JCB logo
Avanti Polar Lipids, Inc.
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 2241K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miner, J. H.
Right arrow Articles by Sanes, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miner, J. H.
Right arrow Articles by Sanes, J. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?
J. Cell Biol.
© The Rockefeller University Press
0021-9525/97/05/685/17 $2.00
Volume 137, Number 3, May 5, 1997 685-701

The Laminin alpha  Chains: Expression, Developmental Transitions, and Chromosomal Locations of alpha 1-5, Identification of Heterotrimeric Laminins 8-11, and Cloning of a Novel alpha 3 Isoform

Jeffrey H. Miner,*Dagger Bruce L. Patton,* Stephen I. Lentz,§ Debra J. Gilbert,par William D. Snider,§ Nancy A. Jenkins,par Neal G. Copeland,par and Joshua R. Sanes*

* Department of Anatomy and Neurobiology, Dagger  Department of Internal Medicine (Renal Division), § Department of Neurology, Washington University School of Medicine, St. Louis, Missouri, 63110; and par  Mammalian Genetics Laboratory, ABL-Basic Research Program, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, Maryland 21702

Abstract
Materials and Methods
Results and Discussion
Footnotes
Acknowledgements
Abbreviations used in this paper
References


Abstract

Laminin trimers composed of alpha , beta , and gamma  chains are major components of basal laminae (BLs) throughout the body. To date, three alpha  chains (alpha 1-3) have been shown to assemble into at least seven heterotrimers (called laminins 1-7). Genes encoding two additional alpha  chains (alpha 4 and alpha 5) have been cloned, but little is known about their expression, and their protein products have not been identified. Here we generated antisera to recombinant alpha 4 and alpha 5 and used them to identify authentic proteins in tissue extracts. Immunoprecipitation and immunoblotting showed that alpha 4 and alpha 5 assemble into four novel laminin heterotrimers (laminins 8-11: alpha 4beta 1gamma 1, alpha 4beta 2gamma 1, alpha 5beta 1gamma 1, and alpha 5beta 2gamma 1, respectively). Using a panel of nucleotide and antibody probes, we surveyed the expression of alpha 1-5 in murine tissues. All five chains were expressed in both embryos and adults, but each was distributed in a distinct pattern at both RNA and protein levels. Overall, alpha 4 and alpha 5 exhibited the broadest patterns of expression, while expression of alpha 1 was the most restricted. Immunohistochemical analysis of kidney, lung, and heart showed that the alpha  chains were confined to extracellular matrix and, with few exceptions, to BLs. All developing and adult BLs examined contained at least one alpha  chain, all alpha  chains were present in multiple BLs, and some BLs contained two or three alpha  chains. Detailed analysis of developing kidney revealed that some individual BLs, including those of the tubule and glomerulus, changed in laminin chain composition as they matured, expressing up to three different alpha  chains and two different beta  chains in an elaborate and dynamic progression. Interspecific backcross mapping of the five alpha  chain genes revealed that they are distributed on four mouse chromosomes. Finally, we identified a novel full-length alpha 3 isoform encoded by the Lama3 gene, which was previously believed to encode only truncated chains. Together, these results reveal remarkable diversity in BL composition and complexity in BL development.


Laminins are components of all basal laminae (BLs)1 throughout the bodies of vertebrates and invertebrates. In mammals they play at least three essential roles. First, they are major structural elements of BLs, forming one of two self-assembling networks (the other is composed of the collagens IV) to which other glycoproteins and proteoglycans of the BL attach (for review see Yurchenco and O'Rear, 1994; Timpl, 1996). Second, they interact with cell surface components such as dystroglycan to attach cells to the extracellular matrix (for review see Henry and Campbell, 1996). Third, they are signaling molecules that interact with cellular receptors such as the integrins to convey morphogenetically important information to the cell's interior (for review see Clark and Brugge, 1995; Mercurio, 1995; Yamada and Miyamoto, 1995). For example, laminin promotes myogenesis in skeletal muscle, outgrowth of neurites from central and peripheral neurons, and mesenchymal to epithelial transitions in kidney (Foster et al., 1987; Klein et al., 1988; Reichardt and Tomaselli, 1991; Vachon et al., 1996).

Laminin was initially isolated from tumor cells as a heterotrimer of A, B1, and B2 subunits (Chung et al., 1979; Timpl et al., 1979), later renamed alpha 1, beta 1, and gamma 1 (Burgeson et al., 1994). Molecular cloning revealed that the three subunits were encoded by distinct but homologous genes (Martin and Timpl, 1987). Subsequently, homologues of the alpha 1 chain (merosin, or alpha 2; Ehrig et al., 1990) and the beta 1 chain (s-laminin, or beta 2; Hunter et al., 1989b) were isolated, revealing a previously unsuspected heterogeneity of laminins. Five additional laminin chains have now been identified, all of which clearly belong to the alpha , beta , or gamma  subfamilies (alpha 3-5, beta 3, and gamma 2; Kallunki et al., 1992; Ryan et al., 1994; Aberdam et al., 1994b; Richards et al., 1994; Gerecke et al., 1994; Miner et al., 1995). All native laminins isolated to date are composed of one alpha , one beta , and one gamma  chain, and seven distinct heterotrimers have been identified (for review see Engvall and Wewer, 1996). The existence of multiple chains that oligomerize with a defined stoichiometry provides a means to generate functional diversity within a common structural framework (Sanes et al., 1990).

Here we focus on the alpha  subfamily of laminin chains. This is the largest subfamily, with five members identified to date in mammals. Interactions of cells with laminin alpha  chains are critical for cell-matrix interactions. For example, at least six distinct integrin heterodimers (alpha 1beta 1, alpha 2beta 1, alpha 3beta 1, alpha 6beta 1, alpha 7beta 1, and alpha vbeta 3), as well as dystroglycan, heparin, and the adhesion molecule-associated glycoconjugate HNK-1/L2, bind to sites on laminin alpha  chains (Rao and Kefalides, 1990; Gee et al., 1993; Hall et al., 1993; Sung et al., 1993; Mercurio, 1995; Mecham and Hinek, 1996; Colognato, H., and P.D. Yurchenco. 1996. Mol. Biol. Cell. 7(Suppl.):67a). Moreover, both dystroglycan and some integrins can distinguish amongst different alpha  chains, suggesting that alpha  chain diversity is functionally significant (Mercurio, 1995; Pall et al., 1996). In direct support of this notion, mutations in two alpha  chains, alpha 2 and alpha 3, lead to congenital muscular dystrophy and junctional epidermolysis bullosa, respectively (Sunada et al., 1994; Xu et al., 1994; Helbling-Leclerc et al., 1995; McGrath et al., 1995). In Drosophila, mutation of the only known laminin alpha  chain is embryonically lethal, leading to defects in numerous tissues (Henchcliffe et al., 1993; Yarnitzky and Volk, 1995; Garcia-Alonso et al., 1996).

Despite their importance, limited information is available about the distribution of the alpha  chains (see, e.g., Engvall et al., 1990; Sanes et al., 1990; Vuolteenaho et al., 1994; Virtanen et al., 1995, 1996). Moreover, the alpha 1 chain has been studied most intensively in human tissues with a single mAb (4C7; Engvall et al., 1986, 1990) whose specificity for alpha 1 has been questioned (Ekblom, 1996). For the recently discovered alpha 4 and alpha 5 chains, no direct evidence has been presented to show that they form heterotrimers, and no data on cellular localization have been reported. Accordingly, we have generated and characterized antibodies to the alpha 4 and alpha 5 chains and used them to identify four novel laminin heterotrimers: laminin-8 (alpha 4beta 1gamma 1), laminin-9 (alpha 4beta 2gamma 1), laminin-10 (alpha 5beta 1gamma 1), and laminin-11 (alpha 5beta 2gamma 1). Using a panel of antibodies and cDNA probes, we analyzed the distribution of all five laminin alpha  chains in embryonic and adult mice. We show that the alpha  chains are expressed in overlapping but distinct patterns, with each BL containing at least one of the known alpha  chains. Moreover, we demonstrate that some individual BLs contain different complements of alpha  chains at distinct stages of their development. Finally, we identify a novel isoform of alpha 3 and report the chromosomal locations of all five alpha  chains in mice.


Materials and Methods

Isolation of cDNAs

Laminin alpha 3B. We performed the reverse transcription-coupled PCR (RT-PCR) using embryonic day (E) 17.5 mouse lung RNA and primers designed to amplify sequences encoding the NH2-terminal portion of domain VI of laminin alpha 5. Surprisingly, the reaction generated a novel 209-bp fragment that was similar but not identical to known alpha chains. We hypothesized that this fragment could be part of a laminin alpha 3B cDNA extending 5' of that reported by Galliano et al. (1995). To test this hypothesis, two primers were used in RT-PCR from adult lung RNA to attempt to amplify the potentially intervening cDNA: sense, 5'AGCGGGACCCAGAGGTC3' (from the novel product); antisense, 5'TGCCTCACAGACAATCTCACC3' (from near the 5' end of the sequence in Galliano et al. [1995]). RT-PCR conditions were as described (Miner and Sanes, 1994), with the addition of Taq Extender PCR Additive (Stratagene Cloning Systems, La Jolla, CA). A 2.2-kb fragment was sequenced with a Taq DyeDeoxy Terminator cycle sequencing kit (Applied Biosystems, Inc., Foster City, CA), and sequence was analyzed on the BLAST server at the National Center for Biotechnology Information (Altschul et al., 1990). Sequence was obtained from multiple clones to resolve errors introduced by Taq polymerase amplification.

Laminin alpha 4. A mouse laminin alpha 4 cDNA fragment was amplified by RT-PCR from E17.5 placenta using degenerate primers based on the human amino acid sequence (Richards et al., 1994). The primers, designed to amplify the mouse segment homologous to nucleotides 1,800-2,607, were: sense, 5'TCNATGATGTTYGAYGGNCARTC3'; antisense, 5'CGNCCRCTRCTRAANCCRAARTC3'. The fragment was isolated on a low melting point gel and ligated into the pCRII vector (Invitrogen, San Diego, CA). The DNA and deduced amino acid sequences were determined and have been deposited into GenBank under accession number U88352.

RNA Analyses

RNA was prepared from mouse tissues by acid guanidinium phenol/chloroform extraction (Chomczynski and Sacchi, 1987). RNase protections were performed as described (Miner and Wold, 1991) using [32P]UTP-labeled probes and 5 µg (E17.5) or 7.5 µg (adult) of total RNA per hybridization. A probe for elongation factor 1alpha was included to control for the quality and amount of input RNA. For Northern analysis, a filter containing poly(A)-selected RNA from several adult mouse tissues (Clontech, Palo Alto, CA) was hybridized according to the manufacturer's instructions. In situ hybridizations were performed with 35S-UTP-labeled probes as described (Lentz et al., 1997). The laminin alpha  chain probes used for RNase protection assays and in situ hybridizations were as described (Lentz et al., 1997).

Antibodies

Rat mAbs to mouse laminin alpha 1 (clones 198 and 200; Sorokin et al., 1992) were gifts from Lydia Sorokin (Institute for Experimental Medicine, Erlangen, Germany). A rabbit antiserum to human laminin alpha 2 cross-reactive with the mouse protein (Vachon et al., 1996) was kindly provided by Peter Yurchenco (Robert Wood Johnson Medical School, Piscataway, NJ). A rabbit antiserum to mouse laminin alpha 3 (Aberdam et al., 1994a,b) was a gift from Daniel Aberdam (INSERM U385, Nice, France). Mouse mAbs to rat laminin chains beta 1 (C21, C22), beta 2 (D7, D19, D27), and gamma 1 (D18) were produced and characterized in our laboratory and have been described previously (Sanes and Chiu, 1983; Hunter et al., 1989b; Sanes et al., 1990; Green et al., 1992). A guinea pig antiserum against a recombinant COOHterminal fragment of laminin beta 2 was produced as described (Sanes et al., 1990). A rat mAb to laminin gamma 1 was purchased from Chemicon (Temecula, CA). Second antibodies were purchased as follows: fluorescein- and HRP-conjugated goat anti-rabbit antibodies from Boehringer Mannheim Biochemicals (Indianapolis, IN); fluorescein-conjugated goat anti-rat antibodies from Cappel/Organon Teknika (Durham, NC); Cy3-conjugated goat anti-rabbit antibodies from Jackson ImmunoResearch Laboratories (West Grove, PA); biotinylated goat anti-guinea pig antibodies from Sigma Chemical Co. (St. Louis, MO).

