|
||
4 Integrin Subunit
Division of Cell Biology, The Netherlands Cancer Institute, NL-1066 CX Amsterdam; and * Department of Dermatology, University of Pennsylvania, Philadelphia, Pennsylvania 19104
Bullous pemphigoid antigen 180 (BP180) is a component of hemidesmosomes, i.e., cell-substrate adhesion complexes. To determine the function of specific sequences of BP180 to its incorporation in hemidesmosomes, we have transfected 804G cells with cDNA-constructs encoding wild-type and deletion mutant forms of human BP180. The results show that the cytoplasmic domain of BP180 contains sufficient information for the recruitment of the protein into hemidesmosomes because removal of the extracellular and transmembrane domains does not abolish targeting. Expression of chimeric proteins, which consist of the membrane targeting sequence of K-Ras fused to the cytoplasmic domain of BP180 with increasing internal deletions or lacking the NH2 terminus, indicates that the localization of BP180 in hemidesmosomes is mediated by a segment that spans 265 amino acids. This segment comprises two important regions located within the central part and at the NH2 terminus of the cytoplasmic domain of BP180.
To investigate the effect of the
6
4 integrin on the
subcellular distribution of BP180, we have transfected
COS-7 cells, which lack
6
4 and BP180, with cDNAs
for BP180 as well as for human
6A and
4. We provide evidence that a mutant form of BP180 lacking
the collagenous extracellular domain as well as a chimeric protein, which contains the entire cytoplasmic
domain of BP180, are colocalized with
6
4. In contrast, when cells were transfected with cDNAs for
6A and mutant forms of
4, either lacking the cytoplasmic COOH-terminal half or carrying phenylalanine
substitutions in the tyrosine activation motif of the
cytoplasmic domain, the recombinant BP180 molecules
were mostly not colocalized with
6
4, but remained
diffusely distributed at the cell surface. Moreover, in
cells transfected with cDNAs for
6A and a
4/
1
chimera, in which the cytoplasmic domain of
4 was
replaced by that of the
1 integrin subunit, BP180 was
not colocalized with the
6
4/
1 chimera in focal adhesions, but remained again diffusely distributed. These
results indicate that sequences within the cytoplasmic
domain of
4 determine the subcellular distribution of
BP180.
HEMIDESMOSOMES (HD)1 are multi-protein complexes, that mediate adhesion of epithelial cells to
the underlying basement membrane, thereby linking elements of the cytoskeleton to the extracellular matrix
in stratified epithelia (1, 12). Ultrastructurally, HD appear
as tripartite membrane-associated electron dense plaques associated with the keratin intermediate filament (IF) network.
Several molecular components of HD have recently been
identified. However, their exact interactions and their
function in the formation of HD are not completely understood (1, 12). The cytoplasmic components of HD include
the bullous pemphigoid antigen 230 (BP230, also termed
bullous pemphigoid antigen 1) (49), IFAP300 (44), plectin/
HD1 (6, 14, 57), and P200 (25). All these proteins have
been implicated in the attachment of the IF to the
hemidesmosomal plaque (1, 12). In BP230 knockout mice,
HD lack the inner plaque and they are not associated with
the IF, suggesting that BP230 is required to anchor the IF to the HD (13). It is possible that plectin and HD1 are the same protein, because of their similar molecular weight
and tissue distribution (1, 6, 14, 57). The observation that
both plectin and HD1 are absent in a subset of patients
with epidermolysis bullosa (EB), which represents a group
of hereditary disorders characterized by fragility of the
skin and blistering in response to trauma, supports this
contention (7, 33). However, comparison of the cDNA sequence of HD1 and of plectin is required to confirm their
identity. Two transmembrane proteins have been characterized in HD, the We here report experiments to investigate (1) the function of specific regions of human BP180 in the recruitment
of this protein into HD; and (2) the ability of BP180 to interact with Cell Culture and Antibody Preparation
The 804G cell line and the African monkey kidney cell line COS-7 were
cultured in DMEM (Gibco BRL, Paisley, UK) supplemented with 10%
(vol/vol) bovine FCS, 100 U/ml penicillin, and 100 U/ml streptomycin. The
804G cell line derived from a rat bladder tumor has been described previously (40, 41). The cells were grown at 37°C in a humidified, 5% CO2 atmosphere.
The following antibodies were used. The mouse IgG1 mAb antiFLAGTMM2 against the FLAGTM peptide (DYKDDDDK) was purchased
(IBI, Eastman Kodak Company, New Haven, CT). The rabbit antiserum
J17 directed against the intracellular portion of BP180 was kindly provided by Dr. J.C.R. Jones (Cell and Molecular Biology, Northwestern University Medical School, Chicago, IL) (18, 19). The mouse IgG1 mAb 1A8c
directed against the intracellular portion of BP180, and the mouse mAb
121 directed against HD1 were kindly donated by Dr. K. Owaribe (Department of Molecular Biology, Nagoya University, Nagoya, Japan) (14, 38).
The mouse mAb 450-10D against the cytoplasmic domain of cDNA-Constructs
The BP180 nucleotide and protein sequences are numbered according to
Giudice et al. (10) and Hopkinson et al. (19), respectively. Full-length
BP180 was obtained from human keratinocyte RNA by reverse transcriptase-PCR with primers based on published sequence of human
BP180 (GenBank accession number M91669) (10) using the Riboclone
cDNA Synthesis Kit (Promega, Madison, WI), the RNA-PCR Kit (Perkin
Elmer, Roche Molecular Systems, Inc., Branchburg, NY), and the PCR
Reagent System (GIBCO-BRL). The PCR reaction consisted of 35 cycles
of 15 s at 95°C, 30 s at 55°C and 90 s at 72°C. PCR products corresponding
to overlapping portions of BP180 were first cloned into pBluescript II
SK+ (Stratagene, La Jolla, CA) and ligated together to obtain full-length
BP180 using distinct restriction sites: PflmI, StuI, SacII, ClaI and EcoRI (at nucleotide positions 566, 1307, 1694, 2548 and 3619, respectively). A
PCR site-directed mutagenesis system was subsequently used to prepare
the various expression plasmids (Fig. 1 A). To generate clone A, B, C, and
D, a 5
The correctness of all clones was verified by sequence analysis, the various constructs were subsequently cloned using the XbaI and/or a NotI restriction site in the eukaryotic expression vector pCI-neo (Promega, Madison, WI). This vector carries a CMV enhancer/promotor for strong
constitutive expression, an intron located upstream from the multiple
cloning site as well as a SV40 origin for episomal replication in cell lines
expressing the SV large T antigen, such as COS-7 cells. Transfection studies have indicated that an intron flanking the cDNA of interest may significantly increase the gene expression level (2, 20).
For generation of the wild-type For generation of full-length The following cDNA constructs were used as a control for transfection.
A full-length murine BP180 cDNA (29), provided by Dr. J. Uitto (Department of Dermatology, Thomas Jefferson University, Philadelphia, PA),
was subcloned into the EcoRI site of pcDNA3. A full-length CD31
cDNA, provided by Dr. B. Seed (Massachusetts General Hospital, Boston, MA), was subcloned into the HindIII/NotI sites of pRc/CMV. A fulllength CD8 cDNA, provided by Dr. A. Kelly, Guy's and St. Thomas's
Medical and Dental School, London, UK), was subcloned into the
HindIII and BamH1 site of pcDNA3.
