|
||
The Scripps Research Institute, Departments of Cell and Molecular Biology, La Jolla, California 92037
p53/58 is a transmembrane protein that continuously recycles between the ER and pre-Golgi intermediates composed of vesicular-tubular clusters (VTCs) found in the cell periphery and at the cis face of the Golgi complex. We have generated an antibody that uniquely recognizes the p53/58 cytoplasmic tail. Here we present evidence that this antibody arrests the anterograde transport of vesicular stomatitis virus glycoprotein and leads to the accumulation of p58 in preGolgi intermediates. Consistent with a role for the KKXX retrieval motif found at the cytoplasmic carboxyl terminus of p53/58 in retrograde traffic, inhibition of transport through VTCs correlates with the ability of the antibody to block recruitment of COPI coats to the p53/58 cytoplasmic tail and to p53/58-containing membranes. We suggest that p53/58 function may be required for the coupled exchange of COPII for COPI coats during segregation of anterograde and retrograde transported proteins.
Sorting and recycling of proteins during transit
through the early secretory pathway (ER, pre-Golgi
intermediates, and Golgi compartments) is a critical
event required for the selective delivery of cargo to the
cell surface (Pelham, 1994 Although the precise mechanism of protein recycling in
the early secretory pathway is unknown, it is likely to involve the COPI coat complex (coatomer) (Letourneur et al.,
1994 Membrane traffic through the exocytic pathway occurs
through a selective transport mechanism (Aridor and
Balch, 1996 VTCs are the first site of segregation of anterograde and
retrograde transported proteins (Aridor et al., 1995 The intermediate compartment marker p53 in human
cell lines is an unglycosylated, type I transmembrane protein
that exists in both dimeric and oligomeric forms (Schweizer
et al., 1988 To establish whether p58 is required for ER to Golgi
transport and to define its potential site of action, we have
generated an antipeptide antibody that uniquely recognizes the cytoplasmic tail common to p53 and p58. Here,
we report that this antibody potently inhibits the transport
of VSV-G from VTCs to the Golgi stack but not export
from the ER. Coincident with the block in anterograde
transport in the presence of antibody, we observe the accumulation of p58 in VTCs. The block in protein transport directly correlates with inhibition of COPI recruitment to
the p53/58 cytoplasmic tail and VTCs in vitro. We propose
that p58 and its homologue p53 are coatomer-binding proteins that participate in COPI-coupled segregation events
during transport of cargo through VTCs.
Materials
Peptides were synthesized and purified, and their structure was confirmed
by mass spectroscopy by The Scripps Research Institute Protein/DNA
and Mass Spectrometry core facilities (La Jolla, CA). A monoclonal antibody to p53 was a generous gift of H.-P. Hauri (University of Basel, Basel,
Switzerland). The clones for monoclonal antibodies M3A5 (Allan and
Kreis, 1986 Generation of Antipeptide Antibody, Fab Fragments,
and Affinity Purification
A peptide that corresponds to the carboxyl-terminal 10 amino acids of
p53/58 (QQEAAAKKFF) plus an NH2-terminal cysteine was synthesized, coupled to maleimide-activated KLH, and used for immunization.
The serum was applied to cyanogen bromide-activated Sepharose 4B to
which the immunizing peptide was coupled for affinity purification. The
column was washed with five bed volumes of PBS, eluted with 0.1 M glycine, pH 2.8, and then neutralized to pH 7.2. The eluate was dialyzed
against 25 mM Hepes, pH 7.2, 125 mM KOAc (25/125) and concentrated
for use in the semiintact cell transport assay. Fab fragments of affinity-purified anti-cytoplasmic tail were made as described by the manufacturer
(Pierce, Rockford, IL).
p53 Cloning and Production of Recombinant
p53 Protein
HeLa mRNA was isolated (Oligotex; Qiagen, Chatsworth, CA) and then
reverse transcribed for 1 h with AMV Reverse Transcriptase and 1.0 µM
specific primer to p53: 5 Generation of GST-p53/58 Carboxyl
Tail Fusion Protein
Oligonucleotides that corresponded to the cytoplasmic domain of p53/58
(forward primer introduced a BamHI site, 5 Analysis of Transport In Vitro
Normal rat kidney (NRK) or CHO clone 15 B cells were infected for 4 h
with the temperature-sensitive VSV strain ts045 and then biosynthetically
labeled with 100 µCi Trans[35S] for 10 min at the restrictive temperature
(39.5°C) to accumulate VSV-G mutant in the ER. The cells were then perforated by swelling and scraping. ER to cis/medial-Golgi transport in vitro
was measured as described (Davidson and Balch, 1993 Indirect Immunofluorescence
NRK, BHK, and HeLa cells were plated on coverslips overnight and then
fixed in 3% formaldehyde/PBS for 10 min. The fixed cells were then permeabilized with 0.05% saponin in PBS for 10 min, incubated with affinitypurified antipeptide antibody to the cytoplasmic tail of p53/58 for 30 min,
washed with PBS, and then stained with antirabbit-conjugated FITC for
30 min. The cells were then washed with PBS, mounted, and viewed under
a fluorescence microscope (model Axiovert; Carl Zeiss, Inc., Thornwood,
NY). For the morphological assay, NRK cells plated on coverslips were
infected with ts045 at 39.5°C for 2-3 h and then shifted to ice and permeabilized with digitonin (20 µg/ml) as outlined previously (Plutner et al., 1992 Noninfected digitonin-permeabilized cells were incubated in transport
cocktail with or without antibody for 80 min at 15°C to arrest transport in
the 15°C pre-Golgi structures. Cells were then either fixed with 3% formaldehyde/PBS or transferred to 37°C for 15 min, fixed, stained with anti-
ELISA
Peptides (1 µg/100 µl of 50 mM NaHCO3, pH 9.6) and GST fusion proteins (1 µg/100 µl of 50 mM NaHCO3, pH 9.6) listed in Table I were
coated in Nunc-immunomodules at 4°C overnight. The wells were washed
in TBS, blocked in TBS/5% FBS for 1 h at 37°C, additionally washed in
TBS, then incubated with 1 µg affinity-purified antitail antibody for 3 h at
37°C, washed with TBS, and then incubated with antirabbit-conjugated
alkaline phosphatase for 1 h at 37°C. The wells were washed with TBS and
then developed with Sigma 104 phosphatase substrate (St. Louis, MO) and
read at 405 nm on a microplate reader.