To generate antibodies to the laminin alpha 4 and alpha 5 chains, the laminin alpha 4 cDNA described above, another containing nucleotides 3,670-4,391 (described in Lentz et al., 1997), and a laminin alpha 5 fragment comprising nucleotides 4,243-4,926 (SacI to EcoRV) were each cloned in frame into the pET 23 vector (Novagen, Madison, WI). Proteins were produced in BL21(DE3) bacteria, and inclusion bodies were isolated according to a protocol supplied by Novagen. Fusion proteins were gel isolated as described (Miner and Sanes, 1994) and used to immunize rabbits (Caltag, Healdsburg, CA). For both alpha 4 and alpha 5, two separately immunized rabbits generated antisera that displayed qualitatively similar patterns of reactivity on both sections and immunoblots. The higher titer antiserum to each immunogen was used for the studies reported here.

Immunohistochemistry

Mouse tissues were frozen fresh and sectioned at 4-8 µm on a cryostat. Antibodies were diluted in 1% (wt/vol) BSA in PBS and incubated on sections for 1-2 h. After rinsing off unbound primary antibody with PBS, secondary antibodies were applied for 1-2 h. Sections were rinsed again, and then mounted in glycerol-para-phenylenediamine and observed with epifluorescent illumination. Since the laminin alpha 4 antisera only recognized denatured antigen, the following protocol was used when staining with these antibodies: sections were fixed in 2% paraformaldehyde in PBS for 20 min, rinsed in PBS, incubated with 100 mM glycine in PBS for 10 min, incubated in 0.05% SDS in PBS for 30 min at 50°C, and then rinsed in PBS before the antibody was applied. Anti-alpha 5 stained untreated and SDS- denatured sections in qualitatively similar patterns.

Western Blots and Immunoprecipitations

For immunoblotting, tissues from rat were used because a greater range of mAbs was available against rat than against mouse laminin beta  and gamma  chains (see above). Lungs and kidneys from saline-perfused adult rats were homogenized in ice-cold 40 mM Tris, pH 7.5, 15 mM NaCl, and 2 mM CaCl2 (H buffer) containing protease inhibitors (0.1 mM PMSF, 1 mM benzamidine, and 1 µg/ml soybean trypsin inhibitor) using a Polytron. Crude membrane fractions were recovered at 20,000 g, washed once with H buffer containing PMSF, resuspended in H buffer containing 10 mM EDTA, 2 mM EGTA, PMSF, and soybean trypsin inhibitor (H+E buffer), and stored at -10°C. To improve immunoblotting sensitivity for BL components, the crude pellet was extracted by brief sonication in H+E buffer with 0.1 M NaCl and 1% Triton X-100, pelleted at 50,000 g, and resuspended in H+E buffer. However, data qualitatively similar to those presented in Results were obtained with the crude pellet. Protein content was assayed with bicinchoninic acid reagents (Pierce Chemical Co., Rockford, IL) using BSA as a standard. Purified Engelbreth-Holm-Swarm (EHS) laminin-1 was obtained from Gibco BRL (Gaithersburg, MD).

Samples were solubilized by boiling in SDS gel loading buffer with or without DTT. The proteins were then separated by SDS-PAGE and transferred to nitrocellulose using standard methods. Fusion proteins, reduced native laminins, and nonreduced native laminins were separated on 12%, 7%, and 3.5% polyacrylamide gels, respectively. After blotting, filters were blocked with nonfat dry milk/0.3% Tween-20 in PBS, and then incubated with antibodies overnight. For detecting the fusion proteins, antisera were preadsorbed to an unrelated fusion protein containing the common pET 23 leader and His tag sequences. Bound antibodies were detected with either HRP-conjugated second antibody (for rabbit) or biotinylated second antibody with HRP-conjugated Z-avidin (Zymed Laboratories, South San Francisco, CA) (for guinea pig), and Renaissance chemiluminescent substrate (DuPont/New England Nuclear, Boston, MA).

For immunoprecipitations, laminins were first partially purified from adult rat lung by the protocol of Lindblom et al. (1994), modified as follows: crude membranes were prepared as described above, and then extracted repeatedly over 12 h with 50 mM Tris, pH 7.5, 0.15 M NaCl, 10 mM EDTA, and 10 mM EGTA (TBS/EDTA). The pooled extracts were diluted to 90 mM NaCl, adjusted to pH 8.3, and loaded onto a DEAE- Sepharose CL-4B column (Pharmacia, Uppsala, Sweden). The column was eluted with 1.0 M NaCl, and fractions containing laminin beta 2 (detected by immunoblotting) were pooled and brought to 50% saturation with ammonium sulfate. Precipitated material was resuspended in TBS/EDTA, brought to 10% glycerol, 0.6 M KCl, and 0.05% Tween-20, and then fractionated on a Sepharose CL-4B column. Fractions containing laminin beta 2 were pooled and passed through CM-Sepharose CL-6B; the flow-through was resubjected to DEAE-Sepharose chromatography. Protein eluted with 0.5 M NaCl was stored at -70°C with 0.1 mM PMSF. Protein was measured by Bradford assay (Bio Rad Laboratories, Hercules, CA). SDSPAGE of this fraction under reducing conditions displayed a heterogeneous population of proteins >180 kD, along with the laminin-binding protein entactin (150 kD) as a major constituent.

Laminins were immunoprecipitated essentially by the method of Green et al. (1992), modified as follows: laminin samples were incubated with antibeta 1 mAbs (a mixture of C21 and C22) or anti-beta 2 antibodies (a mixture of D7, D19, and D27) in 50 mM Tris, pH 8.0, 100 mM NaCl, 2 mM EDTA, 1% NP-40, and 0.05% sodium deoxycholate (IP buffer). Immune complexes were isolated using protein A-Sepharose 4B (Pharmacia) that was preblocked with 4 mg/ml IgG-free BSA (Sigma Chemical Co.) and washed in IP buffer. Rabbit anti-mouse IgG (Fc) antibodies (Jackson ImmunoResearch Laboratories) were included to bridge mAbs to protein A. Precipitated laminins were dissolved by boiling in SDS-PAGE sample buffer, separated by SDS-PAGE, and then detected by Western blotting as above.

Interspecific Mouse Backcross Mapping

Interspecific backcross progeny were generated by mating (C57BL/6J × Mus spretus) F1 females and C57BL/6J males as described (Copeland and Jenkins, 1991). DNA isolation, restriction enzyme digestion, agarose gel electrophoresis, and Southern blot transfer and hybridization were performed essentially as described (Jenkins et al., 1982). All blots were prepared with Zetabind nylon membrane (Cuno, Inc., Meriden, CT). Probes, which were specific for each locus, were labeled with [32P]dCTP using a random primed labeling kit (Amersham Corp., Arlington Heights, IL) or a nick translation labeling kit (Boehringer Mannheim Biochemicals); washing was done to a final stringency of 0.8-1.0 × SSC and 0.1% SDS at 65°C. The probe and restriction fragment length polymorphisms (RFLPs) for Lama1 have been described previously (Okazaki et al., 1993). The Lama2 probe, a ~360-bp fragment of mouse cDNA from domain G, detected fragments of 10.5 kb in C57BL/6J (B) DNA and 5.4 and 4.2 kb in M. spretus (S) DNA after digestion with PstI. The Lama3 probe, a ~500-bp fragment of mouse cDNA from domains I/II, detected EcoRV fragments of 10.5 kb (B) and ~23.0 kb (S). A second probe, a genomic clone containing a portion of domain VI of laminin alpha 3B, gave results identical to those obtained with the domain I/II probe. The Lama4 probe, a ~800-bp fragment of mouse cDNA from domain G, detected BglII fragments of 4.4 and 1.7 kb (B) and 6.0 kb (S). The Lama5 probe, a ~7.5-kb fragment of mouse genomic DNA from domains V and IVb, detected BamHI fragments of 4.2, 3.7, and 3.3 kb (B) and 4.2, 3.3, 2.3, and 1.8 kb (S). The presence or absence of M. spretus-specific fragments was followed in backcross mice. A total of 205 N2 mice were used to map each Lama locus.

Descriptions of most of the probes and RFLPs for the loci used to position the Lama loci in the interspecific backcross have been reported. These include: Gnas, chromosome 2 (Wilkie et al., 1992); Myb, Fyn, and Ros1, chromosome 10 (Justice et al., 1990); Fert and Tik, chromosome 17 (Fishel et al., 1993; Okazaki et al., 1993); and Tpl2, Cdh2, and Ttr, chromosome 18 (Justice et al., 1992, 1994). One locus has not been reported previously for this interspecific backcross: the Mc3r probe, a 2.0-kb BamHI/ XhoI fragment of mouse cDNA, was kindly provided by Roger Cone (Vollum Institute, Portland, OR) and detected SphI fragments of 3.5 kb (B) and 5.9 kb (S). Recombination distances were calculated as described (Green, 1981) using the computer program SPRETUS MADNESS. Gene order was determined by minimizing the number of recombination events required to explain the allele distribution patterns.


Results and Discussion

The Laminin alpha  Chain Family: Identification of Full-Length alpha 3

The alpha  subfamily of laminin chains currently contains five members. Fig. 1 shows the domain structure of these chains based on the nomenclature of Sasaki et al. (1988). All alpha  chains contain a carboxyl-terminal globular G domain and alpha -helical domains I and II. The previously described fulllength alpha 1 and alpha 2 chains contain six additional domains (IIIa-VI) that alternate between cysteine-rich stretches containing EGF-like repeats (IIIa, IIIb, and V) and globular regions (IVa, IVb, and VI) (Engvall and Wewer, 1996). The newest member of the family, alpha 5, is also a full-length chain, but it is larger than alpha 1 or alpha 2, owing to the greater number of EGF-like repeats in domain V and a larger domain IVb (Miner et al., 1995). In contrast, laminins alpha 3A and alpha 4 are severely truncated chains that contain only a single cysteine-rich domain (IIIa) downstream of a short aminoterminal domain (Ryan et al., 1994; Galliano et al., 1995; Iivanainen et al., 1995; Richards et al., 1996). Of the vertebrate alpha  chains, alpha 5 may be most like the ancestral alpha  chain, because of its similarity in both domain structure and sequence to the only known invertebrate alpha  chain, Drosophila A (Miner et al., 1995).


Fig. 1. The laminin alpha  chain subfamily. Numbering of domains is based on accepted nomenclature (Sasaki et al., 1988; Engvall and Wewer, 1996). Numbers of laminin-type cysteine-rich (EGFlike) repeats, rounded to the nearest integer, are indicated within each domain IIIa, IIIb, or V. Note that laminins alpha 3A and alpha 3B share domains G, I/II, and IIIa but have distinct NH2 termini.
[View Larger Version of this Image (23K GIF file)]

The only laminin gene so far shown to encode more than a single polypeptide is the laminin alpha 3 gene. The two known products, alpha 3A and alpha 3B, differ at their amino termini, resulting from alternative splicing and/or alternative promoter usage. The shorter alpha 3A chain was the first to be identified by both immunological methods (Rousselle et al., 1991) and by cDNA cloning (Aberdam et al., 1994b). Subsequently, however, multiple alpha 3 cDNAs were identified in human (Ryan et al., 1994) and mouse (Galliano et al., 1995), suggesting the existence of a second, longer isoform called alpha 3B. Sequence analysis (Galliano et al., 1995) indicated that alpha 3B contains two cysteine-rich (IIIa and IIIb) and two globular (IVa and IV'') domains in addition to the G and I/II domains, but no domains V or VI. This would make it the sole "mid-sized" alpha  chain. However, we have obtained mouse cDNAs (see Materials and Methods) that extend the previously reported sequence 5' by ~2.2 kb (Fig. 2). This novel sequence encodes the NH2-terminal portion of domain IVb, a complete domain V, and what is likely all but a few amino acids of a domain VI. These domains are most similar in sequence and predicted tertiary structure to the analogous domains of laminin alpha 5. For example, the amino acid sequence of domain VI is 74% identical to that of alpha 5, but only 54 and 51% identical to those of alpha 1 and alpha 2, respectively. A probe from the 5' end of this sequence recognized ~10-kb bands on Northern blots of mouse RNA from adult brain, lung, and kidney (data not shown). The proposed alpha 3B structure is shown in Fig. 1, indicating its unique NH2 terminus and the COOH terminus it shares with alpha 3A.


