Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article Abstract Full Text (PDF, 1169K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Alert me to new content in the JCB Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Borradori, L. Articles by Sonnenberg, A. Search for Related Content PubMed Articles by Borradori, L. Articles by Sonnenberg, A. Social Bookmarking                            What's this?

© The Rockefeller University Press, 0021-9525/1997//1333 $5.00
The Journal of Cell Biology, Volume 136, Number 6, , 1997 1333-1347

The Localization of Bullous Pemphigoid Antigen 180 (BP180) in Hemidesmosomes Is Mediated by Its Cytoplasmic Domain and Seems to be Regulated by the β4 Integrin Subunit

Division of Cell Biology, The Netherlands Cancer Institute, NL-1066 CX Amsterdam; and ^* Department of Dermatology, University of Pennsylvania, Philadelphia, Pennsylvania 19104

Bullous pemphigoid antigen 180 (BP180) is a component of hemidesmosomes, i.e., cell-substrate adhesion complexes. To determine the function of specific sequences of BP180 to its incorporation in hemidesmosomes, we have transfected 804G cells with cDNA-constructs encoding wild-type and deletion mutant forms of human BP180. The results show that the cytoplasmic domain of BP180 contains sufficient information for the recruitment of the protein into hemidesmosomes because removal of the extracellular and transmembrane domains does not abolish targeting. Expression of chimeric proteins, which consist of the membrane targeting sequence of K-Ras fused to the cytoplasmic domain of BP180 with increasing internal deletions or lacking the NH₂ terminus, indicates that the localization of BP180 in hemidesmosomes is mediated by a segment that spans 265 amino acids. This segment comprises two important regions located within the central part and at the NH₂ terminus of the cytoplasmic domain of BP180.

To investigate the effect of the 6β4 integrin on the subcellular distribution of BP180, we have transfected COS-7 cells, which lack 6β4 and BP180, with cDNAs for BP180 as well as for human 6A and β4. We provide evidence that a mutant form of BP180 lacking the collagenous extracellular domain as well as a chimeric protein, which contains the entire cytoplasmic domain of BP180, are colocalized with 6β4. In contrast, when cells were transfected with cDNAs for 6A and mutant forms of β4, either lacking the cytoplasmic COOH-terminal half or carrying phenylalanine substitutions in the tyrosine activation motif of the cytoplasmic domain, the recombinant BP180 molecules were mostly not colocalized with 6β4, but remained diffusely distributed at the cell surface. Moreover, in cells transfected with cDNAs for 6A and a β4/β1 chimera, in which the cytoplasmic domain of β4 was replaced by that of the β1 integrin subunit, BP180 was not colocalized with the 6β4/β1 chimera in focal adhesions, but remained again diffusely distributed. These results indicate that sequences within the cytoplasmic domain of β4 determine the subcellular distribution of BP180.

Abbreviations used in this paper: BP180, bullous pemphigoid antigen 180; BP230, bullous pemphigoid antigen 230; EB, epidermolysis bullosa; FNIII, type III fibronectin repeat; HD, hemidesmosomes; IF, intermediate filament; TAM, tyrosine activation motif.

HEMIDESMOSOMES (HD)¹ are multi-protein complexes, that mediate adhesion of epithelial cells to the underlying basement membrane, thereby linking elements of the cytoskeleton to the extracellular matrix in stratified epithelia (1, 12). Ultrastructurally, HD appear as tripartite membrane-associated electron dense plaques associated with the keratin intermediate filament (IF) network.

Several molecular components of HD have recently been identified. However, their exact interactions and their function in the formation of HD are not completely understood (1, 12). The cytoplasmic components of HD include the bullous pemphigoid antigen 230 (BP230, also termed bullous pemphigoid antigen 1) (49), IFAP300 (44), plectin/ HD1 (6, 14, 57), and P200 (25). All these proteins have been implicated in the attachment of the IF to the hemidesmosomal plaque (1, 12). In BP230 knockout mice, HD lack the inner plaque and they are not associated with the IF, suggesting that BP230 is required to anchor the IF to the HD (13). It is possible that plectin and HD1 are the same protein, because of their similar molecular weight and tissue distribution (1, 6, 14, 57). The observation that both plectin and HD1 are absent in a subset of patients with epidermolysis bullosa (EB), which represents a group of hereditary disorders characterized by fragility of the skin and blistering in response to trauma, supports this contention (7, 33). However, comparison of the cDNA sequence of HD1 and of plectin is required to confirm their identity. Two transmembrane proteins have been characterized in HD, the 6β4 integrin (26, 45, 50) and the bullous pemphigoid antigen 180 (BP180, also termed bullous pemphigoid antigen 2 or type XVII collagen) (10, 19, 27, 29). The 6β4 integrin appears to be crucial for cell adhesion and the formation of HD; since (1) antibodies directed against the 6β4 integrin inhibit the assembly of HD and disrupt existing ones, and induce dermo-epidermal separation in vitro (26); (2) the formation of HD can be prevented by inhibition of the phosphorylation of β4 (9, 30, 31); (3) in humans, mutations of β4 cause junctional EB associated with pyloric atresia, a severe form of EB (36, 56); (4) finally, null-mutant mice for either β4 or 6 show widespread dermo-epidermal separation and lack HD (8, 55). 6β4-mediated functions are probably regulated by sequences within the large cytoplasmic domain of β4 (9, 30) which comprises two pairs of type III fibronectin repeats (FNIII) separated from each other by a connecting segment (17, 51). The other transmembrane protein, BP180, also contributes to the maintenance of dermo-epidermal integrity. Defects in the gene for BP180 have been described in generalized atrophic benign EB, a human disease in which dermo-epidermal cleavage occurs in the lamina lucida and, ultrastructurally, HD appear to be incompletely formed (21, 32). Furthermore, patients with the blistering skin disorder called bullous pemphigoid have frequently circulating autoantibodies against epitopes on the BP180 ectodomain, that may cause dermo-epidermal cleavage (11, 27). BP180 is a type II transmembrane protein. Its extracellular COOH-terminal amino acid sequence contains 15 interrupted collagenous domains, which probably form collagen-like triple helices (10, 16). The cytoplasmic amino acid sequence is highly basic and contains several potential phosphorylation sites (10, 19). The cytoplasmic domain of BP180 might play an important role in the organization of the cytoskeleton and the assembly of HD. Transfection studies with mutant forms of BP180 have identified two segments within BP180, one located in the intracellular NH₂-terminal and another in the extracellular membrane-proximal region, that may be important for the integration of this protein into HD (18).

We here report experiments to investigate (1) the function of specific regions of human BP180 in the recruitment of this protein into HD; and (2) the ability of BP180 to interact with 6β4. We have transfected 804G cells with wild-type and deletion mutants of the cDNA for BP180 as well as cDNA-constructs encoding chimeric proteins composed of different portions of the cytoplasmic tail of BP180 linked to the membrane localization sequence of the K-Ras protein. In contrast to the above-mentioned study (18) our results indicate that sequences within the cytoplasmic domain of BP180 are sufficient for HD targeting. Furthermore, by cotransfecting COS-7 cells, which do not form HD, with cDNAs for the human 6A and β4A integrin subunits, we demonstrated that these proteins form distinct junctional structures, in which recombinant BP180 molecules are colocalized with the 6β4 integrin. Our results suggest that the codistribution of BP180 with 6β4 is regulated by sequences contained within the COOHterminal half of the β4 tail including the third and fourth FNIII and a part of the connecting segment. Specifically, signals mediated by the tyrosine activation motif (TAM) located within the connecting segment seem to be required to efficiently coordinate the codistribution of BP180 with 6β4.

	Materials and Methods

Top Abstract Materials and Methods Results Discussion References

 
Cell Culture and Antibody Preparation
The 804G cell line and the African monkey kidney cell line COS-7 were cultured in DMEM (Gibco BRL, Paisley, UK) supplemented with 10% (vol/vol) bovine FCS, 100 U/ml penicillin, and 100 U/ml streptomycin. The 804G cell line derived from a rat bladder tumor has been described previously (40, 41). The cells were grown at 37°C in a humidified, 5% CO₂ atmosphere.