Table I.
ELISA1 Characterization of Binding of
Affinity-purified p53/58 to Peptides
; Aridor and Balch, 1996
). Segregation is now recognized to include both soluble cargo that contains a carboxyl-terminal retrieval motif (KDEL)
and a growing list of transmembrane proteins that possess
a di-lysine (KKXX or KXKXX) recycling motif at their
cytoplasmic tails (Nilsson et al., 1989
; Jackson et al., 1993
).
The retrograde retrieval of these and other proteins from
pre- and cis-Golgi elements appears necessary for the
maintenance of organelle composition and for the reuse
of transport components that participate in vesicle formation and their subsequent fusion to downstream compartments.
; Aridor et al., 1995
). Yeast mutant strains defective in
the COPI subunits
, 
,
, and
are unable to retrieve
KKXX-tagged proteins (Letourneur et al., 1994
; Cosson
et al., 1996
; Gaynor and Emr, 1997
). This observation is
supported by the fact that a glutathione-S-transferase (GST)1 fusion protein that possesses the carboxyl-terminal
KKXX motif binds COPI coat proteins. The binding of
coatomer is lost when the di-lysine residues are mutated
(Cosson and Letourner, 1994). In addition, a novel di-phenylalanine motif has recently been found to also facilitate
binding to COPI, suggesting a bimodal interaction of proteins with coatomer (Fielder et al., 1996; Söhn et al., 1996
).
Mutations in ARF1, a small GTPase that is essential for
COPI recruitment to elements found in the peripheral cytoplasm or at the cis face of the Golgi complex (Orci et al.,
1993
), potently inhibits both ER to Golgi transport and
the recycling of KKXX-containing proteins in vivo and in
vitro (Dascher and Balch, 1994
; Aridor et al., 1995
; Tang
et al., 1995
). While these results emphasize the importance
of COPI in retrograde transport, they also suggest that
proteins that contain carboxyl-terminal di-lysine/phenylalanine motifs may play a direct role in protein traffic.
). Selective transport is initiated through the
formation of COPII-coated vesicles initially discovered by
Schekman and colleagues in yeast (Barlowe et al., 1994
)
and subsequently shown to be essential for ER export in
mammalian cells (Kuge et al., 1994
; Aridor et al., 1995
).
COPII coats promote efficient sorting and concentration
of cargo during export from the ER (Mizuno and Singer,
1993
; Balch et al., 1994
; Barlowe et al., 1994
). After release
from the ER, COPII vesicles are targeted to pre-Golgi intermediates composed of vesicular tubular clusters (VTCs).
These elements were originally defined by the distribution
of the type I transmembrane marker protein p53 in human
cell lines (Schweizer et al., 1988
) and its homologue, rat
p58 (>90% identity) (Saraste et al., 1987
; Saraste and
Svensson, 1991
; Lahtinen et al., 1996
), and the small GTPase Rab2 (Chavrier et al., 1990
; Tisdale and Balch, 1996
).
A stereological characterization of the distribution of these
intermediates has shown that they are a component of a
more complex morphological structure, referred to as "export complexes," in which VTCs are closely juxtaposed to
ER membranes that contain numerous COPII budding
profiles (Bannykh et al., 1996
). Export complexes are
found throughout the peripheral cytoplasm but are particularly concentrated at the cis face of the Golgi complex
through microtubule-dependent events (Presley, J.F., N.B.
Cole, and J. Lippincott-Schwartz. 1996. Mol. Biol. Cell. 7:74a).
; Tang
et al., 1995
), and the principal site for the recruitment of
COPI coats in peripheral sites and in the Golgi region
(Lotti et al., 1992
; Oprins et al., 1993
; Aridor et al., 1995
).
We have previously demonstrated that a coupled exchange of COPI for COPII coats is essential for the anterograde transport of cargo such as the type 1 transmembrane
glycoprotein vesicular stomatitis virus glycoprotein (VSVG) and the segregation of p58 to recycling vesicles (Aridor et al., 1995
). When cells are incubated at reduced temperature (15°C), VTCs accumulate, an event particularly evident in the peripheral regions, and cargo fails to be delivered to the Golgi stack (Saraste and Kuismanen, 1984
;
Pind et al., 1994
; Aridor et al., 1995
). These results suggest
that a low temperature-sensitive step regulates membrane
flow from VTCs to the Golgi region.
), whereas rat p58 is a glycoprotein. p58 is efficiently recruited into COPII-coated vesicles during budding from the ER (Rowe et al., 1996
). p53/58 are abundant
components of both ER-derived vesicles (Rowe et al., 1996
)
and isolated VTCs (Schweizer et al., 1990
; 1991). The cytoplasmic tails of p53 and p58 are conserved and terminate
with the KKXX retrieval motif. This motif, along with additional flanking residues, appears to be critical for the normal recycling itinerary of p53/58 (Itin et al., 1995
). Interestingly, p53 has recently been shown to be identical to the
mannose-specific membrane lectin, MR60 (Arar et al.,
1995
), and has been suggested to function as an oligosaccharide-based sorting receptor in the secretory pathway
(Itin et al., 1996
). However, either a direct role for p53/58
in COPII vesicle budding or COPI binding or its potential
role in recycling during ER to Golgi transport has been
demonstrated.
Materials and Methods
) and P5D4 (Kreis, 1986
) were kindly provided by T. Kreis
(University of Basel, Basel, Switzerland).
GCGGGATCCTACACAAATAGATGAACTACACAGG 3
. The resulting first-strand cDNA was amplified by PCR
using the following primers, which generated 5
NdeI and 3
BamHI sites: 5
GGCCATATGGCGGGATCCAGGCAAAGGGGTCTCCGG 3
and
the reverse primer 5
GCGGGATCCTCAAAAGAATTTTTTGGCAGCTGC 3
. The sequence of the PCR product was confirmed by automated sequencing (Applied Biosystems, Inc., Foster City, CA). The p53
cDNA was cloned into pET3A, and protein was expressed in 100 µM
IPTG-induced Escherichia coli (BL21) for 3 h at 37°C. The cells were harvested, lysed, Dounce homogenized in 50 mM Tris, pH 8, 200 mM NaCl,
1% Triton X-100, 1 mM EDTA, 40 µg/ml lysozyme, and then centrifuged
for 30 min at 15,000 g. The soluble fraction was loaded on a 12% SDS-PAGE and the band corresponding to the p53 protein, excised, and electroeluted.