Fig. 2. Nucleotide and deduced amino acid sequences of the laminin alpha 3B chain, 5' and NH2-terminal to those reported by Galliano et al. (1995). Overlapping nucleotides are in lowercase. The Galliano sequence contains a single deoxyguanosine (parentheses) not found in our sequence, which shifts the reading frame and leads to an encoded methionine (bottom line, italics). Domains are marked as in Fig. 1. This was hypothesized to be the initiator for translation. An adhesive tripeptide sequence, LRE (Hunter et al., 1989a), is indicated by bullets; another LRE is located in the G domain (Galliano et al., 1995). These sequence data are available from GenBank under accession number U88353.
[View Larger Version of this Image (86K GIF file)]

There is a discrepancy between our sequence and that of Galliano et al. (1995): a single base near the 5' end of their reported sequence is absent from our cDNAs (see last line of Fig. 2). As a result of this insertion, the methionine residue that Galliano et al. (1995) suggested to initiate translation of alpha 3B and the following amino acid are encoded in a different reading frame than is the extended sequence reported here (Fig. 2). Possible explanations for this discrepancy include a polymorphism between mouse strains, alternative splicing of exons that differ by only one base, RNA editing, sequencing error, or cDNA cloning artifact. We cannot exclude any of these possibilities, although we consider the first three unlikely and note that our sequence, derived from multiple cDNAs, generates a single uninterrupted open reading frame (~9.8 kb) extending through the region of discrepancy. Therefore, we favor the interpretation that there is no mid-sized form of laminin alpha 3, but only the severely truncated alpha 3A and the full-length alpha 3B form reported here. Full-length alpha 3B would thus contain ~3,300 amino acids and have a molecular mass of ~360 kD. Thus, the alpha subfamily of laminin chains currently consists of four long (alpha 1, alpha 2, alpha 3B, and alpha 5) and two short (alpha 3A and alpha 4) proteins.

Differential Expression of Laminin alpha  Chain Genes in Embryos and Adults

As a first step in assessing the distribution of the laminin alpha  chains, we performed RNase protection analyses on RNA isolated from a set of eight adult tissues plus a late-term (E17.5) placenta (Fig. 3 A). Laminin alpha 1 was readily detectable only in placenta, but long autoradiographic exposures revealed low levels in kidney. Laminin alpha 2 RNA was present at levels above background (yeast RNA lane) in heart, kidney, lung, muscle, and skin. Laminin alpha 3A/B was expressed primarily in lung, skin, and intestine, although very low levels of this RNA were also detectable in kidney. In contrast, laminin alpha 4 RNA was present in all tissues at low (liver) to moderate (lung) levels. Laminin alpha 5 transcripts were also easily detectable in all tissues, although levels were very low in liver. Thus, each laminin alpha  chain is expressed in a distinct pattern. Interestingly, the two most recently discovered laminins, alpha 4 and alpha 5, are the most widely expressed. The alpha 2 and alpha 3 chains show more restricted patterns of expression. In general, alpha 2 levels were highest in tissues with large mesodermally derived components (skeletal and cardiac muscle), whereas alpha 3 levels were highest in organs that are rich in epithelia (skin, intestine, and lung). The notion that alpha 2 and alpha 3 are predominantly mesodermal and epithelial products, respectively, has been proposed (Vuolteenaho et al., 1994; Aberdam et al., 1994a). Finally, expression of laminin alpha 1, the initially described alpha  chain, was the most severely restricted of the five.


Fig. 3. Ribonuclease protection analysis of laminin alpha  chain expression in (A) adult and (B) E17.5 mouse tissues. A probe for elongation factor 1alpha was used to control for the amount of input RNA in both embryos (B) and adults (not shown). Each alpha  chain is expressed in a distinct pattern in the adult and, in general, these patterns are established by birth. The alpha 5 chain is the most highly expressed, and alpha 1 is the most restricted. B, brain; I, intestine; H, heart; K, kidney; Li, liver; Lu, lung; M, skeletal muscle; S, skin; P, placenta; Y, yeast RNA. The sample of E17.5 placental RNA was included in the panel of adult RNAs to allow comparison between experiments. nd, not done.
[View Larger Version of this Image (88K GIF file)]

We next tested RNAs prepared from the same tissues but at a late fetal (E17.5) stage. In general, patterns of expression seen in the fetus were similar to those seen in adults, although levels of expression were generally higher in the fetus (Fig. 3 B). Laminin alpha 1 was again the least widely expressed alpha  chain, although its RNA was readily detected in fetal kidney as well as in placenta. Likewise, laminins alpha 2-5 were expressed at moderate to high levels in a variety of tissues, consistent with patterns seen in adults. Thus, the distinct patterns of laminin alpha  chain expression found in adult tissues are, for the most part, established before birth.

To map alpha  chain expression in younger embryos (E15.5), we used in situ hybridization. Laminin alpha 1 was detected in the kidney and in the meninges of the central nervous system (Fig. 4 a). Laminin alpha 2 was observed primarily in the developing skeletal musculature, in dorsal root ganglia, and in kidney (Fig. 4 b). Laminin alpha 3A/B was strongly expressed in skin, lung, olfactory epithelium, and the superficial layers of the tongue and palate (Fig. 4 c). Laminin alpha 4 was expressed strongly in mesenchymal tissues of the head, in dorsal root ganglia, and in intestine, and was observed diffusely in skeletal and cardiac muscle (Fig. 4 d). Finally, laminin alpha 5 was expressed in a pattern similar to alpha 3, with additional sites of expression in salivary gland, in intestine, and in the most superficial cells of the liver (Fig. 4 e).


Fig. 4. In situ hybridization of laminin alpha  chain probes to E15.5 embryo parasagittal sections. (a) alpha 1, (b) alpha 2, (c) alpha 3, (d) alpha 4, and (e) alpha 5. alpha 1 shows restricted expression in kidney and meninges (arrowheads); alpha 2 and alpha 4 show widespread expression in mesenchymal cells and derivatives as well as in dorsal root ganglia (arrowheads); and alpha 3 and alpha 5 transcripts localize primarily to epithelia. (f-h) High power views of (f) alpha 3, (g) alpha 4, and (h) alpha 5 expression in lung. alpha 3 and alpha 5 are concentrated in the epithelial lung buds, and alpha 4 to the mesenchyme. H, heart; K, kidney; L, lung; SG, salivary gland; T, tongue (muscle). Bars: (d) 1 mm; (h) 50 µm.
[View Larger Version of this Image (208K GIF file)]

When compared with the RNase protection results from E17.5 (Fig. 3 B), it is apparent that the main sites of expression are already established by E15.5: alpha 2 and alpha 4 in muscle, alpha 3 and alpha 5 in skin, and alpha 3-5 in lung. There are, however, a few differences. For example, alpha 2 is barely detectable in heart at E15.5 but is expressed strongly at E17.5; the presence of alpha 4 in heart at E15.5 suggests that there may be a developmental transition in alpha  chain expression in the heart in which alpha 4 is joined by alpha 2. In addition, a particularly interesting pattern of alpha 3-alpha 5 chain expression was observed in the lung, as shown at higher power in Fig. 4, f-h. alpha 3 and alpha 5 were confined to the epithelial lung buds at this stage, while alpha 4 was expressed only in the surrounding mesenchyme. This complementary pattern of expression suggests that these chains may play distinct roles in lung development: alpha 3 and alpha 5 in branching morphogenesis, and alpha 4 in the organization of the mesenchyme.

Identification of Laminin alpha 4 and alpha 5 Proteins

The alpha 1-3 chains were first identified by biochemical and immunochemical methods (Timpl et al., 1979; Leivo and Engvall, 1988; Rousselle et al., 1991; Carter et al., 1991; Verrando et al., 1992). In contrast, alpha 4 and alpha 5 were identified as cDNAs by molecular cloning (Richards et al., 1994; Iivanainen et al., 1995; Miner et al., 1995). Sequence analysis implies that the alpha 4 and alpha 5 cDNAs encode laminin-like proteins, but it is crucial to demonstrate this directly. To this end, we used alpha 4 and alpha 5 cDNAs to produce recombinant proteins in bacteria, and then used the proteins to generate antisera in rabbits. Each antiserum specifically recognized its immunogen on Western blots (Fig. 5 A), and immunoreactivity was removed by incubation with the corresponding fusion protein. Since alpha 3B and alpha 5 sequences are closely related (see above), we also tested anti-alpha 5 on a recombinant fragment from the corresponding domains of alpha 3B. No cross-reaction was detected (data not shown).


Fig. 5. Identification of laminin alpha 4 and alpha 5 proteins in lung and kidney. (A) Characterization of antisera. The alpha 4 and alpha 5 fusion proteins used to immunize rabbits were fractionated by SDSPAGE on 12% gels and transferred to blots. Strips were probed either with no primary antibody (lanes 1 and 4), with the anti-alpha 4 antiserum (lanes 2 and 5), or with the anti-alpha 5 antiserum (lanes 3 and 6). Each antiserum specifically recognized its cognate immunogen. (B) Solubilized and reduced crude membranes from adult rat lung and kidney and purified laminin-1 were fractionated on 7% gels and transferred to blots. Strips were probed either with anti-laminin-1 (lanes 1, 6, and 10), nonimmune (lanes 2, 7, and 11), antilaminin alpha 4 (lanes 3, 8, and 12), or anti-laminin alpha 5 (lanes 4, 5, 9, and 13). The anti-alpha 4 serum recognized a protein of ~180 kD in lung and kidney. The alpha 5 antiserum recognized several bands in lung and kidney (lanes 4 and 9), the largest of which, ~450 kD, was observed only after long exposures (lane 5, arrowheads). Neither serum recognized laminin alpha 1 (lanes 12 and 13). n.i., nonimmune serum; x, nonspecific bands seen in all lung lanes with long exposures.
[View Larger Version of this Image (54K GIF file)]

To detect laminin alpha 4 and alpha 5 proteins, we prepared extracts of adult lung and kidney; lung was chosen because it expresses both chains at high levels (Fig. 3 A), and kidney was chosen because it was the focus of immunohistochemical studies detailed below. Tissue BL proteins and purified laminin-1 (alpha 1/beta 1/gamma 1) were reduced, fractionated by gel electrophoresis, and transferred to nitrocellulose filters, which were then probed with antisera to laminins alpha 4 or alpha 5 or with an antiserum to laminin-1. Results are shown in Fig. 5 B. Anti-alpha 4 recognized an ~180-kD protein in both lung and kidney (Fig. 5 B, lanes 3 and 8). Anti-alpha 5 recognized large proteins of ~380 and ~350 kD, as well as a smaller protein of ~210 kD, in both tissues (Fig. 5 B, lanes 4 and 9). Additional specific anti-alpha 5-reactive bands of high Mr (~450 kD) were observed with longer exposure times in several experiments (Fig. 5 B, lane 5). Neither anti-alpha 4 nor anti-alpha 5 reacted with the ~400-kD alpha 1 chain of laminin-1 (Fig. 5 B, lanes 12 and 13), although this chain was readily detected by a polyclonal antiserum to laminin-1 (lane 10). Nonimmune rabbit serum was not reactive with any of the laminin chains (Fig. 5 B, lanes 2, 7, and 11). Thus, the laminin alpha 4 and alpha 5 chains are present in adult lung and kidney, and this is consistent with results of RNase protection assays (Fig. 3 A).