The following antibodies were used. The mouse IgG1 mAb antiFLAG^TMM2 against the FLAG^TM peptide (DYKDDDDK) was purchased (IBI, Eastman Kodak Company, New Haven, CT). The rabbit antiserum J17 directed against the intracellular portion of BP180 was kindly provided by Dr. J.C.R. Jones (Cell and Molecular Biology, Northwestern University Medical School, Chicago, IL) (18, 19). The mouse IgG1 mAb 1A8c directed against the intracellular portion of BP180, and the mouse mAb 121 directed against HD1 were kindly donated by Dr. K. Owaribe (Department of Molecular Biology, Nagoya University, Nagoya, Japan) (14, 38). The mouse mAb 450-10D against the cytoplasmic domain of β4 was kindly supplied by Dr. S.J. Kennel (Oak Ridge National Laboratory, Oak Ridge, TN) (22). The rat mAb GoH3 against an extracellular epitope of human 6 (47), a rabbit antiserum against the cytoplasmic domain of β4 (34), a rabbit antiserum against the COOH-terminal portion of 6A (5) as well as a rabbit antiserum to rat IgG (46) have been described previously. The mAb against vinculin, clone VIN-11-5, was purchased (Sigma Chem. Co., St. Louis, MO). A rabbit antiserum against the COOH-terminal domain of BP230, was kindly provided by Dr. J.R. Stanley (Department of Dermatology, University of Pennsylvania, Philadelphia, PA) (52). Species specific FITC-conjugated goat anti–mouse IgG (Nordic Immunochemicals Laboratory, Tilburg, The Netherlands) and Texas red–conjugated donkey anti–rabbit IgG (Amersham International plc, Buckinghamshire, UK) were purchased.

cDNA-Constructs
The BP180 nucleotide and protein sequences are numbered according to Giudice et al. (10) and Hopkinson et al. (19), respectively. Full-length BP180 was obtained from human keratinocyte RNA by reverse transcriptase-PCR with primers based on published sequence of human BP180 (GenBank accession number M91669) (10) using the Riboclone cDNA Synthesis Kit (Promega, Madison, WI), the RNA-PCR Kit (Perkin Elmer, Roche Molecular Systems, Inc., Branchburg, NY), and the PCR Reagent System (GIBCO-BRL). The PCR reaction consisted of 35 cycles of 15 s at 95°C, 30 s at 55°C and 90 s at 72°C. PCR products corresponding to overlapping portions of BP180 were first cloned into pBluescript II SK+ (Stratagene, La Jolla, CA) and ligated together to obtain full-length BP180 using distinct restriction sites: PflmI, StuI, SacII, ClaI and EcoRI (at nucleotide positions 566, 1307, 1694, 2548 and 3619, respectively). A PCR site-directed mutagenesis system was subsequently used to prepare the various expression plasmids (Fig. 1 A). To generate clone A, B, C, and D, a 5' end primer was used that contained an EcoRI and a NotI site for cloning, sequences for optimal initiation of translation (bold) (24), sequences coding for the FLAG^TM peptide (underlined) (IBI, Eastman Kodak Company) for immunodetection, as well as nucleotides corresponding to sequences between 109 and 131 of human BP180 (italic) located immediately downstream from the predicted methionine start site of BP180 (nucleotide 106-109) (18) (5'-GCCGGAATTCGCGGCCGCCGCCATGGACTACAAGGACGACGATGACAAGGATGTAACCAAGAAA - AACAAACG 3'-). The 3' primer of clone A contained a NotI and a XbaI restriction site and the nucleotides corresponding to sequences between 4579 and 4599 of BP180 (italic) including the stop codon (5'-CGAT GCGGCCGCTCTAGATCACGGCTTGACAGCAATACT 3'-). The 3' end primer of clone B contained a NotI and a XbaI restriction site, a stop codon, and nucleotides corresponding to sequences 1641 and 1662 of BP 180 (italic) (5'-CGATGCGGCCGC TCTAGATTATATTCTATCCATGCTGTCCCCA 3'-) The 3' primer used to generate clone C contained a NotI and a XbaI site restriction site, a stop codon, and nucleotides corresponding to sequences between 1480 and 1503 of BP180(italic) (5'-CGATGCGGCCGCTCTAGATTACTTCCACCAGCTGCAGCAGGAGCC 3'-). The 3' primer used for clone D was designed in order to generate a chimeric protein composed of the cytoplasmic domain of BP180 fused to the membrane localization sequences of K-Ras (KMSKDGKKKKKKSKTKCVIM) (GenBank accession number M54968 and M38506). This primer contained a NotI and a XbaI restriction site, a stop codon, nucleotides encoding the membrane localization sequences of the K-Ras (bold) as well as the sequence between 1479-1503 of BP180 (italic) (5'-CGATGCGGCCGCTCTAGATTACATAATTACACACTTTGTCTTTGACTTCTTTT - TCTTCTTTTTACCATCTTTGCTCATCTTCTTCCACCAGCTGCAGC - AGGAGCC 3'-). The clones E, F, and G, which encoded chimeric proteins with increasing internal truncations of the cytoplasmic portion of BP180 starting from amino acid 244, 201 and 113, respectively, to 402, were generated by partial digestion of clone D with Ecl136 II (nucleotide sites 440, 701, and 830) and complete digestion with StuI (nucleotide 1307). The construct H lacking the sequences encoding amino acids 1 to 36 was generated using a 5' primer that contained a XbaI site, sequences for optimal initiation of translation (bold) and for the FLAG^TM tag (underlined), as well as nucleotides corresponding to sequences between 214 and 230 of BP180 (5' GCCGTCTAGACGCCATGGACTACAAGGACGACGATGACAAGAGCAATGGCTATGCTAAAACAGC 3'-). Combined alanine substitutions at positions Ser¹⁶⁹, Ser¹⁷⁵, and Ser¹⁸⁰ were introduced in clone B using the overlap extension method for site directed mutagenesis as previously described (5).

View larger version (22K): [in this window] [in a new window] [Download PPT slide]   Figure 1 (A) Schematic representation of wild-type and mutant forms of BP180 with summary of their localization in 804G cells. The upper three cDNA-constructs represent wild-type (clone A) and COOH-terminal truncations of BP180 (clones B and C), while the lower five (clones D, E, F, G, and H) represent chimeric cDNA-constructs encoding the membrane localization sequence of K-Ras fused with cDNAs encoding various cytoplasmic regions of BP180. IC, intracellular domain; EC, extracellular domain; T, FLAGTM tag; DSR, degenerate set of four 24-26 residue tandem repeats; TM, membrane-spanning domain; CX, membrane localization sequences of K-Ras. Truncations introduced by cloning procedures are indicated by the segment of amino acids that were deleted (). The protein sequence of BP180 is numbered according to Hopkinson et al. (18). (B) Schematic representation of 6A and β4A integrin subunits, of mutant form β4A1382, and of the β4/β1 chimera. The mutant form β4A1382 lacks the COOH-terminal half of the cytoplasmic domain, including the third and fourth type III fibronectin repeats (FNIII) and a portion of the connecting segment (CS). The β4/β1 chimera consists of the extracellular and the transmembrane domain of β4 fused to the entire cytoplasmic domain of β1. The position of the two tyrosine residues, Tyr1422 and Tyr1440, in the cytoplasmic domain of β4, which are part of the tyrosine activation motif, is indicated (arrows). The COOH-terminal truncation () is indicated by the stretch of amino acids that was removed. The protein sequence of β4A is numbered according to Suzuki and Naitoh (51).

For generation of the wild-type 6A cDNA, two overlapping cDNA clones, A33 and A84, isolated from a gt11 human keratinocyte library were used as previously described (5). The full-length 6A was inserted into the HindIII site of the pRc/CMV expression vector (Invitrogen, San Diego, CA) (Fig. 1 B) (5).

For generation of full-length β4A cDNA, a cDNA clone isolated from a gt11 human keratinocyte library was used that encodes β4A from position 1880 to the 3' terminus. The DNA was digested with SfiI and the resulting 2.2-kb fragment was exchanged for the 2.35-kb SfiI fragment of β4B (35, 37). The cDNA was then ligated into the XbaI site of the pRc/ CMV vector (Invitrogen). The cDNA-construct encoding a truncated β4 molecule, clone β4¹³⁸², was obtained by exchanging a PCR fragment with a wild-type fragment of β4 and will be described in detail elsewhere. After sequence analysis, the β4¹³⁸² cDNA construct was subcloned into pcDNA3 (Invitrogen) (Fig. 1 B). The cDNA plasmid encoding a β4 with combined phenylalanine substitutions of the tyrosine activation motif (30) was kindly provided by Dr. F.G. Giancotti (Department of Pathology, New York University School of Medicine, New York, NY). The construct was assembled into pcDNA3. Construction of the β4/β1 cDNA encoding a chimeric protein, in which the cytoplasmic domain of β4, with the exception of a 19–amino acid stretch immediately close to the transmembrane domain, was replaced with that of β1, has been recently described. The β4/β1 cDNA was inserted into the XbaI site of the pcDNA-1Hyg expression vector (43).

The following cDNA constructs were used as a control for transfection. A full-length murine BP180 cDNA (29), provided by Dr. J. Uitto (Department of Dermatology, Thomas Jefferson University, Philadelphia, PA), was subcloned into the EcoRI site of pcDNA3. A full-length CD31 cDNA, provided by Dr. B. Seed (Massachusetts General Hospital, Boston, MA), was subcloned into the HindIII/NotI sites of pRc/CMV. A fulllength CD8 cDNA, provided by Dr. A. Kelly, Guy's and St. Thomas's Medical and Dental School, London, UK), was subcloned into the HindIII and BamH1 site of pcDNA3.

Transfection Experiments
For transfection, cells were first grown to 50–80% confluency in six-well tissue culture plates (Falcon, Becton Dickinson, Lincoln Park, NJ). The rat bladder carcinoma cell line 804G was transfected using a cationic lipid, Lipofectin^® (1:1-N-[1-(2,3-dioleyloxy) propyl]-n,n,n-trimethylammonium chloride and dioleoyl phosphatidylethanolamine (GIBCO-BRL). The DNA:Lipofectin^® mixture was prepared using serum free medium (OPTIMEM^®, GIBCO-BRL). The final concentration of plasmid DNA and Lipofectin^® in serum free transfection medium was 5 µg/ml and 20 µg/ml, respectively. 1 ml of transfection medium was added to each monolayer that had been previously washed with serum free medium and cells were incubated with the transfection medium for 12–18 h at 37°C with 5% CO₂. The transfection medium was then replaced with normal growth medium and cells were incubated for additional 24–36 h and then assayed for gene expression. COS-7 cells were transfected using the DEAE-dextran method (4) and assayed for gene expression after 36 h.