GATCCCAACAAGAAGCAGCTGCAAAA AAATTTTTCTG 3
, reverse primer introduced an
EcoRI site, 5
AATTCAGAAAAATTTTTTTGCAGCTGCTTCTTGTTGG 3
) were synthesized, phosphorylated by T4 polynucleotide kinase, annealed, and the oligonucleotide cassette ligated into pGEX-2T (Pharmacia LKB Biotechnology, Inc., Piscataway, NJ). BL21 cells that contained the recombinant pGEX plasmid were grown at 37°C to 0.6A600 and
then induced with 0.1 mM IPTG for 3 h at 37°C. The liquid culture was
centrifuged, and the pellet was resuspended in cold PBS, sonicated, and
recentrifuged, and the resulting supernatant was applied to a glutathione
Sepharose 4B column (Pharmacia LKB Biotechnology, Inc.). The column
was washed with 10 bed volumes of PBS, and the fusion protein was
eluted with 5 mM reduced glutathione. The resulting fusion protein was
analyzed by SDS-PAGE and Western blot and was recognized by the antitail antibody.
). Briefly, transport
reactions were performed in a final volume of 40 µl in a buffer that contained 25 mM Hepes-KOH, pH 7.2, 75 mM KOAc, 2.5 mM MgOAc, 5 mM
EGTA, 1.8 mM CaCl2, 1 mM N-acetylglucosamine, an ATP-regeneration
system (1 mM ATP, 5 mM creatine phosphate, and 0.2 IU rabbit muscle
creatine phosphokinase), and 5 µl rat liver cytosol and 5 µl of semiintact cells (~5 × 107 cells/ml, ~25-30 µg total protein) in 50 mM Hepes-KOH,
pH 7.2, 90 mM KOAc. To the assay was added the indicated concentration (see Results) of affinity-purified antibody or Fab fragments. The reactions were preincubated on ice for 45 min, subsequently incubated for
90 min at 32°C, and transferred to ice to terminate transport, and the
membranes were pelleted, solubilized in buffer, and digested with endoglycosidase H (endo H) (Davidson and Balch, 1993
) or endoglycosidase
D (endo D) (Beckers et al., 1987
) as described. The samples were analyzed by SDS-PAGE and the fraction of VSV-G protein processed to the
endo H-resistant or endo D-sensitive forms quantitated by a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
). Coverslips with permeabilized cells were inverted and placed in tissue culture wells that contained the transport cocktail described above,
preincubated on ice for 45 min with or without the antibody, and then incubated for 30 min at 32°C. To terminate transport, the cells were transferred to ice and fixed in 3% formaldehyde/PBS for 10 min. Intracellular
VSV-G was detected by repermeabilization of the fixed cells with 0.05%
saponin in PBS for 10 min, washed with PBS, and then incubated for 30 min with a monoclonal antibody specific for VSV-G protein cytoplasmic
tail (P5D4) (Kreis, 1986
). Cells were then washed with PBS, costained for
30 min with Texas red anti-mouse antibody, mounted, and viewed as
above.
-COP (M3A5) (Allan and Kreis, 1986
), washed, and then costained with
anti-mouse Texas red, as described above.
-COP Binding to GST-p53/58 Cytoplasmic Tail
Fusion Protein
GST-p53/58 protein (100 µg) was preincubated with 75 µl of glutathione
Sepharose 4B for 4 h at room temperature and then washed three times
with 25/125 to remove any unbound protein. Excess antipeptide antibody
(100 µg) was added where indicated in the Results and allowed to absorb
to the fusion protein for 4 h on ice. Rat liver cytosol (~200 µg total protein in 25/125 [Davidson and Balch, 1993
]) was then added and incubated
for an additional 4 h at 4°C. The beads were pelleted at 5K for 5 min and
the supernatant collected. The beads were then washed four times with
1 ml of 25/125 at 5,000 g for 5 min. The resulting supernatants were
pooled, precipitated with 20% TCA, and centrifuged, and the pellets were resuspended in sample buffer. The bound rat liver cytosolic proteins were
eluted from the fusion protein with 1 ml of 500 mM NaCl in 25/125 after
centrifugation at 5K for 5 min. The supernatant was precipitated with
20% TCA and centrifuged, and the pellet was resuspended in sample
buffer. All fractions were separated by SDS-PAGE and transferred to nitrocellulose in 25 mM Tris, pH 8.3, 192 mM glycine, and 20% methanol.
The membrane was blocked in TBS that contained 5% nonfat dry milk
and 0.5% Tween-20, incubated with a monoclonal antibody to
-COP
(M3A5), washed, further incubated with a horseradish peroxidase-conjugated anti-mouse antibody, and then developed with enhanced chemiluminescence (Amersham Corp., Arlington Heights, IL).
Determination of COPI Binding to Membranes
NRK cells (two confluent 10-cm dishes) were washed three times with icecold PBS. The cells were scraped off the dish with a rubber policeman into
10 mM Hepes, pH 7.2, and 250 mM mannitol and then homogenized with
15 passes of a 27-gauge syringe. The homogenate was pelleted at 500 g for
10 min at 4°C, and the supernatant was centrifuged at 16,000 g for 20 min
at 4°C. The microsomal fraction (pellet) was washed in 1 M KCl in 10 mM
Hepes, pH 7.2, for 15 min on ice to remove bound coatomer and then centrifuged at 16,000 g for 20 min at 4°C. The membranes were resuspended in 10 mM Hepes, pH 7.2, and 250 mM mannitol and used in the binding reaction as described by Aridor (1995), with modifications. Membrane (30 µg
of total protein) was added to a reaction mixture that contained 27.5 mM
Hepes, pH 7.2, 2.75 mM MgOAc, 65 mM KOAc, 5 mM EGTA, 1.8 mM
CaCl2, 1 mM ATP, 5 mM creatine phosphate, and 0.2 U of rabbit muscle
creatine kinase. Antibody was added in the amounts indicated in Results,
and the reaction mix was incubated on ice for 45 min. Rat liver cytosol (25 µg)
and 20 µM GTP
S (to promote constitutive ARF1 activation) were then
added and the reactions shifted to 37°C and incubated for 15 min. The
binding reaction was terminated by transferring the samples to ice and then adding 1 ml of 25 mM Hepes, pH 7.2, 2.5 mM MgOAC, and KOAc to
a final concentration of 250 mM. The samples were vortexed and centrifuged at 16,000 g for 10 min at 4°C. The pellet was resuspended in sample
buffer, separated by SDS-PAGE, transferred to nitrocellulose, developed,
and quantitated by densitometry as described above.