The Mr of the anti-alpha 4-reactive protein, ~180 kD, is consistent with the size predicted from the open reading frame of the cDNA (190 kD; Iivanainen et al., 1995; Richards et al., 1996). Likewise, the ~450-kD alpha 5 chain is of the expected size for this presumably glycosylated protein. The observation that smaller alpha 5-immunoreactive bands (380, 350, and 210 kD) are more abundant than the 450-kD species indicates that alpha 5 is subject to posttranslational cleavage. Multiple protease inhibitors were used in preparing tissue, and the relative abundance of the bands in the extracts remained constant for several weeks at 4°C. We therefore suspect that this cleavage occurred in situ, as has been reported for laminins alpha 2 and alpha 3 (Ehrig et al., 1990; Marinkovich et al., 1992a), rather than during isolation.

Cellular Distribution of Laminin alpha  Chains in Adult Tissues

The laminin alpha 1-3 chains have been shown to be associated with BLs in a variety of tissues, as have the beta  and gamma  chains. Here we asked whether alpha 4 and alpha 5 are components of BLs, and whether their expression overlaps those of the alpha 1-3 chains. In addition, we wanted to know whether all BLs contained at least one alpha  chain, as the finding of an apparently alpha -free BL might suggest the existence of additional alpha  chains. We began by using our alpha 4 and alpha 5 antisera, along with previously characterized antibodies to alpha 1-3 (see Materials and Methods), to investigate the expression patterns of the laminin alpha  chains in kidney, a tissue that contains numerous heterogeneous yet well-characterized BLs (Abrahamson et al., 1989; Sanes et al., 1990; Abrahamson and Leardkamolkarn, 1991; Abrahamson and St. John, 1993; Miner and Sanes, 1994; Virtanen et al., 1995).

Laminin alpha 1 was readily detected in the BLs of a subset of renal tubules (primarily proximal), as shown previously (Horikoshi et al., 1988; Sorokin et al., 1992). The alpha 1 chain was absent from glomerular BL but was present in the glomerular mesangium, an amorphous matrix that is one of the few sites in which laminins are present outside of a formed BL (Fig. 6 a). No alpha 1 was detectable in the BLs of arteries, veins, or capillaries. In the peripheral portion of the kidney, laminin alpha 2 was largely restricted to the mesangium, in agreement with previous studies of human kidney (Fig. 6 b; Sanes et al., 1990; Virtanen et al., 1995). At deeper levels, however, some tubules were weakly alpha 2 positive, particularly in the transitional zone between the cortex and medulla (the corticomedullary junction; Fig. 6 b, inset). Laminin alpha 3 was absent from glomeruli, tubules, and vasculature of the renal cortex (data not shown), but it was present in the epithelial BL that lines the papilla (Fig. 6 c). Laminin alpha 4 was absent from all renal, epithelial, and arterial BLs (Fig. 6 d) but was found in many capillaries of the medulla (not shown). Finally, laminin alpha 5 was detected in virtually all BLs, including those of glomeruli, arteries, and all tubules (Fig. 6 e). Thus, all five of the known alpha  chains are present in adult kidney, but each is expressed in a unique pattern.


Fig. 6. Immunohistochemical localization of laminin alpha  chains in adult mouse kidney (a-e), heart (f-j), and lung (k-o). All five alpha chains were present in adult BLs, but each chain was distributed in a distinct pattern. alpha 1 was found only in kidney mesangium and in a subset of tubular BLs (primarily proximal) (a). alpha 2 was present in mesangium (b), in a subset of corticomedullary tubular BLs (b, inset), and in cardiomyocyte BLs (g). alpha 3 was detected in kidney papillary BL (c) and in lung alveolar BL (m). alpha 4 was absent from renal cortex (d) but found in capillaries of both the renal medulla (not shown) and heart (i), and in alveolar BLs in lung (n). alpha 5 showed the most widespread expression: in all kidney BLs---glomerular, tubular, and arterial (e); in heart blood vessels and in some cardiomyocyte BLs (j); and in lung alveolar BL (o). G, glomerulus; M, mesangium; bv, blood vessel. Bar, 50 µm.
[View Larger Version of this Image (111K GIF file)]

To extend these studies, we examined two other BL-rich tissues, heart and lung. As in kidney, the laminin alpha  chains were primarily restricted to BLs, and each chain was expressed in a distinct pattern. In the heart, laminins alpha 1 and alpha 3 were undetectable (Fig. 6, f and h). Laminin alpha 2 was abundant in the myocyte BLs (Fig. 6 g), as reported previously (Leivo and Engvall, 1988; Paulsson et al., 1991), while laminin alpha 4, as in the kidney, was restricted to capillaries (Fig. 6 i). Laminin alpha 5 was present in arterioles and capillaries and was also found at low levels in many myocyte BLs (Fig. 6 j). In lung, laminin alpha 3 was present in alveolar BL (Fig. 6 m), consistent with a recent report by Virtanen et al. (1996). The alpha 5 chain was colocalized with alpha 3 in most alveolar BLs (Fig. 6 o), while laminin alpha 4 was detected in a large subset of these BLs (Fig. 6 n). The identity of the alpha 4positive BLs remains to be determined. Interestingly, however, in developing lung, protein localization mirrors the RNA localization documented above: alpha 3 and alpha 5 are concentrated in the epithelial lung buds, with alpha 4 in the mesenchyme (data not shown; Miner, J.H., manuscript in preparation). Laminins alpha 1 and alpha 2 were not detectable in lung (Fig. 6, k and l).

Several conclusions can be drawn from these results. First, all laminin alpha  chains are confined to the extracellular matrix and, with the exception of the glomerular mesangium, to BLs. Cytoplasmic deposits of laminins were not detected, nor were any laminin alpha chains present in the interstitial collagen- and fibronectin-rich matrix between tubules (in kidney) or myocytes (in heart). Second, each alpha  chain is expressed in a unique pattern. Third, each BL contains at least one alpha  chain. Fourth, BLs can contain either a single alpha  chain (e.g., alpha 5 in glomerular BL) or multiple alpha  chains (e.g., alpha 1 and alpha 5 in proximal tubular BL or alpha 3, alpha 4, and alpha 5 in some alveolar BLs). Fifth, even a single BL can vary in laminin composition along its length (e.g., alpha 1 and alpha 5 in proximal portions of tubular BL, alpha 5 in distal portions, and alpha 2 and alpha 5 at the corticomedullary junction). Sixth, as surmised from studies at the RNA level (see above), alpha 1 is most restricted in its expression, and alpha 5 is the most broadly distributed in adult BLs. Together, these results support the idea that the functional diversity of BLs is achieved in part by laminin alpha  chain diversity.

Finally, it is interesting to compare the distribution of the individual alpha  chains to that previously documented for alpha 1. Many studies, including some from our laboratory, have used the mAb 4C7 (Engvall et al., 1986) to assess the distribution of alpha 1 (Engvall et al., 1990; Sanes et al., 1990; Virtanen et al., 1995, 1996; Sewry et al., 1995; Durham and Snyder, 1995). This antibody was shown to recognize a laminin alpha  chain distinct from alpha 2 at a time when only two alpha  chains had been described (Engvall et al., 1990), but since this antibody does not recognize mouse protein, it could not be tested on bona fide laminin alpha 1 as originally isolated and cloned from the EHS tumor. 4C7-immunoreactive material is more broadly distributed than is alpha 1-immunoreactive material, as recognized by mAbs that bind to mouse laminin alpha 1 (Sorokin et al., 1992) and were used here. Interestingly, the array of BLs recognized by 4C7 most closely resembles that stained by anti-alpha 5 in heart, lung, and kidney (Fig. 6), as well as in skeletal muscle (Patton, B.L., J.H. Miner, and J.R. Sanes, unpublished results). Unfortunately, direct comparisons are not feasible because 4C7 does not recognize mouse or rat antigen, and our antialpha 5 antiserum does not recognize rabbit or human antigen. However, we speculate that 4C7 may recognize the laminin alpha 5 chain, either instead of or in addition to alpha 1.

Developmental Transitions in Laminin alpha  Chain Expression

We next used our panel of antisera to ask when developing BLs acquire their complement of laminin alpha  chains. Based on the studies of adult organs detailed above, and on the fact that laminins have been implicated as important in renal development and function (Klein et al., 1988; Noakes et al., 1995), we focused on kidney for this analysis. In fact, we found a complex and dynamic pattern of laminin alpha  chain expression in the BLs of the developing nephron. To document these results, it is first necessary to summarize the main stages of nephrogenesis (Fig. 7).


Fig. 7. Schematic summary of kidney development, and expression patterns of the laminin alpha  chains in various nephron segment BLs. The laminin alpha  and beta  chains expressed in the developing glomerular BL (GBM) and its progenitors are boxed. See text for details.
[View Larger Version of this Image (53K GIF file)]

Nephrogenesis begins when the epithelial ureteric bud grows out of the mesonephric duct, invades loose metanephric mesenchyme, and induces it to condense into a sphere (Fig. 7 A). The condensed mesenchyme then epithelializes, forming a vesicle, and secretes a BL around its periphery (Fig. 7 B). One side of the vesicle and then the other invaginates to form, successively, a comma-shaped and an S-shaped figure (Fig. 7, C and D); during this process, a blood vessel invades the primary invagination. Next, the distal portion of the S-shaped body fuses with the ureteric bud to form the tubule, and the invading vessel branches within the widening invagination to form the rudimentary capillary loops of the glomerulus (Fig. 7 E). Further ramification of the capillary loops and their enclosure by glomerular constriction lead successively to the immature and mature glomeruli (Fig. 7, F and G). Multiple waves of induction of cortical mesenchyme by the branching and lengthening ureteric bud make nephrogenesis a graded process that continues from E11 until postnatally, with newly forming nephrons just beneath the cortical surface and more mature stages at increasingly deep levels (Abrahamson, 1991; Sorokin and Ekblom, 1992; Davies, 1993).

To search for potential developmental transitions in laminin alpha  chain expression, we stained sections of E15.5 and neonatal mouse kidney with antibodies to laminins alpha 1-5. Results are summarized in Fig. 7 and examples are shown in Fig. 8. Before vesicle formation, the only BL near the cortical surface was that of the ureteric bud. This BL was rich in laminin alpha 5 (Fig. 8 a) throughout its length and also contained alpha 1 (Fig. 8 g) in the cortical portions. The first-formed BL of the nephron, that of the vesicle, contained laminins alpha 1 (not shown) and alpha 4 (Fig. 8 b). Laminin alpha 1 was detected in the BL of some but not all vesicles, suggesting that it appears after alpha 4 near the end of the vesicle stage. In the comma, alpha 1 and alpha 4 remained (Fig. 8, c and e) and were joined by alpha 5 (Fig. 8 a). At this stage, significant heterogeneity became evident within the single BL that surrounded each comma: laminin alpha 4 was present at higher levels in the tuft than in the periphery (Fig. 8 c), whereas laminin alpha 5 was clearly present in the periphery but was virtually absent from the tuft (Fig. 8 a). Thus, the BL of the tuft, which is the precursor of the glomerular BL, becomes molecularly distinct from continuous but nonglomerular stretches of BL at an early stage of nephrogenesis.