Western Blot Analysis
Cells were lysed with 1% SDS in 25 mM Tris-HCl, pH 7.5, 4 mM EDTA, 100 mM NaCl, 1 mM PMSF, 10 µg/ml leupeptin and 10 µg/ml soybean trypsin inhibitor. Protein concentration in the cell lysates was determined with the BCA protein assay reagent (Pierce, Rockford, IL). Equal amounts of protein were loaded on a 8.5% or 13.5% SDS polyacrylamide gel, separated, and electrophoretically transferred to nitrocellulose sheets for 1 h at 240 mA in 25 mM Tris-HCl, pH 8.3, 192 mM glycine, 20% (vol/vol) methanol and 0.0375% SDS as previously described (53). The filters were incubated in TBST (10 mM Tris-HCl, pH 7.6, and 150 mM Nacl, 0.1% Tween20) containing 2% (wt/vol) BSA and 2% (wt/vol) baby milk powder for 12 h at 4°C. Subsequently the filters were probed with the primary antibody for 90 min, after which they were washed four times for 5 min in TBST. The filters were subsequently incubated with horseradish peroxidase– linked sheep anti–mouse IgG or horseradish peroxidase–linked goat anti– rabbit IgG (Amersham International plc), diluted to 1:5,000 and 1:2,000, respectively, for 1 h and then washed with TBST. Proteins were visualized using enhanced chemiluminescence (Amersham International plc).

Immunofluorescence Microscopy
Cells grown on glass coverslips in six-well tissue culture plates were fixed with 1% formaldehyde for 10 min and permeabilized with 0.5% Triton X-100 for 5 min. After rinsing with PBS and blocking with 2% (wt/vol) BSA in PBS for 30 min, the cells were incubated with primary antibody for 30 min at 37°C, then washed three times with PBS. The cells were stained with fluorescein- or Texas red–labeled anti–mouse IgG, anti–rat IgG or rabbit IgG for 30 min at 37°C. The coverslips were subsequently washed, mounted with Vectashield (Vector, Burlingame, CA), and viewed under an MRC-600 confocal scanning laser microscope (Bio-Rad Laboratories, Richmond, CA).

Cell Labeling and Immunoprecipitation
Transfected COS-7 cells were washed twice with PBS and incubated with DMEM without methionine and cysteine (ICN Biomedicals Inc., Costa Mesa, CA) for 1 h at 37°C. Cells were then labeled with 100 µCi/ml [³⁵S]methionine/cysteine (Amersham International plc) for 4 h, then washed and lysed with 1% NP-40 in 25 mM Tris-HCl, pH 7.5, 4 mM EDTA, 100 mM NaCl, 1 mM PMSF, 10 µg/ml leupeptin, and 10 µg/ml soybean trypsin inhibitor. Cells were also lysed with 1% Triton X-100, 2 mM CaCl₂, 1 mM PMSF, 10 µg/ml leupeptin, and 10 µg/ml soybean trypsin inhibitor or 10 mM CHAPS in HBSS. The lysates were clarified by centrifugation at 10,000 g and precleared with protein A–Sepharose CL-4B (Pharmacia LKB Biotechnology Inc., Uppsala, Sweden). Samples of precleared lysates were immunoprecipitated with antibodies previously bound to protein A–Sepharose or to protein A–Sepharose to which rabbit anti– mouse IgG was attached. The immunoprecipitates were subsequently analyzed by SDS-PAGE.

	Results

Top Abstract Materials and Methods Results Discussion References

 
Expression of Recombinant Forms of Human BP180
The role of specific sequences of BP180 in the localization of the protein in HD was investigated by introducing a series of cDNA-constructs into the epithelial cell line 804G. The 804G cells, which have previously been used to study the assembly and formation of HD, contain the structural components of HD, i.e., proteins that may interact with BP180, including the 6β4 integrin, BP230, and HD1 (40, 41, 48). As illustrated in Fig. 1 A, we have generated cDNAconstructs encoding full-length (clone A) or two truncated forms of BP180, that consist of either the entire cytoplasmic domain, the transmembrane region and a segment of 30 amino acids located adjacent to the transmembrane region (clone B) or of the cytoplasmic domain alone (clone C). Clone B was used because a previous study had indicated that the protein encoded by this construct contains the minimal sequence of the ectodomain of BP180 essential for incorporation into HD (18). To further investigate the contribution of distinct cytoplasmic domains in the recruitment of BP180 to HD, we generated cDNA clones encoding chimeric proteins, in which the membrane localization sequence of K-Ras (28, 39) had been linked to various parts of the cytoplasmic region of BP180 (clones D to H). To identify proteins encoded by the transfected plasmids a 24-bp sequence encoding the FLAG^TM peptide was added at the 5' end of the cDNAs. In addition to DNA sequencing of the various constructs, the proteins encoded by the clones were analyzed by in vitro transcription/translation followed by SDS-PAGE and found to be of the predicted mol wt (not shown). Finally, to assess whether the transiently transfected 804G cells expressed the appropriately sized recombinant BP180 molecules, we performed immunoblot analysis of cell extracts (Fig. 2) using mAbs directed against the FLAG^TM peptide as well as against the cytoplasmic domain of BP180. In transfected cells, the apparent mol wt of the recombinant proteins were close to the sizes predicted on the basis of the corresponding cDNA sequence, i.e., 151.6 kD, 55.7 kD, 49.4 kD, 51.7 kD, 35.3 kD, 30.9 kD, 21.4 kD, and 47.9 for clones A, B, C, D, E, F, G, and H, respectively. The size of the protein encoded by clone A, corresponding to full-length human BP180, was slightly smaller than that of endogenous rat BP180, possibly due to insufficient posttranslational processing of this protein and/or a species difference. In extracts from COS-7 cells transfected with cDNAs for either human or mouse full-length BP180, the mol wt of the expressed proteins were similar (not shown).

View larger version (18K): [in this window] [in a new window] [Download PPT slide]   Figure 2 Identification of mutant forms of BP180 expressed in 804G cells by immunoblotting. Extracts of cells transfected with clones A (lanes 1 and 3), B (lane 7), C (lane 8), D (lanes 4 and 9), H (lane 10), E (lane 11), F (lane 12) or G (lanes 13 and 15) and of mock-transfected controls (lanes 2, 5, 14, and 16–18) were processed using the BP180 antiserum J17 (lanes 1 and 2) and the mAb 1A8c (lanes 3–5, and 7 to 14), that are both directed against the intracellular portion of human BP180, as well as the mAb antiFLAGTMM2 against the FLAGTM tag (lanes 15 and 16). Samples were separated by 8.5% (lanes 1–6) and 13% (lanes 7–18) SDS-PAGE under reducing conditions. Note that the rabbit antiserum J17 clearly recognizes a protein corresponding to endogenous wild-type BP180 (lanes 1 and 2) with a slightly slower electrophoretic mobility than full-length human BP180 (lane 1). The mutant protein encoded by clone G, which carried the largest deletion of the cytoplasmic domain, is not recognized by mAb 1A8c (lane 13), but is recognized by the mAb anti-FLAGTMM2 (lane 15) (arrow head). Since mAb anti-FLAG generated high unspecific background (lanes 15 and 16), only short time exposure is depicted. Mock-transfected cells were also processed using an antiserum against the cytoplasmic domain of β4 (lane 6), an anti-6A antiserum recognizing the light chain of the endogenous 6 (lane 17), and a normal rabbit serum (lane 18). Molecular weight markers are indicated in kD.

View larger version (130K): [in this window] [in a new window] [Download PPT slide]   Figure 3 Immunolocalization of mutant forms of BP180 in hemidesmosomes of transfected 804G cells by confocal laser microscopy. Cells were grown on glass coverslips and transfected with clones A (A and B), B (C and D) or C (E and F). After 36 h, cells were fixed with 1% formaldehyde, permeabilized with 0.5% Triton X-100, and subjected to double immunofluorescence using the mAb anti-FLAGTMM2 (A, C, and E) and an anti-6A antiserum (B, D, and F). FITC-conjugated goat anti–mouse IgG (left) and Texas red–conjugated donkey anti–rabbit IgG (right). The recombinant forms of BP180 were concentrated in a Swiss cheese–like pattern characteristic for hemidesmosome-like structures, where they were colocalized with 6 along the basal cell surface as demonstrated by z-sections of individual cells (insets). Note that the mutant form expressed by clone C showed, in addition to its localization in hemidesmosomes, a diffuse cytoplasmic distribution (E). Bar, 10 µm.

View larger version (76K): [in this window] [in a new window] [Download PPT slide]   Figure 4 Immunolocalization of chimeric forms of BP180 composed of the membrane targeting sequence of K-Ras combined with various cytoplasmic portions of BP180 in 804G cells. Cells transfected with clones D (A and B), E (C and D), F (E and F), G (G and H), or H (I and J) were fixed, permeabilized, and subjected to double immunofluorescence using the mAb antiFLAGTMM2 (A, C, E, G, and I) and an anti-6A antiserum (B, D, F, H, and J). FITC-conjugated goat anti–mouse IgG (left) and Texas red–conjugated donkey anti–rabbit IgG (right). In cells transfected with clones D, E, or F, the chimeric proteins are clearly codistributed with 6 and are concentrated along the basal cell surface (z-sections in the insets). In contrast, the chimeric proteins expressed by clone G (G) or H (I) are diffusely distributed at the cell surface and are not colocalized with 6. Bar, 10 µm.