Antibody Neutralization
GST-p53/58 (50 µg in 500 µl of 25/125) or GST (50 µg in 500 µl 25/125) was added to 50 µl of glutathione Sepharose 4B preequilibrated with 25/125 for 4 h at 4°C and then washed three times with 25/125 to remove unbound fusion protein. The beads were resuspended in 18 µl of 25/125 with or without 5 µg of antipeptide antibody, incubated 4 h at 4°C, and centrifuged at 5,000 g for 5 min, and the supernatants were removed and used in the semiintact cell assay.
An Affinity-purified Antibody to the Carboxyl Terminus of p53/58 Recognizes the Endogenous Protein
To address the potential biochemical role of p53 and p58
in the transport of cargo between the ER and the Golgi, we
generated an antipeptide polyclonal antibody that recognizes a cytoplasmic tail peptide (QQEEAAKKFF) common
to both proteins (to be referred to as the antitail antibody)
(Schweizer et al., 1988
; Lahtinen et al., 1996
). Affinity-purified antibody detected an ~58-kD protein from NRK and
BHK cell lysates on a Western blot (Fig. 1 A, lanes a and
b) that comigrated with a protein identified by previously characterized antibodies specific for p58 (Saraste et al., 1987
) (Fig. 1 B, lanes a and b). In HeLa cell lysates, the antitail antibody recognized a slightly faster migrating protein of
~53 kD (Fig. 1 A, lane c), which was also detected by a
monoclonal antibody specific for the luminal domain of
p53 (Schweizer et al., 1988
) (Fig. 1 B, lane c). This protein
is likely to be p53 since the antitail antibody also recognized purified recombinant p53 (Fig. 1 C, lane a). The antitail antibody did not detect GST fusion proteins (~30 kD)
that contained either the KKXX retrieval motif (FIDEKKMP) of the E3/E19 glycoprotein or the KSKXX retrieval motif (KAHKSKTH) of an ER resident protein
(Fig. 1 C, lanes b and c, arrow). Moreover, the antibody
did not detect proteins in cell lysates in the molecular mass
range of 24 kD, which have recently been shown to bind
coatomer through either KKXX-, KXKXX-, or di-phenylalanine-containing motifs (Fiedler et al., 1996
; Söhn et al.,
1996
). Specifically, the antibody did not detect recombinant gp25l (Waka et al., 1991
) or a GST-gp25l tail peptide
(KNFFIAKKLV) fusion protein, a representative member
of the p24 gene family (Schimmoller et al., 1995
; Stamnes
et al., 1995
; Belden and Barlowe, 1996
; Fielder et al., 1996)
(not shown). These results suggest that antibody recognition is dependent on an epitope in the carboxyl terminus
unique to p58.
To extend these results, an ELISA was performed to define the epitope recognized by the antibody. As shown in
Table I, the antibody recognized a peptide that coded for
the wild-type p53/58 cytoplasmic tail (QQEAAAKKFF)
or a GST fusion protein containing the cytoplasmic tail of
p53/58 with similar affinity. Moreover, the GST-peptide
fusion proteins containing FIDEKKMP or KAHKSKTH, which were not recognized by antitail antibody on Western blots (Fig. 2 C), were similarly unreactive when bound
to microtitre wells. Removal of the QQE residues did not
affect antibody recognition (Table I), indicating that the
epitope responsible for binding was in the terminal seven
residues. Mutation of the di-lysine residues to serine had
only a partial effect on antibody binding (Table I). However, mutation of the terminal FF residues to either AA or
MP completely abrogated antibody recognition (Table I). In contrast, a peptide corresponding to the tail of p23/24c
(RRFFKAKKLIE) (Fielder et al., 1996; Söhn et al., 1996
),
which contains an internal FF motif, was not recognized
(Table 1). The combined results indicate that the dominant epitope recognized by the affinity-purified antitail
antibody requires terminal FF residues with a weaker contribution of adjacent di-lysine residues. Importantly, neither di-lysine nor internal di-phenylalanine residues are
sufficient to elicit antibody recognition.
To confirm that the antibody recognizes p53/58 in vivo,
we used indirect immunofluorescence. The affinity-purified antibody labeled clusters of punctate structures largely
concentrated near the Golgi complex in HeLa (Fig. 2 A)
and BHK (Fig. 2 C) cells at steady state. In NRK cells (Fig.
2 B), numerous punctate structures distributed throughout
the cytoplasm characteristic of peripheral pre-Golgi intermediates composed of clusters of vesicular tubular elements
(VTCs) were also detected. The labeling of peripheral punctate elements in all cell lines tested were markedly enhanced after incubation at 15°C (not shown), a condition
that results in accumulation of p53/58-containing VTCs (Saraste and Svensson, 1991
). The distribution observed with
the antitail antibody was identical with that reported for
antibodies that recognize the luminal domain of p53 in human (Schweizer et al., 1990
) and p58 in rat (Saraste and
Svensson, 1991
) cell lines. These results demonstrate that
the antibody detects a protein with the morphological properties of p53/58. All subsequent studies use the affinity-purified antibody for analysis of the role of p53/58 in transport.
Antipeptide Antibody Inhibits ER to Golgi Transport
The antitail antibody was first tested in a semiintact cell
assay to evaluate its effect on protein traffic from the ER
to the Golgi complex in NRK cells (Davidson and Balch,
1993
). This assay makes use of ts045 VSV-G, a protein that
has a thermoreversible defect in export from the ER (Lafay, 1974
; Plutner et al., 1992
). Cells infected for 4 h at the
restrictive temperature (39.5°C) to retain VSV-G in the
ER (Plutner et al., 1992
; Balch et al., 1994
) were rapidly
transferred to ice and perforated to generate semiintact
cells (Beckers et al., 1987
). Export of VSV-G from the ER
was initiated by incubation of perforated cells at the permissive temperature (32°C) in the presence of cytosol and
ATP (Davidson and Balch, 1993
). The assay measures
transport of the VSV-G protein to the Golgi stack by following the conversion of its two N-linked oligosaccharides
from the endo H-sensitive oligosaccharide form found in
the ER to the endo H-resistant species found in the cis/
medial region of the Golgi stack (Schwaninger et al., 1991
;
Davidson and Balch, 1993
).