Fig. 8. Immunohistochemical analysis of laminins alpha 1, alpha 4, alpha 5, and gamma 1 in developing kidney shows the dynamic pattern of alpha  chain accumulation depicted schematically in Fig. 7. All sections are from P1 mouse kidney except c, which is from E15.5. b', c, d', f', g, and h' are double exposures of doubly labeled sections; antibodies listed first and second are shown in green and red, respectively, and regions of overlap are indicated by yellow and light orange. Single exposure companions are shown in b (for b'), d (for d'), f (for f'), and h (for h'). U, ureteric bud; V, vesicle; C, comma-shaped structure; S, S-shaped structure; CL, capillary loop; mG, maturing glomerulus; bv, blood vessel. (Arrows) Progenitors of glomerular BL. Bar, 50 µm.
[View Larger Version of this Image (66K GIF file)]

At the S-shaped stage, distinct portions of the nephron that will give rise to the glomerular filtration apparatus, Bowman's capsule, and the tubule can be distinguished. Interestingly, BLs in each of these regions bore a different complement of laminin alpha  chains. The progenitor of the glomerular BL was rich in alpha 4 and alpha 5 and contained low levels of alpha 1; the progenitor of Bowman's capsule BL was rich in all three chains; and the progenitor of the tubular BL contained abundant alpha 1, low levels of alpha 5, and no detectable alpha 4 (Fig. 8, d and f). In addition, the invading vessel, destined to generate the capillary loops of the glomerulus, was coated by a BL with yet a fourth composition: rich in alpha 4 but with no detectable alpha 1 or alpha 5.

As summarized in Fig. 7, E-G, and documented in Fig. 8, d, g, and h, each stretch of BL underwent further changes in laminin alpha  chain composition as the nephron matured. (1) In the BL of Bowman's capsule, alpha 4 declined in level by the capillary loop stage and disappeared from the capsule in the immature glomerulus. Levels of alpha 1 declined later, leaving the mature capsular BL rich in alpha 5, poor in alpha 1, and without detectable alpha 4. (2) Tubular BL became richer in alpha 5 as development proceeded. Different segments of the tubule either maintained or lost alpha 1, or acquired alpha 2, as described above (Fig. 6, a-e). (3) Arteriolar BL lost alpha 4 and acquired alpha 5 at a late stage of development. (4) The glomerular BL first lost alpha 4 and then lost alpha 1, leaving alpha 5 as the only detectable laminin alpha chain in the adult. (5) Finally, the mesangial matrix was first detectable at the capillary loop stage, where it was alpha 4 positive. Later, alpha 4 disappeared from this matrix, and alpha 1 and alpha 2 accumulated.

It is interesting to compare the laminin alpha  chain transitions in glomerular BL to those previously documented for the laminin beta  and collagen IV alpha  chains (Abrahamson and St. John, 1993; Miner and Sanes, 1994; Noakes et al., 1995; Virtanen et al., 1995). Laminin beta 1 and collagen alpha 1,2(IV) chains are present in the primitive comma and S-shaped figure BLs. At the capillary loop stage, they are joined by laminin beta 2 and collagen alpha 3-5(IV) in the developing glomerular BL. At the immature glomerulus stage, laminin beta 1 and collagen alpha 1,2(IV) levels begin to decline, leaving only laminin beta 2 and collagen alpha 3-5(IV) in the mature glomerular BL. The later appearance of alpha 5 and beta 2 raises the possibility that these two events are linked. However, the initial accumulation of laminin alpha 5 occurs at the S-shaped stage, while laminin beta 2 and collagen alpha 35(IV) do not appear until the capillary loop stage (Fig. 7, D and E). Likewise, the roughly parallel disappearance of laminins alpha 1, alpha 4, and beta 1 raises the possibility that this developmental step reflects loss of alpha 1beta 1- or alpha 4beta 1-containing trimers. However, laminin beta 1 was detectable in maturing glomerular BLs that lacked laminins alpha 1 and alpha 4 (data not shown), suggesting that elimination of these molecules is not obligatorily linked. Surprisingly, therefore, the developmental transitions in laminin alpha  and beta  chains appear to be regulated independently. If all laminin chains occur in alpha /beta /gamma trimers (see below), these results suggest that alpha 1beta 1-, alpha 1beta 2-, alpha 4beta 1-, alpha 4beta 2-, alpha 5beta 1-, and alpha 5beta 2-containing trimers are potentially present, at least transiently, in developing glomerular BL.

To determine whether the isoform transitions detected at the protein level reflected regulation of gene expression, we performed in situ hybridizations on P1 kidney sections using probes for the alpha 1-5 chains. As noted above, nephrons at all stages of development are present in a corticomedullary gradient in neonates, with the most primitive just beneath the cortical surface and the most mature at deeper levels. Laminin alpha 4 transcripts were clustered at the cortex, as expected from its early appearance in vesicular BL (Fig. 9 d). Laminin alpha 1 transcripts were detected in cortical and subcortical clusters, consistent with the expression of this chain in late vesicle, comma, and S-shaped stages (Fig. 9 a). Segments of tubules were also alpha 1 positive, and lower level expression (above background) was found throughout the kidney. Low levels of laminin alpha 5 RNA were present in the superficial layer of the cortex, consistent with the later appearance of this chain in the developing nephron. Occasional clusters that were observed are likely to be the tips of the ureteric buds that have BLs rich in alpha 5 (Fig. 9 e). Deep in the medulla, laminin alpha 5 RNA was abundant in the collecting ducts, which are derived from the alpha 5-positive ureteric bud. alpha 5 labeling was not abundant in all structures that contained the protein (e.g., capillary loop stage glomeruli), suggesting that, in some cases, alpha 5 RNA is unstable or simply present at low levels but translated efficiently. Laminin alpha 2 RNA was concentrated in the deep cortical and medullary portions of the kidney (Fig. 9 b), consistent with its localization in a subset of tubules (Fig. 6 b). Laminin alpha 3 RNA was not detectable within the renal cortex but was found at P15 in the papilla (data not shown), consistent with its protein localization in adult kidney (Fig. 6 c).


Fig. 9. In situ hybridization of laminin alpha  chain probes to P1 kidney sections. alpha 1 was observed in primitive structures in the cortex and in some tubules (a). alpha 2 was absent from the cortical structures but distributed diffusely in the interior (b). alpha 4 was detected primarily in clusters at the cortex (vesicle and comma stage nephrons) but also diffusely in the medulla (d). alpha 5 was mainly in the collecting ducts, but there were also grain clusters in the inner cortex and in the medulla (e). alpha 3 was absent (c), and a sense control was negative (f). These patterns suggest that the developmental transitions demonstrated immunohistochemically in Figs. 7 and 8 reflect, in part, developmental transitions in alpha  chain gene expression. The cortical surface of the kidney is outlined in white. Insets in a-e show higher power views of the cortex. Bars: (f) 0.5 mm; (a, inset) 0.1 mm.
[View Larger Version of this Image (151K GIF file)]

Identification of Heterotrimers Containing the Laminin alpha 4 or alpha 5 Chain

Current understanding of the structure and function of BLs is based on the assumption that all laminins are heterotrimers of alpha , beta , and gamma  subunits, covalently joined by disulfide bonds (Burgeson et al., 1994). Such trimeric structures have been demonstrated for the alpha 1-3 chains, which form laminins 1-7 (Table I), but not for alpha 4 and alpha 5. We therefore asked whether the alpha 4 and alpha 5 chains also occur as components of trimers. To this end, we fractionated proteins from lung and kidney on SDS gels under nonreducing conditions such that laminins migrate as trimers, the relative sizes of which depend on the constituent alpha , beta , and gamma  chains. Nitrocellulose blots were then probed with antibodies to alpha 4 or alpha 5 (Fig. 10 A). Both lung and kidney contained high Mr complexes that reacted with the alpha 4 (Fig. 10 A, lanes 3 and 7) or alpha 5 (lanes 4 and 8) antisera but not with nonimmune serum (lanes 2 and 6). The alpha 4 complexes were ~500-600 kD, and the alpha 5 complexes were ~700-800 kD. These values are consistent with Mrs predicted for laminin trimers. None of the alpha 4- or alpha 5-immunoreactive bands (=<450 kD) that had been seen after reduction (Fig. 5 B) were detectable under these nonreducing conditions, indicating that all of the monomeric species were associated with larger, disulfide-bonded complexes. Moreover, the approximate difference in Mr between the alpha 4- and alpha 5-containing complexes (~200 kD) is consistent with the difference in Mr between the full-length alpha 4 and alpha 5 chains themselves. An antiserum to laminin-1, which recognizes the alpha 1, beta 1, and gamma 1 chains, blotted material at the Mrs of all alpha 4- and alpha 5containing complexes (Fig. 10 A, lanes 1 and 5), whereas anti-alpha 4 and anti-alpha 5 did not recognize laminin-1 (lanes 11 and 12). Together, these results suggest that laminins alpha 4 and alpha 5 occur in heterotrimers with beta 1 and/or gamma 1 chains.

Table I. Composition of Laminin Trimers

[View Table]


Fig. 10. Biochemical identification of laminins-8, -9, -10, and -11. (A) Detection of laminin complexes containing alpha 4 and alpha 5. Crude membrane preparations from adult lung and kidney and purified laminin-1 were solubilized without reducing agent and fractionated by SDS-PAGE on 3.5% polyacrylamide gels. Proteins were transferred to nitrocellulose and probed with nonimmune (n.i.) serum (lanes 2, 6, and 10) or with antibodies to laminin-1 (lanes 1, 5, and 9), alpha 4 (lanes 3, 7, and 11), or alpha 5 (lanes 4, 8, and 12). The size of the laminin-1 trimer (~800 kD) is indicated. Lung contained at least two complexes containing alpha 4 (lane 3), while kidney contained multiple alpha 5-positive complexes (lane 8). Laminin-1 contained little or no detectable alpha 4 or alpha 5. (B) Identification of laminin trimers from adult lung. Laminins were solubilized, partially purified, and then immunoprecipitated with antibodies to laminin beta 1 (lanes 1-5), beta 2 (lanes 6-10), gamma 1 (lanes 11-13), or without primary antibody (lanes 14-18). The precipitates were then fractionated on nonreducing gels and probed without primary antibody (lanes 1, 6, 11, and 14), or with antibodies to laminins beta 2 (lanes 2, 7, and 15), alpha 4 (lanes 3, 8, 12, and 16), alpha 5 (lanes 4, 9, 13, and 17), and gamma 1 (lanes 5, 10, and 18). Four novel laminin trimers were identified: laminin-8 (alpha 4beta 1gamma 1), laminin-9 (alpha 4beta 2gamma 1), laminin-10 (alpha 5beta 1gamma 1), and laminin-11 (alpha 5beta 2gamma 1).
[View Larger Version of this Image (49K GIF file)]

To definitively identify the alpha 4- and alpha 5-containing complexes as laminin heterotrimers, we solubilized and partially purified laminins from lung. Lung was chosen for this set of experiments because, unlike kidney, it expresses both alpha 4 and alpha 5 chains at high levels in adulthood (Figs. 3 and 6). Lung homogenates were extracted with EDTA, EGTA, NaCl, and Triton X-100, and the extracts were then fractioned by a combination of ion exchange and size exclusion chromatography (see Materials and Methods). The resulting laminin-rich fraction was then subjected to immunoprecipitation with mAbs specific for laminin beta 1 or beta 2. Precipitates were separated on gels under nonreducing conditions, electroblotted onto nitrocellulose, and probed with antibodies specific for individual laminin chains (Fig. 10 B). Antibodies to laminin beta 1 precipitated a series of complexes of ~500-800 kD (Fig. 10 B, lanes 1-5). All the complexes comigrated with gamma 1 (Fig. 10 B, lane 5), but none contained beta 2 (lane 2). Individual complexes reacted with either anti-alpha 4 (Fig. 10 B, lane 3) or with anti-alpha 5 (lane 4) but not with both. Complexes containing alpha 4 had Mrs of ~500-600 kD, and those with alpha 5 had Mrs of ~700-800 kD, corresponding to Mrs of the nonreduced alpha 4 and alpha 5 complexes observed by immunoblotting crude lung samples (Fig. 10 A). Controls in which the primary antibody was omitted did not contain laminins (Fig. 10 B, lanes 14-18). Thus, the laminin alpha 4 and alpha 5 chains are both associated with beta 1 in distinct heterotrimers.

