|
||
-Actin Messenger RNA Localization and
Protein Synthesis Augment Cell Motility

* Department of Cell Biology, University of Massachusetts Medical School, Worcester, Massachusetts 01655; and
Department
of Anatomy and Structural Biology, Albert Einstein College of Medicine, Bronx, New York 10461
In chicken embryo fibroblasts (CEFs),
-actin
mRNA localizes near an actin-rich region of cytoplasm
specialized for motility, the lamellipodia. This localization is mediated by isoform-specific 3
-untranslated
sequences (zipcodes) and can be inhibited by antizipcode oligodeoxynucleotides (ODNs) (Kislauskis, E.H.,
X.-C. Zhu, and R.H. Singer. 1994. J. Cell Biol. 127:
441-451). This inhibition of
-actin mRNA localization
resulted in the disruption of fibroblast polarity and,
presumably, cell motility. To investigate the role of
-actin mRNA in motility, we correlated time-lapse images of moving CEFs with the distribution of
-actin
mRNA in these cells. CEFs with localized
-actin
mRNA moved significantly further over the same time
period than did CEFs with nonlocalized mRNA. Antizipcode ODN treatment reduced this cell translocation
while control ODN treatments showed no effect. The
temporal relationship of
-actin mRNA localization to
cell translocation was investigated using serum addition
to serum-deprived cultures.
-actin mRNA was not localized in serum-deprived cells but became localized
within minutes after serum addition (Latham, V.M.,
E.H. Kislauskis, R.H. Singer, and A.F. Ross. 1994. J. Cell Biol. 126:1211-1219). Cell translocation increased
over the next 90 min, and actin synthesis likewise increased. Puromycin reduced this cell translocation and
blocked this induction in cytosolic actin content. The
serum induction of cell movement was also inhibited by
antizipcode ODNs. These observations support the hypothesis that
-actin mRNA localization and consequent protein synthesis augment cell motility.
Most differentiated cells are structurally and functionally polarized with regard to apical-basal,
anterior-posterior, or proximal-distal axes of
asymmetry. For motile cells, like fibroblasts, anterior polarity is indicated by the lamellipodium, a flattened extension of the leading edge of cytoplasm highly enriched in actin. Polymerization of actin in the lamellipodia is fundamental to the process of membrane protrusion (Wang,
1985 mRNA sorting is one mechanism to effect the enrichment of proteins asymmetrically within a cell. We have
postulated that Maintenance of a motile morphology requires the continuous presence of serum in media. The polymerization
state of actin is sensitive to serum composition of the medium (Riddle et al., 1979 In this work, we test the hypothesis that Cell Culture
Primary CEFs were prepared as previously described (Kislauskis et al.,
1993 Motility Analysis
CEFs on coverslips with the finder grids were transferred to fresh media
supplemented with various ODNs or no additives. Video images were
taken at the indicated intervals before and during ODN treatment using
phase contrast optics on a microscope (model Microphot-SA; Nikon, Inc.,
Melville, NY) connected to a black and white CCD camera (Microvideo
Instruments, Inc., Avon, MN) and printed with a high resolution video
graphic printer on high-density paper. Change in cell position over time
was plotted on transparencies overlaid and aligned with the CELLocate
grid within each video frame. The magnitude and direction of cell translocation was established by measuring a change in the position of the center
of each nucleus during each interval. CEFs undergoing mitosis were excluded from the analysis. Analysis of variance between treatments in the
motility analyses was performed using the Turkeys-HSD test with significance level 0.05.
Phosphorothioate ODNs
Phosphorothioate-modified ODNs were synthesized (model 394 DNA
synthesizer; Applied Biosystems, Inc., Foster City, CA) and purified by
electrophoresis through a 20% polyacrylamide gel. Additional contaminants were removed by columns (sepack C18; Millipore, Milford, MA).