Preincubation of semiintact NRK cells with affinitypurified antibody led to a dose-dependent inhibition of
ER to Golgi transport (Fig. 3). The processing of VSV-G
to endo H-resistant forms was reduced by 50% in the presence of ~2 µg antibody with complete inhibition at 8-10
µg (Fig. 3, closed squares). This inhibition was not a consequence of protein aggregation as Fab fragments also inhibited acquisition of endo H resistance at a level comparable to that of the intact antibody (Fig. 3, open squares). To
provide further proof that the block in transport was due
to the specific neutralization of a p53/58 carboxyl-terminal
epitope, antibody was incubated with a GST-p53/58 carboxyl tail fusion protein (GST-p53/58 tail) bound to glutathione Sepharose 4B. The resulting nonabsorbed fraction was tested for activity in the semiintact cell assay. Preincubation of the antibody with the GST-p53/58 tail
beads efficiently neutralized its inhibitory effect on protein traffic (Fig. 3, inset, c). In contrast, inhibition was not
affected by incubation of antibody with control GST beads
that lacked the p53/58 tail (Fig. 3, inset, d). These results
show that the antibody blocks transport in NRK cells
through a specific interaction with p58 and is the first demonstration that p58 may be required for ER to Golgi transport.
Antibody to the p53/58 Cytoplasmic Tail Inhibits Transport of VSV-G From VTCs to the Golgi Stack
To localize the step in transport sensitive to antibody, we
made use of the CHO clone 15B cell line, which lacks the
cis/medial-Golgi enzyme N-acetylglucosamine-transferase
I (GlcNAC Tr I) (Tabas and Kornfeld, 1979
). In 15B cells,
processing of VSV-G oligosaccharides does not proceed
beyond the Man5 form, which appears in response to trimming by
-mannosidase I found in the cis region of Golgi stack (Beckers et al., 1987
). The Man5 form of VSV-G is
uniquely susceptible to digestion with endo D (Beckers et
al., 1987
), providing a direct measure for VSV-G delivery
to the cis-most face of the Golgi. As shown in Fig. 4
(closed circles), semiintact CHO 15B cells incubated in the
absence of antibody at 32°C processed VSV-G to the Man5
form. In contrast, in the presence of antibody, processing was completely inhibited (Fig. 4, open circles).
-1,2 mannosidase I. Semiintact CHO clone 15B cells were incubated at 32°C in
a complete transport cocktail for indicated time in the absence (closed circles) or presence (open circles) of antitail antibody. The
amount of VSV-G processed to endo D-sensitive forms was determined as described in Materials and Methods. (Inset) Antibody inhibition precedes the Ca2+-dependent fusion of VTCs to
the Golgi stack. Semiintact CHO clone 15B cells were incubated
in a transport cocktail that contained 5 mM EGTA for 60 min at
32°C to accumulate VSV-G in post-ER, pre-Golgi VTCs (Pind et al.,
1994
Since the above results demonstrated that VSV-G transport was blocked at a pre-Golgi step, we next determined
whether antibody inhibited a Ca2+-dependent step involved in the delivery of cargo from pre-Golgi VTCs to
Golgi compartments (Beckers and Balch, 1989
; Pind et al., 1994
; Aridor et al., 1995
). This step has been previously
well characterized in both yeast (Rexach and Schekman,
1991
) and mammalian cells (Beckers and Balch, 1989
;
Pind et al., 1994
; Aridor et al., 1995
). Using immunoelectron microscopy, we have demonstrated that Ca2+ depletion
prevents a late fusion event, resulting in the accumulation of VSV-G-containing VTCs (Pind et al., 1994
). Semiintact
15B CHO cells were incubated in a transport cocktail containing 5 mM EGTA for 60 min at 32°C to accumulate
VSV-G in VTCs. Cells were then pelleted, held on ice in a
Ca2+-containing transport cocktail in either the absence or
presence of antibody, and subsequently incubated at 32°C
for an additional 90 min. In both control (Fig. 4, inset, b)
and antibody-treated cells (Fig. 4, inset, c), VSV-G was efficiently processed to the endo D-sensitive form. Thus, the
site of antibody action is before the Ca2+-dependent fusion of VTCs to the Golgi stack.
We have shown previously that VSV-G exits the ER via
COPII-coated vesicles and accumulates in VTCs when
cells are incubated at 15°C (15°C-VTCs) in vitro (Aridor
et al., 1995
). To determine if the antibody inhibits transport of VSV-G from 15°C-VTCs to the Golgi stack, semiintact cells were incubated at reduced temperature for 80 min in a complete transport cocktail (Fig. 5, circles) and
then transferred to 32°C and at the indicated time (
t) either shifted to ice (Fig. 5, closed circles) or supplemented
with antibody and incubated for a total time of 90 min
(Fig. 5, open circles). Cells incubated continuously at 15°C
did not acquire endo H resistance, which indicates minimal leakage from VTCs to the Golgi over the 190-min time
course (Fig. 5, gray circle). Control cells transferred from 15 to 32°C rapidly processed VSV-G to endo H-resistant
forms (Fig. 5, closed circles). In this case, the 10-15-min lag
period typically observed after export of VSV-G from the
ER upon shift from 39.5 to 32°C (Fig. 5, closed squares)
was completely absent (Fig. 5, closed circles), attesting to
the prior accumulation of VSV-G in post-ER intermediates at reduced temperature. Intriguingly, semiintact cells
treated with antibody before shift from 15 to 32°C failed to
process VSV-G to endo H-resistant forms (Fig. 5, open
circle, arrow). However, this sensitivity was rapidly lost. Incubation of cells at 32°C for as little as 2 min before the addition of antibody led to >60% of the total VSV-G migrating to an antibody-insensitive step. These results demonstrate that the function of p58 cannot be fulfilled in cells
incubated at 15°C. However, the rapid migration of VSVG through the antibody-sensitive step reveals that the activity of p58 is linked to an early step in VTC function during recovery at 32°C.
t) and then transferred to ice to terminate transport (closed circles), or supplemented with 10 µg antipeptide antibody at the indicated time
(
t) (open circles) and incubated for a total of 90 min. The fraction of VSV-G processed to the endo H-resistant forms was determined as described in Materials and Methods.