Transfection Experiments
For transfection, cells were first grown to 50-80% confluency in six-well
tissue culture plates (Falcon, Becton Dickinson, Lincoln Park, NJ). The
rat bladder carcinoma cell line 804G was transfected using a cationic lipid,
Lipofectin® (1:1-N-[1-(2,3-dioleyloxy) propyl]-n,n,n-trimethylammonium
chloride and dioleoyl phosphatidylethanolamine (GIBCO-BRL). The
DNA:Lipofectin® mixture was prepared using serum free medium (OPTIMEM®, GIBCO-BRL). The final concentration of plasmid DNA and Lipofectin® in serum free transfection medium was 5 µg/ml and 20 µg/ml, respectively. 1 ml of transfection medium was added to each monolayer that
had been previously washed with serum free medium and cells were incubated with the transfection medium for 12-18 h at 37°C with 5% CO2. The
transfection medium was then replaced with normal growth medium and
cells were incubated for additional 24-36 h and then assayed for gene expression. COS-7 cells were transfected using the DEAE-dextran method
(4) and assayed for gene expression after 36 h.
Western Blot Analysis
Cells were lysed with 1% SDS in 25 mM Tris-HCl, pH 7.5, 4 mM EDTA,
100 mM NaCl, 1 mM PMSF, 10 µg/ml leupeptin and 10 µg/ml soybean
trypsin inhibitor. Protein concentration in the cell lysates was determined
with the BCA protein assay reagent (Pierce, Rockford, IL). Equal amounts
of protein were loaded on a 8.5% or 13.5% SDS polyacrylamide gel, separated, and electrophoretically transferred to nitrocellulose sheets for 1 h at
240 mA in 25 mM Tris-HCl, pH 8.3, 192 mM glycine, 20% (vol/vol) methanol and 0.0375% SDS as previously described (53). The filters were incubated in TBST (10 mM Tris-HCl, pH 7.6, and 150 mM Nacl, 0.1% Tween20) containing 2% (wt/vol) BSA and 2% (wt/vol) baby milk powder for
12 h at 4°C. Subsequently the filters were probed with the primary antibody for 90 min, after which they were washed four times for 5 min in TBST.
The filters were subsequently incubated with horseradish peroxidase-
linked sheep anti-mouse IgG or horseradish peroxidase-linked goat anti-
rabbit IgG (Amersham International plc), diluted to 1:5,000 and 1:2,000,
respectively, for 1 h and then washed with TBST. Proteins were visualized
using enhanced chemiluminescence (Amersham International plc).
Immunofluorescence Microscopy
Cells grown on glass coverslips in six-well tissue culture plates were fixed
with 1% formaldehyde for 10 min and permeabilized with 0.5% Triton
X-100 for 5 min. After rinsing with PBS and blocking with 2% (wt/vol)
BSA in PBS for 30 min, the cells were incubated with primary antibody for
30 min at 37°C, then washed three times with PBS. The cells were stained
with fluorescein- or Texas red-labeled anti-mouse IgG, anti-rat IgG or
rabbit IgG for 30 min at 37°C. The coverslips were subsequently washed,
mounted with Vectashield (Vector, Burlingame, CA), and viewed under
an MRC-600 confocal scanning laser microscope (Bio-Rad Laboratories,
Richmond, CA).
Cell Labeling and Immunoprecipitation
Transfected COS-7 cells were washed twice with PBS and incubated with
DMEM without methionine and cysteine (ICN Biomedicals Inc., Costa
Mesa, CA) for 1 h at 37°C. Cells were then labeled with 100 µCi/ml
[35S]methionine/cysteine (Amersham International plc) for 4 h, then washed and lysed with 1% NP-40 in 25 mM Tris-HCl, pH 7.5, 4 mM EDTA,
100 mM NaCl, 1 mM PMSF, 10 µg/ml leupeptin, and 10 µg/ml soybean
trypsin inhibitor. Cells were also lysed with 1% Triton X-100, 2 mM
CaCl2, 1 mM PMSF, 10 µg/ml leupeptin, and 10 µg/ml soybean trypsin inhibitor or 10 mM CHAPS in HBSS. The lysates were clarified by centrifugation at 10,000 g and precleared with protein A-Sepharose CL-4B (Pharmacia LKB Biotechnology Inc., Uppsala, Sweden). Samples of precleared
lysates were immunoprecipitated with antibodies previously bound to
protein A-Sepharose or to protein A-Sepharose to which rabbit anti-
mouse IgG was attached. The immunoprecipitates were subsequently analyzed by SDS-PAGE.
Expression of Recombinant Forms of Human BP180
The role of specific sequences of BP180 in the localization
of the protein in HD was investigated by introducing a series of cDNA-constructs into the epithelial cell line 804G.
The 804G cells, which have previously been used to study
the assembly and formation of HD, contain the structural
components of HD, i.e., proteins that may interact with
BP180, including the
Wild-Type and Mutant Forms of BP180 Lacking the
Extracellular and the Transmembrane Domains Are
Recruited into Hemidesmosomes of 804G Cells
As shown by confocal laser immunofluorescence microscopy, the hemidesmosomal proteins of 804G cells are concentrated at sites of cell-substrate contact in structures appearing as dots and patches arranged in a characteristic
"Swiss cheese" pattern (40, 41, 48). To investigate the distribution of the recombinant BP180 molecules, transiently
transfected cells were subjected to double immunofluorescence microscopy. The mAb anti-FLAGTMM2 directed
against the FLAGTM peptide was used to distinguish the recombinant, tagged proteins from endogenous wild-type
BP180. When 804G cells were transfected with clones A
and B, mutant proteins were found at the basal side of the
cells, colocalized with
A 265-Amino Acid Segment Mediates the
Incorporation of BP180 into Hemidesmosomes
To further define the function of distinct cytoplasmic domains, cDNA-constructs encoding the plasma membrane
targeting sequence of K-Ras fused to various cytoplasmic
parts of BP180, were expressed in 804G cells (clones D to
H, Fig. 4). The K-Ras membrane localization signal, which
consists of a CAAX motif (in which A means aliphatic -, and X refers to any amino acid) and a lysine-rich polybasic domain, targets proteins with high efficiency to the inner
surface of the plasma membrane (28, 39). We assumed
that because of the presence of the the K-ras sequence, the
truncated BP180 proteins would become localized at the
plasma membrane where interactions with hemidesmosomal proteins take place. Transient expression of clone
D, which contained the sequence for the entire cytoplasmic domain of BP180, resulted in the incorporation of the
chimeric protein in HD-like structures, where it was codistributed with endogenous
Localization of BP180 in Hemidesmosomes Is Not
Affected by Mutations at Serine Residues within the
Central Portion of its Cytoplasmic Domain
A recent study has suggested that phosphorylation at
serine residues of BP180 may regulate its localization into
HD (23). Analysis of clone F encoded protein, which contains the minimal sequences required for the targeting of
the protein to HD, reveals the presence of several potential phosphorylation sites (Thr28, Ser41, Thr157, Ser169, Ser180,
and Thr191) as well as a recognition sequence for p34cdc2 kinase (Ser175) (19). Notably, the deletion of three serine residues (Ser169, Ser175, and Ser180) located in the central portion of the cytoplasmic domain of the BP180 recombinant
protein encoded by clone G, prevents its incorporation
into HD. To examine the role of these serine residues, we
mutated the recombinant protein encoded by clone D by
substituting the three Ser169, Ser175, and Ser180 by alanines.
As shown in Fig. 5, by immunofluorescence, this mutated
BP180 molecule was distributed in a Swiss cheese-like pattern, which indicates that this recombinant protein was
correctly localized in HD. Thus, phosphorylation of the
above Ser residues does not seem to be required for the localization of BP180 in HD.
The Cytoplasmic Tail of BP180 Is Colocalized with the
Previous studies have shown that the
In COS-7 cells transfected with clone A encoding wildtype BP180, the recombinant molecule remained diffusely
distributed in the cytoplasm, where it was localized in
granules and tubular structures, particularly prominent in
perinuclear regions (not shown). Because the recombinant
protein was synthesized but not expressed on the cell surface, as shown by immunoprecipitation (Fig. 9) and FACS
analysis (not shown), the full-length BP180 was probably
retained in the ER and/or Golgi apparatus. This was most
likely due to incorrect folding and/or impaired trimer formation of this collagenous protein (16). In contrast, the
mutant proteins encoded by clones B or D were properly
expressed at the plasma membrane. Both proteins were
distributed predominantly at the apicolateral cell surface.