Parallel results were obtained from material precipitated by antibodies to laminin beta 2 (Fig. 10 B, lanes 6-10). All of the laminin beta 2-reactive material precipitated by these antibodies (Fig. 10 B, lane 7) reacted with anti gamma 1 (lane 10) and with either anti-alpha 4 (lane 8) or anti-alpha 5 (lane 9) but not both. Complexes containing alpha 4 had Mrs of ~500-600 kD, and those with alpha 5 had Mrs of ~700-800 kD, corresponding to those detected in crude lung samples (Fig. 10 A). Electrophoresis of the immunoprecipitates under reducing conditions revealed that the major alpha 4- and alpha 5-reactive bands detected in crude extracts (Fig. 5 B) were complexed with beta 2 (data not shown). Thus, lung also contains distinct laminin heterotrimers that include alpha 4+beta 2 and alpha 5+beta 2.

Two observations indicated that the complexes containing alpha 4beta 1, alpha 4beta 2, alpha 5beta 1, and alpha 5beta 2 also contained the gamma 1 chain. First, an mAb to gamma 1 precipitated alpha 4- and alpha 5-containing complexes (Fig. 10 B, lanes 11-13) that were equivalent in Mr to those precipitated by anti-beta 1 or anti-beta 2. Second, as noted above, anti-beta 1 and anti-beta 2 precipitated gamma 1-containing complexes that comigrated with all of the alpha 4- and alpha 5immunoreactive trimers (Fig. 10 B, lanes 5 and 10). Together, these results provide strong evidence for the existence of laminin trimers with chain compositions of alpha 4beta 1gamma 1, alpha 4beta 2gamma 1, alpha 5beta 1gamma 1, and alpha 5beta 2gamma 1. In accordance with recently adopted rules of nomenclature (Burgeson et al., 1994), these are named laminins 8-11, respectively (Table I).

Chromosomal Mapping of Lama Genes

The murine chromosomal locations of Lama1-Lama5 were determined using an interspecific backcross mapping panel derived from crosses of [(C57BL/6J × M. spretus) F1 X C57BL/6J] mice. Mouse genomic or cDNA fragments specific for each locus were used as probes in Southern blot hybridization analysis of C57BL/6J and M. spretus genomic DNA that was separately digested with several different restriction enzymes to identify informative RFLPs (see Materials and Methods). The strain distribution pattern of each RFLP in the interspecific backcross was then determined by following the presence or absence of RFLPs specific for M. spretus in backcross mice.

Backcross mapping refined previously reported chromosomal locations for Lama1-3 and provided the first data on mouse chromosomal locations of Lama4 and Lama5 (Fig. 11). Lama1 has previously been reported to map to the distal region of mouse chromosome 17 in this interspecific backcross (Okazaki et al., 1993; Doyle et al., 1996). Lama2 mapped to the proximal region of mouse chromosome 10, 4.5 centiMorgans (cM) distal of Myb and 3.9 cM proximal of Fyn. This result is in good agreement with previous studies that map Lama2 3.2 ± 1.8 cM distal of Myb on mouse chromosome 10 (Sunada et al., 1994). We have also confirmed the recent results of Aberdam et al. (1994b) and Griffith et al. (1996) by assigning Lama3 to the proximal region of chromosome 18. In our interspecific cross, Lama3 mapped 1.6 cM distal of Tpl1 and 1.1 cM proximal of Cdh2. Lama4 is linked to Lama2 on chromosome 10 and does not recombine with Fyn in 129 animals typed in common, suggesting that the two loci are within 2.3 cM of each other (upper 95% confidence limit). Finally, Lama5 mapped to the very distal region of mouse chromosome 2, 2.2 cM distal of Gnas. Thus, the five Lama loci were distributed on four different mouse autosomes, indicating that most of the Lama genes have become dispersed through evolution.


Fig. 11. Chromosomal locations of Lama loci in the mouse genome, as determined from interspecific backcross analysis. The number of recombinant N2 animals is presented over the total number of N2 animals typed to the left of the chromosome maps between each pair of loci. The recombination frequencies, expressed as genetic distance in centimorgans (± one standard error) are also shown. The upper 95% confidence limit of the recombination distance is given in parentheses when no recombinants were found between loci. Gene order was determined by minimizing the number of recombination events required to explain the allele distribution patterns. The positions of loci on human chromosomes, where known, are shown to the right of the chromosome maps. (Asterisk) The human LAMA5 gene is predicted to reside on chromosome 20q13. References for the human map positions of loci cited in this study can be obtained from GDB (Genome Data Base), a computerized database of human linkage information maintained by The William H. Welch Medical Library of The Johns Hopkins University (Baltimore, MD).
[View Larger Version of this Image (15K GIF file)]

Previous studies have shown that the Lama2 gene encodes the dystrophia muscularis (dy) mouse mutation (Sunada et al., 1994; Xu et al., 1994), but no targeted or spontaneous mouse mutants have been reported for lama1, 3, 4, or 5. Therefore, we compared our maps of mouse chromosomes 2, 10, 17, and 18 with composite mouse maps that report the map locations of many uncloned mouse mutations (obtained from the Mouse Genome Database, maintained at The Jackson Laboratory, Bar Harbor, ME). Mutations in the vicinity of the Lama genes include thin fur (thf) near the Lama1 locus; ataxia (ax), twirler (Tw), and balding (bal) near the Lama3 locus; waltzer (v) and kidney disease (kd) near the Lama4 locus; and ragged (Ra) and wasted (wst) near the Lama5 locus. For most of these mutations, the reported phenotypes are not suggestive of a BL defect. For ragged, however, the phenotype is an intriguing one. The mutation Ra shows semidominance, and the coats of heterozygotes have a thin ragged appearance. Homozygotes are naked, many die in utero, and there are internal visceral defects (Carter and Phillips, 1954; Slee, 1957). Another semidominant allele of ragged, Ra < op > (opossum) (Green and Mann, 1961), is homozygous lethal before E11, which, because of its expression in many tissues, might be expected for a Lama5 mutant. Also, since alpha 5 is expressed in the skin, a mutation may affect the function of hair follicles, which could lead to the ragged coat appearance. Moreover, the disruption of heterotrimeric laminin structure by a defective alpha  chain could explain the semidominant phenotype of both ragged alleles identified to date.

Several of the LAMA genes have also been mapped to human chromosomes (summarized in Fig. 11). LAMA1 maps to human 18p11.32-p11.22, LAMA2 to 6q22-q23, LAMA3 to 18q11.2, and LAMA4 to 6q21. LAMA1 is currently the only gene that maps to human chromosome 18 and mouse chromosome 17. Thus, LAMA1 defines a new region of homology between mouse and human chromosomes. In contrast, the mouse and human map locations of LAMA2-4 confirm and extend the known regions of homology between mouse and human chromosomes (Fig. 11; data not shown). LAMA5 has not been mapped in humans. However, the distal region of mouse chromosome 2 shares a region of homology with human chromosome 20q13, suggesting that LAMA5 will map to 20q13 in humans, as well. As noted in the Introduction, the LAMA2 gene is mutated in some congenital muscular dystrophies, and the LAMA3 gene is mutated in a subset of patients with a skin blistering disease, junctional epidermolysis bullosa. No human mutations that suggest a BL defect map to the vicinity of the human LAMA1 or LAMA4 locus or to the predicted LAMA5 locus.

Conclusion

The laminins are major components of BLs throughout the body, and their alpha  chains are ligands for most cellular laminin receptors identified to date, including at least six integrins, dystroglycan, and several glycoconjugates (see Introduction). Yet the distribution of the laminin alpha  chains has not previously been studied in detail, and the existence of the two most recently identified chains (alpha 4 and alpha 5) has been deduced from cDNA sequence but not shown directly at the protein level. We have therefore generated a panel of antibody and cDNA reagents and have used it to localize the alpha  chain genes on mouse chromosomes and the alpha  chain RNAs and proteins in developing and adult tissues. We have also identified a new isoform of laminin alpha 3 and provided direct evidence for the existence of four novel laminin heterotrimers. Our main conclusions are as follows:

(1) The alpha  subfamily of laminin genes currently consists of five members, which encode six proteins. Four (alpha 1, alpha 2, alpha 3B, and alpha 5) are full-sized chains, and two (alpha 3A and alpha 4) are truncated chains (Fig. 1). The previously hypothesized mid-sized alpha  chain (alpha 3B) may not, in fact, exist (Fig. 2).

(2) All five of the laminin alpha  chain genes are expressed in both embryos and adults, but each is expressed in a distinct pattern (Figs. 3 and 4). Their products are confined to the extracellular matrix and, with a few exceptions (e.g., the glomerular mesangium), to BLs (Fig. 6).

(3) All developing and adult BLs studied to date contain at least one of the known alpha  chains, and some contain two or three distinct alpha  chains. Although additional alpha  chains may well exist, our results provide no evidence for them and no clues as to their nature or distribution.

(4) Laminin alpha 5 is the most widely distributed alpha  chain in adult BLs, and alpha 1 is the most restricted. The alpha 2 chain is particularly abundant in mesodermally derived tissues (e.g., skeletal and cardiac muscle), and alpha 3 is concentrated in epithelial BLs. The restricted distribution of alpha 1 is inconsistent with the broad distribution of immunoreactive material recognized by a widely used mAb, 4C7. This discrepancy, together with data on the distribution of alpha 2-5, raises the possibility that 4C7 recognizes the alpha 5 chain, in addition to or instead of alpha 1.

(5) The main patterns of alpha  chain expression are established embryonically (Fig. 4), but some individual BLs change in alpha  chain composition as development proceeds. In kidney, for example, forming glomeruli express three different alpha  chains in a dynamic progression. Moreover, distinct portions of a continuous BL, such as that of the nephron, can contain distinct complements of alpha  chains, and these change during development as well (Figs. 7 and 8).

(6) Laminins alpha 1-5 all form heterotrimers with beta  and gamma  chains. At present, 11 distinct heterotrimers have been identified in mammalian cells or tissues, including at least two containing each alpha  chain (Table I). The four heterotrimers identified in this study (Fig. 10) have been named laminins-8 (alpha 4beta 1gamma 1), -9 (alpha 4beta 2gamma 1), -10 (alpha 5beta 1gamma 1), and -11 (alpha 5beta 2gamma 1).

(7) The five alpha  chain genes are distributed on four chromosomes in mouse, and probably on three chromosomes in human. The two alpha  chain genes present on a single chromosome in both species (alpha 2 and alpha 4) are not tightly linked, and two chains present on the same chromosome in humans (alpha 1 and alpha 3) are on different chromosomes in mouse (Fig. 11). Thus, there is no evidence for functionally important linkage of the alpha  chain genes.

The patterns of expression that we have documented indicate that the alpha  chains contribute importantly to the molecular diversity of BLs. Together with evidence that some cellular receptors can distinguish among alpha  chains and that naturally occurring mutations of alpha 2 and alpha 3 have tissuespecific phenotypes (see Introduction), our results suggest that differences among alpha  chains are critical to the multiplicity of roles that BLs play both during development and in maturity.

Note Added in Proof. A third alpha 3 transcript with a distinct 5' end and translation start site has now been identified by D. Aberdam and colleagues. It encodes a protein intermediate in size between the alpha 3B isoform reported here and the alpha 3A isoform described by Galliano et al. (1995). Thus, there may be three isoforms of laminin alpha 3: short (A), fulllength (B), and mid-sized (C) (Aberdam, D., personal communication).


Footnotes

Received for publication 24 December 1996 and in revised form 13 February 1997.

   Please address all correspondence to Joshua R. Sanes, Department of Anatomy and Neurobiology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110. Tel.: (314) 362-2507. Fax: (314) 747-1150.
   J.H. Miner and B.L. Patton contributed equally to this work.

We are grateful to Drs. Lydia Sorokin, Peter Yurchenco, and Daniel Aberdam for gifts of antisera and to Renate Lewis, Jeanette Cunningham, and Ellen Ryan for technical assistance. J.H. Miner was supported in part by a Damon Runyon-Walter Winchell Cancer Research Fund fellowship.

This work was supported by grants from the National Institutes of Health.