VSV-G Accumulates in VTCs in the Presence of the Antitail Antibody
Although it was clear that p58 was required for the transit
of VSV-G from VTCs to the Golgi stack, it remained possible that the protein was also essential for export from the
ER given its lectin-like properties (Arar et al., 1995
; Itin
et al., 1996
). To address this issue, we used a morphological assay in which NRK cells were infected with ts045
VSV-G for 3 h at 39.5°C (to restrict VSV-G to the ER)
(Fig. 6 A) (Plutner et al., 1992
). After permeabilization,
cells were incubated in the absence or presence of antibody for 45 min on ice and then transferred to 32°C for 30 min, and the distribution of VSV-G was determined by indirect immunofluorescence. Control cells incubated at
32°C in the absence of antibody efficiently transported
VSV-G to the juxtanuclear Golgi complex (Fig. 6 C). This
distribution overlapped with the typical steady-state distribution of p58 in VTCs localized predominantly to the cisGolgi region (Fig. 6, B and D). In contrast, permeabilized cells incubated in the presence of antibody largely accumulated VSV-G in numerous punctate VTCs scattered
throughout the perinuclear and peripheral cytoplasm (Fig.
6 E). VSV-G present in peripheral punctate elements
completely overlapped with that of p58 (Fig. 6 F). The antibody had no effect on the distribution of the Golgi complex as assessed by staining with Lens culinaris, which recognizes cis/medial-Golgi compartments (not shown) (Liener
et al., 1986
; Tisdale et al., 1992
). Moreover, cells incubated
at 15°C for 80 min in the presence of antibody accumulated
VSV-G in pre-Golgi VTCs (not shown). These results demonstrate that the antibody did not affect export in a manner
similar to that of the Sar1 GDP-restricted mutant, which
prevents COPII assembly and blocks exit of VSV-G from
the ER (Kuge et al., 1994
; Aridor et al., 1995
), but interfered specifically with transit from VTCs to compartments of the Golgi stack. These results are consistent with the
lack of processing of VSV-G to endo D- (Fig. 3) and endo
H- (Fig. 4) resistant forms in the presence of antibody.
The fact that the antibody caused retention of VSV-G
in punctate VTCs, which also strongly labeled for p58,
prompted us to examine if antibody-treated cells were
altered in their ability to transport p58 from these intermediates to the more typical Golgi-like steady-state distribution observed at 32°C (Fig. 6 B). Uninfected, permeabilized NRK cells were incubated in the absence (Fig. 7,
A and B) or presence (Fig. 7 C) of antibody at 15°C for 80 min to accumulate 15°C-VTCs (Aridor et al., 1995
). Cells
were subsequently shifted to 32°C for 20 min. In the absence of antibody, p58 redistributed from its punctate distribution in pre-Golgi intermediates (Fig. 7 A) to the typical perinuclear, steady-state distribution (Fig. 7 B) found
before incubation at reduced temperature (Fig. 6 B). In
contrast, antibody-treated cells retained p58 in numerous,
peripheral punctate elements (Fig. 7 C), a distribution
very similar to that observed at reduced temperature (Fig.
7 A). This result is identical to the effect of ARF1 mutants
that interfere with coatomer function (Dascher and Balch,
1994
; Aridor et al., 1995
). The apparent inability of both
VSV-G and p58 to be mobilized from VTCs raises the possibility that the antitail antibody coordinately interferes
with the transit of both anterograde and retrograde transported proteins.
Antibody to the p53/58 Cytoplasmic Domain Blocks Recruitment of COPI
Segregation of p58 from VSV-G during transit through
VTCs requires COPI (Aridor et al., 1995
). Because COPI
components bind to carboxyl-terminal di-lysine and diphenylalanine motifs (Cosson and Letourner, 1994; Fiedler and Simons, 1995
; Söhn et al., 1996
), the presence of
these residues at the cytoplasmic tail of p53/58 suggested
that the antibody may inhibit transport by interfering with
the binding of coatomer. To address this question morphologically, uninfected, permeabilized NRK cells were preincubated at 15°C for 80 min in the absence of antibody to
accumulate VTCs containing p58 (as shown in Fig. 7 A).
The cells were then incubated at 37°C for 20 min in the absence (Fig. 8 A) or presence (Fig. 8 B) of antibody. Control cells (lacking antibody) showed a typical intense staining for
-COP in the Golgi region (Duden et al., 1991
;
Oprins et al., 1993
; Aridor et al., 1995
). In contrast, cells
incubated in the presence of antibody displayed a striking
reduction in the number of
-COP-positive structures
(Fig. 8 C). A similar reduction in coatomer recruitment in
the presence of antibody was observed by incubating cells
at 32°C for 30 min without the 15°C preincubation (not
shown). The loss of
-COP-positive elements was not observed using a number of other antibodies, including several monoclonal reagents specific for the small GTPases
Rab1 (Plutner et al., 1991
; Saraste et al., 1995
) and Rab2
(Chavrier et al., 1990
), which are localized to pre-Golgi intermediates. Moreover, in the case of infected cells, a polyclonal specific to the cytoplasmic tail of VSV-G protein
had no effect on the distribution of
-COP-positive elements (not shown). Thus, the anti-p53/58 tail antibody appears to significantly modify, either directly or indirectly,
the ability of VTCs located in peripheral and Golgi adjacent sites to recruit COPI.
-COP to
membranes. Uninfected NRK cells grown on coverslips were permeabilized as described (Plutner et al., 1992
-COP was determined as described in Materials and Methods.
Antitail Antibody Inhibits the Binding of COPI to the GST-Tail Fusion Protein and to Microsomes
To assess the possible effect of antibody on coatomer recruitment by p53/58, we analyzed COPI binding to the
GST fusion protein containing the carboxyl terminus
QQEEAAKKFF residues bound to glutathione Sepharose 4B beads (GST-tail beads). GST-tail beads were incubated with rat liver cytosol, which serves as a rich source
of coatomer. After incubation, the beads were washed extensively with either a low (75 mM) or high (500 mM) saltcontaining buffer, and the unbound (low salt wash) and
bound-released protein (high salt wash) were analyzed by
SDS-PAGE and Western blotting for
-COP. Control
beads containing the GST construct alone (minus tail) did
not retain
-COP after the high-salt wash (Fig. 9 A, lanes
a-c). In contrast, GST-tail beads retained
-COP (Fig. 9 A, lane f). No binding was detected to GST-tail beads in
which the di-lysine motif in the carboxyl-tail was mutated
to serine residues (not shown). Importantly, preabsorption
of the GST-tail beads with the antitail antibody completely blocked
-COP binding (Fig. 9 A, lane i), consistent with the observation that the antibody blocks the recruitment of COPI to membranes in vivo (Fig. 8).