View larger version (127K): [in this window] [in a new window] [Download PPT slide]   Figure 5 Immunolocalization of clone B encoded protein, in which combined alanine substitutions of three serine residues (Ser169, Ser175, and Ser180) were introduced. 804G cells were grown on glass coverslips, transfected, fixed with 1% formaldehyde, permeabilized with 0.5% Triton X-100, and subjected to double immunofluorescence using the mAb anti-FLAGTMM2 (A) and an anti-6A antiserum (B). FITC-conjugated goat anti–mouse IgG (left) and Texas red–conjugated donkey anti– rabbit IgG (right). The recombinant form of BP180 was distributed in a Swiss cheese–like pattern characteristic for hemidesmosome-like structures, where it was colocalized with 6. Bar, 10 µm.

The Cytoplasmic Tail of BP180 Is Colocalized with the 6β4 Integrin and HD1 in COS-7 Cells

View larger version (52K): [in this window] [in a new window] [Download PPT slide]   Figure 9 (A) Immunoprecipitation analysis of transfected COS-7 cells. Lysates of 35S-radiolabeled cells cotransfected with cDNAs for 6A and β4A as well as clone D (lanes 1–3), clone B (lanes 4–6), or clone A (lanes 7–9), with cDNAs for 6A and β4A alone (lanes 10–12), and of mock-transfected cells (lanes 13–15), were immunoprecipitated with the mAb anti-FLAGTMM2 (lanes 1, 4, 7, 10, and 13), an anti-6 antiserum (lanes 2, 5, 8, 11, and 14), and an anti-β4 antiserum (lanes 3, 6, 9, 12, and 15). Note that immunoprecipitation of cells transfected with cDNAs for 6A and β4A with either an anti-6 and an anti-β4A antiserum yielded a heterodimer complex of 6A and β4A, while no coprecipitation of BP180 is observed. No coprecipitation of the 6A and β4A is detected by using the mAb anti-FLAGTMM2, even after longer exposure of the gel. (B) Lysates of 35S-radiolabeled cells cotransfected with cDNA for 6A as well as with clone D (lanes 1–3), clone B (lanes 4–6), or clone A (lanes 7– 9), and of cells cotransfected with cDNA for β4A and clone D (lanes 10–12), clone B (lanes 13–15), or clone A (lanes 16–18). Immunoprecipitation was performed with the mAb anti-FLAGTMM2 (lanes 1, 4, 7, 10, 13, and 16), an anti-6 antiserum (lanes 2, 5, 8, 11, 14, and 17), and an anti-β4 antiserum (lanes 3, 6, 9, 12, 15, and 18). No coprecipitation of the 6A and β4A is found by using the mAb antiFLAGTMM2. In addition, no coprecipitation of mutant BP180 proteins is detected with either an anti-6 or an anti-β4A antiserum. Note that one radiolabeled polypeptide (arrow heads) is coprecipitated by the mAb anti-FLAGTMM2 from extracts of cells transfected with clone B. The identity of this protein, which was not precipitated when cells were lysed with 1% Triton X-100 (not shown), is unclear. Samples were analyzed by 8% SDS-PAGE under reducing conditions. Molecular mass markers are indicated in kD.

View larger version (129K): [in this window] [in a new window] [Download PPT slide]   Figure 6 Confocal double immunofluorescence microscopy of transfected COS-7 cells showing the subcellular distribution of the chimeric protein composed of the membrane targeting sequence of K-Ras combined with the cytoplasmic domain of BP180 (clone D). Cells grown on glass coverslips were transfected with clone D. After 36 h, cells were fixed, permeabilized, and subjected to double labeling using the BP180 antiserum J17 (A and C) and the mAb VIN 11-5 against vinculin (B), or the mAb 121 against HD1 (D). Texas red–conjugated donkey anti–rabbit IgG (left) and FITC-conjugated goat anti– mouse IgG (right). The chimeric BP180 protein is distributed diffusely at the cell surface and is not colocalized with endogenous vinculin or HD1. Bar, 10 µm.

Transfection of COS-7 cells with cDNAs for 6A and β4A resulted in the expression of the 6β4 integrin at sites of cell-substrate contact and, concomitantly, in the redistribution of HD1 from the cytoskeleton into junctional complexes containing 6β4 (37) (Fig. 7, B and D, and Fig. 8 B). When COS-7 cells were transfected with cDNAs for 6A and a β4/β1 chimera encoding the extracellular domain of β4 fused to the cytoplasmic domain of β1, 6 was associated with β4/β1 as assessed by immunoprecipitation (not shown) and was found together with vinculin in focal contacts (see Fig. 8 F) (43). In these cells, HD1 remained diffusely distributed in a pattern similar to that observed in untransfected COS-7 cells.

View larger version (107K): [in this window] [in a new window] [Download PPT slide]   Figure 7 Double immunofluorescence microscopy of transfected COS-7 showing that the chimeric protein composed of the membrane targeting sequence of K-Ras combined with the entire cytoplasmic domain of BP180 (clone D) is codistributed with the 6β4 integrin. Cells grown on glass coverslips were transfected with clone D (A–F) together with cDNAs for human 6A and β4A (A–D), or with cDNAs for human 6A and β4A1382 (E and F). After 36 h cells were fixed, permeabilized, and subjected to double labeling using the mAb antiFLAGTMM2 (A and E) and the rat mAb GoH3 (B and F) as well as the BP180 antiserum J17 (C) and the mAb 121 against HD1(D). FITCconjugated goat anti–mouse IgG (A, D, and E), Texas red–conjugated donkey anti– rabbit IgG (C). The rat mAb GoH3 was stained using a rabbit anti–rat IgG (absorbed against mouse IgG) and Texas red–conjugated donkey anti–rabbit IgG (B and F). In cells transfected with 6A and β4A cDNAs, the BP180 chimeric protein is found concentrated along the basal cell surface, where it is codistributed with 6 and HD1. In contrast, in cells cotransfected with cDNAs for 6A and β4A1382, the mutant form of BP180 displayed uniquely an apicolateral cell surface distribution and is not colocalized with 6. Z-sections of transfected cells are shown in the insets. The optical plane is the same as in Fig. 6. Bar, 10 µm.

View larger version (124K): [in this window] [in a new window] [Download PPT slide]   Figure 8 Double immunofluorescence microscopy of transfected COS-7 showing that the subcellular distribution of clone B encoded protein is affected by the cytoplasmic domain of the β4 integrin subunit. Cells were transfected with clone B (A–F) together with cDNAs for human 6A and β4A (A and B), or with cDNAs for human 6A and a mutated β4 carrying phenylalanine substitutions of the TAM (C and D), or, finally, with cDNAs for 6A and a β4/β1 chimera, in which the cytoplasmic domain of β4 was replaced by that of β1 (E and F). After 36 h cells were fixed, permeabilized, and subjected to double labeling using the mAb anti-FLAGTMM2 (A, C, and E) and the rat mAb GoH3 (B, D, and F). FITC-conjugated goat anti–mouse IgG (A, C, and E). The rat mAb GoH3 was stained using a rabbit anti–rat IgG (absorbed against mouse IgG) and Texas red–conjugated donkey anti–rabbit IgG (B, D, and F). In cells transfected with 6A and β4A cDNAs, the clone B encoded protein was localized along the basal cell surface codistributing with 6β4. In contrast, in cells cotransfected with cDNAs for 6A and a β4 carrying a mutated TAM or a β4/β1 chimera, the BP180 recombinant molecule displayed predominantly an apicolateral cell surface distribution and is not colocalized with 6β4 or 6β4/β1, respectively. Z-sections of transfected cells are shown in the insets. The optical plane is the same as in Fig. 6. Bar, 10 µm.

Finally, COS-7 cells were also cotransfected with clone G or H with more extensive deletions: in this case, the staining of the plasma membrane was too intense, due to the high level of expression, to assess the colocalization with 6β4.

Mutant Forms of BP180 Do Not Coprecipitate with 6β4 in COS-7 Cells
A recent study has provided evidence for an interaction between BP180 and 6 (18). To determine the ability of mutant forms of BP180 to associate directly with 6 and β4, we performed immunoprecipitation experiments using extracts from radiolabeled COS-7 cells that were transiently transfected with either of the clones A, B, or D together with cDNAs encoding 6A and β4. The SDS-PAGE analysis of these immunoprecipitates is shown in Fig. 9 A. In all cases, the mol wt of the detected proteins corresponded with the sizes predicted on the basis of the cDNA sequence. Neither 6 nor β4 were precipitated in association with BP180 recombinant polypeptides encoded by clones A, B, or D by the mAb anti-FLAG^TMM2. Furthermore, the recombinant forms of BP180 encoded by these clones could not be coimmunoprecipitated with either 6 or β4 by an anti-6 or anti-β4 antiserum, respectively. Identical results were obtained when COS-7 cells were transfected with clones A, B, or D together with cDNA for either 6A or β4 (Fig. 9 B). When the samples immunoprecipitated with the anti-6 or anti-β4 antiserum were subjected to immunoblotting with the mAb anti-FLAG^TMM2, this mAb did not show any reactivity with the various precipitates. Moreover, no coprecipitation of recombinant forms of BP180 with either 6A or β4A was observed when cells were lysed with different detergents, such as Triton X-100 or CHAPS (not shown). In contrast, immunoprecipitation with either a rabbit anti-6 or a rabbit anti-β4 antiserum of lysates from cells transfected with cDNAs for the 6A and β4 yielded, as expected, a heterodimer complex consisting of 6 and β4. Together, these data do not provide evidence for a physical association between mutant forms of BP180 and the 6β4 integrin in transfected COS-7 cells.