By double immunofluorescence microscopy, the localization of these mutant forms of BP180 was clearly different from that of vinculin (Fig. 6, A and B), Transfection of COS-7 cells with cDNAs for
When clone B or D cDNA was cotransfected with Finally, COS-7 cells were also cotransfected with clone
G or H with more extensive deletions: in this case, the
staining of the plasma membrane was too intense, due to
the high level of expression, to assess the colocalization with
Mutant Forms of BP180 Do Not Coprecipitate with
A recent study has provided evidence for an interaction
between BP180 and The Subcellular Distribution of BP180 Is Affected by
the Cytoplasmic Domain of As an alternative approach to identify domains involved in
the association of BP180 and We have studied the contribution of various segments of
BP180 to its incorporation into HD by transfecting 804G
cells with cDNA-constructs encoding wild-type, deletion
mutant forms of BP180, and chimeric proteins, in which
the membrane targeting sequence of K-Ras had been fused
to segments of the cytoplasmic domain of BP180. The results indicate that the cytoplasmic domain of BP180 contains sequences sufficient for the incorporation of mutant forms of BP180 into HD-like structures in 804G cells. The
localization of BP180 in HD appears to be mediated by a
region that spans 265 amino acids (clone F) comprising
two important domains, that are located at the NH2 terminus and within the central portion of the BP180 cytoplasmic domain.
Based on transient transfections of 804G cells, it was recently reported that a 36-amino acid stretch located at the
NH2 terminus determines the localization of BP180 at the
basal side of the cell, whereas the extracellular segment
close to the membrane-spanning domain is required for its
recruitment into HD (18). Our results confirm the functional importance of the NH2-terminal domain of BP180.
However, our observation that a chimeric protein composed of the membrane targeting signal of K-Ras and a cytoplasmic tail of BP180 lacking this NH2-terminal region
(clone H) is not only localized at the apical, but also often
at the basolateral cell surface, indicates that this segment is
not uniquely involved in sorting the protein to the basal
cell surface, but rather is required for targeting BP180 to
HD. The membrane targeting signal of K-Ras may be responsible for the diffuse localization of the protein (28,
39), but this possibility seems less likely, because recombinant molecules encoded by clones B or D, that lack or contain the K-Ras membrane localization sequence, respectively, were frequently similarly distributed. Alternatively,
it is conceivable that the localization of the mutant protein
is dynamic and dependent on its relative expression level
in transfectants.
The results of the subcellular localization of chimeric
proteins with deletions of increasing size within the BP180
cytoplasmic domain indicate the existence of an additional, as yet unrecognized, functionally important region.
Whereas a truncated BP180 molecule consisting of a 265-
amino acid stretch was localized in HD (clone F), a recombinant protein with an additional internal deletion of 88 amino acids towards the NH2 terminus (clone G) was not.
What are the mechanisms by which the truncations of
the cytoplasmic domain of BP180 interfere with its incorporation in HD? First, the deleted regions may contain the
sequences responsible for the interaction of BP180 with elements of the hemidesmosomal cytoskeleton. Second,
conformational changes in protein architecture may be responsible for the failure of clone G and clone F encoded proteins to be incorporated into HD. PHD secondary
structural analysis (42) predicts that the protein encoded
by clone F, containing the minimal sequences for recruitment into HD, has several Our results demonstrate that removal of the extracellular and transmembrane regions of BP180 or their substitution by the membrane localization sequence of K-Ras does
not abolish the localization of BP180 in HD of 804G cells.
This was unexpected, because in a previous study, deletion
of a segment of 27 amino acids located immediately after
the transmembrane domain prevented the incorporation of the BP180 protein into HD, suggesting that this region
is required for targeting (18). However, in this latter study
(18) it has not been ascertained whether the truncated
protein was correctly inserted in the plasma membrane.
BP180 is a type II transmembrane protein, whose insertion
in the membrane depends on both the "signal-anchor" sequence of the transmembrane domain and the number
and type of flanking charged amino acids (15). Therefore,
deletion of the region proximal to the transmembrane domain may have a deleterious effect on the translocation
and insertion of the truncated protein into the plasma
membrane, preventing its interaction with the hemidesmosomal cytoskeleton. Since our transfection studies only assess the ability of mutant proteins to be incorporated, together with endogenous components, into HD (48), our
findings do not exclude the possibility that the ectodomain
of BP180 is also involved in the localization of the protein
in HD as well as in their nucleation and formation by binding to an extracellular ligand(s).
To analyze the potential of BP180 to interact with Our mutagenesis experiments indicate that the COOHterminal half of the The results of our immunofluorescence analysis indicate
that neither the elimination of the COOH-terminal half of
It is difficult to reconcile some of our findings with a
previous report stating that a mutant form of BP180, identical to that encoded by clone B, coprecipitated with In conclusion, the studies reported here show that the
cytoplasmic tail of BP180 contains sequences critical and
sufficient for mediating the localization of BP180 in HD.
Upon expression of both the
6
4 integrin (26, 45, 50) and the
bullous pemphigoid antigen 180 (BP180, also termed bullous pemphigoid antigen 2 or type XVII collagen) (10, 19,
27, 29). The
6
4 integrin appears to be crucial for cell adhesion and the formation of HD; since (1) antibodies directed against the
6
4 integrin inhibit the assembly of
HD and disrupt existing ones, and induce dermo-epidermal separation in vitro (26); (2) the formation of HD can
be prevented by inhibition of the phosphorylation of
4 (9,
30, 31); (3) in humans, mutations of
4 cause junctional
EB associated with pyloric atresia, a severe form of EB
(36, 56); (4) finally, null-mutant mice for either
4 or
6
show widespread dermo-epidermal separation and lack HD
(8, 55).
6
4-mediated functions are probably regulated
by sequences within the large cytoplasmic domain of
4 (9,
30) which comprises two pairs of type III fibronectin repeats (FNIII) separated from each other by a connecting
segment (17, 51). The other transmembrane protein, BP180,
also contributes to the maintenance of dermo-epidermal
integrity. Defects in the gene for BP180 have been described in generalized atrophic benign EB, a human disease in which dermo-epidermal cleavage occurs in the
lamina lucida and, ultrastructurally, HD appear to be incompletely formed (21, 32). Furthermore, patients with
the blistering skin disorder called bullous pemphigoid have
frequently circulating autoantibodies against epitopes on
the BP180 ectodomain, that may cause dermo-epidermal
cleavage (11, 27). BP180 is a type II transmembrane protein. Its extracellular COOH-terminal amino acid sequence
contains 15 interrupted collagenous domains, which probably form collagen-like triple helices (10, 16). The cytoplasmic amino acid sequence is highly basic and contains
several potential phosphorylation sites (10, 19). The cytoplasmic domain of BP180 might play an important role in
the organization of the cytoskeleton and the assembly of
HD. Transfection studies with mutant forms of BP180
have identified two segments within BP180, one located in
the intracellular NH2-terminal and another in the extracellular membrane-proximal region, that may be important for the integration of this protein into HD (18).
6
4. We have transfected 804G cells with
wild-type and deletion mutants of the cDNA for BP180 as
well as cDNA-constructs encoding chimeric proteins composed of different portions of the cytoplasmic tail of
BP180 linked to the membrane localization sequence of
the K-Ras protein. In contrast to the above-mentioned
study (18) our results indicate that sequences within the
cytoplasmic domain of BP180 are sufficient for HD targeting. Furthermore, by cotransfecting COS-7 cells, which do
not form HD, with cDNAs for the human
6A and
4A
integrin subunits, we demonstrated that these proteins form distinct junctional structures, in which recombinant
BP180 molecules are colocalized with the
6
4 integrin.