The ODNs were lyophilized overnight and resuspended in diethyl pyrocarbonate-treated sterile water (Kislauskis et al., 1994 In Situ Hybridization and Microscopy
In situ hybridization was performed using nick-translated digoxigeninlabeled Actin Quantitation
Approximately 0.5 × 106 CEFs were plated in 60-mm dishes and cultured
in 10% FBS/MEM for 18 h. The cells were rinsed with cold Hank's buffer
twice and incubated in MEM for 23.5 h, when either puromycin (200 µg/ml)
or the same volume of MEM was added for 30 min. Parallel cultures were
trypsinized and counted to determine cell number at the time of extraction. Each plate of CEFs was simultaneously induced with 10% FBS/
MEM, quickly rinsed with Hank's buffer, and then extracted on ice with
300 µl of cold 100 mM NaCl, 50 mM Tris, pH 7.4, 5 mM MgCl, 5 mM
EDTA, and 1% Triton X-100. CEF extract was scraped from each plate,
mixed by gentle inversion for 2 h in the cold, and centrifuged for 2 min at
5,000 rpm. One-quarter of the extract supernatant was electrophoresed through a standard 10% SDS-PAGE with a 3% stacking gel (National Diagnostic, Atlanta, GA) maintaining 25 mA through the stacking gel and
35 mA through the resolving gel. A range of concentrations of purified actin (No. A-0348; Sigma Chemical Co., St. Louis, MO) from 0.2-5.0 µg were
loaded in the same gel as reference standards. The gel was fixed and
stained overnight in 0.2% Coomassie brilliant blue, 50% EtOH, and 5%
acetic acid. It was destained in 30% MeOH, 5% glycerol and soaked overnight in 25% MeOH, 5% glycerol and dried between cellophane sheets.
The quantity of actin per lane was determined by scanning densitometry
using ImageQuantTM Version 1.1 for Macintosh (Molecular Dynamics,
Sunnyvale, CA).
The Distribution of To determine whether CEF movement correlated with the
distribution of
Inhibition of In our previous study, ODNs complementary to zipcode
sequences, but not flanking 3
ODN treatments corresponding to the middle or distal
third of the zipcode (ODN B or C, respectively) had
marked effects on translocation relative to untreated cells
(no ODN) or control ODN treatments (C+ or D). Migration distance was reduced by 55% with ODN B (13.6 µm)
and by 38% with ODN C (18.9 µm) relative to untreated
CEFs (30.4 µm), while the effect of antizipcode A, corresponding to the first third of the 54-nucleotide zipcode, was not significantly different from the control ODN
treatments (P > 0.05). The conclusion from this analysis
was that inhibition of Serum-induced Relocalization of Rapid changes in the distribution of actin mRNA and protein occur within minutes of serum addition to serumstarved (24 h) CEFs (Fig. 4 a). Lamellipodia are induced
by serum replacement and become enriched in phalloidinstained actin filaments (Fig. 4, c and e), and
Both actin and protein localization occurred rapidly upon
addition of serum (Fig. 5). Within 2 min, the percentage of
CEFs with phalloidin-labeled lamellipodia increased from
38 to 92%, while those with localized
Next, we added serum and one of various ODNs simultaneously, or no additive, to serum-starved cells to evaluate
the consequences of ODN treatment on the rapid induction of
To examine whether
Role of Protein Synthesis in Translocation
To investigate the role of protein synthesis in cell motility,
CEFs were treated with an inhibitor of polysome integrity
(puromycin). Analysis of translocation distance was determined within 105 min of treatment to minimize collateral
effects of general inhibition of protein synthesis. In a
steady-state culture (Fig. 8), translocation was suppressed
by 15% after 35 min of treatment and an additional 15%
over the next 35-min interval. Thereafter, translocation
levels off at ~70% of controls.
To determine whether actin synthesis could account for
the increased motility in response to serum, we measured
total cytosolic actin content after the addition of serum to
serum-starved cells (Fig. 9). Serum-starved cells contained
9 pg actin per cell, while CEFs cultured in serum (steadystate) contained ~18 pg. Within 30 min of serum addition,
an increase in actin synthesis was detected. By 4 h, actin
content increased to 13.2 pg/cell, at a rate of 1.67 pg/h. Puromycin treatment effectively blocked this induction (data not
shown). These results indicate that actin protein synthesis can play a significant role in increasing the cellular actin
content over time.
The results presented herein are consistent with the hypothesis that Because F-actin and actin mRNA appear in the lamellipodia and leading lamellae, respectively, within 2 min of
serum addition, both the actin protein and mRNA appear
to sort simultaneously. That Contemporary models of cell motility have not seriously
considered a role for translation (Lauffenburger and Horwitz, 1996 How could protein synthesis influence the dynamics of
the cellular actin pool? In response to serum stimulation,
protein synthesis rates have been estimated to increase
fourfold. At the peak rate of synthesis, 4-6 h after serum
addition, actin synthesis accounts for 15% of the total cell
constituents (Riddle et al., 1979 The serum induction of mRNA localization, and subsequent actin synthesis, provides the basis for a model of
how translation may promote cell motility. Serum induces
a burst of rapid actin polymerization in the leading lamella
that precedes protrusion of the lamellipod. In mammary
adenocarcinoma cells stimulated with an upshift of EGF
concentration, polymerization is nucleated from severed
actin filaments, and actin monomers are estimated to add
to the leading edge at the rate of between 60,000 and
600,000 per second (Chan, A.Y., S. Raft, M. Bailly, J.B.