The Subcellular Distribution of BP180 Is Affected by the Cytoplasmic Domain of β4
As an alternative approach to identify domains involved in the association of BP180 and 6β4, we generated a cDNA construct encoding a β4 molecule, β4¹³⁸², with a truncated cytoplasmic domain, which contains the first pair of FNIII and a segment of 64 amino acids at the NH₂ terminus of the connecting segment, but which lacks the tyrosine activation motif (TAM) (30) of the connecting segment as well as the third and fourth FNIII. In COS-7 cells transfected with cDNAs encoding 6A and this truncated β4, the β4 mutant protein was distributed together with 6 and HD1 along the basal cell surface in a pattern indistinguishable from that observed in cells transfected with wild-type 6A and β4A, as assessed by double immunofluorescence staining (Fig. 7 F). Strikingly, in COS-7 cells expressing 6 and β4¹³⁸² the mutant forms of BP180 encoded by clone B (not shown) and D were not colocalized with 6β4 and HD1 in these junctional complexes, but in most cells remained diffusely distributed at the apicolateral cell surface (Fig. 7, E and F). Since recent studies (30, 31) have demonstrated that phosphorylation of the TAM of β4 is required for the incorporation of 6β4 into HD and for their assembly, we then investigated if the TAM of β4 plays a role in the subcellular distribution of BP180 by using a β4 subunit carrying a mutated TAM. In COS-7 cells transfected with cDNAs for 6A and a β4 subunit with combined phenylalanine substitutions at the TAM, the colocalization potential of the clone B encoded protein with the mutated β4 was impaired as compared to that of wildtype β4. In most cells expressing 6 and the mutated β4, clone B encoded protein was diffusely distributed over the plasma membrane (Fig. 8, C and D), and in only a few transfected cells it was concentrated at the basal cell surface together with 6β4 (not shown). Notably, in cells expressing 6 and β4 with a mutated TAM, HD1 was found to be codistributed with 6β4 in a pattern indistinguishable from that observed with 6 associated with wild-type β4 (not shown). Taken together, these results indicate, first, that sequences contained in the COOH-terminal half of the cytoplasmic tail of β4 are involved in determining the subcellular distribution of BP180; second, that mutations of the β4 TAM interfere with the efficient colocalization of BP180 with 6β4; finally, that colocalization of HD1 with 6β4 is, in contrast to that of BP180, mediated by sequences within the NH₂-terminal half of the cytoplasmic domain of β4.

	Discussion

Top Abstract Materials and Methods Results Discussion References

 
We have studied the contribution of various segments of BP180 to its incorporation into HD by transfecting 804G cells with cDNA-constructs encoding wild-type, deletion mutant forms of BP180, and chimeric proteins, in which the membrane targeting sequence of K-Ras had been fused to segments of the cytoplasmic domain of BP180. The results indicate that the cytoplasmic domain of BP180 contains sequences sufficient for the incorporation of mutant forms of BP180 into HD-like structures in 804G cells. The localization of BP180 in HD appears to be mediated by a region that spans 265 amino acids (clone F) comprising two important domains, that are located at the NH₂ terminus and within the central portion of the BP180 cytoplasmic domain.

Based on transient transfections of 804G cells, it was recently reported that a 36–amino acid stretch located at the NH₂ terminus determines the localization of BP180 at the basal side of the cell, whereas the extracellular segment close to the membrane-spanning domain is required for its recruitment into HD (18). Our results confirm the functional importance of the NH₂-terminal domain of BP180. However, our observation that a chimeric protein composed of the membrane targeting signal of K-Ras and a cytoplasmic tail of BP180 lacking this NH₂-terminal region (clone H) is not only localized at the apical, but also often at the basolateral cell surface, indicates that this segment is not uniquely involved in sorting the protein to the basal cell surface, but rather is required for targeting BP180 to HD. The membrane targeting signal of K-Ras may be responsible for the diffuse localization of the protein (28, 39), but this possibility seems less likely, because recombinant molecules encoded by clones B or D, that lack or contain the K-Ras membrane localization sequence, respectively, were frequently similarly distributed. Alternatively, it is conceivable that the localization of the mutant protein is dynamic and dependent on its relative expression level in transfectants.

The results of the subcellular localization of chimeric proteins with deletions of increasing size within the BP180 cytoplasmic domain indicate the existence of an additional, as yet unrecognized, functionally important region. Whereas a truncated BP180 molecule consisting of a 265– amino acid stretch was localized in HD (clone F), a recombinant protein with an additional internal deletion of 88 amino acids towards the NH₂ terminus (clone G) was not.

What are the mechanisms by which the truncations of the cytoplasmic domain of BP180 interfere with its incorporation in HD? First, the deleted regions may contain the sequences responsible for the interaction of BP180 with elements of the hemidesmosomal cytoskeleton. Second, conformational changes in protein architecture may be responsible for the failure of clone G and clone F encoded proteins to be incorporated into HD. PHD secondary structural analysis (42) predicts that the protein encoded by clone F, containing the minimal sequences for recruitment into HD, has several β-sheet regions as well as one –helical domain, which are absent in the recombinant protein encoded by clone G. Moreover, the functionally important domain at the NH₂ terminus of BP180 contains a β-sheet. The above two regions at the NH₂ terminus and within the central portion of the cytoplasmic domain may thus be involved in the proper folding of BP180, which may be essential for its assembly in HD. Finally, the truncations may interfere with the transmission of an intracellular signal required to render BP180 competent to interact with other components of HD. Phosphorylation pathways appear to critically regulate the assembly of HD (9). Inhibition of the phosphorylation of the β4 integrin subunit was found to prevent localization of the 6β4 integrin in HD (9). In addition, a recent study suggests that a protein kinase C is involved in the phosphorylation of BP180 at serine residues, which affects its localization at the basal cell membrane of squamous carcinoma cells (23). Although combined alanine substitutions at three serine residues located in the central portion of the cytoplasmic domain of BP180 did not affect its localization in HD, it is conceivable that the truncations in clone G and H encoded proteins G might interfere with signaling pathways that control the association of BP180 with HD.

Our results demonstrate that removal of the extracellular and transmembrane regions of BP180 or their substitution by the membrane localization sequence of K-Ras does not abolish the localization of BP180 in HD of 804G cells. This was unexpected, because in a previous study, deletion of a segment of 27 amino acids located immediately after the transmembrane domain prevented the incorporation of the BP180 protein into HD, suggesting that this region is required for targeting (18). However, in this latter study (18) it has not been ascertained whether the truncated protein was correctly inserted in the plasma membrane. BP180 is a type II transmembrane protein, whose insertion in the membrane depends on both the "signal-anchor" sequence of the transmembrane domain and the number and type of flanking charged amino acids (15). Therefore, deletion of the region proximal to the transmembrane domain may have a deleterious effect on the translocation and insertion of the truncated protein into the plasma membrane, preventing its interaction with the hemidesmosomal cytoskeleton. Since our transfection studies only assess the ability of mutant proteins to be incorporated, together with endogenous components, into HD (48), our findings do not exclude the possibility that the ectodomain of BP180 is also involved in the localization of the protein in HD as well as in their nucleation and formation by binding to an extracellular ligand(s).

To analyze the potential of BP180 to interact with 6β4, we have performed transfection experiments using COS-7 cells. In COS-7 cells, transfected with cDNAs for the 6A and β4 integrin subunits, expression of the 6β4 integrin results in the generation of distinct structures at sites of cell-substrate contact (37). These junctional complexes, containing 6β4 and HD1, may correspond to the recently described type II HD, which are found in some cell types and which lack the two hemidesmosomal components BP230 and BP180 present in HD (54). When COS-7 cells were cotransfected with clones B or D, the recombinant BP180 molecules were present in the same complexes as 6β4. These findings confirm the previously reported colocalization of a mutant form of BP180 (identical to that encoded by clone B) with 6β4 in FG cells which, like COS-7 cells, lack endogenous BP180 and BP230 (18). However, the observation that codistribution also occurred with the mutant form of BP180 lacking the entire extracellular region (clone D), suggests that the cytoplasmic domain of BP180 contains sufficient elements for its recruitment into complexes containing 6β4 and HD1.

Our mutagenesis experiments indicate that the COOHterminal half of the β4 subunit contains sequences required for the colocalization of mutant forms of BP180 with 6β4 in transfected COS-7 cells. This region of β4 comprises the third and fourth FNIII as well as part of the connecting segment including the TAM, that consists of two tyrosine residues at position 1422 and 1440 of the β4 subunit (30). Recent studies have demonstrated that phosphorylation of this TAM is required for the incorporation of 6β4 into HD as well as their assembly (30). Combined phenylalanine substitutions of the TAM impaired the capacity of BP180 to codistribute with 6β4, suggesting that the TAM is involved in transducing signals that critically regulate the subcellular distribution of BP180 in cos-7 cells. However, the observation that in some cells the expression of a mutated β4 TAM did not completely suppress this codistribution suggests that additional factors also contribute. Since type III fibronectin homology modules have been implicated in protein–protein interactions (3, 48), it is conceivable that the third and fourth FNIII within the COOH-terminal half of the cytoplasmic domain of β4 also coordinate the localization of recombinant BP180 molecules with the 6β4 integrin by providing a binding site for interaction. However, coimmunoprecipitation experiments failed to provide evidence for a direct association between mutant BP180 proteins and 6β4, but a weak association between these proteins which is lost after cell lysis cannot be ruled out.