Our results suggest that the codistribution of BP180 with
6
4 is regulated by sequences contained within the COOHterminal half of the
4 tail including the third and fourth
FNIII and a part of the connecting segment. Specifically,
signals mediated by the tyrosine activation motif (TAM)
located within the connecting segment seem to be required to efficiently coordinate the codistribution of BP180 with
6
4.
Materials and Methods
4 was
kindly supplied by Dr. S.J. Kennel (Oak Ridge National Laboratory, Oak
Ridge, TN) (22). The rat mAb GoH3 against an extracellular epitope of
human
6 (47), a rabbit antiserum against the cytoplasmic domain of
4
(34), a rabbit antiserum against the COOH-terminal portion of
6A (5) as
well as a rabbit antiserum to rat IgG (46) have been described previously.
The mAb against vinculin, clone VIN-11-5, was purchased (Sigma Chem.
Co., St. Louis, MO). A rabbit antiserum against the COOH-terminal domain of BP230, was kindly provided by Dr. J.R. Stanley (Department of
Dermatology, University of Pennsylvania, Philadelphia, PA) (52). Species
specific FITC-conjugated goat anti-mouse IgG (Nordic Immunochemicals
Laboratory, Tilburg, The Netherlands) and Texas red-conjugated donkey
anti-rabbit IgG (Amersham International plc, Buckinghamshire, UK)
were purchased.
end primer was used that contained an EcoRI and a NotI site for
cloning, sequences for optimal initiation of translation (bold) (24), sequences coding for the FLAGTM peptide (underlined) (IBI, Eastman Kodak Company) for immunodetection, as well as nucleotides corresponding
to sequences between 109 and 131 of human BP180 (italic) located immediately downstream from the predicted methionine start site of BP180
(nucleotide 106-109) (18) (5
-GCCGGAATTCGCGGCCGCCGCCATGGACTACAAGGACGACGATGACAAGGATGTAACCAAGAAA - AACAAACG 3
-). The 3
primer of clone A contained a NotI and a XbaI
restriction site and the nucleotides corresponding to sequences between
4579 and 4599 of BP180 (italic) including the stop codon (5
-CGAT GCGGCCGCTCTAGATCACGGCTTGACAGCAATACT 3
-). The 3
end primer of clone B contained a NotI and a XbaI restriction site, a stop
codon, and nucleotides corresponding to sequences 1641 and 1662 of BP
180 (italic) (5
-CGATGCGGCCGC TCTAGATTATATTCTATCCATGCTGTCCCCA 3
-) The 3
primer used to generate clone C contained
a NotI and a XbaI site restriction site, a stop codon, and nucleotides corresponding to sequences between 1480 and 1503 of BP180(italic) (5
-CGATGCGGCCGCTCTAGATTACTTCCACCAGCTGCAGCAGGAGCC 3
-).
The 3
primer used for clone D was designed in order to generate a chimeric protein composed of the cytoplasmic domain of BP180 fused to the
membrane localization sequences of K-Ras (KMSKDGKKKKKKSKTKCVIM) (GenBank accession number M54968 and M38506). This primer
contained a NotI and a XbaI restriction site, a stop codon, nucleotides encoding the membrane localization sequences of the K-Ras (bold) as well
as the sequence between 1479-1503 of BP180 (italic) (5
-CGATGCGGCCGCTCTAGATTACATAATTACACACTTTGTCTTTGACTTCTTTT - TCTTCTTTTTACCATCTTTGCTCATCTTCTTCCACCAGCTGCAGC - AGGAGCC 3
-). The clones E, F, and G, which encoded chimeric proteins with increasing internal truncations of the cytoplasmic portion of
BP180 starting from amino acid 244, 201 and 113, respectively, to 402, were generated by partial digestion of clone D with Ecl136 II (nucleotide
sites 440, 701, and 830) and complete digestion with StuI (nucleotide 1307).
The construct H lacking the sequences encoding amino acids 1 to 36 was
generated using a 5
primer that contained a XbaI site, sequences for optimal initiation of translation (bold) and for the FLAGTM tag (underlined),
as well as nucleotides corresponding to sequences between 214 and 230 of
BP180 (5
GCCGTCTAGACGCCATGGACTACAAGGACGACGATGACAAGAGCAATGGCTATGCTAAAACAGC 3
-). Combined
alanine substitutions at positions Ser169, Ser175, and Ser180 were introduced
in clone B using the overlap extension method for site directed mutagenesis as previously described (5).
Fig. 1.
(A) Schematic representation of wild-type and mutant
forms of BP180 with summary of their localization in 804G cells.
The upper three cDNA-constructs represent wild-type (clone A)
and COOH-terminal truncations of BP180 (clones B and C),
while the lower five (clones D, E, F, G, and H) represent chimeric cDNA-constructs encoding the membrane localization sequence of K-Ras fused with cDNAs encoding various cytoplasmic regions of BP180. IC, intracellular domain; EC, extracellular
domain; T, FLAGTM tag; DSR, degenerate set of four 24-26 residue tandem repeats; TM, membrane-spanning domain; CX, membrane localization sequences of K-Ras. Truncations introduced
by cloning procedures are indicated by the segment of amino acids that were deleted (
). The protein sequence of BP180 is numbered according to Hopkinson et al. (18). (B) Schematic representation of
6A and
4A integrin subunits, of mutant form
4A1382, and of the
4/
1 chimera. The mutant form
4A1382
lacks the COOH-terminal half of the cytoplasmic domain, including the third and fourth type III fibronectin repeats (FNIII) and a
portion of the connecting segment (CS). The
4/
1 chimera consists of the extracellular and the transmembrane domain of
4
fused to the entire cytoplasmic domain of
1. The position of the
two tyrosine residues, Tyr1422 and Tyr1440, in the cytoplasmic domain of
4, which are part of the tyrosine activation motif, is indicated (arrows). The COOH-terminal truncation (
) is indicated
by the stretch of amino acids that was removed. The protein sequence of
4A is numbered according to Suzuki and Naitoh (51).
[View Larger Version of this Image (21K GIF file)]
6A cDNA, two overlapping cDNA
clones, A33 and A84, isolated from a
gt11 human keratinocyte library
were used as previously described (5). The full-length
6A was inserted
into the HindIII site of the pRc/CMV expression vector (Invitrogen, San
Diego, CA) (Fig. 1 B) (5).
4A cDNA, a cDNA clone isolated from
a
gt11 human keratinocyte library was used that encodes
4A from position 1880 to the 3
terminus. The
DNA was digested with SfiI and the resulting 2.2-kb fragment was exchanged for the 2.35-kb SfiI fragment of
4B (35, 37). The cDNA was then ligated into the XbaI site of the pRc/
CMV vector (Invitrogen). The cDNA-construct encoding a truncated
4
molecule, clone
41382, was obtained by exchanging a PCR fragment with
a wild-type fragment of
4 and will be described in detail elsewhere. After
sequence analysis, the
41382 cDNA construct was subcloned into pcDNA3
(Invitrogen) (Fig. 1 B). The cDNA plasmid encoding a
4 with combined
phenylalanine substitutions of the tyrosine activation motif (30) was
kindly provided by Dr. F.G. Giancotti (Department of Pathology, New
York University School of Medicine, New York, NY). The construct was assembled into pcDNA3. Construction of the
4/
1 cDNA encoding a
chimeric protein, in which the cytoplasmic domain of
4, with the exception of a 19-amino acid stretch immediately close to the transmembrane
domain, was replaced with that of
1, has been recently described. The
4/
1 cDNA was inserted into the XbaI site of the pcDNA-1Hyg expression vector (43).
Results
6
4 integrin, BP230, and HD1 (40,
41, 48). As illustrated in Fig. 1 A, we have generated cDNAconstructs encoding full-length (clone A) or two truncated
forms of BP180, that consist of either the entire cytoplasmic domain, the transmembrane region and a segment of 30 amino acids located adjacent to the transmembrane region (clone B) or of the cytoplasmic domain alone (clone C).