-COP to a GST fusion protein containing the carboxyl terminus of p53/58 and prevents the recruitment of COPI coats to microsomes. (A) GST
(lanes a-c) or a GST fusion protein containing the carboxyl terminus of p53/58 (lanes d-i) was bound to glutathione Sepharose
4B beads and preincubated in the absence (lanes a-f) or presence
(lanes g-i) of antipeptide antibody as described in Materials and
Methods. Rat liver cytosol was then added and incubated for an
additional 4 h at 4°C. In each case, the unbound fraction (lanes a,
d, and g), the low (75 mM) salt wash (lanes b, e, and h), and the
high (500 mM) salt wash (lanes c, f, and i) were prepared as described in Materials and Methods. The amount of
-COP in each
fraction was determined by Western blotting and densitometry.
(B) Microsomes were prepared from whole cell homogenates as
described in Materials and Methods, mixed with cytosol and 20 µM GTP
S, and either not incubated (lane a) or incubated for 15 min at 37°C (lanes b-g) in the absence (lanes a-c) or presence
(lanes d-g) of the indicated amount of antitail antibody. Membranes were transferred to ice and pelleted, and the amount of
-COP (arbitrary units) was determined by Western blotting and
densitometry. In lane c, membranes were omitted from the cocktail.
To examine whether we could detect a similar effect of
the antitail antibody on the recruitment of COPI to VTCs
and early Golgi compartments in vitro, membranes were
prepared from whole cell homogenates, pretreated with
a high-salt wash to remove the loosely bound coatomer,
and incubated at 37°C in the presence of cytosol, ATP, and
GTP
S, a nonhydrolyzable analog of GTP that constitutively activates the small GTPase ARF1 involved in
coatomer binding to VTCs (Aridor et al., 1995
). Previous
studies have demonstrated that coatomer present on Golgi
membranes actively involved in COPI vesicle formation is
resistant to a high-salt wash (500 mM), whereas inactive
forms can be readily removed by a low (75 mM) salt wash
(Aridor et al., 1995
; Ostermann et al., 1993
; Stamnes and
Rothman, 1993
). In the absence of antibody, GTP
S
markedly stimulated (~2.5-fold) the level of the high salt
resistant form of COPI bound to microsomes during a
brief (15 min) incubation at 37°C (Fig. 9 B, compare lane a
[ice] to lane b [15 min, 37°]). COPI appearing in the highspeed pellet after the high-salt wash was membrane dependent, as little
-COP was detected when GTP
S was
incubated with cytosol alone (Fig. 9 B, lane c). Addition of
antibody led to a dose-dependent inhibition of GTP
Sinduced coatomer binding to membranes (Fig. 9 B, lanes
d-g) to levels observed to the control level before incubation (Fig. 9 B, lane a). The amount of antibody required to
block
-COP binding to membranes was comparable to
that required to significantly inhibit protein transport in
semiintact cells (Fig. 3). No effect on coatomer binding to
membranes prepared from noninfected cells was observed with either Rab1- or Rab2-specific antibody (not shown).
The effect of the p53/58 tail antibody on
-COP recruitment supports the conclusion that displacement of COPI
from VTCs interferes with vesicular traffic and that p58
may participate at this step in such events.
We have generated and characterized a polyclonal antibody that recognizes the cytoplasmic tail of p53/58. Affinitypurified antibody detected a single protein in cell lysates
of NRK and BHK cells that comigrated with the p58 protein recognized by a previously characterized p58-specific
polyclonal antibody (Saraste et al., 1987
; Saraste and Svensson, 1991
), and a slightly lower molecular weight species
detected by a p53-specific monoclonal antibody in HeLa
cells (Schweizer et al., 1988
). Indirect immunofluorescence showed that the anti-p53/58 tail antibody stained vesicular
tubular structures located near the Golgi complex in multiple cell types. An identical pattern has been observed for
antibodies that bind to the luminal domains of p53 in human (Schweizer et al., 1988
) and p58 (Saraste and Svensson,
1991
) in rat cell lines. Although the cytoplasmic domain of
p53/58 contains a terminal di-lysine motif, GST fusion proteins that terminate with other KKXX or KXKXX retrieval motifs were not recognized by antibody. Notably,
we were unable to detect binding to a GST fusion protein
containing the cytoplasmic tail of the p24 family member
gp25l, nor were we able to detect binding of antibody to
proteins in the 20-25-kD molecular mass range on immunoblots. This region of the gel would be expected to include members of the p24 gene family, which frequently contain coatomer binding motifs (Schimmoller et al., 1995
;
Stamnes et al., 1995
; Fielder et al., 1996; Söhn et al., 1996
).
Epitope mapping led us to conclude that antibody primarily detects the terminal di-phenylalanine residues in the
context of adjacent di-lysine residues. The combined results conclusively demonstrate that the epitope recognized
by the antipeptide antibody is specific for residues found
in the p53/58 cytoplasmic tail and not other coatomerbinding proteins identified to date.
Using the antitail antibody, we have provided the first
evidence that p53/p58, a protein found in ER-derived vesicular carriers (Rowe et al., 1996
) and abundant in VTCs
(Schweizer et al., 1991
), is likely to play an important role
in the transport of cargo from the ER to the Golgi complex. Incubation in the presence of antibody or Fab fragments arrested both the anterograde transport of VSV-G
from VTCs to the Golgi stack and the recycling of p58. This result is entirely consistent with previous observations in which VTCs were found to be the first site of segregation of VSV-G and p58 (Aridor et al., 1995
; Tang et al.,
1995
) and that this sorting event involves a coupling between the disassembly of COPII coats and the assembly of
COPI coat (Aridor et al., 1995
; Rowe et al., 1996
). Although a recent report concluded that the di-phenylalanine motif present in the cytoplasmic tail of p24 family
members was required for ER export (Fielder et al., 1996), the rate of appearance of early Golgi processed forms of a
CD8-p24 tail peptide chimera is more consistent with previous results that have demonstrated that FF residues do
not affect ER export, rather the efficiency of retrieval of
p53 (Itin et al., 1995
). As such, these studies provide a separate line of evidence that the residues recognized by the
antitail antibody modulate the efficiency of coatomer interaction during recycling.
While we were able to document rigorously that the antitail antibody blocks VSV-G transport to the Golgi, its effects on p58 recycling to the ER relied on our observation
using indirect immunofluorescence, which showed that
p58 was retained and/or accumulated in VTCs in the presence of antitail antibody. This result is very similar to the
effect of ARF1 mutants that prevent proper coatomer
function (Dascher and Balch, 1994
; Aridor et al., 1995
;
Rowe et al., 1996
). The ability of the antibody to block recycling of p53/58 will need to be analyzed more rigorously
using biochemical assays that measure retrograde transport of p53/58 to the ER.
The site of p53/58 function inhibited by the antitail antibody was established by a combination of biochemical and
morphological approaches. VTCs are dynamic structures
that undergo continuous maturation (Aridor et al., 1995
)
and translocation via microtubules to the central Golgi region (Presley, J.F., N.B. Cole, and J. Lippincott-Schwartz.
1996. Mol. Biol. Cell. 7:74a). We have recently shown that
VTCs are components of a more elaborate structure, referred to as "export complexes" (Bannykh et al., 1996
),
which contain numerous COPII budding profiles facing a
central cavity housing COPI coated VTCs. VTCs accumulate
at reduced temperature (15°C) and contain enhanced levels
of p53/58. Although the antitail antibody blocked transport
of VSV-G from 15°C-VTCs to the Golgi stack, this inhibition
was lost after a brief shift from 15 to 32°C or after maturation to a later step by incubation in the absence of Ca2+
(Pind et al., 1994
). Thus, at least one aspect of p53/58 function, as measured by the effects of antibody binding to its
carboxyl tail, appears during the temporally restricted step
associated with the segregation of p53/58 from cargo during
transit through VTCs (Aridor et al., 1995
; Tang et al., 1995
).
Although the precise role of VTCs in mediating segregation of anterograde and retrograde transported protein
is unknown, we have provided a new line of evidence that
it may involve p58 in its capacity to recruit COPI. This interpretation is consistent with the presence of the KKXX
motif at the cytoplasmic tail of p53/58, a motif that has
been previously demonstrated to be involved in COPI binding (Cosson and Letourner, 1994) and in retrograde transport (Jackson et al., 1993
; Letourneur et al., 1994
). Three lines of evidence support the importance of coatomer binding to p53/58 during transit through VTCs: (a) The binding
of COPI to the GST-p53/58 tail fusion protein was sensitive to the antitail antibody; (b) the antibody markedly reduced binding of coatomer to microsomes in vitro; and (c)
-COP labeling of pre-Golgi intermediates in the peripheral and perinuclear region of permeabilized cells was
greatly reduced in the presence of antibody. The studies
on COPI recruitment used the intact polyclonal reagent
and therefore could potentially have unanticipated indirect effects. However, we have observed potent inhibition
of transport with Fab's suggestive of a direct effect, and
our results are consistent with previous observations that
both brefeldin A and a trans dominant mutant of ARF1
restricted to the GDP-bound form also inhibit COPI recruitment to VTCs, and in so doing, block both anterograde and retrograde transport (Aridor et al., 1995
).
The above results raise the surprising possibility that
p53/58 plays an important role, either directly or indirectly,
in regulating COPI binding to VTCs and early Golgi compartments. Consistent with a direct role is the observation
that p53/58 is a major protein constituent of pre-Golgi intermediates (Schweizer et al., 1990
, 1991). However, p53/58
is not unique in its ability to bind coatomer, as a number of
other proteins contain KKXX, KXKXX, or internal FF
residues that can potentially function in recruitment. At
least two members of the p24 gene family appear to be
components of COPII carrier vesicles
others have been
shown to be associated with purified COPI vesicles
(Stamnes et al., 1995
; Elrod-Erickson and Kaiser, 1996
;
Fielder et al., 1996; Söhn et al., 1996
). Because many of
these proteins may actively recycle, the marked decrease
in COPI association with membranes observed in vitro in
response to the p53/58 antitail antibody may be, in part,
due to a general block in the retrograde pathway involving these other coatomer-binding proteins. In addition, the
observation that the antibody blocks stable (high salt resistant) binding of COPI coats to microsomal membranes
may reflect the possibility that coatomer recruitment is a
combinatorial event requiring more than one protein
(Fielder et al., 1996) and that the antibody augments this
dependency.
Although the antitail antibody potently blocked transit
of VSV-G through VTCs, it did not block export of VSV-G
from the ER. It has recently been proposed that p53/58
serves as a lectin for the sorting of cargo from resident ER
proteins (Itin et al., 1995
, 1996). Consistent with this possibility is our previous observation that p53/58 is a component of ER-derived vesicular COPII carriers containing
VSV-G (Rowe et al., 1996
). p53/58 may use its luminal lectin-binding domain for protein export and its cytosolic domain for retrieval. In general, our results reinforce a
model (Aridor et al., 1995
; Rowe et al., 1996
) in which a
critical step in the segregation of anterograde and retrograde transported protein through VTCs is related to the
recruitment of COPI, a step possibly involving the function of p53/58.
Received for publication 8 August 1996 and in revised form 15 March 1997.
1. Abbreviations used in this paper: endo D and H, endoglycosidase D and H; GST, glutathione-S-transferase; NRK, normal rat kidney; VSV-G, vesicular stomatitis glycoprotein; VTC, vesicular tubular cluster.This work was supported by a grant from the National Institutes of Health (GM 42336) to W.E. Balch. E. Tisdale was a recipient of a National Institutes of Health postdoctoral fellowship (CA 09270).
-COP, a 110 kDa protein associated with non-clathrin-coated vesicles and the Golgi complex shows homology to
-adaptin.
Cell.
64:
649-665
[Medline].
-COP localizes mainly to the cis-Golgi side in exocrine pancreas.
J. Cell Biol.
121:
49-59
identification of a 58-kD cis Golgi protein.
J. Cell Biol.
105:
2021-2029
-mannosidase capable of processing asparagine-linked oligosaccharides.
J. Biol. Chem.
254:
11655-11663
and
associated calnexin are major calcium binding proteins of the endoplasmic
reticulum membrane.
J. Biol. Chem.
266:
19599-19610
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|