Wyckoff, J.E. Segall, and J.S. Condeelis, manuscript submitted for publication), in an area within 1.5 µm of the leading edge membrane (Condeelis, 1993 This work has focused on the
). Conversion of protrusion into cell translocation across
a surface requires coordination of the cytoskeleton, adhesion, and membrane systems (Lauffenburger and Horwitz,
1996
; Mitchison and Cramer, 1996
). The ability to generate and maintain this functional asymmetry involves the
enrichment of actin at the lamellipodia.
-actin mRNA localization results in the
compartmentalized synthesis of
-actin proximal to the
leading edge of the fibroblast (Lawrence and Singer, 1986
)
and that this localization is important for the polarity and
motility of the cell (Kislauskis et al., 1995
). This view is
supported by our results in chicken embryo fibroblasts (CEFs)1 treated with specific antisense oligodeoxynucleotides (ODNs) that delocalized
-actin mRNA and showed
a loss of cell polarity (Kislauskis et al., 1994
).
); addition of serum to starved cells
results in rapid actin filament formation (Ridley and Hall,
1992
, 1994
). Analogously,
-actin mRNA is rapidly relocalized to the developing leading lamellae of CEFs
(Latham et al., 1994
) or pseudopods of rat muscle cells (Hill et al., 1994
) upon addition of serum or serum growth
factors to quiescent cells, where the mRNA is not localized. These data suggest that the same signal transduction
pathways that cause actin filaments to elongate and membranes to ruffle also regulate
-actin mRNA localization
(Latham et al., 1994
). That
-actin mRNA sorts rapidly to
the lamellipodia suggests that protein synthesis may be important in supplying actin for cell movement.
-actin mRNA
localization serves a physiologically significant role in cell
motility. The movement of individual cells and the distribution of
-actin mRNA was assessed as a function of various treatments: serum induction, antisense inhibition, and
protein synthesis inhibition. The distance and direction of
cell translocation was found to correlate with the distribution of
-actin mRNA and was inhibited by ODNs that delocalized
-actin mRNA. In serum-induced cells, the increase in actin protein synthesis was significant, enough to
account for a doubling of the cellular actin in 15 h. An increase in cell movement accompanied this synthesis of actin. The increase in movement was inhibited by puromycin. These data support the hypothesis that
-actin mRNA
localization and the consequent localized actin synthesis
contribute significantly to cell movement.
Materials and Methods
), cultured for 72 h, and were replated on 0.5% gelatin-coated coverslips etched with a finder grid (model CELLocate; Eppendorf, Hamburg,
Germany) for a minimum of 16 h before performing a motility analysis.
Each grid square was 175 µm. Standard culture medium included 10%
FBS in MEM I (GIBCO BRL, Gaithersburg, MD) unless otherwise stated.
Serum-starved CEFs were cultured in OPTI-MEM I or MEM I medium
(GIBCO BRL) for 24 h before any described change in medium. Cycloheximide (5 µg/ml) and puromycin (200 µg/ml) were used in the inhibitor
studies. Both inhibited >95% incorporation of [35S]methionine into actin
relative to untreated control as evaluated by SDS-PAGE and autoradiography (data not shown).
). ODNs (8 µM)
were included in medium containing 10% FBS, and, when appropriate,
fresh media and ODNs were replaced every 4 h. Within three consecutive
4-h treatments, the phenotypic effects on lamellipodia structure, cell polarity, and actin filament distribution were evident (Kislauskis et al.,
1994
). The effects of specific antizipcode ODNs on steady state
-actin
mRNA localization are maximal within 4-6 h of a single dose, with nearly
full recovery of
-actin mRNA relocalization within 12 h (data not
shown). The sequences of ODNs A-C and C+ have been previously described (Kislauskis et al., 1994
). New ODNs used in this work are the control ODN Crev, which is identical to ODN C but synthesized in the reverse orientation (5
-GCATTTATGGGTTTTGTT), and B rev (5
TGTGGGTGTGGGGACACTACT), which is a control for possible
nonspecific effects associated with 4Gs in ODN B (Yaswen et al., 1993
;
Stein and Kreig, 1995
). Antisense ODN D corresponds to position 1325-
1342 in the
-actin 3
-untranslated region (stop codon position 1222) in the
chicken cDNA and flanks the antizipcode sequences.