Clone B was used because a previous study had indicated
that the protein encoded by this construct contains the
minimal sequence of the ectodomain of BP180 essential
for incorporation into HD (18). To further investigate the
contribution of distinct cytoplasmic domains in the recruitment of BP180 to HD, we generated cDNA clones encoding chimeric proteins, in which the membrane localization
sequence of K-Ras (28, 39) had been linked to various
parts of the cytoplasmic region of BP180 (clones D to H).
To identify proteins encoded by the transfected plasmids a
24-bp sequence encoding the FLAGTM peptide was added
at the 5
end of the cDNAs. In addition to DNA sequencing of the various constructs, the proteins encoded by the
clones were analyzed by in vitro transcription/translation followed by SDS-PAGE and found to be of the predicted
mol wt (not shown). Finally, to assess whether the transiently transfected 804G cells expressed the appropriately
sized recombinant BP180 molecules, we performed immunoblot analysis of cell extracts (Fig. 2) using mAbs directed against the FLAGTM peptide as well as against the
cytoplasmic domain of BP180. In transfected cells, the apparent mol wt of the recombinant proteins were close to
the sizes predicted on the basis of the corresponding
cDNA sequence, i.e., 151.6 kD, 55.7 kD, 49.4 kD, 51.7 kD,
35.3 kD, 30.9 kD, 21.4 kD, and 47.9 for clones A, B, C, D,
E, F, G, and H, respectively. The size of the protein encoded by clone A, corresponding to full-length human
BP180, was slightly smaller than that of endogenous rat BP180, possibly due to insufficient posttranslational processing of this protein and/or a species difference. In extracts from COS-7 cells transfected with cDNAs for either
human or mouse full-length BP180, the mol wt of the expressed proteins were similar (not shown).
Fig. 2.
Identification of
mutant forms of BP180 expressed in 804G cells by immunoblotting. Extracts of
cells transfected with clones A (lanes 1 and 3), B (lane 7),
C (lane 8), D (lanes 4 and 9), H (lane 10), E (lane 11), F
(lane 12) or G (lanes 13 and
15) and of mock-transfected controls (lanes 2, 5, 14, and 16-18) were processed using the BP180 antiserum J17 (lanes 1 and 2) and the mAb 1A8c (lanes 3-5, and 7 to 14), that are both directed against the intracellular portion of human BP180, as well as the mAb antiFLAGTMM2 against the FLAGTM tag (lanes 15 and 16). Samples were separated by 8.5% (lanes 1-6) and 13% (lanes 7-18) SDS-PAGE
under reducing conditions. Note that the rabbit antiserum J17 clearly recognizes a protein corresponding to endogenous wild-type
BP180 (lanes 1 and 2) with a slightly slower electrophoretic mobility than full-length human BP180 (lane 1). The mutant protein encoded by clone G, which carried the largest deletion of the cytoplasmic domain, is not recognized by mAb 1A8c (lane 13), but is recognized by the mAb anti-FLAGTMM2 (lane 15) (arrow head). Since mAb anti-FLAG generated high unspecific background (lanes 15 and
16), only short time exposure is depicted. Mock-transfected cells were also processed using an antiserum against the cytoplasmic domain of
4 (lane 6), an anti-
6A antiserum recognizing the light chain of the endogenous
6 (lane 17), and a normal rabbit serum (lane
18). Molecular weight markers are indicated in kD.
[View Larger Version of this Image (16K GIF file)]
6 (Fig. 3) and
4, and with BP230
(not shown) producing the typical Swiss cheese-like staining pattern. However, the clone C encoded protein, which
lacks the transmembrane and extracellular domains, was
not only localized in HD-like structures, but was also diffusely distributed in the cytoplasm (Fig. 3, E and F). The
localization of this mutant protein was more obvious in
cells with low transgene expression levels, as estimated by
fluorescent staining intensities. These results indicate that
the full-length (clone A) as well as the two truncated forms
of BP180 (clones B and C), that lack either the whole collagenous extracellular domain or both the transmembrane
and extracellular domain, are normally incorporated into
HD of 804G cells. The peculiar localization of clone C encoded protein in both HD and the cytoplasm suggests that
not only the cytoplasmic domain but also the transmembrane region and/or portions of the extracellular domain
are required for efficient recruitment of the protein into
HD; or that the amount of the recombinant protein is too
large to be completely incorporated into HD. The second
possibility is supported by the observation that in cells with
high levels of the mutant proteins encoded by clone A or B, these proteins were not found uniquely in HD, but also
localized diffusely over the cell surface (not shown).
Fig. 3.
Immunolocalization
of mutant forms of BP180 in
hemidesmosomes of transfected 804G cells by confocal laser microscopy. Cells were grown on glass coverslips and transfected with
clones A (A and B), B (C
and D) or C (E and F). After
36 h, cells were fixed with 1%
formaldehyde, permeabilized
with 0.5% Triton X-100, and subjected to double immunofluorescence using the mAb
anti-FLAGTMM2 (A, C, and
E) and an anti-
6A antiserum
(B, D, and F). FITC-conjugated goat anti-mouse IgG
(left) and Texas red-conjugated donkey anti-rabbit IgG (right). The recombinant
forms of BP180 were concentrated in a Swiss cheese-like
pattern characteristic for
hemidesmosome-like structures, where they were colocalized with
6 along the
basal cell surface as demonstrated by z-sections of individual cells (insets). Note that
the mutant form expressed
by clone C showed, in addition to its localization in
hemidesmosomes, a diffuse
cytoplasmic distribution (E).
Bar, 10 µm.
[View Larger Version of this Image (128K GIF file)]
6 (Fig. 4, A and B) and
4, and
with BP230 (not shown). Computer generated z-sections
demonstrated that the mutant protein was concentrated at
the basal cell surface (Fig. 4). Recombinant proteins encoded by clones E and F with increasing internal deletions of 159 and 202 amino acids in the cytoplasmic domain of
BP180, showed also the ability to be correctly localized in
HD (Fig. 4, C and E). However, in many cells these mutants were also distributed at the apicolateral cell membrane, suggesting that the amount of the recombinant proteins was too large to be completely incorporated into HD
or, alternatively, that their incorporation into HDs was partially defective. These recombinant proteins lacked the degenerate set of four 24-26 residue tandem repeats (10). In
contrast, the protein encoded by clone G, in which, compared to clone F, there is an additional deletion of 88 amino acids towards the NH2 terminus, was never found to
be codistributed with
6, but remained diffusely distributed at the cell surface (Fig. 4, G and H). Finally, the same
diffuse cell membrane localization was observed with the
chimeric protein encoded by clone H lacking the first 36 amino acids at the NH2 terminus (Fig. 4, I and J). This
short segment has previously been reported to be required for the localization of a truncated BP180 protein at the
ventral surface of 804G cells (18). These results show that
the chimeric protein consisting of a 265-amino acid stretch
of the cytoplasmic tail of BP180 (clone F) contains sequences sufficient for the localization of the protein in
HD. Furthermore, deletion of specific segments located at
the NH2 terminus (clone H) and within the central portion
of the cytoplasmic domain of BP180 (clone G) completely prevents the recruitment of mutant forms of BP180 into HD.
Fig. 4.
Immunolocalization of chimeric forms of BP180 composed of the membrane targeting sequence of K-Ras combined
with various cytoplasmic portions of BP180 in 804G cells. Cells
transfected with clones D (A and B), E (C and D), F (E and F), G
(G and H), or H (I and J) were fixed, permeabilized, and subjected to double immunofluorescence using the mAb antiFLAGTMM2 (A, C, E, G, and I) and an anti-
6A antiserum (B,
D, F, H, and J). FITC-conjugated goat anti-mouse IgG (left) and
Texas red-conjugated donkey anti-rabbit IgG (right). In cells
transfected with clones D, E, or F, the chimeric proteins are
clearly codistributed with
6 and are concentrated along the basal cell surface (z-sections in the insets). In contrast, the chimeric proteins expressed by clone G (G) or H (I) are diffusely distributed at the cell surface and are not colocalized with
6. Bar, 10 µm.
[View Larger Version of this Image (75K GIF file)]
Fig. 5.