The results of our immunofluorescence analysis indicate that neither the elimination of the COOH-terminal half of β4 nor the mutation of the β4 TAM prevent the subcellular redistribution of HD1 with 6β4, which occurs after transfection of COS-7 cells with cDNAs for 6 and the mutated β4 molecules. The colocalization of HD1 with 6β4 may thus be mediated by distinct sequences in the NH₂-terminal half of the cytoplasmic domain of β4. Recent in vitro binding and transfection studies using β4 recombinant proteins have provided evidence that HD1 associates with the cytoplasmic tail of β4 (37). Based on our findings in COS-7 cells, it is tempting to speculate that 6β4 and HD1 form a complex that serves as a core for the assembly of HD to which BP180 and BP230 aggregate in a later step, possibly regulated by TAM-dependent signals. Clearly, further experiments are needed to elucidate the mechanisms controlling the association of the 6β4 integrin with the other hemidesmosomal cytoskeletal molecules.

It is difficult to reconcile some of our findings with a previous report stating that a mutant form of BP180, identical to that encoded by clone B, coprecipitated with 6 from HT1080 cells transfected with this mutant, which contain 6β1 but not 6β4. This interaction appears to rely on the extracellular segment of BP180 close to the transmembrane domain (18). It is possible that the reported association between 6 and BP180 only occurs in some cell types. In fact, in cultured keratinocytes derived from a patient with junctional EB associated with pyloric atresia, who was completely deficient for β4, 6 was associated with β1 and was localized in focal contacts, whereas BP180 was present in HD (36). This latter observation is consistent with our results in transfected COS-7 cells, in which BP180 recombinants were not codistributed with 6, associated with β4/β1, in focal contacts. Alternatively, coprecipitation of 6 with a recombinant form of BP180 may have been due to incomplete solubilization of BP180 and/or aggregation of molecules after cell lysis.

In conclusion, the studies reported here show that the cytoplasmic tail of BP180 contains sequences critical and sufficient for mediating the localization of BP180 in HD. Upon expression of both the 6 and β4 integrin subunits in cells that do not form HD, mutant forms of BP180 are codistributed with 6β4 and HD1 in complexes along the basal cell surface. In these complexes, the localization of recombinant BP180 molecules with 6β4 appears to be regulated by sequences within the COOH-terminal half of the β4 tail, including the third and fourth FNIII and part of the connecting segment containing the TAM. These observations provide new insights relevant for the understanding of the molecular interactions and regulatory elements involved in the organization and assembly of HD.

	Acknowledgments

 
This work was supported by grants from the Netherlands Organization for Scientific Research (NWO 902-11-060), the Dutch Cancer Society (NKI 91-260), and from the Swiss National Foundation for Scientific Research (L. Borradori).

We are indebted to Dr. K. B. Yancey, in whose laboratory at the Dermatology Branch, National Cancer Institute, National Institutes of Health (Bethesda, MD), part of the cloning of BP180 was performed during a postdoctoral fellowship (L. Borradori). We thank Drs. K. Owaribe, J. Kennel, J.R. Stanley, and J.C.R. Jones for kindly providing antibodies. We are grateful to Drs. E. Roos, J. Neefjes, P. Engelfriet, C. Gimond, and C. Baudoin for critical reading of the manuscript and to Dr. T. Sixma for helpful discussion about structural analysis predictions. Dr. L. Oomen is thanked for excellent assistance with the confocal laser microscope and N. Ong for photographic work.

Please address all correspondence to Arnoud Sonnenberg, Division of Cell Biology, The Netherlands Cancer Institute, Plesmanlaan 121, NL1066 CX Amsterdam, The Netherlands.Tel: 31 20 5121942. Fax: 31 20 5121944.

	References

Top Abstract Materials and Methods Results Discussion References

 