-actin cDNA probes to detect endogenous
-actin mRNA as
previously described (Sundell and Singer, 1990
; Kislauskis et al., 1994
),
unless otherwise stated. Alternatively, Cy-3 fluorochrome-conjugated antisense ODN corresponding to
-actin 3
-untranslated sequences were
used as probes as previously described (Kislauskis et al., 1993
). Coverslips
processed after alkaline phosphatase detection of in situ hybrids were
mounted in GelMount aqueous/dry mounting media (Biomeda, Foster
City, CA). Coverslips processed for fluorescence detection of hybridized
probes were mounted in phenylenediamine (1 mg/ml) after staining with
4
,6-diamidino-2-phenylindole. Fluorescence and phase contrast microscopy were performed on a microscope (model Microphot-SA; Nikon,
Inc.). mRNA was judged to be localized when most of the colored in situ
signal was asymmetrically distributed in lamellae, separated from the nucleus. Signal that contacted the nucleus scored as nonlocalized.
Results
-Actin mRNA Correlated with the
Magnitude and Direction of Cell Translocation
-actin mRNA, we recorded time-lapse video
images of individual CEFs crawling over a finder-grid coverslip. Immediately thereafter, coverslips were fixed and
subjected to in situ hybridization using probes specific to
-actin mRNA. CEFs were categorized (Fig. 1) as either "localized," when the majority (~80%) of mRNA signal occurred within the leading lamellae, or "nonlocalized," when the signal was distributed throughout the cytoplasm. Each
of 171 cells was evaluated and a change in position of the
nucleus (µm) was determined relative to the distribution
of
-actin mRNA in the same cells (Fig. 2). During the 45min interval, nearly all cells (93%) moved a measurable
distance. Of these motile cells, 68% showed localized
-actin
mRNA toward the leading edge in one or more cell protrusions, consistently (97%) in the direction of movement.
The remainder (32%) of motile cells were categorized as
having nonlocalized mRNA signal. Few nonmotile cells
(24%) showed localized
-actin mRNA. Significantly, CEFs
with localized mRNA translocated an average of 1.6-fold
further than cells with nonlocalized mRNA (28.1 compared
to 17.6 µm). This differential in motility between CEFs
with localized and nonlocalized
-actin mRNA was highly
significant (P
0.0001). Thus, the distribution of
-actin
mRNA correlated with the magnitude and direction of cell
translocation.
Fig. 1.
Direction of cell motility correlates with
-actin distribution. CEFs cultured on gelatin-coated, gridded coverslips were video recorded twice, 45 min apart, and then fixed and processed to detect
-actin mRNA by in situ hybridization. Alkaline phosphatase activity
(dark intracellular staining) corresponded to the distribution of endogenous
-actin mRNA at the time of fixation. Signal is well-localized in the lamellae of two CEFs (in the direction of motility, arrows) and not in a third. Grid square is 175 µm. Bar, 30 µm.
[View Larger Version of this Image (81K GIF file)]
Fig. 2.
Speed correlates with localization of
-actin mRNA.
CEF speed was calculated for 171 CEFs from the magnitude of
the distance each CEF migrated (translocated) during the 45-60min period. Nearly all CEFs (93%) moved during that period.
-actin mRNA was localized (predominantly peripheral) in 68%
of CEFs. CEFs with localized
-actin mRNA migrated 1.7-fold
faster than nonlocalized. Error bars indicate the standard error of
the mean for each data point.
[View Larger Version of this Image (14K GIF file)]
-Actin mRNA Localization Reduced
Cell Motility
UTR sequences, delocalized endogenous
-actin mRNA and affected cell morphology (Kislauskis et al., 1994
). ODN treatments did not
reduce steady-state levels of actin mRNA nor the ability
of
-actin mRNA to be translated (Kislauskis et al., 1994
).
Hence, the effect of ODN treatment on CEF shape was
proposed to have resulted from the mislocalized synthesis of
-actin throughout the cytoplasm. To extend these observations and probe the role of
-actin mRNA localization in cell motility, the same protocol was used and cell
translocation evaluated over the subsequent 60-min interval (Fig. 3).