Immunolocalization of clone
B encoded protein, in which combined
alanine substitutions of three serine
residues (Ser169, Ser175, and Ser180)
were introduced. 804G cells were grown
on glass coverslips, transfected, fixed
with 1% formaldehyde, permeabilized
with 0.5% Triton X-100, and subjected
to double immunofluorescence using the mAb anti-FLAGTMM2 (A) and an
anti-
6A antiserum (B). FITC-conjugated goat anti-mouse IgG (left) and
Texas red-conjugated donkey anti- rabbit IgG (right). The recombinant
form of BP180 was distributed in a
Swiss cheese-like pattern characteristic for hemidesmosome-like structures, where it was colocalized with
6.
Bar, 10 µm.
[View Larger Version of this Image (126K GIF file)]
6
4 Integrin and HD1 in COS-7 Cells
6
4 integrin plays
an essential role in the assembly of HD (8, 26, 30, 31, 55).
We next investigated the effect of the
6
4 integrin on the
subcellular distribution of wild-type or mutant forms of
BP180 by expressing cDNAs for these different components in COS-7 cells. COS-7 cells express HD1, the
3
1
integrin, and a small amount of
6
4, but lack BP230,
BP180, and
6
4 (37) (see Fig. 9 A). In COS-7 cells, vinculin (Fig. 6 B) and
1 are localized in punctate and streaky
arrays at sites of cell-substrate contact which represent focal adhesions, while a similar localization of
6 was observed in only a few cells. In contrast, HD1 is found
throughout the cytoplasm in a dense and delicate cytoskeletal network, similar to that previously described for plectin (Fig. 6 D) (37, 57).
Fig. 9.
(A) Immunoprecipitation analysis of transfected COS-7
cells. Lysates of 35S-radiolabeled cells cotransfected with cDNAs
for
6A and
4A as well as clone D (lanes 1-3), clone B (lanes 4-6),
or clone A (lanes 7-9), with cDNAs for
6A and
4A alone
(lanes 10-12), and of mock-transfected cells (lanes 13-15), were
immunoprecipitated with the mAb anti-FLAGTMM2 (lanes 1, 4,
7, 10, and 13), an anti-
6 antiserum (lanes 2, 5, 8, 11, and 14), and
an anti-
4 antiserum (lanes 3, 6, 9, 12, and 15). Note that immunoprecipitation of cells transfected with cDNAs for
6A and
4A with either an anti-
6 and an anti-
4A antiserum yielded a
heterodimer complex of
6A and
4A, while no coprecipitation
of BP180 is observed. No coprecipitation of the
6A and
4A is
detected by using the mAb anti-FLAGTMM2, even after longer
exposure of the gel. (B) Lysates of 35S-radiolabeled cells cotransfected with cDNA for
6A as well as with clone D (lanes 1-3),
clone B (lanes 4-6), or clone A (lanes 7- 9), and of cells cotransfected with cDNA for
4A and clone D (lanes 10-12), clone B
(lanes 13-15), or clone A (lanes 16-18). Immunoprecipitation
was performed with the mAb anti-FLAGTMM2 (lanes 1, 4, 7, 10,
13, and 16), an anti-
6 antiserum (lanes 2, 5, 8, 11, 14, and 17),
and an anti-
4 antiserum (lanes 3, 6, 9, 12, 15, and 18). No coprecipitation of the
6A and
4A is found by using the mAb antiFLAGTMM2. In addition, no coprecipitation of mutant BP180
proteins is detected with either an anti-
6 or an anti-
4A antiserum. Note that one radiolabeled polypeptide (arrow heads) is coprecipitated by the mAb anti-FLAGTMM2 from extracts of cells
transfected with clone B. The identity of this protein, which was
not precipitated when cells were lysed with 1% Triton X-100 (not
shown), is unclear. Samples were analyzed by 8% SDS-PAGE under reducing conditions. Molecular mass markers are indicated in kD.
[View Larger Version of this Image (49K GIF file)]
Fig. 6.
Confocal double immunofluorescence microscopy of transfected COS-7 cells
showing the subcellular distribution of the
chimeric protein composed of the membrane
targeting sequence of K-Ras combined with
the cytoplasmic domain of BP180 (clone D).
Cells grown on glass coverslips were transfected with clone D. After 36 h, cells were
fixed, permeabilized, and subjected to double
labeling using the BP180 antiserum J17 (A
and C) and the mAb VIN 11-5 against vinculin (B), or the mAb 121 against HD1 (D).
Texas red-conjugated donkey anti-rabbit
IgG (left) and FITC-conjugated goat anti-
mouse IgG (right). The chimeric BP180 protein is distributed diffusely at the cell surface
and is not colocalized with endogenous vinculin or HD1. Bar, 10 µm.
[View Larger Version of this Image (127K GIF file)]
1, and HD1 (Fig.
6, C and D).
6A and
4A resulted in the expression of the
6
4 integrin at sites
of cell-substrate contact and, concomitantly, in the redistribution of HD1 from the cytoskeleton into junctional
complexes containing
6
4 (37) (Fig. 7, B and D, and Fig.
8 B). When COS-7 cells were transfected with cDNAs for
6A and a
4/
1 chimera encoding the extracellular domain of
4 fused to the cytoplasmic domain of
1,
6 was
associated with
4/
1 as assessed by immunoprecipitation
(not shown) and was found together with vinculin in focal
contacts (see Fig. 8 F) (43). In these cells, HD1 remained
diffusely distributed in a pattern similar to that observed
in untransfected COS-7 cells.
Fig. 7.
Double immunofluorescence microscopy of
transfected COS-7 showing
that the chimeric protein
composed of the membrane
targeting sequence of K-Ras
combined with the entire cytoplasmic domain of BP180
(clone D) is codistributed
with the
6
4 integrin. Cells grown on glass coverslips
were transfected with clone
D (A-F) together with cDNAs
for human
6A and
4A
(A-D), or with cDNAs for
human
6A and
4A1382 (E
and F). After 36 h cells
were fixed, permeabilized,
and subjected to double labeling using the mAb antiFLAGTMM2 (A and E) and
the rat mAb GoH3 (B and F)
as well as the BP180 antiserum J17 (C) and the mAb
121 against HD1(D). FITCconjugated goat anti-mouse IgG (A, D, and E), Texas
red-conjugated donkey anti-
rabbit IgG (C). The rat mAb
GoH3 was stained using a
rabbit anti-rat IgG (absorbed against mouse IgG)
and Texas red-conjugated
donkey anti-rabbit IgG (B
and F). In cells transfected
with
6A and
4A cDNAs,
the BP180 chimeric protein is
found concentrated along the
basal cell surface, where it is
codistributed with
6 and
HD1. In contrast, in cells
cotransfected with cDNAs
for
6A and
4A1382, the
mutant form of BP180 displayed uniquely an apicolateral cell surface distribution
and is not colocalized with
6. Z-sections of transfected
cells are shown in the insets.
The optical plane is the same
as in Fig. 6. Bar, 10 µm.
[View Larger Version of this Image (104K GIF file)]
Fig. 8.