1. Borradori L & Sonnenberg A. Hemidesmosomes: roles in adhesion, signaling and human diseases, Curr Opin Cell Biol, 1996, 8, 647–656.[Medline]
2. Buchman AR & Berg P. Comparison of intron-dependent and intron-independent gene expression, Mol Cell Biol, 1988, 8, 4395–4405.[Abstract/Free Full Text]
3. Campbell ID & Spitzfaden C. Building proteins with fibronectin type III modules, Structure, 1994, 2, 333–337.[Medline]
4. Cullen BR. Use of eukaryotic expression technology in the functional analysis of cloned genes, Methods Enzymol, 1987, 152, 684–703.[Medline]
5. Delwel GO, Hogervorst F, Kuikman I, Paulsson M, Timpl R & Sonnenberg A. Expression and function of the cytoplasmic variants of the integrin 6 subunit in transfected K562 cells. Activation dependent adhesion and interaction with isoforms of laminin, J Biol Chem, 1993, 268, 25865–25875.[Abstract/Free Full Text]
6. Foisner R & Wiche G. Intermediate filament-associated proteins, Curr Opin Cell Biol, 1991, 3, 75–81.[Medline]
7. Gache Y, Chavanas S, Lacour JP, Wiche G, Owaribe K, Meneguzzi G & Ortonne JP. Defective expression of plectin\\HD1 in epidermolysis bullosa simplex with muscular dystrophy, J Clin Invest, 1996, 97, 2289–2298.[Medline]
8. Georges-Labouesse E, Messaddeq N, Yehia G, Cadalbert L, Dierich A & Le Meur M. Absence of the 6 leads to epidermolysis bullosa and neonatal death in mice, Nature Genet, 1996, 13, 370–373.[Medline]
9. Giancotti FG. Signal transduction by the 6β4 integrin: charting the path between laminin binding and nuclear events, J Cell Sci, 1996, 109, 1165–1172.[Medline]
10. Giudice GJ, Emery DJ & Diaz LA. Cloning and primary structural analysis of the bullous pemphigoid autoantigen BP180, J Invest Dermatol, 1992, 99, 243–250.[Medline]
11. Giudice GJ, Emery DJ, Zelickson BD, Anhalt GJ, Liu Z & Diaz LA. Bullous pemphigoid and herpes gestationis autoantibodies recognize a common non-collagenous site on the BP180 ectodomain, J Immunol, 1993, 151, 5742–5750.[Abstract]
12. Green KJ & Jones JCR. Desmosomes and hemidesmosomes: structure and function of molecular components, FASEB (Fed Am Soc Exp Biol) J, 1996, 10, 871–881.[Abstract]
13. Guo L, Degenstein L, Dowling J, Yu Q-C, Wollmann R, Perman B & Fuchs E. Gene targeting of BPAG1: abnormalities in mechanical strength and cell migration in stratified epithelia and neurologic degeneration, Cell, 1995, 81, 233–243.[Medline]
14. Hieda Y, Nishizawa Y, Uematsu J & Owaribe K. Identification of a new hemidesmosomal protein, HD1: a major, high molecular mass component of isolated hemidesmosomes, J Cell Biol, 1992, 116, 1497–1506.[Abstract/Free Full Text]
15. High S & Dobberstein B. Mechanisms that determine the transmembrane disposition of proteins, Curr Opin Cell Biol, 1992, 4, 581–586.[Medline]
16. Hirako Y, Usukura J, Nishizawa Y & Owaribe K. Demonstration of the molecular shape of BP180, a 180-kDa bullous pemphigoid antigen and its potential for trimer formation, J Biol Chem, 1996, 271, 13739–13745.[Abstract/Free Full Text]
17. Hogervorst F, Kuikman I, Kr AEG, von dem Borne & Sonnenberg A. Cloning and sequence analysis of β-4 cDNA: an integrin subunit that contains a unique 118 kD cytoplasmic domain, EMBO (Eur Mol Biol Organ) J, 1990, 9, 765–770.[Medline]
18. Hopkinson SB, Baker SE & Jones JCR. Molecular genetic studies of a human epidermal autoantigen (the 180-kD bullous pemphigoid antigen/BP180): identification of functionally important sequences within the BP180 molecule and evidence for an interaction between BP180 and 6 integrin, J Cell Biol, 1995, 130, 117–125.[Abstract/Free Full Text]
19. Hopkinson SB, Riddelle KS & Jones JCR. Cytoplasmic domain of the 180-kD bullous pemphigoid antigen, a hemidesmosomal component: molecular and cell biologic characterization, J Invest Dermatol, 1992, 99, 264–270.[Medline]
20. Huang MTF & Gorman CM. Intervening sequences increase efficiency of RNA 3' processing and accumulation of cytoplasmic RNA, Nucleic Acids Res, 1990, 18, 937–947.[Abstract/Free Full Text]
21. Jonkman MF, de Jong MCJM, Heeres K, Pas HH, van der Meer JB, Owaribe K, Martinez de Velasco AM, Niessen CM & Sonnenberg A. 180-kD bullous pemphigoid antigen (BP180) is deficient in generalized atrophic benign epidermolysis bullosa, J Clin Invest, 1995, 95, 1345–1352.[Medline]
22. Kennel SJ, Godfrey V, Ch'ang LY, Lankford TK, Foote L J & Makkinje A. The β4 subunit of the integrin family is displayed on a restricted subset of endothelium in mice, J Cell Sci, 1992, 103, 145–150.[Abstract/Free Full Text]
23. Kitajima Y, Owada MK, Fujisawa Y, Seishima M, Yaoita H, Hirako Y & Owaribe K. A hemidesmosomal transmembrane collagenous molecule, the 180-kDa bullous pemphigoid antigen (BPAII), is phosphorylated with 12-0-tetradecanoylphorbol-13-acetate in a human squamous cell carcinoma line (DJM-1), Epith Cell Biol, 1995, 4, 70–75.[Medline]
24. Kozak M. Structural features in eukaryotic mRNAs that modulate the initiation of translation, J Biol Chem, 1991, 266, 19867–19870.[Free Full Text]
25. Kurpakus MA & Jones JCR. A novel hemidesmosomal plaque component: tissue distribution and incorporation into assembling hemidesmosomes in an in vitro model, Exp Cell Res, 1991, 194, 139–146.[Medline]
26. Kurpakus MA, Quaranta V & Jones JC. Surface relocation of 6β4 integrins and assembly of hemidesmosomes in an in vitro model of wound healing, J Cell Biol, 1991, 115, 1737–1750.[Abstract/Free Full Text]
27. Labib RS, Anhalt GJ, Patel HP, Mutasim DF & Diaz LA. Molecular heterogeneity of the bullous pemphigoid antigens as detected by immunoblotting, J Immunol, 1986, 136, 1231–1235.[Abstract]
28. Leevers SJ, Paterson HF & Marshall CJ. Requirement for Ras in Raf activation is overcome by targeting Raf to the plasma membrane, Nature (Lond), 1994, 369, 411–414.[Medline]
29. Li K, Tamai K, Tan EML & Uitto J. Cloning of type XVII collagen. Complementary and genomic DNA sequences of mouse 180-kilodalton bullous pemphigoid antigen (BPAG2) predict an interrupted collagenous domain, a transmembrane segment, and unusual features in the 5'-end of the gene and the 3'-untranslated region of the mRNA, J Biol Chem, 1993, 268, 8825–8834.[Abstract/Free Full Text]
30. Mainiero F, Pepe A, Wary KK, Spinardi L, Mohammadi M, Schlessinger J & Giancotti FG. Signal transduction by the 6β4 integrin: distinct β4 subunit sites mediate recruitment of Shc/Grb2 and association with the cytoskeleton of hemidesmosomes, EMBO (Eur Mol Biol Organ) J, 1995, 14, 4470–4481.[Medline]
31. Mainiero F, Pepe A, Yeon M, Ren Y & Giancotti FG. The intracellular functions of 6β4 are regulated by EGF, J Cell Biol, 1996, 134, 241–253.[Abstract/Free Full Text]
32. McGrath JA, Gatalica B, Christiano AM, Li K, Owaribe K, McMillan JR, Eady RAJ & Uitto J. Mutations in the 180-kD bullous pemphigoid antigen (BPAG2), a hemidesmosomal transmembrane collagen (COL17A1), in generalized atrophic benign epidermolysis bullosa, Nature Genet, 1995, 11, 83–86.[Medline]
33. McLean WHI, Pulkkinen L, Smith FJD, Rugg EL, Lane EB, Bullrich F, Burgeson RE, Amano S, Hudson DL, Owaribe K et al.. Loss of plectin causes epidermolysis bullosa with muscular dystrophy: cDNA cloning and genomic organization, Genes Dev, 1996, 10, 1724–1735.[Abstract/Free Full Text]
34. Niessen CM, Cremona O, Daams H, Ferraresi S, Sonnenberg A & Marchisio PC. Expression of the integrin 6β4 in peripheral nerves: localization in Schwann and perineural cells and different variants of the β4 subunit, J Cell Sci, 1994, 107, 543–552.[Abstract]
35. Niessen CM, Hogervorst F, Jaspars LH, de Melker AA, Delwel GO, Hulsman EHM, Kuikman I & Sonnenberg A. The 6β4 integrin is a receptor for both laminin and kalinin, ExpCell Res, 1994, 211, 360–367.[Medline]
36. Niessen CM, van der Raaij-Helmer LMH, Hulsman EHM, van der Neut R, Jonkman MF & Sonnenberg A. Deficiency of the integrin β4 subunit in junctional epidermolysis bullosa with pyloric atresia: consequences for hemidesmosome formation and adhesion properties, J Cell Sci, 1996, 109, 1695–1706.[Abstract]
37. Niessen, C.M., E.H.M. Hulsman, E.S. Rots, P. Sanchez-Aparicio, and A. Sonnenberg. 1997. The integrin 6β4 forms a complex with the cytoskeletal protein HD1 and induces its redistribution in transfected COS-7 cells. Mol. Biol. Cell. In press.
38. Nishizawa Y, Uematsu J & Owaribe K. HD4, a 180 kDa bullous pemphigoid antigen, is a major transmembrane glycoprotein of the hemidesmosome, J Biochem (Tokyo), 1993, 113, 493–501.[Abstract/Free Full Text]
39. Quilliam LA, Huff SY, Rabun KM, Wei W, Park W, Broek D & Der CJ. Membrane-targeting potentiates guanine nucleotide exchange factor CDC25 and SOS1 activation of Ras transforming activity, Proc Natl Acad Sci USA, 1994, 91, 8512–8516.[Abstract/Free Full Text]
40. Riddelle KS, Green KJ & Jones JC. Formation of hemidesmosomes in vitro by a transformed rat bladder cell line, J Cell Biol, 1991, 112, 159–168.[Abstract/Free Full Text]
41. Riddelle KS, Hopkinson SB & Jones JCR. Hemidesmosomes in the epithelial cell line 804G: their fate during wound closure, mitosis and drug induced reorganization of the cytoskeleton, J Cell Sci, 1992, 103, 475–490.[Abstract]
42. Rost B & Sander C. Prediction of protein structure at better than 70% accuracy, J Mol Biol, 1993, 232, 584–599.[Medline]
43. Sanchez-Aparicio P, Martinez de Velasco AM, Niessen CM, Borradori L, Kuikman I, Hulsman EHM, Fässler R, Owaribe K & Sonnenberg A. The subcellular distribution of the high molecular mass protein, HD1, is determined by the cytoplasmic domain of the integrin β4 subunit, J Cell Sci, 1997, 110, 169–178.[Abstract]
44. Skalli O, Jones JCR, Gagescu R & Goldman RD. IFAP 300 is common to desmosomes and hemidesmosomes and is a possible linker of intermediate filaments to these junctions, J Cell Biol, 1994, 125, 159–170.[Abstract/Free Full Text]
45. Sonnenberg A, Calafat J, Janssen H, Daams H, van der RaaijHelmer LMH, Falcioni R, Kennel SJ, Aplin JD, Baker J, Loizidou M et al.. Integrin 6/β4 complex is located in hemidesmosomes, suggesting a major role in epidermal cell-basement membrane adhesion, J Cell Biol, 1991, 113, 907–917.[Abstract/Free Full Text]
46. Sonnenberg A, Daams H, van der Valk MA, Hilkens J & Hilgers J. Development of mouse mammary gland: identification of stages in differentiation of luminal and myoepithelial cells using monoclonal antibodies and polyvalent antiserum against keratin, J Histochem Cytochem, 1986, 34, 1037–1046.[Abstract]
47. Sonnenberg A & Modderman PW. F.Hogervorst. Laminin receptor on platelets is the integrin VLA-6, Nature (Lond), 1988, 336, 487–489.[Medline]
48. Spinardi L, Ren Y-L, Sanders R & Giancotti FG. The β4 subunit cytoplasmic domain mediates the interaction of 6β4 integrin with the cytoskeleton of hemidesmosomes, Mol Biol Cell, 1993, 4, 871–884.[Abstract]
49. Stanley JR, Tanaka T, Mueller S, Klaus-Kovtun V & Roop D. Isolation of cDNA for bullous pemphigoid antigen by use of patients' autoantibodies, J Clin Invest, 1988, 82, 1864–1870.[Medline]
50. Stepp MA, Spurr-Michaud S, Tisdale A, Elwell J & Gipson IK. 6β4 integrin heterodimer is a component of hemidesmosomes, Proc Natl Acad Sci USA, 1990, 87, 8970–8974.[Abstract/Free Full Text]
51. Suzuki S & Naitoh Y. Amino acid sequence of a novel integrin β4 subunit and primary expression of the mRNA in epithelial cells, EMBO (Eur Mol Biol Organ) J, 1990, 9, 757–763.[Medline]
52. Tanaka T, Korman NJ, Shimizu H, Eady RAJ, Klaus-Kovtun V, Cehrs K & Stanley JR. Production of rabbit antibodies against carboxy-terminal epitopes encoded by bullous pemphigoid cDNA, J Invest Dermatol, 1990, 94, 617–623.[Medline]
53. Towbin H, Stahelin T & Gordon J. Electrophoretic transfers of proteins from polyacrylamide gels to nitrocellulose sheets. Procedure and some applications, Proc Natl Acad Sci USA, 1979, 76, 4350–4354.[Abstract/Free Full Text]
54. Uematsu J, Nishizawa Y, Sonnenberg A & Owaribe K. Demonstration of type II hemidesmosomes in a mammary gland epithelial cell line, BMGE-H, J Biochem, 1994, 115, 469–476.[Abstract/Free Full Text]
55. Van der Neut R, Krimpenfort P, Calafat J, Niessen CM & Sonnenberg A. Epithelial detachment due to absence of hemidesmosomes in integrin β4 null mice, Nature Genet, 1996, 13, 366–369.[Medline]
56. Vidal F, Aberdam D, Miquel C, Christiano AM, Pulkkinen L, Uitto J, Ortonne JP & Meneguzzi G. Integrin β4 mutations associated with junctional epidermolysis bullosa with pyloric atresia, Nature Genet, 1995, 10, 229–234.[Medline]
57. Wiche, G., D. Gromov, A. Donovan, M.J. Castanon, and E. Fuchs. 1993. Expression of plectin mutant cDNA in cultured cells indicates a role of COOH-terminal domain in intermediate filament association. J. Cell Biol. 121:607–619.