Fig. 3.
Antizipcode oligodeoxynucleotides inhibit cell motility.
CEFs were treated for 12 h with various phosphorothioate ODNs
corresponding to antisense (A-D), sense (C+), or no ODNs, as depicted schematically. A significant reduction in translocation over a
60-min period was observed with ODNs complementary to the middle and distal third of the 54-nucleotide zipcode, only (B or C). Error
bars indicate the standard error of the mean for each data point.
[View Larger Version of this Image (20K GIF file)]
-actin mRNA localization resulted
in significantly reduced cell translocation.
-Actin mRNA and
Translocation Are Mediated Through the Zipcode
-actin mRNA
changes from nonlocalized (Fig. 4 b) to localized (Fig. 4, d
and f).
Fig. 4.
Serum-induced relocalization of
-actin protein and its mRNA. CEFs cultured on gelatin coverslips were serum deprived for 24 h and induced with 10% FBS and fixed after 2 and 5 min. Representative examples of the distribution of
-actin-specific FITCimmunocytochemistry (a, c, and e) and
-actin mRNA by in situ hybridization (b, d, and f) are shown. a and b, 24 h starved control; c
and d, 2 min induced; and e and f, 5 min induced. Arrowheads show lamellipodia staining and membrane protrusion. Bar, 20 µm.
[View Larger Version of this Image (88K GIF file)]
-actin mRNA approached half-maximum, from 18 to 39%. By 5 min, the
percentage of CEFs with actin-rich lamellipodia peaked at
97%, while CEFs with localized mRNA reached a steadystate percentage (60%). After 1 h, the percentage of CEFs with lamellipodia declined to nearly 60%, the same percentage showing localized
-actin mRNA. Therefore, rapid
relocalization of
-actin mRNA in response to serum correlated temporally with protrusion of lamellipodia, an
early event in motility.
Fig. 5.
The course of serum-induced relocalization of
-actin
protein and its mRNA. CEFs were induced with 10% FBS after a
24 h serum starvation (Fig. 4). Coverslips with CEFs were removed 0, 2, 5, 10, 30, and 60 min after induction. The percent of
CEFs is represented with localized mRNA (open circles) or with
lamellipodia staining by
-actin immunocytochemistry (closed
circles). The experimental mean was calculated from three separate experiments for each point except 60 min (single experiment).
[View Larger Version of this Image (17K GIF file)]
-actin mRNA localization and cell translocation
(Fig. 6). Because ODNs enter the cell rapidly and hybridize to their targets within minutes (Politz et al., 1995
), it
was possible that antisense treatment could block the transport and anchoring of
-actin mRNA in the leading
lamellae. After a 30-min treatment, the CEFs were fixed
and processed to detect
-actin mRNA by in situ hybridization. In this experiment,
-actin mRNA was localized in
23% of the serum-starved CEFs (Fig. 6). Within 30 min of
serum treatment, 61% showed localized
-actin mRNA
(Latham et al., 1994
). Treatment with either antizipcode ODN B or C impeded this localization.
-Actin mRNA was
localized in 37% of CEFs treated with serum containing
antizipcode C, whereas localization was comparable to untreated cells after treatment with control ODNs (D = 68%
and C+ = 73%, respectively). Therefore, the zipcode sequence in the 3
UTR, which had previously been identified by other methods (Kislauskis et al., 1994
), also mediated the serum-induced relocalization.
Fig. 6.
Serum-induced relocalization of
-actin mRNA is mediated through the
-actin zipcode. CEFs were serum deprived
for 24 h and induced for 30 min with 10% FBS containing the indicated ODNs or no ODNs.
-Actin mRNA localization in the
population was evaluated by in situ hybridization as described in
Materials and Methods. The effects of ODNs on the percentage
of CEF with localized
-actin mRNA signal is shown. The serumstarved level of localization was 23%.
[View Larger Version of this Image (18K GIF file)]
-actin mRNA relocalization was
important for translocation, serum-starved CEFs were
treated as above, in the presence or absence of antizipcode
or control ODN treatments, and photographed over 90 min before being fixed and stained with FITC-phalloidin.