Double immunofluorescence microscopy of transfected COS-7 showing that the subcellular distribution of clone B encoded
protein is affected by the cytoplasmic domain of the
4 integrin subunit. Cells were transfected with clone B (A-F) together with
cDNAs for human
6A and
4A (A and B), or with cDNAs for human
6A and a mutated
4 carrying phenylalanine substitutions of
the TAM (C and D), or, finally, with cDNAs for
6A and a
4/
1 chimera, in which the cytoplasmic domain of
4 was replaced by that
of
1 (E and F). After 36 h cells were fixed, permeabilized, and subjected to double labeling using the mAb anti-FLAGTMM2 (A, C, and
E) and the rat mAb GoH3 (B, D, and F). FITC-conjugated goat anti-mouse IgG (A, C, and E). The rat mAb GoH3 was stained using a
rabbit anti-rat IgG (absorbed against mouse IgG) and Texas red-conjugated donkey anti-rabbit IgG (B, D, and F). In cells transfected
with
6A and
4A cDNAs, the clone B encoded protein was localized along the basal cell surface codistributing with
6
4. In contrast, in cells cotransfected with cDNAs for
6A and a
4 carrying a mutated TAM or a
4/
1 chimera, the BP180 recombinant molecule displayed predominantly an apicolateral cell surface distribution and is not colocalized with
6
4 or
6
4/
1, respectively. Z-sections of
transfected cells are shown in the insets. The optical plane is the same as in Fig. 6. Bar, 10 µm.
[View Larger Version of this Image (122K GIF file)]
6A
and
4A cDNAs, the mutant BP180 proteins were concentrated at the basal cell surface and were codistributed with
the
6
4 integrin (Figs. 7 and 8, A and B) and HD1 (Fig. 7,
C and D), although in some cells staining of the apicolateral cell surface was still observed, in particular of the
clone D encoded protein (Fig. 7, A and C). In contrast, after identical transfections with the
4/
1 chimera instead
of
4, the two mutant BP180 proteins were not codistributed with
6
4/
1 in focal adhesions, but remained diffusely distributed at the cell surface (Fig. 8, E and F).
These results show that the BP180 mutants encoded by
clones B and D contain sequences necessary and sufficient
for the codistribution of BP180 with
6
4 and HD1, and
that the
4 cytoplasmic domain is involved in determining
the subcellular distribution of the BP180 recombinants and HD1. The colocalization of BP180,
6
4, and HD1
along the basal aspect of the transfected cells is unlikely to
be coincidental. First, BP180 recombinants were not concentrated at the basal cell side in the absence of
6
4. Second, when cells were cotransfected with cDNAs for either
CD8 or CD31, these two transmembrane proteins were
distributed diffusely at the cell membrane and did not codistribute with
6
4 (not shown).
6
4.
6
4 in COS-7 Cells
6 (18). To determine the ability of
mutant forms of BP180 to associate directly with
6 and
4, we performed immunoprecipitation experiments using
extracts from radiolabeled COS-7 cells that were transiently transfected with either of the clones A, B, or D together with cDNAs encoding
6A and
4. The SDS-PAGE
analysis of these immunoprecipitates is shown in Fig. 9 A.
In all cases, the mol wt of the detected proteins corresponded with the sizes predicted on the basis of the cDNA
sequence. Neither
6 nor
4 were precipitated in association with BP180 recombinant polypeptides encoded by
clones A, B, or D by the mAb anti-FLAGTMM2. Furthermore, the recombinant forms of BP180 encoded by these
clones could not be coimmunoprecipitated with either
6
or
4 by an anti-
6 or anti-
4 antiserum, respectively.
Identical results were obtained when COS-7 cells were
transfected with clones A, B, or D together with cDNA for
either
6A or
4 (Fig. 9 B). When the samples immunoprecipitated with the anti-
6 or anti-
4 antiserum were subjected to immunoblotting with the mAb anti-FLAGTMM2,
this mAb did not show any reactivity with the various precipitates. Moreover, no coprecipitation of recombinant forms
of BP180 with either
6A or
4A was observed when cells
were lysed with different detergents, such as Triton X-100
or CHAPS (not shown). In contrast, immunoprecipitation
with either a rabbit anti-
6 or a rabbit anti-
4 antiserum
of lysates from cells transfected with cDNAs for the
6A
and
4 yielded, as expected, a heterodimer complex consisting of
6 and
4. Together, these data do not provide
evidence for a physical association between mutant forms
of BP180 and the
6
4 integrin in transfected COS-7 cells.
4
6
4, we generated a cDNA
construct encoding a
4 molecule,
41382, with a truncated
cytoplasmic domain, which contains the first pair of FNIII
and a segment of 64 amino acids at the NH2 terminus of the
connecting segment, but which lacks the tyrosine activation motif (TAM) (30) of the connecting segment as well
as the third and fourth FNIII. In COS-7 cells transfected
with cDNAs encoding
6A and this truncated
4, the
4
mutant protein was distributed together with
6 and HD1
along the basal cell surface in a pattern indistinguishable
from that observed in cells transfected with wild-type
6A
and
4A, as assessed by double immunofluorescence staining (Fig. 7 F). Strikingly, in COS-7 cells expressing
6 and
41382 the mutant forms of BP180 encoded by clone B
(not shown) and D were not colocalized with
6
4 and
HD1 in these junctional complexes, but in most cells remained diffusely distributed at the apicolateral cell surface
(Fig. 7, E and F). Since recent studies (30, 31) have demonstrated that phosphorylation of the TAM of
4 is required for the incorporation of
6
4 into HD and for their
assembly, we then investigated if the TAM of
4 plays a
role in the subcellular distribution of BP180 by using a
4
subunit carrying a mutated TAM. In COS-7 cells transfected with cDNAs for
6A and a
4 subunit with combined phenylalanine substitutions at the TAM, the colocalization potential of the clone B encoded protein with
the mutated
4 was impaired as compared to that of wildtype
4. In most cells expressing
6 and the mutated
4,
clone B encoded protein was diffusely distributed over the
plasma membrane (Fig. 8, C and D), and in only a few transfected cells it was concentrated at the basal cell surface together with
6
4 (not shown). Notably, in cells expressing
6 and
4 with a mutated TAM, HD1 was found
to be codistributed with
6
4 in a pattern indistinguishable from that observed with
6 associated with wild-type
4 (not shown). Taken together, these results indicate, first,
that sequences contained in the COOH-terminal half of
the cytoplasmic tail of
4 are involved in determining the
subcellular distribution of BP180; second, that mutations of the
4 TAM interfere with the efficient colocalization
of BP180 with
6
4; finally, that colocalization of HD1
with
6
4 is, in contrast to that of BP180, mediated by sequences within the NH2-terminal half of the cytoplasmic
domain of
4.
Discussion
-sheet regions as well as one
-helical domain, which are absent in the recombinant
protein encoded by clone G. Moreover, the functionally
important domain at the NH2 terminus of BP180 contains
a
-sheet. The above two regions at the NH2 terminus and
within the central portion of the cytoplasmic domain may
thus be involved in the proper folding of BP180, which
may be essential for its assembly in HD. Finally, the truncations may interfere with the transmission of an intracellular signal required to render BP180 competent to interact
with other components of HD. Phosphorylation pathways
appear to critically regulate the assembly of HD (9). Inhibition of the phosphorylation of the
4 integrin subunit
was found to prevent localization of the
6
4 integrin in
HD (9). In addition, a recent study suggests that a protein
kinase C is involved in the phosphorylation of BP180 at
serine residues, which affects its localization at the basal
cell membrane of squamous carcinoma cells (23). Although combined alanine substitutions at three serine residues located in the central portion of the cytoplasmic domain of BP180 did not affect its localization in HD, it is
conceivable that the truncations in clone G and H encoded proteins G might interfere with signaling pathways that
control the association of BP180 with HD.
6
4,
we have performed transfection experiments using COS-7
cells. In COS-7 cells, transfected with cDNAs for the
6A
and
4 integrin subunits, expression of the
6
4 integrin
results in the generation of distinct structures at sites of
cell-substrate contact (37). These junctional complexes,
containing
6
4 and HD1, may correspond to the recently
described type II HD, which are found in some cell types
and which lack the two hemidesmosomal components
BP230 and BP180 present in HD (54). When COS-7 cells
were cotransfected with clones B or D, the recombinant
BP180 molecules were present in the same complexes as
6
4. These findings confirm the previously reported
colocalization of a mutant form of BP180 (identical to that
encoded by clone B) with
6
4 in FG cells which, like
COS-7 cells, lack endogenous BP180 and BP230 (18).