CiteULike

Complore

Connotea

Del.icio.us

Digg

Facebook

Reddit

Technorati

Twitter

This article has been cited by other articles:

• Franzke, C.-W., Bruckner-Tuderman, L., Blobel, C. P. (2009). Shedding of Collagen XVII/BP180 in Skin Depends on Both ADAM10 and ADAM9. J. Biol. Chem. 284: 23386-23396 [Abstract] [Full Text]  
• Thoma-Uszynski, S., Uter, W., Schwietzke, S., Schuler, G., Borradori, L., Hertl, M. (2006). Autoreactive T and B Cells from Bullous Pemphigoid (BP) Patients Recognize Epitopes Clustered in Distinct Regions of BP180 and BP230. J. Immunol. 176: 2015-2023 [Abstract] [Full Text]  
• Raymond, K., Kreft, M., Janssen, H., Calafat, J., Sonnenberg, A. (2005). Keratinocytes display normal proliferation, survival and differentiation in conditional {beta}4-integrin knockout mice. J. Cell Sci. 118: 1045-1060 [Abstract] [Full Text]  
• Franzke, C.-W., Tasanen, K., Borradori, L., Huotari, V., Bruckner-Tuderman, L. (2004). Shedding of Collagen XVII/BP180: STRUCTURAL MOTIFS INFLUENCE CLEAVAGE FROM CELL SURFACE. J. Biol. Chem. 279: 24521-24529 [Abstract] [Full Text]  
• Rabinovitz, I., Tsomo, L., Mercurio, A. M. (2004). Protein Kinase C-{alpha} Phosphorylation of Specific Serines in the Connecting Segment of the {beta}4 Integrin Regulates the Dynamics of Type II Hemidesmosomes. Mol. Cell. Biol. 24: 4351-4360 [Abstract] [Full Text]  
• Koster, J., van Wilpe, S., Kuikman, I., Litjens, S.H.M., Sonnenberg, A. (2004). Role of Binding of Plectin to the Integrin {beta}4 Subunit in the Assembly of Hemidesmosomes. Mol. Biol. Cell 15: 1211-1223 [Abstract] [Full Text]  
• Parikka, M., Kainulainen, T., Tasanen, K., Vaananen, A., Bruckner-Tuderman, L., Salo, T. (2003). Alterations of Collagen XVII Expression During Transformation of Oral Epithelium to Dysplasia and Carcinoma. J. Histochem. Cytochem. 51: 921-929 [Abstract] [Full Text]  
• Hirako, Y., Yoshino, K., Zillikens, D., Owaribe, K. (2003). Extracellular Cleavage of Bullous Pemphigoid Antigen 180/Type XVII Collagen and Its Involvement in Hemidesmosomal Disassembly. J Biochem 133: 197-206 [Abstract] [Full Text]  
• Koster, J., Geerts, D., Favre, B., Borradori, L., Sonnenberg, A. (2003). Analysis of the interactions between BP180, BP230, plectin and the integrin {alpha}6{beta}4 important for hemidesmosome assembly. J. Cell Sci. 116: 387-399 [Abstract] [Full Text]  
• Kumari, S., Bhol, K. C., Simmons, R. K., Razzaque, M. S., Letko, E., Foster, C. S., Ahmed, A. R. (2001). Identification of Ocular Cicatricial Pemphigoid Antibody Binding Site(s) in Human {beta}4 Integrin. IOVS 42: 379-385 [Abstract] [Full Text]  
• Gonzalez, A. M., Otey, C., Edlund, M., Jones, J. C. R. (2001). Interactions of a hemidesmosome component and actinin family members. J. Cell Sci. 114: 4197-4206 [Abstract] [Full Text]  
• Sterk, L. M.Th., Geuijen, C. A.W., Oomen, L. C.J.M., Calafat, J., Janssen, H., Sonnenberg, A. (2000). The Tetraspan Molecule Cd151, a Novel Constituent of Hemidesmosomes, Associates with the Integrin {alpha}6{beta}4 and May Regulate the Spatial Organization of Hemidesmosomes. JCB 149: 969-982 [Abstract] [Full Text]  
• Tasanen, K., Eble, J. A., Aumailley, M., Schumann, H., Baetge, J., Tu, H., Bruckner, P., Bruckner-Tuderman, L. (2000). Collagen XVII Is Destabilized by a Glycine Substitution Mutation in the Cell Adhesion Domain Col15. J. Biol. Chem. 275: 3093-3099 [Abstract] [Full Text]  
• Schumann, H., Baetge, J., Tasanen, K., Wojnarowska, F., Schacke, H., Zillikens, D., Bruckner-Tuderman, L. (2000). The Shed Ectodomain of Collagen XVII/BP180 Is Targeted by Autoantibodies in Different Blistering Skin Diseases. Am. J. Pathol. 156: 685-695 [Abstract] [Full Text]  
• Nievers, M., Kuikman, I, Geerts, D, Leigh, I., Sonnenberg, A (2000). Formation of hemidesmosome-like structures in the absence of ligand binding by the (alpha)6(beta)4 integrin requires binding of HD1/plectin to the cytoplasmic domain of the (beta)4 integrin subunit. J. Cell Sci. 113: 963-973 [Abstract]  
• Hopkinson, S. B., Jones, J. C. R. (2000). The N Terminus of the Transmembrane Protein BP180 Interacts with the N-terminal Domain of BP230, Thereby Mediating Keratin Cytoskeleton Anchorage to the Cell Surface at the Site of the Hemidesmosome. Mol. Biol. Cell 11: 277-286 [Abstract] [Full Text]  
• Geerts, D., Fontao, L., Nievers, M. G., Schaapveld, R. Q.J., Purkis, P. E., Wheeler, G. N., Lane, E. B., Leigh, I. M., Sonnenberg, A. (1999). Binding of Integrin {alpha}6{beta}4 to Plectin Prevents Plectin Association with F-Actin but Does Not Interfere with Intermediate Filament Binding. JCB 147: 417-434 [Abstract] [Full Text]  
• Schacke, H., Schumann, H., Hammami-Hauasli, N., Raghunath, M., Bruckner-Tuderman, L. (1998). Two Forms of Collagen XVII in Keratinocytes. A FULL-LENGTH TRANSMEMBRANE PROTEIN AND A SOLUBLE ECTODOMAIN. J. Biol. Chem. 273: 25937-25943 [Abstract] [Full Text]  
• Schaapveld, R. Q.J., Borradori, L., Geerts, D., van Leusden, M. R., Kuikman, I., Nievers, M. G., Niessen, C. M., Steenbergen, R. D.M., Snijders, P. J.F., Sonnenberg, A. (1998). Hemidesmosome Formation Is Initiated by the {beta}4 Integrin Subunit, Requires Complex Formation of {beta}4 and HD1/Plectin, and Involves a Direct Interaction between {beta}4 and the Bullous Pemphigoid Antigen 180. JCB 142: 271-284 [Abstract] [Full Text]  
• Hirako, Y., Usukura, J., Uematsu, J., Hashimoto, T., Kitajima, Y., Owaribe, K. (1998). Cleavage of BP180, a 180-kDa Bullous Pemphigoid Antigen, Yields a 120-kDa Collagenous Extracellular Polypeptide. J. Biol. Chem. 273: 9711-9717 [Abstract] [Full Text]  
• Nievers, M., Schaapveld, R., Oomen, L., Fontao, L, Geerts, D, Sonnenberg, A (1998). Ligand-independent role of the beta 4 integrin subunit in the formation of hemidesmosomes. J. Cell Sci. 111: 1659-1672 [Abstract]  
• Dans, M., Gagnoux-Palacios, L., Blaikie, P., Klein, S., Mariotti, A., Giancotti, F. G. (2001). Tyrosine Phosphorylation of the beta 4 Integrin Cytoplasmic Domain Mediates Shc Signaling to Extracellular Signal-regulated Kinase and Antagonizes Formation of Hemidesmosomes. J. Biol. Chem. 276: 1494-1502 [Abstract] [Full Text]  
• Areida, S. K., Reinhardt, D. P., Muller, P. K., Fietzek, P. P., Kowitz, J., Marinkovich, M. P., Notbohm, H. (2001). Properties of the Collagen Type XVII Ectodomain. EVIDENCE FOR N- TO C-TERMINAL TRIPLE HELIX FOLDING. J. Biol. Chem. 276: 1594-1601 [Abstract] [Full Text]  
• Favre, B., Fontao, L., Koster, J., Shafaatian, R., Jaunin, F., Saurat, J.-H., Sonnenberg, A., Borradori, L. (2001). The Hemidesmosomal Protein Bullous Pemphigoid Antigen 1 and the Integrin beta 4 Subunit Bind to ERBIN. MOLECULAR CLONING OF MULTIPLE ALTERNATIVE SPLICE VARIANTS OF ERBIN AND ANALYSIS OF THEIR TISSUE EXPRESSION. J. Biol. Chem. 276: 32427-32436 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF, 1169K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Alert me to new content in the JCB Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Borradori, L. Articles by Sonnenberg, A. Search for Related Content PubMed Articles by Borradori, L. Articles by Sonnenberg, A. Social Bookmarking                            What's this?