Actin polymerization or protrusion of lamellipodia was
not inhibited by ODN treatment nor was translocation after 30 min of treatment (data not shown). However, after a 90min treatment, translocation in response to serum was inhibited with ODN B and C (52 and 38%, respectively) but
not the corresponding control ODNs, which had the same
sequences in the reverse orientation (Fig. 7). These results
indicate that the same cis-acting sequences (zipcodes) that
regulate
-actin mRNA localization in the steady state
mediate serum-induced relocalization of
-actin mRNA.
Furthermore, these results suggest that
-actin mRNA localization contributed to processes in motility that followed the initial actin polymerization and protrusion of
the lamellipodia.
Fig. 7.
Serum induction of motility is inhibited by antisense
ODNs. CEFs were serum deprived for 24 h and induced with
10% FBS containing the indicated ODN for 90 min as indicated.
Motility (translocation) was measured over a 30-min interval after
treatment. Similar to the results in Fig. 3, antizipcode ODN B significantly inhibited translocation, while control ODN Brev did not.
[View Larger Version of this Image (14K GIF file)]
Fig. 8.
Inhibition of protein synthesis suppresses motility.
Analysis of translocation distance for a steady-state culture of
CEFs over consecutive 30-min periods after treatment with puromycin (200 µg/ml). Control cells were evaluated before treatment
(time 0). Translocation was suppressed by 30% after 70 min in
puromycin.
[View Larger Version of this Image (12K GIF file)]
Fig. 9.
Cytoplasmic actin content after serum induction. Line
plot of the increase in actin content in serum-starved CEFs before and after the addition of serum. Coomassie-stained gels were
used for quantitation.
[View Larger Version of this Image (10K GIF file)]
Discussion
-actin mRNA localization has a physiologically significant role in fibroblast motility. Presumably, the
mRNA augments cell motility by providing synthesis of
new actin monomers for polymerization at the leading
edge. Several results support this interpretation. First,
cells with
-actin mRNA localized in the leading lamellae moved farther than cells that did not, previous to fixation
and in situ hybridization. Second, inhibition of this localization with specific antizipcode ODNs retarded translocation distances relative to controls, independent of the
growth conditions of the cells. Third, serum addition to
starved cells rapidly induced both mRNA localization and
motility. Fourth, the amount of actin per cell increased significantly after serum stimulation. Fifth, this increase was
inhibited by puromycin, as was the increase in cell motility.
-actin mRNA localization
does not require protein synthesis (Sundell and Singer,
1990
) and puromycin did not inhibit formation of the
lamellipod shows that these events are independent, initially. Later (>30 min), disruption of actin mRNA localization and inhibition of protein synthesis did have an effect on cell translocation. Therefore, it is reasonable to
propose that translation of localized
-actin mRNA is important to achieve maximal translocation.
; Mitchison and Cramer, 1996
). This is in part because protein synthesis inhibitors were not observed to
completely prevent motility or protrusion of the lamellipodia (Spooner et al., 1971
; Albrecht-Buhler, 1980
). Over
time, quantitation of translocation distance demonstrated that inhibition of protein synthesis resulted in a partial effect (~50%) on motility in primary fibroblasts.
). If ribosomes are spaced
15 nucleotides apart, synthesis of one actin/s/mRNA is
well within the established translation rate of a polysome/
mRNA complex, estimated to be about five amino acid residues per second (Darnell et al., 1995
). This would result in
the synthesis of about 150,000 actin molecules/min/cell, assuming ~2,500 mRNAs/cell (Latham et al., 1994
). We
have measured the average actin content per cell to be
10.5 pg, which represents ~1.5 × 108 actin molecules/cell.
This is also the number of actin molecules calculated per
cell by another independent method, based on ~1.8 pl volume/cell and an actin concentration of 135 µM. At a rate of synthesis of 150,000 actin/min, a cell could increase its
actin content by 6% per hour (0.9 × 107 actin molecules/
h). Growing CEFs divide approximately every 20 h, allowing sufficient time for the actin content to double. These
calculations are consistent with the amount of actin synthesis we actually observed per cell. We observe that actin
content after serum stimulation increased at the rate of 1 pg/h/cell, or ~1.4 × 107 molecules/h, nearly a 10% increase per hour. Based on an estimated 2,500 mRNAs, this
is the equivalent of 3,900 actin molecules synthesized per
second, or ~1.5 actins/s/mRNA. Most important, however, is the obvious conclusion that all the synthesis is restricted to where the mRNA is localized (i.e., the lamella).
