE.
This band was intense when the 706FLAG cells were
treated with CPE at 37°C, but was not detectable when the 706FLAG cells were treated with H10PER (Fig. 7 A, lanes
3 and 4). An additional band of ~42 kD was precipitated
from all the samples. This was probably a protein that reacted nonspecifically with anti-FLAG resin, because it was
also detected in a precipitate prepared from the parental
L929 cell line (data not shown). Decrease in intensity of
this band was probably due to leakage of cell contents on
CPE-induced cell lysis during the incubation (Fig. 7 A,
lane 6). The components of this complex were examined
by Western blot analysis of the immunoprecipitates. AntiFLAG antibody recognized the CPE receptor (Fig. 7 B,
lanes 5-7, CPE-R) as well as the large complex (Fig. 7 B,
lane 7). The complex also reacted with anti-CPE antibody
(Fig. 7 B, lane 3). These results indicate that the complex
contained at least CPE and the CPE receptor. As expected, neither the CPE receptor nor the large complex
was detected in CPE-insensitive L929 cells treated with
CPE (Fig. 7 B, lanes 4 and 8). H10PER was also coprecipitated with the CPE receptor (Fig. 7 B, lane 2, H10PER),
but the large complex was not formed (Fig. 7 B, lanes 2 and 6, and A, lanes 3 and 4). When CPE alone was subjected to SDS-PAGE, the large protein band was not detected, although it aggregated and migrated as broad
bands (Fig. 7 B, lower panel, lane 9) as reported previously
(Enders and Duncan, 1976
). From these results we concluded that the complex was formed by specific interaction
between CPE and the CPE receptor. The NH2-terminal
half of CPE, which is known to be necessary for cytotoxic
activity, was essential for formation of the complex.
Fig. 7.
Presence of both
the CPE and CPE receptor
in a CPE-induced high molecular weight complex. (A)
706 FLAG cells were labeled with [35S]methionine and
treated with buffer alone
(lanes 1 and 2) or buffer containing either 140 nmol of
H10PER (lanes 3 and 4) or CPE (lanes 5 and 6) for 30 min at 4°C (odd-numbered
lanes) or 37°C (even-numbered lanes). The cells were
solubilized with PBS-0.5% NP-40, and the lysates were
immunoprecipitated with
anti-FLAG antibody. Precipitated proteins were separated by SDS-15% PAGE, and protein bands were located with Bioimaging Analyzer. The positions of molecular weight standards are indicated on the left in kD. (B) 706FLAG cells (lanes 1-3 and 5-7), and parental L929 cells (lanes 4 and 8)
were treated with buffer alone (lanes 1 and 5) or buffer containing either 140 nmol of H10PER (lanes 2 and 6) or CPE (lanes 3, 4, 7, and
8). The cells were solubilized with PBS-0.5% NP-40 and immunoprecipitated with anti-FLAG antibodies. The precipitates were separated by SDS-15% PAGE (top) or SDS-2-15% gradient PAGE (bottom; note that only the relevant area is shown), transferred to a
PVDF membrane, and then treated with biotinylated anti-CPE (lanes 1-4) or anti-FLAG (lanes 5-8) antibodies followed by alkaline
phosphatase-conjugated streptavidin. As a control, 7 nmol of purified CPE was applied to SDS-2-15% polyacrylamide gradient gel,
and then subjected to Western blotting with biotinylated anti-CPE antibody (bottom, lane 9). The positions of molecular weight standards are indicated on the left in kD.
[View Larger Version of this Image (37K GIF file)]
Discussion
; McDonel, 1980
; Horiguchi et al., 1985
). The present results are consistent with
these previous reports, because the 22-kD CPE receptor
could act as a high affinity binding site (Ka = 1.49 × 108
M
1) for CPE. In addition, we demonstrated the in vitro
binding of CPE to the CPE receptor by ligand overlay assay. Thus CPE binds directly and specifically to the CPE
receptor as the initial step in CPE-induced intoxication.
; Wnek and McClane, 1986
).
detected a large hydrophobic
complex after treatment of CPE-sensitive cells with CPE.