However, the observation that codistribution also occurred with the mutant form of BP180 lacking the entire
extracellular region (clone D), suggests that the cytoplasmic domain of BP180 contains sufficient elements for its
recruitment into complexes containing
6
4 and HD1.
4 subunit contains sequences required for the colocalization of mutant forms of BP180 with
6
4 in transfected COS-7 cells. This region of
4 comprises the third and fourth FNIII as well as part of the connecting segment including the TAM, that consists of two
tyrosine residues at position 1422 and 1440 of the
4 subunit (30). Recent studies have demonstrated that phosphorylation of this TAM is required for the incorporation of
6
4 into HD as well as their assembly (30). Combined
phenylalanine substitutions of the TAM impaired the capacity of BP180 to codistribute with
6
4, suggesting that
the TAM is involved in transducing signals that critically
regulate the subcellular distribution of BP180 in cos-7
cells. However, the observation that in some cells the expression of a mutated
4 TAM did not completely suppress this codistribution suggests that additional factors
also contribute. Since type III fibronectin homology modules have been implicated in protein-protein interactions
(3, 48), it is conceivable that the third and fourth FNIII
within the COOH-terminal half of the cytoplasmic domain
of
4 also coordinate the localization of recombinant
BP180 molecules with the
6
4 integrin by providing a
binding site for interaction. However, coimmunoprecipitation experiments failed to provide evidence for a direct association between mutant BP180 proteins and
6
4, but a
weak association between these proteins which is lost after
cell lysis cannot be ruled out.
4 nor the mutation of the
4 TAM prevent the subcellular redistribution of HD1 with
6
4, which occurs after
transfection of COS-7 cells with cDNAs for
6 and the
mutated
4 molecules. The colocalization of HD1 with
6
4 may thus be mediated by distinct sequences in the
NH2-terminal half of the cytoplasmic domain of
4. Recent in vitro binding and transfection studies using
4 recombinant proteins have provided evidence that HD1 associates with the cytoplasmic tail of
4 (37). Based on our
findings in COS-7 cells, it is tempting to speculate that
6
4 and HD1 form a complex that serves as a core for
the assembly of HD to which BP180 and BP230 aggregate in a later step, possibly regulated by TAM-dependent signals. Clearly, further experiments are needed to elucidate the
mechanisms controlling the association of the
6
4 integrin
with the other hemidesmosomal cytoskeletal molecules.
6 from
HT1080 cells transfected with this mutant, which contain
6
1 but not
6
4. This interaction appears to rely on the
extracellular segment of BP180 close to the transmembrane domain (18). It is possible that the reported association between
6 and BP180 only occurs in some cell types.
In fact, in cultured keratinocytes derived from a patient
with junctional EB associated with pyloric atresia, who
was completely deficient for
4,
6 was associated with
1 and was localized in focal contacts, whereas BP180 was
present in HD (36). This latter observation is consistent
with our results in transfected COS-7 cells, in which BP180
recombinants were not codistributed with
6, associated
with
4/
1, in focal contacts. Alternatively, coprecipitation of
6 with a recombinant form of BP180 may have
been due to incomplete solubilization of BP180 and/or aggregation of molecules after cell lysis.
6 and
4 integrin subunits
in cells that do not form HD, mutant forms of BP180 are
codistributed with
6
4 and HD1 in complexes along the
basal cell surface. In these complexes, the localization of
recombinant BP180 molecules with
6
4 appears to be
regulated by sequences within the COOH-terminal half of the
4 tail, including the third and fourth FNIII and part of the connecting segment containing the TAM. These observations provide new insights relevant for the understanding of the molecular interactions and regulatory elements
involved in the organization and assembly of HD.
.
We are indebted to Dr. K. B. Yancey, in whose laboratory at the Dermatology Branch, National Cancer Institute, National Institutes of Health (Bethesda, MD), part of the cloning of BP180 was performed during a postdoctoral fellowship (L. Borradori). We thank Drs. K. Owaribe, J. Kennel, J.R. Stanley, and J.C.R. Jones for kindly providing antibodies. We are grateful to Drs. E. Roos, J. Neefjes, P. Engelfriet, C. Gimond, and C. Baudoin for critical reading of the manuscript and to Dr. T. Sixma for helpful discussion about structural analysis predictions. Dr. L. Oomen is thanked for excellent assistance with the confocal laser microscope and N. Ong for photographic work.This work was supported by grants from the Netherlands Organization for Scientific Research (NWO 902-11-060), the Dutch Cancer Society (NKI 91-260), and from the Swiss National Foundation for Scientific Research (L. Borradori).
BP180, bullous pemphigoid antigen 180; BP230, bullous pemphigoid antigen 230; EB, epidermolysis bullosa; FNIII, type III fibronectin repeat; HD, hemidesmosomes; IF, intermediate filament; TAM, tyrosine activation motif.
6 subunit in transfected K562 cells. Activation dependent
adhesion and interaction with isoforms of laminin.
J. Biol. Chem.
268:
25865-25875
6 leads to epidermolysis bullosa
and neonatal death in mice.
Nature Genet.
13:
370-373
[Medline].
6
4 integrin: charting the
path between laminin binding and nuclear events.
J. Cell Sci.
109:
1165-1172
[Medline].
-4 cDNA: an integrin subunit that contains a unique 118 kD cytoplasmic domain.
EMBO (Eur.
Mol. Biol. Organ.) J.
9:
765-770
[Medline].
6 integrin.
J. Cell Biol.
130:
117-125
processing and accumulation of cytoplasmic RNA.
Nucleic Acids Res.
18:
937-947
4 subunit of the integrin family is displayed on a
restricted subset of endothelium in mice.
J. Cell Sci.
103:
145-150
6
4 integrins and assembly of hemidesmosomes in an in vitro model of
wound healing.
J. Cell Biol.
115:
1737-1750
-end of the gene and the 3
-untranslated region of the mRNA.
J. Biol.
Chem.
268:
8825-8834
6
4
integrin: distinct
4 subunit sites mediate recruitment of Shc/Grb2 and
association with the cytoskeleton of hemidesmosomes.
EMBO (Eur.
Mol. Biol. Organ.) J.
14:
4470-4481
[Medline].
6
4 are regulated by EGF.
J. Cell Biol.
134:
241-253
6
4 in peripheral
nerves: localization in Schwann and perineural cells and different variants of the
4 subunit.
J. Cell Sci.
107:
543-552
[Abstract].
6
4 integrin is a receptor for both laminin and kalinin.
Exp.Cell Res.
211:
360-367
[Medline].
4 subunit in junctional epidermolysis bullosa with pyloric atresia:
consequences for hemidesmosome formation and adhesion properties.
J.
Cell Sci.
109:
1695-1706
[Abstract].
6
4 forms a complex with the cytoskeletal protein HD1 and induces its redistribution in transfected COS-7
cells. Mol. Biol. Cell. In press.
4 subunit.
J. Cell Sci.
110:
169-178
[Abstract].
6/
4 complex is located in hemidesmosomes, suggesting a
major role in epidermal cell-basement membrane adhesion.
J. Cell Biol.
113:
907-917
4 subunit cytoplasmic domain mediates the interaction of
6
4 integrin with
the cytoskeleton of hemidesmosomes.
Mol. Biol. Cell.
4:
871-884
[Abstract].
6
4 integrin heterodimer is a component of hemidesmosomes.
Proc. Natl. Acad. Sci. USA.
87:
8970-8974
4
subunit and primary expression of the mRNA in epithelial cells.
EMBO
(Eur. Mol. Biol. Organ) J.
9:
757-763
[Medline].
4 null mice.
Nature Genet.
13:
366-369
[Medline].
4 mutations associated
with junctional epidermolysis bullosa with pyloric atresia.
Nature Genet.
10:
229-234
[Medline].
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|