The generation of over 105 actin molecules/min in a cytoplasmic compartment that represents only a few percent of
the total cell volume may have significant consequences
for this region of the cell, the region most involved in cell
motility (see below).
; Segall et al., 1996
).
This polymerization persists for 1 min, possibly using as
much as 36 million monomers. Because the leading
lamella is a minor portion of the total cytoplasm, this rapid
reduction of actin monomers may deplete the local concentration, requiring either sorting of recycled actin or
new synthesis. In cells moving in a gradient of EGF or
spontaneously in culture, repetitive cycles of actin polymerization at the leading edge are expected. Localized actin
synthesis could influence this cyclical reaction over time
by augmenting the supply of free actin monomers necessary for preferential polymerization at the leading edge. This continuing, highly localized synthesis may become
significant in maintaining the persistence of movement. In
this model, it would follow that inhibition of mRNA localization, or of actin translation, would reduce the constant
asymmetric supply of monomers, eventually affecting the
translocation of the cell. The data presented here are consistent with this model since the initial protrusion events (polymerization of actin in lamellipodia) upon serum induction were unaffected by either the antizipcode ODNs or
puromycin treatment (data not shown). However, after 60 min, inhibition of protein synthesis began to negatively affect motility, suggesting that the continued supply of new
actin monomer replenishes the leading edge.
-Actin mRNA localization could affect other structures
that are important in motility (Farmer et al., 1983
; Bershadsky et al., 1995
). Focal adhesions influence locomotion by
providing traction for the contractile force. Synthesis of
actin (and other proteins) in association with this structure
likewise may provide an anchoring point for filament elongation during protrusion. Fibroblasts, although slow in their
migration, can generate very high traction forces because of
their strong substrate adherence (Lauffenburger and Horwitz, 1996
). The localized supply of actin monomers at the
leading edge could also facilitate the synthesis and assembly of proteins involved in forming the focal adhesions.
-isoform of actin, implicated in cell motility (Hoock et al., 1991
; Herman, 1993
).
Other actin isoforms such as
- and
- are also components of the cytoskeleton in particular cell types (Otey et al.,
1988
). The ratio of the various isoforms within the cell has
a profound effect on cell structure and function (Schevzov
et al., 1992
; Lloyd and Gunning, 1993
). While each actin
isoform is highly conserved in amino acid sequence, the 3
UTRs of their respective mRNAs differ. Possibly, each
isoform is synthesized in its respective cytoplasmic compartment, and protein sorting results (von Arx et al., 1995), in
part, from the distribution of their respective mRNAs.
mRNA localization therefore represents a spatial component of gene expression in the cytoplasm dictating where a
protein will be synthesized. This level of control of gene
expression could be as significant to cell structure and
function as which protein is expressed.
Received for publication 3 July 1996 and in revised form 9 January 1997.
Essential conceptual contributions were made by John Condeelis (Albert Einstein College of Medicine), and critical comments on early drafts were made by Yu-Li Wang (Worcester Foundation for Biomedical Research). The authors thank Dr. Peter Quesenberry for access to his videomicroscope. Helpful comments related to this manuscript also were made by members of the laboratory: Tony Ross, Joan Politz, Krishan Taneja, and Chris Powers. We appreciate Birgit Koppetsch's skill at preparing primary CEF cultures and the secretarial help provided by Terri O'Toole. The essence of much of this work was published in abstract form (1995. Mol. Biol. Cell. 6[Suppl.]:309a). Funding for this work was provided to E.H. Kislauskis by a Muscular Dystrophy Research Grant and to R.H. Singer from National Institutes of Health (grant AR41480).CEF, chicken embryo fibroblasts; ODN, oligodeoxynucleotides.
-actin within the cell.
J. Cell Biol.
126:
1221-1230
-actin and its mRNA
are localized at the plasma membrane and the regions of moving cytoplasm
during the cellular response to injury.
J. Cell Biol.
112:
653-664
untranslated sequences sort
-cardiac and
-cytoplasmic actin messenger
RNAs to different cytoplasmic compartments.
J. Cell Biol.
123:
165-172
-actin messenger RNA also affect cell phenotype.
J. Cell Biol.
127:
441-451
-Actin
mRNA localization is regulated by signal transduction mechanisms.
J. Cell
Biol.
126:
1211-1219
-actin gene influence the impact of the gene on myoblast morphology.
J. Cell Biol.
121:
73-82
- and
-actin genes differentially impacts on myoblast architecture.
J. Cell Biol.
117:
775-785
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|