Abbreviations used in this paper

BL, basal lamina; cM, centiMorgan; E, embryonic day; EHS, Englebreth-Holm-Swarm; RFLP, restriction fragment length polymorphism; RT-PCR, reverse transcription coupled-PCR.


References

  1. Aberdam, D., A. Aguzzi, C. Baudoin, M.-F. Galliano, J.-P. Ortonne, and G. Meneguzzi. 1994a. Developmental expression of nicein adhesion protein (laminin-5) subunits suggests multiple morphogenic roles. Cell Adhes. Commun. 2: 115-129 [Medline].
  2. Aberdam, D., M.F. Galliano, M.-G. Mattei, A. Pisani-Spadafora, J.-P. Ortonne, and G. Meneguzzi. 1994b. Assignment of mouse nicein genes to chromosomes 1 and 18.  Mamm. Genome. 5: 229-233 [Medline].
  3. Abrahamson, D.R.. 1991. Glomerulogenesis in the developing kidney. Semin. Nephrol. 11: 375-389 [Medline].
  4. Abrahamson, D.R., and V. Leardkamolkarn. 1991. Development of kidney tubular basement membranes. Kidney Int. 39: 382-393 [Medline].
  5. Abrahamson, D.R., and P.L. St. John. 1993. Laminin distribution in developing glomerular basement membranes. Kidney Int. 43: 73-78 [Medline].
  6. Abrahamson, D.R., M.H. Irwin, P.L. St. John, E.W. Perry, M.A. Accavitti, L.W. Heck, and J.R. Couchman. 1989. Selective immunoreactivities of kidney basement membranes to monoclonal antibodies against laminin: localization of the end of the long arm and the short arms to discrete microdomains. J. Cell Biol. 109: 3477-3491 [Abstract/Free Full Text].
  7. Altschul, S.F., W. Gish, W. Miller, E.W. Myers, and D.J. Lipman. 1990. Basic local alignment search tool. J. Mol. Biol. 215: 403-410 [Medline].
  8. Beck, K., I. Hunter, and J. Engel. 1990. Structure and function of laminin: anatomy of a multidomain glycoprotein. FASEB (Fed. Am. Soc. Exp. Biol.) J. 4: 148-160 [Abstract].
  9. Burgeson, R.E., M. Chiquet, R. Deutzmann, P. Ekblom, J. Engel, H. Kleinman, G.R. Martin, J.-P. Ortonne, M. Paulsson, J. Sanes, et al . 1994. A new nomenclature for laminins. Matrix Biol. 14: 209-211 [Medline].
  10. Carter, T.C., and R.J.S. Phillips. 1954. Ragged, a semidominant coat texture mutant. J. Hered. 45: 151-154 [Abstract/Free Full Text].
  11. Carter, W.G., M.C. Ryan, and P.J. Gahr. 1991. Epiligrin, a new cell adhesion ligand for integrin alpha 3beta 1 in epithelial basement membranes. Cell. 65: 599-610 [Medline].
  12. Champliaud, M.-F., G.P. Lunstrum, P. Rousselle, T. Nishiyama, D.R. Keene, and R.E. Burgeson. 1996. Human amnion contains a novel laminin variant, laminin 7, which like laminin 6, covalently associates with laminin 5 to promote stable epithelial-stromal attachment. J. Cell Biol. 132: 1189-1198 [Abstract/Free Full Text].
  13. Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162: 156-159 [Medline].
  14. Chung, A.E., R. Jaffe, I.L. Freeman, J.P. Vergnes, J.E. Braginsk, and B. Carlin. 1979. Properties of a basement membrane related glycoprotein synthesized by a mouse embryonal carcinoma-derived cell line. Cell. 16: 277-287 [Medline].
  15. Clark, E.A., and J.S. Brugge. 1995. Integrins and signal transduction pathways: the road taken. Science (Wash. DC). 268: 233-239 [Abstract/Free Full Text].
  16. Copeland, N.G., and N.A. Jenkins. 1991. Development and applications of a molecular genetic linkage map of the mouse genome. Trends Genet. 7: 113-118 [Medline].
  17. Davies, J.. 1993. How to build a kidney. Semin. Cell Biol. 4: 213-219 [Medline].
  18. Doyle, J., S. Hoffman, C. Ucla, W. Reith, B. Mach, and L. Stubbs. 1996. Locations of human and mouse genes encoding the RFX1 and RFX2 transcription factor proteins. Genomics. 35: 227-230 [Medline].
  19. Durham, P.L., and J.M. Snyder. 1995. Characterization of alpha 1, beta 1, and gamma 1 laminin subunits during rabbit fetal lung development. Dev. Dyn. 203: 408-421 [Medline].
  20. Ehrig, K., I. Leivo, W.S. Argraves, E. Ruoslahti, and E. Engvall. 1990. Merosin, a tissue-specific basement membrane protein, is a laminin-like protein. Proc. Natl. Acad. Sci. USA. 87: 3264-3268 [Abstract/Free Full Text].
  21. Ekblom, P.. 1996. Receptors for laminins during epithelial morphogenesis. Curr. Opin. Cell Biol. 8: 700-706 [Medline].
  22. Engvall, E., and U.M. Wewer. 1996. Domains of laminin. J. Cell. Biochem. 61: 493-501 [Medline].
  23. Engvall, E., G.E. Davis, K. Dickerson, E. Ruoslahti, S. Varon, and M. Manthorpe. 1986. Mapping of domains in human laminin using monoclonal antibodies: localization of the neurite-promoting site. J. Cell Biol. 103: 2457-2465 [Abstract/Free Full Text].
  24. Engvall, E., D. Earwicker, T. Haaparanta, E. Ruoslahti, and J.R. Sanes. 1990. Distribution and isolation of four laminin variants; tissue restricted distribution of heterotrimers assembled from five different subunits. Cell Regul. 1: 731-740 [Medline].
  25. Fishel, R., M.K. Lescoe, M.R.S. Rao, N.G. Copeland, N.A. Jenkins, J. Garber, M. Kane, and R. Kolodner. 1993. The human mutator gene homolog MSF2 and its association with hereditary nonpolyposis colon cancer. Cell. 75: 1027-1038 [Medline].
  26. Foster, R.F., J.M. Thompson, and S.J. Kaufman. 1987. A laminin substrate promotes myogenesis in rat skeletal muscle cultures: analysis of replication and development using antidesmin and anti-BrdUrd monoclonal antibodies. Dev. Biol. 122: 11-20 [Medline].
  27. Galliano, M.-F., D. Aberdam, A. Aguzzi, J.-P. Ortonne, and G. Meneguzzi. 1995. Cloning and complete primary structure of the mouse laminin alpha 3 chain. J. Biol. Chem. 270: 21820-21826 [Abstract/Free Full Text].
  28. Garcia-Alonso, L., R.D. Fetter, and C.S. Goodman. 1996. Genetic analysis of Laminin A in Drosophila: extracellular matrix containing laminin A is required for ocellar axon pathfinding. Development (Camb.). 122: 2611-2621 [Abstract].
  29. Gee, S.H., R.W. Blacher, P.J. Douville, P.R. Provost, P.D. Yurchenco, and S. Carbonetto. 1993. Laminin-binding protein 120 from brain is closely related to the dystrophin-associated glycoprotein, dystroglycan, and binds with high affinity to the major heparin binding domain of laminin. J. Biol. Chem. 268: 14972-14980 [Abstract/Free Full Text].
  30. Gerecke, S.R., D.W. Wagman, M.F. Champliaud, and R.E. Burgeson. 1994. The complete primary structure for a novel laminin chain, the laminin B1k chain. J. Biol. Chem. 269: 11073-11080 [Abstract/Free Full Text].
  31. Green, E.L. 1981. Linkage, recombination and mapping. In Genetics and Probability in Animal Breeding Experiments. Oxford University Press, New York. 77-113.
  32. Green, E.L., and S.J. Mann. 1961. Opossum, a semi-dominant lethal mutation affecting hair and other characteristics of mice. J. Hered. 52: 223-227 [Free Full Text].
  33. Green, T.L., D.D. Hunter, W. Chan, J.P. Merlie, and J.R. Sanes. 1992. Synthesis and assembly of the synaptic cleft protein S-laminin by cultured cells. J. Biol. Chem. 267: 2014-2022 [Abstract/Free Full Text].
  34. Griffith, A.J., G.L. Radice, D.L. Burgess, D.C. Kohrman, G.M. Hansen, M.L. Justice, K.R. Johnson, M.T. Davisson, and M.H. Meisler. 1996. Location of the 9257 and ataxia mutations on mouse Chromosome 18.  Mamm. Genome. 7: 417-419 [Medline].
  35. Hall, H., L. Liu, M. Schachner, and B. Schmitz. 1993. The L2/NHK-1 carbohydrate mediates adhesion of neural cells to laminin. Eur. J. Neurosci. 5: 34-42 [Medline].
  36. Helbling-Leclerc, A., X. Zhang, H. Topaloglu, C. Cruaud, F. Tesson, J. Weissenbach, F.M. Tome, K. Schwartz, M. Fardeau, K. Tryggvason, and P. Guicheney. 1995. Mutations in the laminin alpha 2-chain gene (LAMA2) cause merosin-deficient congenital muscular dystrophy. Nat. Genet. 11: 216-218 [Medline].
  37. Henchcliffe, C., L. Garcia-Alonso, J. Tang, and C.S. Goodman. 1993. Genetic analysis of laminin A reveals diverse functions during morphogenesis in Drosophila. Development (Camb.). 118: 325-337 [Abstract].
  38. Henry, M.D., and K.P. Campbell. 1996. Dystroglycan---an extracellular matrix receptor linked to the cytoskeleton. Curr. Opin. Cell Biol. 8: 625-631 [Medline].
  39. Horikoshi, S., H. Koide, and T. Shirai. 1988. Monoclonal antibodies against laminin A chain and B chain in the human and mouse kidneys. Lab. Invest. 58: 532-538 [Medline].
  40. Hunter, D.D., B.E. Porter, J.W. Bulock, S.P. Adams, J.P. Merlie, and J.R. Sanes. 1989a. Primary sequence of a motor neuron-selective adhesive site in the synaptic basal lamina protein S-laminin. Cell. 59: 905-913 [Medline].
  41. Hunter, D.D., V. Shah, J.P. Merlie, and J.R. Sanes. 1989b. A laminin-like adhesive protein concentrated in the synaptic cleft of the neuromuscular junction. Nature (Lond.). 338: 229-234 [Medline].
  42. Iivanainen, A., K. Sainio, H. Sariola, and K. Tryggvason. 1995. Primary structure and expression of a novel human laminin alpha 4 chain. FEBS Lett. 365: 183-188 [Medline].
  43. Jenkins, N.A., N.G. Copeland, B.A. Taylor, and B.K. Lee. 1982. Organization, distribution, and stability of endogenous ecotropic murine leukemia virus DNA sequences in chromosomes of Mus musculus. J. Virol. 43: 26-36 [Abstract/Free Full Text].
  44. Justice, M.J., L.D. Siracusa, D.J. Gilbert, N. Heisterkamp, J. Groffen, K. Chada, C.M. Silan, N.G. Copeland, and N.A. Jenkins. 1990. A genetic linkage map of mouse chromosome 10: localization of eighteen molecular markers using a single interspecific backcross. Genetics. 125: 855-866 [Abstract].
  45. Justice, M.J., D.J. Gilbert, K.W. Kinzler, B. Vogelstein, A.M. Buchberg, J.D. Ceci, Y. Matsuda, V.M. Chapman, C. Patriotis, A. Makris, et al . 1992. A molecular genetic linkage map of mouse chromosome 18 reveals extensive linkage conservation with human chromosomes 5 and 18.  Genomics. 13: 1281-1288 [Medline].
  46. Justice, M.J., H.C. Morse III, N.A. Jenkins, and N.G. Copeland. 1994. Identification of Evi-3, a novel common site of retroviral integration in mouse AKXD B-cell lymphomas. J. Virol. 68: 1293-1300 [Abstract/Free Full Text].
  47. Kallunki, P., K. Sainio, R. Eddy, M. Byers, T. Kallunki, H. Sariola, K. Beck, H. Hirvonen, T.B. Shows, and K. Tryggvason. 1992. A truncated laminin chain homologous to the B2 chain: structure, spatial expression, and chromosomal assignment. J. Cell Biol. 119: 679-693 [Abstract/Free Full Text].