By coimmunoprecipitation assay, we demonstrated here
that a large complex contains both CPE and the 22-kD
CPE receptor. This complex was fairly stable, not being
dissociated completely by SDS treatment. The COOH-terminal half of CPE, which can bind directly to the CPE receptor but has no cytotoxic activity, did not form a complex. Moreover, formation of the complex was promoted
by incubation of the cells with CPE at 37°C, a temperature
at which the cytotoxic action is much greater than at 4°C
(Horiguchi et al., 1985
; McClane and Wnek, 1990
). Thus
this complex must be essential for CPE intoxication and
form a CPE-induced pore in the cell membrane. Purified
intact CPE shows an anomalous electrophoretic migration
pattern, but the COOH-terminal fragment does not (Fig.
7 B). Thus we consider that the NH2-terminal half of CPE
may have a role in self assembly but that it is not sufficient
alone for formation of a defined structure. It is not yet
clear whether the CPE receptor is the sole requisite for
CPE intoxication. The interaction of CPE with its receptor
might be necessary not only for the recognition of target
cells but also for the regulated assembly of the CPE-induced
complex in the plasma membrane. Thus we propose that
CPE acts through a novel mechanism differing from those
of other pore-forming toxins (for review see Bhakdi et al.,
1996
). Analyses of the stoichiometric features of CPE and
its receptor in the complex, and investigations on its further interaction with other components are now in
progress in our laboratory.
) and mouse oligodendrocyte
specific protein (these sequence data are available from
GenBank/EMBL/DDBJ under accession number U19582).
These have been reported to be expressed in a highly restricted manner: RVP1 gene is expressed in ventral prostate cells after withdrawal of androgen from the culture
medium in vitro or castration in vivo (Briehl and Miesfeld,
1991
); oligodendrocyte specific protein is expressed specifically in oligodendrocyte. CPE-R was constitutively expressed in various cell lines tested in this study and in tissues
including kidney, liver, and intestine (Katahira, J., N. Inoue, Y. Horiguchi, M. Matsuda, and N. Sugimoto, unpublished results). On searching the expressed sequence tag data base, we also obtained CPE-R and putative RVP1 homologues of human and mouse origin. We found that the
human CPE receptor homologue showed higher homology
to monkey CPE receptor (99.0% identity, 99.5% similarity) than to human RVP1 (70.9% identity, 96.6% similarity) and that the mouse CPE receptor showed higher homology to the monkey CPE receptor (83.8% identity, 98.6%
similarity) than to rat RVP1 (66.8% identity, 94.6% similarity; Katahira, J., N. Inoue, Y. Horiguchi, M. Matsuda,
and N. Sugimoto, manuscript in preparation). Thus we consider that RVP1 may be a different gene product, although
CPE receptor and RVP1 share a structural similarity and
might be members of a functionally identical gene family.
Further functional analysis of the CPE-R product may
provide a clue to not only the physiological function of the
CPE receptor but also the functions of RVP1 and the oligodendrocyte specific protein.
Received for publication 12 November 1996 and in revised form 17 December 1996.
We are indebted to Dr. T. Kinoshita and members of the Department of Immunoregulation for their helpful discussions and providing plasmids. We are grateful to the following persons of Research Institute for Microbial Diseases, Osaka University; Dr. H. Nojima (Department of Molecular Genetics) for helpful suggestions on library construction and Drs. N. Wakamiya (Department of Viral Infections) and K. Nagayama (Department of Bacterial Infections) for providing cell lines. We are also grateful to Dr. T. Asao (Osaka Prefectural Institute of Public Health) for providing the C. perfringens strain. We also thank K. Nakamura, Central Laboratory, Research Institute for Microbial Diseases, Osaka University, for cell sorting. We are grateful to Dr. S. Kozaki (University of Osaka Prefecture) for critical reading of this manuscript.CPE, Clostridium perfringens enterotoxin; CPE-R, CPE-receptor gene; H10PER, histidine-tagged CPE COOHteminal fragment; PE, phycoerythrin.
-noncoding sequences from 699 vertebrate
messenger RNAs.
Nucleic Acids Res.
15:
8125-8148
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|