  48. Klein, G., M. Langegger, R. Timpl, and P. Ekblom. 1988. Role of laminin A chain in the development of epithelial cell polarity. Cell. 55: 331-341 [Medline].
  49. Leivo, I., and E. Engvall. 1988. Merosin, a protein specific for basement membranes of Schwann cell, striated muscle, and trophoblast, is expressed late in nerve and muscle development. Proc. Natl. Acad. Sci. USA. 85: 1544-1548 [Abstract/Free Full Text].
  50. Lentz, S.I., J.H. Miner, J.R. Sanes, and W.D. Snider. 1997. Distribution of the ten known laminin chains in the pathways and targets of developing sensory axons. J. Comp. Neurol. 378: 547-561 [Medline].
  51. Lindblom, A., T. Marsh, C. Fauser, J. Engel, and M. Paulsson. 1994. Characterization of native laminin from bovine kidney and comparison with other laminin variants. Eur. J. Biochem. 219: 383-392 [Medline].
  52. Marinkovich, M.P., G.P. Lunstrum, and R.E. Burgeson. 1992a. The anchoring filament protein kalinin is synthesized and secreted as a high molecular weight precursor. J. Biol. Chem. 267: 17900-17906 [Abstract/Free Full Text].
  53. Marinkovich, M.P., G.P. Lunstrum, D.R. Keene, and R.E. Burgeson. 1992b. The dermal-epidermal junction of human skin contains a novel laminin variant. J. Cell Biol. 119: 695-703 [Abstract/Free Full Text].
  54. Martin, G.R., and R. Timpl. 1987. Laminin and other basement membrane components. Annu. Rev. Cell Biol. 3: 57-85 .
  55. McGrath, J.A., S. Kivirikko, S. Ciatti, C. Moss, G.S. Dunnill, R.A. Eady, C.H. Rodeck, A.M. Christiano, and J. Uitto. 1995. A homozygous nonsense mutation in the alpha 3 chain gene of laminin 5 (LAMA3) in Herlitz junctional epidermolysis bullosa: prenatal exclusion in a fetus at risk. Genomics. 29: 282-284 [Medline].
  56. Mecham, R.P., and A. Hinek. 1996. Non-integrin laminin receptors. In The Laminins. P. Ekblom and R. Timpl, editors. Harwood Academic Publishers, Amsterdam. 159-183.
  57. Mercurio, A.M.. 1995. Laminin receptors: achieving specificity through cooperation. Trends Cell Biol. 5: 419-423 . [Medline]
  58. Miner, J.H., and J.R. Sanes. 1994. Collagen IV alpha 3, alpha 4, and alpha 5 chains in rodent basal laminae: sequence, distribution, association with laminins, and developmental switches. J. Cell Biol. 127: 879-891 [Abstract/Free Full Text].
  59. Miner, J.H., and B.J. Wold. 1991. c-myc inhibition of MyoD and myogenin-initiated myogenic differentiation. Mol. Cell. Biol. 11: 2842-2851 [Abstract/Free Full Text].
  60. Miner, J.H., R.M. Lewis, and J.R. Sanes. 1995. Molecular cloning of a novel laminin chain, alpha 5, and widespread expression in adult mouse tissues. J. Biol. Chem. 270: 28523-28526 [Abstract/Free Full Text].
  61. Noakes, P.G., J.H. Miner, M. Gautam, J.M. Cunningham, J.R. Sanes, and J.P. Merlie. 1995. The renal glomerulus of mice lacking s-laminin/laminin beta 2: nephrosis despite molecular compensation by laminin beta 1. Nat. Genet. 10: 400-406 [Medline].
  62. Okazaki, T., B.N. Yoshida, K.B. Avraham, H. Wang, C.W. Wuenschell, N.A. Jenkins, N.G. Copeland, D.J. Anderson, and N. Mori. 1993. Molecular diversity of the SCG10/Stathmin gene family in the mouse. Genomics. 18: 360-373 [Medline].
  63. Pall, E.A., K.M. Bolton, and J.M. Ervasti. 1996. Differential heparin inhibition of skeletal muscle alpha-dystroglycan binding to laminins. J. Biol. Chem. 271: 3817-3821 [Abstract/Free Full Text].
  64. Paulsson, M., K. Saladin, and E. Engvall. 1991. The 300-kDa chains of murine and bovine heart laminin are related to the human placenta merosin heavy chain and replace the A chain in some laminin variants. J. Biol. Chem. 266: 17545-17551 [Abstract/Free Full Text].
  65. Rao, C.N., and N.A. Kefalides. 1990. Identification and characterization of a 43 kilodalton laminin fragment from the "A" chain (long arm) with high-affinity heparin binding and mammary epithelial cell adhesion-spreading activities. Biochemistry. 29: 6768-6777 [Medline].
  66. Reichardt, L.F., and K.J. Tomaselli. 1991. Extracellular matrix molecules and their receptors: functions in neural development. Annu. Rev. Neurosci. 14: 531-570 [Medline].
  67. Richards, A.J., L. Al-Imara, N.P. Carter, J.C. Lloyd, M.A. Leversha, and F.M. Pope. 1994. Localization of the gene (LAMA4) to chromosome 6q21 and isolation of a partial cDNA encoding a variant laminin A chain. Genomics. 22: 237-239 [Medline].
  68. Richards, A., L. Al-Imara, and F.M. Pope. 1996. The complete cDNA sequence of laminin alpha 4 and its relationship to the other human laminin alpha  chains. Eur. J. Biochem. 238: 813-821 [Medline].
  69. Rousselle, P., G.P. Lunstrum, D.R. Keene, and R.E. Burgeson. 1991. Kalinin: an epithelium-specific basement membrane adhesion molecule that is a component of anchoring filaments. J. Cell Biol. 114: 567-576 [Abstract/Free Full Text].
  70. Ryan, M.C., R. Tizard, D.R. VanDevanter, and W.G. Carter. 1994. Cloning of the LamA3 gene encoding the alpha 3 chain of the adhesive ligand epiligrin. J. Biol. Chem. 269: 22779-22787 [Abstract/Free Full Text].
  71. Sanes, J.R., and A.Y. Chiu. 1983. The basal lamina of the neuromuscular junction. Cold Spring Harbor Symp. Quant. Biol. 48: 667-678 .
  72. Sanes, J.R., E. Engvall, R. Butkowski, and D.D. Hunter. 1990. Molecular heterogeneity of basal laminae: isoforms of laminin and collagen IV at the neuromuscular junction and elsewhere. J. Cell Biol. 111: 1685-1699 [Abstract/Free Full Text].
  73. Sasaki, M., H.K. Kleinman, H. Huber, R. Deutzmann, and Y. Yamada. 1988. Laminin, a multidomain protein: the A chain has a unique globular domain and homology with the basement membrane proteoglycan and the laminin B chains. J. Biol. Chem. 263: 16536-16544 [Abstract/Free Full Text].
  74. Sewry, C.A., M. Chevallay, and F.M.S. Tome. 1995. Expression of laminin subunits in human fetal skeletal muscle. Histochem. J. 27: 497-504 [Medline].
  75. Slee, J.. 1957. The morphology and development of ragged---a mutant affecting the skin and hair of the house mouse. II. Genetics, embryology and gross juvenile morphology. J. Genet. 55: 570-584 .
  76. Sorokin, L., and P. Ekblom. 1992. Development of tubular and glomerular cells of the kidney. Kidney Int. 41: 657-664 [Medline].
  77. Sorokin, L.M., S. Conzelmann, P. Ekblom, C. Battaglia, M. Aumailley, and R. Timpl. 1992. Monoclonal antibodies against laminin A chain fragment E3 and their effects on binding to cells and proteoglycan and on kidney development. Exp. Cell Res. 201: 137-144 [Medline].
  78. Sunada, Y., S.M. Bernier, C.A. Kozak, Y. Yamada, and K.P. Campbell. 1994. Deficiency of merosin in dystrophic dy mice and genetic linkage of laminin M chain gene to dy locus. J. Biol. Chem. 269: 13729-13732 [Abstract/Free Full Text].
  79. Sung, U., J.J. O'Rear, and P.D. Yurchenco. 1993. Cell and heparin binding in the distal long arm of laminin: identification of active and cryptic sites with recombinant and hybrid glycoprotein. J. Cell Biol. 123: 1255-1268 [Abstract/Free Full Text].
  80. Timpl, R.. 1996. Macromolecular organization of basement membranes. Curr. Opin. Cell Biol. 8: 618-624 [Medline].
  81. Timpl, R., H. Rhode, P.G. Robey, S.I. Rennard, J.M. Foidart, and G.R. Martin. 1979. Laminin---A glycoprotein from basement membranes. J. Biol. Chem. 254: 9933-9937 [Abstract/Free Full Text].
  82. Vachon, P.H., F. Loechel, H. Xu, U.M. Wewer, and E. Engvall. 1996. Merosin and laminin in myogenesis; specific requirement for merosin in myotube stability and survival. J. Cell Biol. 134: 1483-1497 [Abstract/Free Full Text].
  83. Verrando, P., O. Partouche, A. Pisani, and J.-P. Ortonne. 1992. The 6/2 (AA3) polyclonal antibody identifying a 37 kD keratinocyte protein reacts also with BM-600/nicein, the basement membrane component bound by the monoclonal antibody GB3. Exp. Derm. 1: 52-58 [Medline].
  84. Virtanen, I., L. Laitinen, and M. Korhonen. 1995. Differential expression of laminin polypeptides in developing and adult human kidney. J. Histochem. Cytochem. 43: 621-628 [Abstract].
  85. Virtanen, I., A. Laitinen, T. Tani, P. Paakko, L.A. Laitinen, R.E. Burgeson, and V.-P. Lehto. 1996. Differential expression of laminins and their integrin receptors in developing and adult human lung. Am. J. Respir. Cell Mol. Biol. 15: 184-196 [Abstract].
  86. Vuolteenaho, R., M. Nissinen, K. Sainio, M. Byers, R. Eddy, H. Hirvonen, T.B. Shows, H. Sariola, E. Engvall, and K. Tryggvason. 1994. Human laminin M chain (merosin): complete primary structure, chromosomal assignment, and expression of the M and A chain in human fetal tissues. J. Cell Biol. 124: 381-394 [Abstract/Free Full Text].
  87. Wilkie, T.M., D.J. Gilbert, A.S. Olsen, X.-N. Chen, T.T. Amatruda, J.R. Korenberg, B.J. Trask, P. de Jong, R.R. Reed, M.I. Simon, et al . 1992. Evolution of the mammalian G protein alpha  subunit multigene family. Nat. Genet. 1: 85-91 [Medline].
  88. Xu, H., X.-R. Wu, U.M. Wewer, and E. Engvall. 1994. Murine muscular dystrophy caused by a mutation in the laminin alpha 2 (Lama2) gene. Nat. Genet. 8: 297-302 [Medline].
  89. Yamada, K.M., and S. Miyamoto. 1995. Integrin transmembrane signaling and cytoskeletal control. Curr. Opin. Cell Biol. 7: 681-689 [Medline].
  90. Yarnitzky, T., and T. Volk. 1995. Laminin is required for heart, somatic muscles, and gut development in the Drosophila embryo. Dev. Biol. 169: 609-618 [Medline].
  91. Yurchenco, P.D., and J.J. O'Rear. 1994. Basal lamina assembly. Curr. Opin. Cell Biol. 6: 674-681 [Medline].

Copyright © 1997 by The Rockefeller University Press.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 2241K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Miner, J. H.
Right arrow Articles by Sanes, J. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Miner, J. H.
Right arrow Articles by Sanes, J. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents