Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

This Article Abstract Full Text (PDF, 2241K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JCB Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Miner, J. H. Articles by Sanes, J. R. Search for Related Content PubMed PubMed Citation Articles by Miner, J. H. Articles by Sanes, J. R. Pubmed/NCBI databases Gene GEO Profiles HomoloGene OMIM Protein UniGene Substance via MeSH Social Bookmarking                            What's this?

© The Rockefeller University Press, 0021-9525/1997//685 $5.00
The Journal of Cell Biology, Volume 137, Number 3, , 1997 685-701

The Laminin Chains: Expression, Developmental Transitions, and Chromosomal Locations of 1-5, Identification of Heterotrimeric Laminins 8–11, and Cloning of a Novel 3 Isoform

Jeffrey H. Miner^*,, Bruce L. Patton^*, Stephen I. Lentz, Debra J. Gilbert^||, William D. Snider, Nancy A. Jenkins^||, Neal G. Copeland^||, and Joshua R. Sanes^*

^* Department of Anatomy and Neurobiology, Department of Internal Medicine (Renal Division), Department of Neurology, Washington University School of Medicine, St. Louis, Missouri, 63110; and ^|| Mammalian Genetics Laboratory, ABL-Basic Research Program, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, Maryland 21702

Laminin trimers composed of , β, and chains are major components of basal laminae (BLs) throughout the body. To date, three chains (1–3) have been shown to assemble into at least seven heterotrimers (called laminins 1–7). Genes encoding two additional chains (4 and 5) have been cloned, but little is known about their expression, and their protein products have not been identified. Here we generated antisera to recombinant 4 and 5 and used them to identify authentic proteins in tissue extracts. Immunoprecipitation and immunoblotting showed that 4 and 5 assemble into four novel laminin heterotrimers (laminins 8–11: 4β11, 4β21, 5β11, and 5β21, respectively). Using a panel of nucleotide and antibody probes, we surveyed the expression of 1-5 in murine tissues. All five chains were expressed in both embryos and adults, but each was distributed in a distinct pattern at both RNA and protein levels. Overall, 4 and 5 exhibited the broadest patterns of expression, while expression of 1 was the most restricted. Immunohistochemical analysis of kidney, lung, and heart showed that the chains were confined to extracellular matrix and, with few exceptions, to BLs. All developing and adult BLs examined contained at least one chain, all chains were present in multiple BLs, and some BLs contained two or three chains. Detailed analysis of developing kidney revealed that some individual BLs, including those of the tubule and glomerulus, changed in laminin chain composition as they matured, expressing up to three different chains and two different β chains in an elaborate and dynamic progression. Interspecific backcross mapping of the five chain genes revealed that they are distributed on four mouse chromosomes. Finally, we identified a novel full-length 3 isoform encoded by the Lama3 gene, which was previously believed to encode only truncated chains. Together, these results reveal remarkable diversity in BL composition and complexity in BL development.

Abbreviations used in this paper: BL, basal lamina; cM, centiMorgan; E, embryonic day; EHS, Englebreth-Holm-Swarm; RFLP, restriction fragment length polymorphism; RT-PCR, reverse transcription coupled–PCR.

Laminins are components of all basal laminae (BLs)¹ throughout the bodies of vertebrates and invertebrates. In mammals they play at least three essential roles. First, they are major structural elements of BLs, forming one of two self-assembling networks (the other is composed of the collagens IV) to which other glycoproteins and proteoglycans of the BL attach (for review see Yurchenco and O'Rear, 1994; Timpl, 1996). Second, they interact with cell surface components such as dystroglycan to attach cells to the extracellular matrix (for review see Henry and Campbell, 1996). Third, they are signaling molecules that interact with cellular receptors such as the integrins to convey morphogenetically important information to the cell's interior (for review see Clark and Brugge, 1995; Mercurio, 1995; Yamada and Miyamoto, 1995). For example, laminin promotes myogenesis in skeletal muscle, outgrowth of neurites from central and peripheral neurons, and mesenchymal to epithelial transitions in kidney (Foster et al., 1987; Klein et al., 1988; Reichardt and Tomaselli, 1991; Vachon et al., 1996).

Laminin was initially isolated from tumor cells as a heterotrimer of A, B1, and B2 subunits (Chung et al., 1979; Timpl et al., 1979), later renamed 1, β1, and 1 (Burgeson et al., 1994). Molecular cloning revealed that the three subunits were encoded by distinct but homologous genes (Martin and Timpl, 1987). Subsequently, homologues of the 1 chain (merosin, or 2; Ehrig et al., 1990) and the β1 chain (s-laminin, or β2; Hunter et al., 1989b) were isolated, revealing a previously unsuspected heterogeneity of laminins. Five additional laminin chains have now been identified, all of which clearly belong to the , β, or subfamilies (3–5, β3, and 2; Kallunki et al., 1992; Ryan et al., 1994; Aberdam et al., 1994b; Richards et al., 1994; Gerecke et al., 1994; Miner et al., 1995). All native laminins isolated to date are composed of one , one β, and one chain, and seven distinct heterotrimers have been identified (for review see Engvall and Wewer, 1996). The existence of multiple chains that oligomerize with a defined stoichiometry provides a means to generate functional diversity within a common structural framework (Sanes et al., 1990).

Here we focus on the subfamily of laminin chains. This is the largest subfamily, with five members identified to date in mammals. Interactions of cells with laminin chains are critical for cell–matrix interactions. For example, at least six distinct integrin heterodimers (1β1, 2β1, 3β1, 6β1, 7β1, and vβ3), as well as dystroglycan, heparin, and the adhesion molecule–associated glycoconjugate HNK-1/L2, bind to sites on laminin chains (Rao and Kefalides, 1990; Gee et al., 1993; Hall et al., 1993; Sung et al., 1993; Mercurio, 1995; Mecham and Hinek, 1996; Colognato, H., and P.D. Yurchenco. 1996. Mol. Biol. Cell. 7(Suppl.):67a). Moreover, both dystroglycan and some integrins can distinguish amongst different chains, suggesting that chain diversity is functionally significant (Mercurio, 1995; Pall et al., 1996). In direct support of this notion, mutations in two chains, 2 and 3, lead to congenital muscular dystrophy and junctional epidermolysis bullosa, respectively (Sunada et al., 1994; Xu et al., 1994; Helbling-Leclerc et al., 1995; McGrath et al., 1995). In Drosophila, mutation of the only known laminin chain is embryonically lethal, leading to defects in numerous tissues (Henchcliffe et al., 1993; Yarnitzky and Volk, 1995; Garcia-Alonso et al., 1996).

Despite their importance, limited information is available about the distribution of the chains (see, e.g., Engvall et al., 1990; Sanes et al., 1990; Vuolteenaho et al., 1994; Virtanen et al., 1995, 1996). Moreover, the 1 chain has been studied most intensively in human tissues with a single mAb (4C7; Engvall et al., 1986, 1990) whose specificity for 1 has been questioned (Ekblom, 1996). For the recently discovered 4 and 5 chains, no direct evidence has been presented to show that they form heterotrimers, and no data on cellular localization have been reported. Accordingly, we have generated and characterized antibodies to the 4 and 5 chains and used them to identify four novel laminin heterotrimers: laminin-8 (4β11), laminin-9 (4β21), laminin-10 (5β11), and laminin-11 (5β21). Using a panel of antibodies and cDNA probes, we analyzed the distribution of all five laminin chains in embryonic and adult mice. We show that the chains are expressed in overlapping but distinct patterns, with each BL containing at least one of the known chains. Moreover, we demonstrate that some individual BLs contain different complements of chains at distinct stages of their development. Finally, we identify a novel isoform of 3 and report the chromosomal locations of all five chains in mice.

	Materials and Methods

Top Abstract Materials and Methods Results and Discussion Note Added in Proof: References

 
Isolation of cDNAs
Laminin 3B.
We performed the reverse transcription–coupled PCR (RT-PCR) using embryonic day (E) 17.5 mouse lung RNA and primers designed to amplify sequences encoding the NH₂-terminal portion of domain VI of laminin 5. Surprisingly, the reaction generated a novel 209-bp fragment that was similar but not identical to known chains. We hypothesized that this fragment could be part of a laminin 3B cDNA extending 5' of that reported by Galliano et al. (1995). To test this hypothesis, two primers were used in RT-PCR from adult lung RNA to attempt to amplify the potentially intervening cDNA: sense, 5'AGCGGGACCCAGAGGTC3' (from the novel product); antisense, 5'TGCCTCACAGACAATCTCACC3' (from near the 5' end of the sequence in Galliano et al. [1995]). RT-PCR conditions were as described (Miner and Sanes, 1994), with the addition of Taq Extender PCR Additive (Stratagene Cloning Systems, La Jolla, CA). A 2.2-kb fragment was sequenced with a Taq DyeDeoxy Terminator cycle sequencing kit (Applied Biosystems, Inc., Foster City, CA), and sequence was analyzed on the BLAST server at the National Center for Biotechnology Information (Altschul et al., 1990). Sequence was obtained from multiple clones to resolve errors introduced by Taq polymerase amplification.

Laminin 4.
A mouse laminin 4 cDNA fragment was amplified by RT-PCR from E17.5 placenta using degenerate primers based on the human amino acid sequence (Richards et al., 1994). The primers, designed to amplify the mouse segment homologous to nucleotides 1,800–2,607, were: sense, 5'TCNATGATGTTYGAYGGNCARTC3'; antisense, 5'CGNCCRCTRCTRAANCCRAARTC3'. The fragment was isolated on a low melting point gel and ligated into the pCRII vector (Invitrogen, San Diego, CA). The DNA and deduced amino acid sequences were determined and have been deposited into GenBank under accession number U88352.

RNA Analyses
RNA was prepared from mouse tissues by acid guanidinium phenol/chloroform extraction (Chomczynski and Sacchi, 1987). RNase protections were performed as described (Miner and Wold, 1991) using [³²P]UTP-labeled probes and 5 µg (E17.5) or 7.5 µg (adult) of total RNA per hybridization. A probe for elongation factor 1 was included to control for the quality and amount of input RNA. For Northern analysis, a filter containing poly(A)-selected RNA from several adult mouse tissues (Clontech, Palo Alto, CA) was hybridized according to the manufacturer's instructions. In situ hybridizations were performed with ³⁵S-UTP–labeled probes as described (Lentz et al., 1997). The laminin chain probes used for RNase protection assays and in situ hybridizations were as described (Lentz et al., 1997).

Antibodies
Rat mAbs to mouse laminin 1 (clones 198 and 200; Sorokin et al., 1992) were gifts from Lydia Sorokin (Institute for Experimental Medicine, Erlangen, Germany). A rabbit antiserum to human laminin 2 cross-reactive with the mouse protein (Vachon et al., 1996) was kindly provided by Peter Yurchenco (Robert Wood Johnson Medical School, Piscataway, NJ). A rabbit antiserum to mouse laminin 3 (Aberdam et al., 1994a,b) was a gift from Daniel Aberdam (INSERM U385, Nice, France). Mouse mAbs to rat laminin chains β1 (C21, C22), β2 (D7, D19, D27), and 1 (D18) were produced and characterized in our laboratory and have been described previously (Sanes and Chiu, 1983; Hunter et al., 1989b; Sanes et al., 1990; Green et al., 1992). A guinea pig antiserum against a recombinant COOHterminal fragment of laminin β2 was produced as described (Sanes et al., 1990). A rat mAb to laminin 1 was purchased from Chemicon (Temecula, CA). Second antibodies were purchased as follows: fluorescein- and HRP-conjugated goat anti–rabbit antibodies from Boehringer Mannheim Biochemicals (Indianapolis, IN); fluorescein-conjugated goat anti–rat antibodies from Cappel/Organon Teknika (Durham, NC); Cy3-conjugated goat anti–rabbit antibodies from Jackson ImmunoResearch Laboratories (West Grove, PA); biotinylated goat anti–guinea pig antibodies from Sigma Chemical Co. (St. Louis, MO).

To generate antibodies to the laminin 4 and 5 chains, the laminin 4 cDNA described above, another containing nucleotides 3,670–4,391 (described in Lentz et al., 1997), and a laminin 5 fragment comprising nucleotides 4,243–4,926 (SacI to EcoRV) were each cloned in frame into the pET 23 vector (Novagen, Madison, WI). Proteins were produced in BL21(DE3) bacteria, and inclusion bodies were isolated according to a protocol supplied by Novagen. Fusion proteins were gel isolated as described (Miner and Sanes, 1994) and used to immunize rabbits (Caltag, Healdsburg, CA). For both 4 and 5, two separately immunized rabbits generated antisera that displayed qualitatively similar patterns of reactivity on both sections and immunoblots. The higher titer antiserum to each immunogen was used for the studies reported here.

Immunohistochemistry
Mouse tissues were frozen fresh and sectioned at 4–8 µm on a cryostat. Antibodies were diluted in 1% (wt/vol) BSA in PBS and incubated on sections for 1–2 h. After rinsing off unbound primary antibody with PBS, secondary antibodies were applied for 1–2 h. Sections were rinsed again, and then mounted in glycerol-para-phenylenediamine and observed with epifluorescent illumination. Since the laminin 4 antisera only recognized denatured antigen, the following protocol was used when staining with these antibodies: sections were fixed in 2% paraformaldehyde in PBS for 20 min, rinsed in PBS, incubated with 100 mM glycine in PBS for 10 min, incubated in 0.05% SDS in PBS for 30 min at 50°C, and then rinsed in PBS before the antibody was applied. Anti-5 stained untreated and SDS- denatured sections in qualitatively similar patterns.

Western Blots and Immunoprecipitations
For immunoblotting, tissues from rat were used because a greater range of mAbs was available against rat than against mouse laminin β and chains (see above). Lungs and kidneys from saline-perfused adult rats were homogenized in ice-cold 40 mM Tris, pH 7.5, 15 mM NaCl, and 2 mM CaCl₂ (H buffer) containing protease inhibitors (0.1 mM PMSF, 1 mM benzamidine, and 1 µg/ml soybean trypsin inhibitor) using a Polytron. Crude membrane fractions were recovered at 20,000 g, washed once with H buffer containing PMSF, resuspended in H buffer containing 10 mM EDTA, 2 mM EGTA, PMSF, and soybean trypsin inhibitor (H+E buffer), and stored at –10°C. To improve immunoblotting sensitivity for BL components, the crude pellet was extracted by brief sonication in H+E buffer with 0.1 M NaCl and 1% Triton X-100, pelleted at 50,000 g, and resuspended in H+E buffer. However, data qualitatively similar to those presented in Results were obtained with the crude pellet. Protein content was assayed with bicinchoninic acid reagents ( Pierce Chemical Co., Rockford, IL) using BSA as a standard. Purified Engelbreth-Holm-Swarm (EHS) laminin-1 was obtained from Gibco BRL (Gaithersburg, MD).

Samples were solubilized by boiling in SDS gel loading buffer with or without DTT. The proteins were then separated by SDS-PAGE and transferred to nitrocellulose using standard methods. Fusion proteins, reduced native laminins, and nonreduced native laminins were separated on 12%, 7%, and 3.5% polyacrylamide gels, respectively. After blotting, filters were blocked with nonfat dry milk/0.3% Tween-20 in PBS, and then incubated with antibodies overnight. For detecting the fusion proteins, antisera were preadsorbed to an unrelated fusion protein containing the common pET 23 leader and His tag sequences. Bound antibodies were detected with either HRP-conjugated second antibody (for rabbit) or biotinylated second antibody with HRP-conjugated Z-avidin ( Zymed Laboratories, South San Francisco, CA) (for guinea pig), and Renaissance chemiluminescent substrate ( DuPont/ New England Nuclear, Boston, MA).

For immunoprecipitations, laminins were first partially purified from adult rat lung by the protocol of Lindblom et al. (1994), modified as follows: crude membranes were prepared as described above, and then extracted repeatedly over 12 h with 50 mM Tris, pH 7.5, 0.15 M NaCl, 10 mM EDTA, and 10 mM EGTA (TBS/EDTA). The pooled extracts were diluted to 90 mM NaCl, adjusted to pH 8.3, and loaded onto a DEAE– Sepharose CL-4B column ( Pharmacia, Uppsala, Sweden). The column was eluted with 1.0 M NaCl, and fractions containing laminin β2 (detected by immunoblotting) were pooled and brought to 50% saturation with ammonium sulfate. Precipitated material was resuspended in TBS/EDTA, brought to 10% glycerol, 0.6 M KCl, and 0.05% Tween-20, and then fractionated on a Sepharose CL-4B column. Fractions containing laminin β2 were pooled and passed through CM–Sepharose CL-6B; the flow-through was resubjected to DEAE–Sepharose chromatography. Protein eluted with 0.5 M NaCl was stored at –70°C with 0.1 mM PMSF. Protein was measured by Bradford assay (Bio Rad Laboratories, Hercules, CA). SDSPAGE of this fraction under reducing conditions displayed a heterogeneous population of proteins >180 kD, along with the laminin-binding protein entactin (150 kD) as a major constituent.

Laminins were immunoprecipitated essentially by the method of Green et al. (1992), modified as follows: laminin samples were incubated with antiβ1 mAbs (a mixture of C21 and C22) or anti-β2 antibodies (a mixture of D7, D19, and D27) in 50 mM Tris, pH 8.0, 100 mM NaCl, 2 mM EDTA, 1% NP-40, and 0.05% sodium deoxycholate (IP buffer). Immune complexes were isolated using protein A–Sepharose 4B ( Pharmacia) that was preblocked with 4 mg/ml IgG-free BSA ( Sigma Chemical Co.) and washed in IP buffer. Rabbit anti–mouse IgG (Fc) antibodies (Jackson ImmunoResearch Laboratories) were included to bridge mAbs to protein A. Precipitated laminins were dissolved by boiling in SDS-PAGE sample buffer, separated by SDS-PAGE, and then detected by Western blotting as above.

Interspecific Mouse Backcross Mapping
Interspecific backcross progeny were generated by mating (C57BL/6J x Mus spretus) F1 females and C57BL/6J males as described (Copeland and Jenkins, 1991). DNA isolation, restriction enzyme digestion, agarose gel electrophoresis, and Southern blot transfer and hybridization were performed essentially as described (Jenkins et al., 1982). All blots were prepared with Zetabind nylon membrane (Cuno, Inc., Meriden, CT). Probes, which were specific for each locus, were labeled with [³²P]dCTP using a random primed labeling kit ( Amersham Corp., Arlington Heights, IL) or a nick translation labeling kit ( Boehringer Mannheim Biochemicals); washing was done to a final stringency of 0.8–1.0 x SSC and 0.1% SDS at 65°C. The probe and restriction fragment length polymorphisms (RFLPs) for Lama1 have been described previously (Okazaki et al., 1993). The Lama2 probe, a 360-bp fragment of mouse cDNA from domain G, detected fragments of 10.5 kb in C57BL/6J (B) DNA and 5.4 and 4.2 kb in M. spretus (S) DNA after digestion with PstI. The Lama3 probe, a 500-bp fragment of mouse cDNA from domains I/II, detected EcoRV fragments of 10.5 kb (B) and 23.0 kb (S). A second probe, a genomic clone containing a portion of domain VI of laminin 3B, gave results identical to those obtained with the domain I/II probe. The Lama4 probe, a 800-bp fragment of mouse cDNA from domain G, detected BglII fragments of 4.4 and 1.7 kb (B) and 6.0 kb (S). The Lama5 probe, a 7.5-kb fragment of mouse genomic DNA from domains V and IVb, detected BamHI fragments of 4.2, 3.7, and 3.3 kb (B) and 4.2, 3.3, 2.3, and 1.8 kb (S). The presence or absence of M. spretus–specific fragments was followed in backcross mice. A total of 205 N₂ mice were used to map each Lama locus.

Descriptions of most of the probes and RFLPs for the loci used to position the Lama loci in the interspecific backcross have been reported. These include: Gnas, chromosome 2 (Wilkie et al., 1992); Myb, Fyn, and Ros1, chromosome 10 (Justice et al., 1990); Fert and Tik, chromosome 17 (Fishel et al., 1993; Okazaki et al., 1993); and Tpl2, Cdh2, and Ttr, chromosome 18 (Justice et al., 1992, 1994). One locus has not been reported previously for this interspecific backcross: the Mc3r probe, a 2.0-kb BamHI/ XhoI fragment of mouse cDNA, was kindly provided by Roger Cone (Vollum Institute, Portland, OR) and detected SphI fragments of 3.5 kb (B) and 5.9 kb (S). Recombination distances were calculated as described (Green, 1981) using the computer program SPRETUS MADNESS. Gene order was determined by minimizing the number of recombination events required to explain the allele distribution patterns.

	Results and Discussion

Top Abstract Materials and Methods Results and Discussion Note Added in Proof: References

 
The Laminin Chain Family: Identification of Full-Length 3
The subfamily of laminin chains currently contains five members. Fig. 1 shows the domain structure of these chains based on the nomenclature of Sasaki et al. (1988). All chains contain a carboxyl-terminal globular G domain and -helical domains I and II. The previously described fulllength 1 and 2 chains contain six additional domains (IIIa–VI) that alternate between cysteine-rich stretches containing EGF-like repeats (IIIa, IIIb, and V) and globular regions (IVa, IVb, and VI) (Engvall and Wewer, 1996). The newest member of the family, 5, is also a full-length chain, but it is larger than 1 or 2, owing to the greater number of EGF-like repeats in domain V and a larger domain IVb (Miner et al., 1995). In contrast, laminins 3A and 4 are severely truncated chains that contain only a single cysteine-rich domain (IIIa) downstream of a short aminoterminal domain (Ryan et al., 1994; Galliano et al., 1995; Iivanainen et al., 1995; Richards et al., 1996). Of the vertebrate chains, 5 may be most like the ancestral chain, because of its similarity in both domain structure and sequence to the only known invertebrate chain, Drosophila A (Miner et al., 1995).

View larger version (16K): [in this window] [in a new window] [Download PPT slide]   Figure 1 The laminin chain subfamily. Numbering of domains is based on accepted nomenclature (Sasaki et al., 1988; Engvall and Wewer, 1996). Numbers of laminin-type cysteine-rich (EGFlike) repeats, rounded to the nearest integer, are indicated within each domain IIIa, IIIb, or V. Note that laminins 3A and 3B share domains G, I/II, and IIIa but have distinct NH2 termini.

View larger version (49K): [in this window] [in a new window] [Download PPT slide]   Figure 2 Nucleotide and deduced amino acid sequences of the laminin 3B chain, 5' and NH2-terminal to those reported by Galliano et al. (1995). Overlapping nucleotides are in lowercase. The Galliano sequence contains a single deoxyguanosine (parentheses) not found in our sequence, which shifts the reading frame and leads to an encoded methionine (bottom line, italics). Domains are marked as in Fig. 1. This was hypothesized to be the initiator for translation. An adhesive tripeptide sequence, LRE (Hunter et al., 1989a), is indicated by bullets; another LRE is located in the G domain (Galliano et al., 1995). These sequence data are available from GenBank under accession number U88353.

Differential Expression of Laminin Chain Genes in Embryos and Adults
As a first step in assessing the distribution of the laminin chains, we performed RNase protection analyses on RNA isolated from a set of eight adult tissues plus a late-term (E17.5) placenta (Fig. 3 A). Laminin 1 was readily detectable only in placenta, but long autoradiographic exposures revealed low levels in kidney. Laminin 2 RNA was present at levels above background (yeast RNA lane) in heart, kidney, lung, muscle, and skin. Laminin 3A/B was expressed primarily in lung, skin, and intestine, although very low levels of this RNA were also detectable in kidney. In contrast, laminin 4 RNA was present in all tissues at low (liver) to moderate (lung) levels. Laminin 5 transcripts were also easily detectable in all tissues, although levels were very low in liver. Thus, each laminin chain is expressed in a distinct pattern. Interestingly, the two most recently discovered laminins, 4 and 5, are the most widely expressed. The 2 and 3 chains show more restricted patterns of expression. In general, 2 levels were highest in tissues with large mesodermally derived components (skeletal and cardiac muscle), whereas 3 levels were highest in organs that are rich in epithelia (skin, intestine, and lung). The notion that 2 and 3 are predominantly mesodermal and epithelial products, respectively, has been proposed (Vuolteenaho et al., 1994; Aberdam et al., 1994a). Finally, expression of laminin 1, the initially described chain, was the most severely restricted of the five.

View larger version (37K): [in this window] [in a new window] [Download PPT slide]   Figure 3 Ribonuclease protection analysis of laminin chain expression in (A) adult and (B) E17.5 mouse tissues. A probe for elongation factor 1 was used to control for the amount of input RNA in both embryos (B) and adults (not shown). Each chain is expressed in a distinct pattern in the adult and, in general, these patterns are established by birth. The 5 chain is the most highly expressed, and 1 is the most restricted. B, brain; I, intestine; H, heart; K, kidney; Li, liver; Lu, lung; M, skeletal muscle; S, skin; P, placenta; Y, yeast RNA. The sample of E17.5 placental RNA was included in the panel of adult RNAs to allow comparison between experiments. nd, not done.

To map chain expression in younger embryos (E15.5), we used in situ hybridization. Laminin 1 was detected in the kidney and in the meninges of the central nervous system (Fig. 4 a). Laminin 2 was observed primarily in the developing skeletal musculature, in dorsal root ganglia, and in kidney (Fig. 4 b). Laminin 3A/B was strongly expressed in skin, lung, olfactory epithelium, and the superficial layers of the tongue and palate (Fig. 4 c). Laminin 4 was expressed strongly in mesenchymal tissues of the head, in dorsal root ganglia, and in intestine, and was observed diffusely in skeletal and cardiac muscle (Fig. 4 d). Finally, laminin 5 was expressed in a pattern similar to 3, with additional sites of expression in salivary gland, in intestine, and in the most superficial cells of the liver (Fig. 4 e).

View larger version (100K): [in this window] [in a new window] [Download PPT slide]   Figure 4 In situ hybridization of laminin chain probes to E15.5 embryo parasagittal sections. (a) 1, (b) 2, (c) 3, (d) 4, and (e) 5. 1 shows restricted expression in kidney and meninges (arrowheads); 2 and 4 show widespread expression in mesenchymal cells and derivatives as well as in dorsal root ganglia (arrowheads); and 3 and 5 transcripts localize primarily to epithelia. (f–h) High power views of (f) 3, (g) 4, and (h) 5 expression in lung. 3 and 5 are concentrated in the epithelial lung buds, and 4 to the mesenchyme. H, heart; K, kidney; L, lung; SG, salivary gland; T, tongue (muscle). Bars: (d) 1 mm; (h) 50 µm.

Identification of Laminin 4 and 5 Proteins
The 1–3 chains were first identified by biochemical and immunochemical methods (Timpl et al., 1979; Leivo and Engvall, 1988; Rousselle et al., 1991; Carter et al., 1991; Verrando et al., 1992). In contrast, 4 and 5 were identified as cDNAs by molecular cloning (Richards et al., 1994; Iivanainen et al., 1995; Miner et al., 1995). Sequence analysis implies that the 4 and 5 cDNAs encode laminin-like proteins, but it is crucial to demonstrate this directly. To this end, we used 4 and 5 cDNAs to produce recombinant proteins in bacteria, and then used the proteins to generate antisera in rabbits. Each antiserum specifically recognized its immunogen on Western blots (Fig. 5 A), and immunoreactivity was removed by incubation with the corresponding fusion protein. Since 3B and 5 sequences are closely related (see above), we also tested anti-5 on a recombinant fragment from the corresponding domains of 3B. No cross-reaction was detected (data not shown).

View larger version (23K): [in this window] [in a new window] [Download PPT slide]   Figure 5 Identification of laminin 4 and 5 proteins in lung and kidney. (A) Characterization of antisera. The 4 and 5 fusion proteins used to immunize rabbits were fractionated by SDSPAGE on 12% gels and transferred to blots. Strips were probed either with no primary antibody (lanes 1 and 4), with the anti-4 antiserum (lanes 2 and 5), or with the anti-5 antiserum (lanes 3 and 6). Each antiserum specifically recognized its cognate immunogen. (B) Solubilized and reduced crude membranes from adult rat lung and kidney and purified laminin-1 were fractionated on 7% gels and transferred to blots. Strips were probed either with anti–laminin-1 (lanes 1, 6, and 10), nonimmune (lanes 2, 7, and 11), antilaminin 4 (lanes 3, 8, and 12), or anti-laminin 5 (lanes 4, 5, 9, and 13). The anti-4 serum recognized a protein of 180 kD in lung and kidney. The 5 antiserum recognized several bands in lung and kidney (lanes 4 and 9), the largest of which, 450 kD, was observed only after long exposures (lane 5, arrowheads). Neither serum recognized laminin 1 (lanes 12 and 13). n.i., nonimmune serum; x, nonspecific bands seen in all lung lanes with long exposures.

The M_r of the anti-4–reactive protein, 180 kD, is consistent with the size predicted from the open reading frame of the cDNA (190 kD; Iivanainen et al., 1995; Richards et al., 1996). Likewise, the 450-kD 5 chain is of the expected size for this presumably glycosylated protein. The observation that smaller 5-immunoreactive bands (380, 350, and 210 kD) are more abundant than the 450-kD species indicates that 5 is subject to posttranslational cleavage. Multiple protease inhibitors were used in preparing tissue, and the relative abundance of the bands in the extracts remained constant for several weeks at 4°C. We therefore suspect that this cleavage occurred in situ, as has been reported for laminins 2 and 3 (Ehrig et al., 1990; Marinkovich et al., 1992a), rather than during isolation.

Cellular Distribution of Laminin Chains in Adult Tissues
The laminin 1–3 chains have been shown to be associated with BLs in a variety of tissues, as have the β and chains. Here we asked whether 4 and 5 are components of BLs, and whether their expression overlaps those of the 1–3 chains. In addition, we wanted to know whether all BLs contained at least one chain, as the finding of an apparently -free BL might suggest the existence of additional chains. We began by using our 4 and 5 antisera, along with previously characterized antibodies to 1–3 (see Materials and Methods), to investigate the expression patterns of the laminin chains in kidney, a tissue that contains numerous heterogeneous yet well-characterized BLs (Abrahamson et al., 1989; Sanes et al., 1990; Abrahamson and Leardkamolkarn, 1991; Abrahamson and St. John, 1993; Miner and Sanes, 1994; Virtanen et al., 1995).

Laminin 1 was readily detected in the BLs of a subset of renal tubules (primarily proximal), as shown previously (Horikoshi et al., 1988; Sorokin et al., 1992). The 1 chain was absent from glomerular BL but was present in the glomerular mesangium, an amorphous matrix that is one of the few sites in which laminins are present outside of a formed BL (Fig. 6 a). No 1 was detectable in the BLs of arteries, veins, or capillaries. In the peripheral portion of the kidney, laminin 2 was largely restricted to the mesangium, in agreement with previous studies of human kidney (Fig. 6 b; Sanes et al., 1990; Virtanen et al., 1995). At deeper levels, however, some tubules were weakly 2 positive, particularly in the transitional zone between the cortex and medulla (the corticomedullary junction; Fig. 6 b, inset). Laminin 3 was absent from glomeruli, tubules, and vasculature of the renal cortex (data not shown), but it was present in the epithelial BL that lines the papilla (Fig. 6 c). Laminin 4 was absent from all renal, epithelial, and arterial BLs (Fig. 6 d) but was found in many capillaries of the medulla (not shown). Finally, laminin 5 was detected in virtually all BLs, including those of glomeruli, arteries, and all tubules (Fig. 6 e). Thus, all five of the known chains are present in adult kidney, but each is expressed in a unique pattern.

View larger version (61K): [in this window] [in a new window] [Download PPT slide]   Figure 6 Immunohistochemical localization of laminin chains in adult mouse kidney (a–e), heart (f–j), and lung (k–o). All five chains were present in adult BLs, but each chain was distributed in a distinct pattern. 1 was found only in kidney mesangium and in a subset of tubular BLs (primarily proximal) (a). 2 was present in mesangium (b), in a subset of corticomedullary tubular BLs (b, inset), and in cardiomyocyte BLs (g). 3 was detected in kidney papillary BL (c) and in lung alveolar BL (m). 4 was absent from renal cortex (d) but found in capillaries of both the renal medulla (not shown) and heart (i), and in alveolar BLs in lung (n). 5 showed the most widespread expression: in all kidney BLs—glomerular, tubular, and arterial (e); in heart blood vessels and in some cardiomyocyte BLs (j); and in lung alveolar BL (o). G, glomerulus; M, mesangium; bv, blood vessel. Bar, 50 µm.

Several conclusions can be drawn from these results. First, all laminin chains are confined to the extracellular matrix and, with the exception of the glomerular mesangium, to BLs. Cytoplasmic deposits of laminins were not detected, nor were any laminin chains present in the interstitial collagen– and fibronectin-rich matrix between tubules (in kidney) or myocytes (in heart). Second, each chain is expressed in a unique pattern. Third, each BL contains at least one chain. Fourth, BLs can contain either a single chain (e.g., 5 in glomerular BL) or multiple chains (e.g., 1 and 5 in proximal tubular BL or 3, 4, and 5 in some alveolar BLs). Fifth, even a single BL can vary in laminin composition along its length (e.g., 1 and 5 in proximal portions of tubular BL, 5 in distal portions, and 2 and 5 at the corticomedullary junction). Sixth, as surmised from studies at the RNA level (see above), 1 is most restricted in its expression, and 5 is the most broadly distributed in adult BLs. Together, these results support the idea that the functional diversity of BLs is achieved in part by laminin chain diversity.

Finally, it is interesting to compare the distribution of the individual chains to that previously documented for 1. Many studies, including some from our laboratory, have used the mAb 4C7 (Engvall et al., 1986) to assess the distribution of 1 (Engvall et al., 1990; Sanes et al., 1990; Virtanen et al., 1995, 1996; Sewry et al., 1995; Durham and Snyder, 1995). This antibody was shown to recognize a laminin chain distinct from 2 at a time when only two chains had been described (Engvall et al., 1990), but since this antibody does not recognize mouse protein, it could not be tested on bona fide laminin 1 as originally isolated and cloned from the EHS tumor. 4C7-immunoreactive material is more broadly distributed than is 1-immunoreactive material, as recognized by mAbs that bind to mouse laminin 1 (Sorokin et al., 1992) and were used here. Interestingly, the array of BLs recognized by 4C7 most closely resembles that stained by anti-5 in heart, lung, and kidney (Fig. 6), as well as in skeletal muscle (Patton, B.L., J.H. Miner, and J.R. Sanes, unpublished results). Unfortunately, direct comparisons are not feasible because 4C7 does not recognize mouse or rat antigen, and our anti5 antiserum does not recognize rabbit or human antigen. However, we speculate that 4C7 may recognize the laminin 5 chain, either instead of or in addition to 1.

Developmental Transitions in Laminin Chain Expression
We next used our panel of antisera to ask when developing BLs acquire their complement of laminin chains. Based on the studies of adult organs detailed above, and on the fact that laminins have been implicated as important in renal development and function (Klein et al., 1988; Noakes et al., 1995), we focused on kidney for this analysis. In fact, we found a complex and dynamic pattern of laminin chain expression in the BLs of the developing nephron. To document these results, it is first necessary to summarize the main stages of nephrogenesis (Fig. 7).

View larger version (32K): [in this window] [in a new window] [Download PPT slide]   Figure 7 Schematic summary of kidney development, and expression patterns of the laminin chains in various nephron segment BLs. The laminin and β chains expressed in the developing glomerular BL (GBM) and its progenitors are boxed. See text for details.

To search for potential developmental transitions in laminin chain expression, we stained sections of E15.5 and neonatal mouse kidney with antibodies to laminins 1–5. Results are summarized in Fig. 7 and examples are shown in Fig. 8. Before vesicle formation, the only BL near the cortical surface was that of the ureteric bud. This BL was rich in laminin 5 (Fig. 8 a) throughout its length and also contained 1 (Fig. 8 g) in the cortical portions. The first-formed BL of the nephron, that of the vesicle, contained laminins 1 (not shown) and 4 (Fig. 8 b). Laminin 1 was detected in the BL of some but not all vesicles, suggesting that it appears after 4 near the end of the vesicle stage. In the comma, 1 and 4 remained (Fig. 8, c and e) and were joined by 5 (Fig. 8 a). At this stage, significant heterogeneity became evident within the single BL that surrounded each comma: laminin 4 was present at higher levels in the tuft than in the periphery (Fig. 8 c), whereas laminin 5 was clearly present in the periphery but was virtually absent from the tuft (Fig. 8 a). Thus, the BL of the tuft, which is the precursor of the glomerular BL, becomes molecularly distinct from continuous but nonglomerular stretches of BL at an early stage of nephrogenesis.

View larger version (84K): [in this window] [in a new window] [Download PPT slide]   Figure 8 Immunohistochemical analysis of laminins 1, 4, 5, and 1 in developing kidney shows the dynamic pattern of chain accumulation depicted schematically in Fig. 7. All sections are from P1 mouse kidney except c, which is from E15.5. b', c, d', f', g, and h' are double exposures of doubly labeled sections; antibodies listed first and second are shown in green and red, respectively, and regions of overlap are indicated by yellow and light orange. Single exposure companions are shown in b (for b'), d (for d'), f (for f'), and h (for h'). U, ureteric bud; V, vesicle; C, comma-shaped structure; S, S-shaped structure; CL, capillary loop; mG, maturing glomerulus; bv, blood vessel. (Arrows) Progenitors of glomerular BL. Bar, 50 µm.

As summarized in Fig. 7, E–G, and documented in Fig. 8, d, g, and h, each stretch of BL underwent further changes in laminin chain composition as the nephron matured. (1) In the BL of Bowman's capsule, 4 declined in level by the capillary loop stage and disappeared from the capsule in the immature glomerulus. Levels of 1 declined later, leaving the mature capsular BL rich in 5, poor in 1, and without detectable 4. (2) Tubular BL became richer in 5 as development proceeded. Different segments of the tubule either maintained or lost 1, or acquired 2, as described above (Fig. 6, a–e). (3) Arteriolar BL lost 4 and acquired 5 at a late stage of development. (4) The glomerular BL first lost 4 and then lost 1, leaving 5 as the only detectable laminin chain in the adult. (5) Finally, the mesangial matrix was first detectable at the capillary loop stage, where it was 4 positive. Later, 4 disappeared from this matrix, and 1 and 2 accumulated.

It is interesting to compare the laminin chain transitions in glomerular BL to those previously documented for the laminin β and collagen IV chains (Abrahamson and St. John, 1993; Miner and Sanes, 1994; Noakes et al., 1995; Virtanen et al., 1995). Laminin β1 and collagen 1,2(IV) chains are present in the primitive comma and S-shaped figure BLs. At the capillary loop stage, they are joined by laminin β2 and collagen 3-5(IV) in the developing glomerular BL. At the immature glomerulus stage, laminin β1 and collagen 1,2(IV) levels begin to decline, leaving only laminin β2 and collagen 3-5(IV) in the mature glomerular BL. The later appearance of 5 and β2 raises the possibility that these two events are linked. However, the initial accumulation of laminin 5 occurs at the S-shaped stage, while laminin β2 and collagen 35(IV) do not appear until the capillary loop stage (Fig. 7, D and E). Likewise, the roughly parallel disappearance of laminins 1, 4, and β1 raises the possibility that this developmental step reflects loss of 1β1- or 4β1-containing trimers. However, laminin β1 was detectable in maturing glomerular BLs that lacked laminins 1 and 4 (data not shown), suggesting that elimination of these molecules is not obligatorily linked. Surprisingly, therefore, the developmental transitions in laminin and β chains appear to be regulated independently. If all laminin chains occur in /β/ trimers (see below), these results suggest that 1β1-, 1β2-, 4β1-, 4β2-, 5β1-, and 5β2-containing trimers are potentially present, at least transiently, in developing glomerular BL.

To determine whether the isoform transitions detected at the protein level reflected regulation of gene expression, we performed in situ hybridizations on P1 kidney sections using probes for the 1–5 chains. As noted above, nephrons at all stages of development are present in a corticomedullary gradient in neonates, with the most primitive just beneath the cortical surface and the most mature at deeper levels. Laminin 4 transcripts were clustered at the cortex, as expected from its early appearance in vesicular BL (Fig. 9 d). Laminin 1 transcripts were detected in cortical and subcortical clusters, consistent with the expression of this chain in late vesicle, comma, and S-shaped stages (Fig. 9 a). Segments of tubules were also 1 positive, and lower level expression (above background) was found throughout the kidney. Low levels of laminin 5 RNA were present in the superficial layer of the cortex, consistent with the later appearance of this chain in the developing nephron. Occasional clusters that were observed are likely to be the tips of the ureteric buds that have BLs rich in 5 (Fig. 9 e). Deep in the medulla, laminin 5 RNA was abundant in the collecting ducts, which are derived from the 5-positive ureteric bud. 5 labeling was not abundant in all structures that contained the protein (e.g., capillary loop stage glomeruli), suggesting that, in some cases, 5 RNA is unstable or simply present at low levels but translated efficiently. Laminin 2 RNA was concentrated in the deep cortical and medullary portions of the kidney (Fig. 9 b), consistent with its localization in a subset of tubules (Fig. 6 b). Laminin 3 RNA was not detectable within the renal cortex but was found at P15 in the papilla (data not shown), consistent with its protein localization in adult kidney (Fig. 6 c).

View larger version (75K): [in this window] [in a new window] [Download PPT slide]   Figure 9 In situ hybridization of laminin chain probes to P1 kidney sections. 1 was observed in primitive structures in the cortex and in some tubules (a). 2 was absent from the cortical structures but distributed diffusely in the interior (b). 4 was detected primarily in clusters at the cortex (vesicle and comma stage nephrons) but also diffusely in the medulla (d). 5 was mainly in the collecting ducts, but there were also grain clusters in the inner cortex and in the medulla (e). 3 was absent (c), and a sense control was negative (f). These patterns suggest that the developmental transitions demonstrated immunohistochemically in Figs. 7 and 8 reflect, in part, developmental transitions in chain gene expression. The cortical surface of the kidney is outlined in white. Insets in a–e show higher power views of the cortex. Bars: (f) 0.5 mm; (a, inset) 0.1 mm.

Identification of Heterotrimers Containing the Laminin 4 or 5 Chain

View larger version (24K): [in this window] [in a new window] [Download PPT slide]   Figure 10 Biochemical identification of laminins-8, -9, -10, and -11. (A) Detection of laminin complexes containing 4 and 5. Crude membrane preparations from adult lung and kidney and purified laminin-1 were solubilized without reducing agent and fractionated by SDS-PAGE on 3.5% polyacrylamide gels. Proteins were transferred to nitrocellulose and probed with nonimmune (n.i.) serum (lanes 2, 6, and 10) or with antibodies to laminin-1 (lanes 1, 5, and 9), 4 (lanes 3, 7, and 11), or 5 (lanes 4, 8, and 12). The size of the laminin-1 trimer (800 kD) is indicated. Lung contained at least two complexes containing 4 (lane 3), while kidney contained multiple 5-positive complexes (lane 8). Laminin-1 contained little or no detectable 4 or 5. (B) Identification of laminin trimers from adult lung. Laminins were solubilized, partially purified, and then immunoprecipitated with antibodies to laminin β1 (lanes 1–5), β2 (lanes 6–10), 1 (lanes 11–13), or without primary antibody (lanes 14–18). The precipitates were then fractionated on nonreducing gels and probed without primary antibody (lanes 1, 6, 11, and 14), or with antibodies to laminins β2 (lanes 2, 7, and 15), 4 (lanes 3, 8, 12, and 16), 5 (lanes 4, 9, 13, and 17), and 1 (lanes 5, 10, and 18). Four novel laminin trimers were identified: laminin-8 (4β11), laminin-9 (4β21), laminin-10 (5β11), and laminin-11 (5β21).

Parallel results were obtained from material precipitated by antibodies to laminin β2 (Fig. 10 B, lanes 6–10). All of the laminin β2-reactive material precipitated by these antibodies (Fig. 10 B, lane 7) reacted with anti 1 (lane 10) and with either anti-4 (lane 8) or anti-5 (lane 9) but not both. Complexes containing 4 had M_rs of 500–600 kD, and those with 5 had M_rs of 700–800 kD, corresponding to those detected in crude lung samples (Fig. 10 A). Electrophoresis of the immunoprecipitates under reducing conditions revealed that the major 4- and 5-reactive bands detected in crude extracts (Fig. 5 B) were complexed with β2 (data not shown). Thus, lung also contains distinct laminin heterotrimers that include 4+β2 and 5+β2.

Two observations indicated that the complexes containing 4β1, 4β2, 5β1, and 5β2 also contained the 1 chain. First, an mAb to 1 precipitated 4- and 5-containing complexes (Fig. 10 B, lanes 11–13) that were equivalent in M_r to those precipitated by anti-β1 or anti-β2. Second, as noted above, anti-β1 and anti-β2 precipitated 1-containing complexes that comigrated with all of the 4- and 5immunoreactive trimers (Fig. 10 B, lanes 5 and 10). Together, these results provide strong evidence for the existence of laminin trimers with chain compositions of 4β11, 4β21, 5β11, and 5β21. In accordance with recently adopted rules of nomenclature (Burgeson et al., 1994), these are named laminins 8–11, respectively (Table I).

Chromosomal Mapping of Lama Genes
The murine chromosomal locations of Lama1–Lama5 were determined using an interspecific backcross mapping panel derived from crosses of [(C57BL/6J x M. spretus) F1 X C57BL/6J] mice. Mouse genomic or cDNA fragments specific for each locus were used as probes in Southern blot hybridization analysis of C57BL/6J and M. spretus genomic DNA that was separately digested with several different restriction enzymes to identify informative RFLPs (see Materials and Methods). The strain distribution pattern of each RFLP in the interspecific backcross was then determined by following the presence or absence of RFLPs specific for M. spretus in backcross mice.

Backcross mapping refined previously reported chromosomal locations for Lama1–3 and provided the first data on mouse chromosomal locations of Lama4 and Lama5 (Fig. 11). Lama1 has previously been reported to map to the distal region of mouse chromosome 17 in this interspecific backcross (Okazaki et al., 1993; Doyle et al., 1996). Lama2 mapped to the proximal region of mouse chromosome 10, 4.5 centiMorgans (cM) distal of Myb and 3.9 cM proximal of Fyn. This result is in good agreement with previous studies that map Lama2 3.2 ± 1.8 cM distal of Myb on mouse chromosome 10 (Sunada et al., 1994). We have also confirmed the recent results of Aberdam et al. (1994b) and Griffith et al. (1996) by assigning Lama3 to the proximal region of chromosome 18. In our interspecific cross, Lama3 mapped 1.6 cM distal of Tpl1 and 1.1 cM proximal of Cdh2. Lama4 is linked to Lama2 on chromosome 10 and does not recombine with Fyn in 129 animals typed in common, suggesting that the two loci are within 2.3 cM of each other (upper 95% confidence limit). Finally, Lama5 mapped to the very distal region of mouse chromosome 2, 2.2 cM distal of Gnas. Thus, the five Lama loci were distributed on four different mouse autosomes, indicating that most of the Lama genes have become dispersed through evolution.

View larger version (10K): [in this window] [in a new window] [Download PPT slide]   Figure 11 Chromosomal locations of Lama loci in the mouse genome, as determined from interspecific backcross analysis. The number of recombinant N2 animals is presented over the total number of N2 animals typed to the left of the chromosome maps between each pair of loci. The recombination frequencies, expressed as genetic distance in centimorgans (± one standard error) are also shown. The upper 95% confidence limit of the recombination distance is given in parentheses when no recombinants were found between loci. Gene order was determined by minimizing the number of recombination events required to explain the allele distribution patterns. The positions of loci on human chromosomes, where known, are shown to the right of the chromosome maps. (Asterisk) The human LAMA5 gene is predicted to reside on chromosome 20q13. References for the human map positions of loci cited in this study can be obtained from GDB (Genome Data Base), a computerized database of human linkage information maintained by The William H. Welch Medical Library of The Johns Hopkins University (Baltimore, MD).

Several of the LAMA genes have also been mapped to human chromosomes (summarized in Fig. 11). LAMA1 maps to human 18p11.32-p11.22, LAMA2 to 6q22-q23, LAMA3 to 18q11.2, and LAMA4 to 6q21. LAMA1 is currently the only gene that maps to human chromosome 18 and mouse chromosome 17. Thus, LAMA1 defines a new region of homology between mouse and human chromosomes. In contrast, the mouse and human map locations of LAMA2–4 confirm and extend the known regions of homology between mouse and human chromosomes (Fig. 11; data not shown). LAMA5 has not been mapped in humans. However, the distal region of mouse chromosome 2 shares a region of homology with human chromosome 20q13, suggesting that LAMA5 will map to 20q13 in humans, as well. As noted in the Introduction, the LAMA2 gene is mutated in some congenital muscular dystrophies, and the LAMA3 gene is mutated in a subset of patients with a skin blistering disease, junctional epidermolysis bullosa. No human mutations that suggest a BL defect map to the vicinity of the human LAMA1 or LAMA4 locus or to the predicted LAMA5 locus.

Conclusion
The laminins are major components of BLs throughout the body, and their chains are ligands for most cellular laminin receptors identified to date, including at least six integrins, dystroglycan, and several glycoconjugates (see Introduction). Yet the distribution of the laminin chains has not previously been studied in detail, and the existence of the two most recently identified chains (4 and 5) has been deduced from cDNA sequence but not shown directly at the protein level. We have therefore generated a panel of antibody and cDNA reagents and have used it to localize the chain genes on mouse chromosomes and the chain RNAs and proteins in developing and adult tissues. We have also identified a new isoform of laminin 3 and provided direct evidence for the existence of four novel laminin heterotrimers. Our main conclusions are as follows:

(1) The subfamily of laminin genes currently consists of five members, which encode six proteins. Four (1, 2, 3B, and 5) are full-sized chains, and two (3A and 4) are truncated chains (Fig. 1). The previously hypothesized mid-sized chain (3B) may not, in fact, exist (Fig. 2).

(2) All five of the laminin chain genes are expressed in both embryos and adults, but each is expressed in a distinct pattern (Figs. 3 and 4). Their products are confined to the extracellular matrix and, with a few exceptions (e.g., the glomerular mesangium), to BLs (Fig. 6).

(3) All developing and adult BLs studied to date contain at least one of the known chains, and some contain two or three distinct chains. Although additional chains may well exist, our results provide no evidence for them and no clues as to their nature or distribution.

(4) Laminin 5 is the most widely distributed chain in adult BLs, and 1 is the most restricted. The 2 chain is particularly abundant in mesodermally derived tissues (e.g., skeletal and cardiac muscle), and 3 is concentrated in epithelial BLs. The restricted distribution of 1 is inconsistent with the broad distribution of immunoreactive material recognized by a widely used mAb, 4C7. This discrepancy, together with data on the distribution of 2–5, raises the possibility that 4C7 recognizes the 5 chain, in addition to or instead of 1.

(5) The main patterns of chain expression are established embryonically (Fig. 4), but some individual BLs change in chain composition as development proceeds. In kidney, for example, forming glomeruli express three different chains in a dynamic progression. Moreover, distinct portions of a continuous BL, such as that of the nephron, can contain distinct complements of chains, and these change during development as well (Figs. 7 and 8).

(6) Laminins 1–5 all form heterotrimers with β and chains. At present, 11 distinct heterotrimers have been identified in mammalian cells or tissues, including at least two containing each chain (Table I). The four heterotrimers identified in this study (Fig. 10) have been named laminins-8 (4β11), -9 (4β21), -10 (5β11), and -11 (5β21).

(7) The five chain genes are distributed on four chromosomes in mouse, and probably on three chromosomes in human. The two chain genes present on a single chromosome in both species (2 and 4) are not tightly linked, and two chains present on the same chromosome in humans (1 and 3) are on different chromosomes in mouse (Fig. 11). Thus, there is no evidence for functionally important linkage of the chain genes.

The patterns of expression that we have documented indicate that the chains contribute importantly to the molecular diversity of BLs. Together with evidence that some cellular receptors can distinguish among chains and that naturally occurring mutations of 2 and 3 have tissuespecific phenotypes (see Introduction), our results suggest that differences among chains are critical to the multiplicity of roles that BLs play both during development and in maturity.

	Note Added in Proof:

Top Abstract Materials and Methods Results and Discussion Note Added in Proof: References

 
A third 3 transcript with a distinct 5' end and translation start site has now been identified by D. Aberdam and colleagues. It encodes a protein intermediate in size between the 3B isoform reported here and the 3A isoform described by Galliano et al. (1995). Thus, there may be three isoforms of laminin 3: short (A), fulllength (B), and mid-sized (C) (Aberdam, D., personal communication).

	Acknowledgments

 
We are grateful to Drs. Lydia Sorokin, Peter Yurchenco, and Daniel Aberdam for gifts of antisera and to Renate Lewis, Jeanette Cunningham, and Ellen Ryan for technical assistance. J.H. Miner was supported in part by a Damon Runyon-Walter Winchell Cancer Research Fund fellowship.

This work was supported by grants from the National Institutes of Health.

Submitted: 24 December 1996

Revised: 13 February 1997

Please address all correspondence to Joshua R. Sanes, Department of Anatomy and Neurobiology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110. Tel.: (314) 362-2507. Fax: (314) 747-1150.

J.H. Miner and B.L. Patton contributed equally to this work.

	References

Top Abstract Materials and Methods Results and Discussion Note Added in Proof: References

 

Aberdam D Aguzzi A Baudoin C Galliano M-F Ortonne J-P Meneguzzi G Developmental expression of nicein adhesion protein (laminin-5) subunits suggests multiple morphogenic roles, Cell Adhes Commun, 1994a, 2, 115–129.[Medline]

Aberdam D Galliano MF Mattei M-G Pisani-Spadafora A Ortonne J-P Meneguzzi G. Assignment of mouse nicein genes to chromosomes 1 and 18, Mamm Genome, 1994b, 5, 229–233.[Medline]

Abrahamson DR. Glomerulogenesis in the developing kidney, Semin Nephrol, 1991, 11, 375–389.[Medline]

Abrahamson DR Leardkamolkarn V. Development of kidney tubular basement membranes, Kidney Int, 1991, 39, 382–393.[Medline]

Abrahamson DR St. John PL. Laminin distribution in developing glomerular basement membranes, Kidney Int, 1993, 43, 73–78.[Medline]

Abrahamson DR Irwin MH St. John PL Perry EW Accavitti MA Heck LW Couchman JR. Selective immunoreactivities of kidney basement membranes to monoclonal antibodies against laminin: localization of the end of the long arm and the short arms to discrete microdomains, J Cell Biol, 1989, 109, 3477–3491.[Abstract/Free Full Text]

Altschul SF Gish W Miller W Myers EW Lipman DJ. Basic local alignment search tool, J Mol Biol, 1990, 215, 403–410.[Medline]

Beck K Hunter I Engel J. Structure and function of laminin: anatomy of a multidomain glycoprotein, FASEB (Fed Am Soc Exp Biol) J, 1990, 4, 148–160.[Abstract]

Burgeson RE Chiquet M Deutzmann R Ekblom P Engel J Kleinman H Martin GR Ortonne J-P Paulsson M Sanes J et al.. A new nomenclature for laminins, Matrix Biol, 1994, 14, 209–211.[Medline]

Carter TC Phillips RJS. Ragged, a semidominant coat texture mutant, J Hered, 1954, 45, 151–154.[Abstract/Free Full Text]

Carter WG Ryan MC Gahr PJ. Epiligrin, a new cell adhesion ligand for integrin 3β1 in epithelial basement membranes, Cell, 1991, 65, 599–610.[Medline]

Champliaud M-F Lunstrum GP Rousselle P Nishiyama T Keene DR Burgeson RE. Human amnion contains a novel laminin variant, laminin 7, which like laminin 6, covalently associates with laminin 5 to promote stable epithelial-stromal attachment, J Cell Biol, 1996, 132, 1189–1198.[Abstract/Free Full Text]

Chomczynski P Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal Biochem, 1987, 162, 156–159.[Medline]

Chung AE Jaffe R Freeman IL Vergnes JP Braginsk JE Carlin B. Properties of a basement membrane related glycoprotein synthesized by a mouse embryonal carcinoma-derived cell line, Cell, 1979, 16, 277–287.[Medline]

Clark EA Brugge JS. Integrins and signal transduction pathways: the road taken, Science (Wash DC), 1995, 268, 233–239.[Abstract/Free Full Text]

Copeland NG Jenkins NA. Development and applications of a molecular genetic linkage map of the mouse genome, Trends Genet, 1991, 7, 113–118.[Medline]

Davies J. How to build a kidney, Semin Cell Biol, 1993, 4, 213–219.[Medline]

Doyle J Hoffman S Ucla C Reith W Mach B Stubbs L. Locations of human and mouse genes encoding the RFX1 and RFX2transcription factor proteins, Genomics, 1996, 35, 227–230.[Medline]

Durham PL Snyder JM. Characterization of 1, β1, and 1 laminin subunits during rabbit fetal lung development, Dev Dyn, 1995, 203, 408–421.[Medline]

Ehrig K Leivo I Argraves WS Ruoslahti E Engvall E. Merosin, a tissue-specific basement membrane protein, is a laminin-like protein, Proc Natl Acad Sci USA, 1990, 87, 3264–3268.[Abstract/Free Full Text]

Ekblom P. Receptors for laminins during epithelial morphogenesis, Curr Opin Cell Biol, 1996, 8, 700–706.[Medline]

Engvall E Wewer UM. Domains of laminin, J Cell Biochem, 1996, 61, 493–501.[Medline]

Engvall E Davis GE Dickerson K Ruoslahti E Varon S Manthorpe M. Mapping of domains in human laminin using monoclonal antibodies: localization of the neurite-promoting site, J Cell Biol, 1986, 103, 2457–2465.[Abstract/Free Full Text]

Engvall E Earwicker D Haaparanta T Ruoslahti E Sanes JR. Distribution and isolation of four laminin variants; tissue restricted distribution of heterotrimers assembled from five different subunits, Cell Regul, 1990, 1, 731–740.[Medline]

Fishel R Lescoe MK Rao MRS Copeland NG Jenkins NA Garber J Kane M Kolodner R. The human mutator gene homolog MSF2and its association with hereditary nonpolyposis colon cancer, Cell, 1993, 75, 1027–1038.[Medline]

Foster RF Thompson JM Kaufman SJ. A laminin substrate promotes myogenesis in rat skeletal muscle cultures: analysis of replication and development using antidesmin and anti-BrdUrd monoclonal antibodies, Dev Biol, 1987, 122, 11–20.[Medline]

Galliano M-F Aberdam D Aguzzi A Ortonne J-P Meneguzzi G. Cloning and complete primary structure of the mouse laminin 3 chain, J Biol Chem, 1995, 270, 21820–21826.[Abstract/Free Full Text]

Garcia-Alonso L Fetter RD Goodman CS. Genetic analysis of Laminin A in Drosophila: extracellular matrix containing laminin A is required for ocellar axon pathfinding, Development (Camb), 1996, 122, 2611–2621.[Abstract]

Gee SH Blacher RW Douville PJ Provost PR Yurchenco PD Carbonetto S. Laminin-binding protein 120 from brain is closely related to the dystrophin-associated glycoprotein, dystroglycan, and binds with high affinity to the major heparin binding domain of laminin, J Biol Chem, 1993, 268, 14972–14980.[Abstract/Free Full Text]

Gerecke SR Wagman DW Champliaud MF Burgeson RE. The complete primary structure for a novel laminin chain, the laminin B1k chain, J Biol Chem, 1994, 269, 11073–11080.[Abstract/Free Full Text]

Green, E.L. 1981. Linkage, recombination and mapping. In Genetics and Probability in Animal Breeding Experiments. Oxford University Press, New York. 77–113.

Green EL Mann SJ. Opossum, a semi-dominant lethal mutation affecting hair and other characteristics of mice, J Hered, 1961, 52, 223–227.[Free Full Text]

Green TL Hunter DD Chan W Merlie JP Sanes JR. Synthesis and assembly of the synaptic cleft protein S-laminin by cultured cells, J Biol Chem, 1992, 267, 2014–2022.[Abstract/Free Full Text]

Griffith AJ Radice GL Burgess DL Kohrman DC Hansen GM Justice ML Johnson KR Davisson MT Meisler MH. Location of the 9257 and ataxia mutations on mouse Chromosome 18, Mamm Genome, 1996, 7, 417–419.[Medline]

Hall H Liu L Schachner M Schmitz B. The L2/NHK-1 carbohydrate mediates adhesion of neural cells to laminin, Eur J Neurosci, 1993, 5, 34–42.[Medline]

Helbling-Leclerc A Zhang X Topaloglu H Cruaud C Tesson F Weissenbach J Tome FM Schwartz K Fardeau M Tryggvason K Guicheney P. Mutations in the laminin 2-chain gene (LAMA2) cause merosin-deficient congenital muscular dystrophy, Nat Genet, 1995, 11, 216–218.[Medline]

Henchcliffe C Garcia-Alonso L Tang J Goodman CS. Genetic analysis of laminin A reveals diverse functions during morphogenesis in Drosophila. , Development (Camb), 1993, 118, 325–337.[Abstract]

Henry MD Campbell KP. Dystroglycan—an extracellular matrix receptor linked to the cytoskeleton, Curr Opin Cell Biol, 1996, 8, 625–631.[Medline]

Horikoshi S Koide H Shirai T. Monoclonal antibodies against laminin A chain and B chain in the human and mouse kidneys, Lab Invest, 1988, 58, 532–538.[Medline]

Hunter DD Porter BE Bulock JW Adams SP Merlie JP Sanes JR. Primary sequence of a motor neuron-selective adhesive site in the synaptic basal lamina protein S-laminin, Cell, 1989a, 59, 905–913.[Medline]

Hunter DD Shah V Merlie JP Sanes JR. A laminin-like adhesive protein concentrated in the synaptic cleft of the neuromuscular junction, Nature (Lond), 1989b, 338, 229–234.[Medline]

Iivanainen A Sainio K Sariola H Tryggvason K. Primary structure and expression of a novel human laminin 4 chain, FEBS Lett, 1995, 365, 183–188.[Medline]

Jenkins NA Copeland NG Taylor BA Lee BK. Organization, distribution, and stability of endogenous ecotropic murine leukemia virus DNA sequences in chromosomes of Mus musculus. , J Virol, 1982, 43, 26–36.[Abstract/Free Full Text]

Justice MJ Siracusa LD Gilbert DJ Heisterkamp N Groffen J Chada K Silan CM Copeland NG Jenkins NA. A genetic linkage map of mouse chromosome 10: localization of eighteen molecular markers using a single interspecific backcross, Genetics, 1990, 125, 855–866.[Abstract]

Justice MJ Gilbert DJ Kinzler KW Vogelstein B Buchberg AM Ceci JD Matsuda Y Chapman VM Patriotis C Makris A et al.. A molecular genetic linkage map of mouse chromosome 18 reveals extensive linkage conservation with human chromosomes 5 and 18, Genomics, 1992, 13, 1281–1288.[Medline]

Justice MJ Morse HC III Jenkins NA Copeland NG. Identification of Evi-3, a novel common site of retroviral integration in mouse AKXD B-cell lymphomas, J Virol, 1994, 68, 1293–1300.[Abstract/Free Full Text]

Kallunki P Sainio K Eddy R Byers M Kallunki T Sariola H Beck K Hirvonen H Shows TB Tryggvason K. A truncated laminin chain homologous to the B2 chain: structure, spatial expression, and chromosomal assignment, J Cell Biol, 1992, 119, 679–693.[Abstract/Free Full Text]

Klein G Langegger M Timpl R Ekblom P. Role of laminin A chain in the development of epithelial cell polarity, Cell, 1988, 55, 331–341.[Medline]

Leivo I Engvall E. Merosin, a protein specific for basement membranes of Schwann cell, striated muscle, and trophoblast, is expressed late in nerve and muscle development, Proc Natl Acad Sci USA, 1988, 85, 1544–1548.[Abstract/Free Full Text]

Lentz SI Miner JH Sanes JR Snider WD. Distribution of the ten known laminin chains in the pathways and targets of developing sensory axons, J Comp Neurol, 1997, 378, 547–561.[Medline]

Lindblom A Marsh T Fauser C Engel J Paulsson M. Characterization of native laminin from bovine kidney and comparison with other laminin variants, Eur J Biochem, 1994, 219, 383–392.[Medline]

Marinkovich MP Lunstrum GP Burgeson RE. The anchoring filament protein kalinin is synthesized and secreted as a high molecular weight precursor, J Biol Chem, 1992a, 267, 17900–17906.[Abstract/Free Full Text]

Marinkovich MP Lunstrum GP Keene DR Burgeson RE. The dermal-epidermal junction of human skin contains a novel laminin variant, J Cell Biol, 1992b, 119, 695–703.[Abstract/Free Full Text]

Martin GR Timpl R. Laminin and other basement membrane components, Annu Rev Cell Biol, 1987, 3, 57–85.

McGrath JA Kivirikko S Ciatti S Moss C Dunnill GS Eady RA Rodeck CH Christiano AM Uitto J. A homozygous nonsense mutation in the alpha 3 chain gene of laminin 5 (LAMA3) in Herlitz junctional epidermolysis bullosa: prenatal exclusion in a fetus at risk, Genomics, 1995, 29, 282–284.[Medline]

Mecham, R.P., and A. Hinek. 1996. Non-integrin laminin receptors. In The Laminins. P. Ekblom and R. Timpl, editors. Harwood Academic Publishers, Amsterdam. 159–183.

Mercurio AM. Laminin receptors: achieving specificity through cooperation, Trends Cell Biol, 1995, 5, 419–423.[Medline]

Miner JH Sanes JR. Collagen IV 3, 4, and 5 chains in rodent basal laminae: sequence, distribution, association with laminins, and developmental switches, J Cell Biol, 1994, 127, 879–891.[Abstract/Free Full Text]

Miner JH Wold BJ. c-mycinhibition of MyoD and myogenin-initiated myogenic differentiation, Mol Cell Biol, 1991, 11, 2842–2851.[Abstract/Free Full Text]

Miner JH Lewis RM Sanes JR. Molecular cloning of a novel laminin chain, 5, and widespread expression in adult mouse tissues, J Biol Chem, 1995, 270, 28523–28526.[Abstract/Free Full Text]

Noakes PG Miner JH Gautam M Cunningham JM Sanes JR Merlie JP. The renal glomerulus of mice lacking s-laminin/laminin β2: nephrosis despite molecular compensation by laminin β1, Nat Genet, 1995, 10, 400–406.[Medline]

Okazaki T Yoshida BN Avraham KB Wang H Wuenschell CW Jenkins NA Copeland NG Anderson DJ Mori N. Molecular diversity of the SCG10/Stathmin gene family in the mouse, Genomics, 1993, 18, 360–373.[Medline]

Pall EA Bolton KM Ervasti JM. Differential heparin inhibition of skeletal muscle alpha-dystroglycan binding to laminins, J Biol Chem, 1996, 271, 3817–3821.[Abstract/Free Full Text]

Paulsson M Saladin K Engvall E. The 300-kDa chains of murine and bovine heart laminin are related to the human placenta merosin heavy chain and replace the A chain in some laminin variants, J Biol Chem, 1991, 266, 17545–17551.[Abstract/Free Full Text]

Rao CN Kefalides NA. Identification and characterization of a 43 kilodalton laminin fragment from the "A" chain (long arm) with high-affinity heparin binding and mammary epithelial cell adhesion-spreading activities, Biochemistry, 1990, 29, 6768–6777.[Medline]

Reichardt LF Tomaselli KJ. Extracellular matrix molecules and their receptors: functions in neural development, Annu Rev Neurosci, 1991, 14, 531–570.[Medline]

Richards AJ Al-Imara L Carter NP Lloyd JC Leversha MA Pope FM. Localization of the gene (LAMA4) to chromosome 6q21 and isolation of a partial cDNA encoding a variant laminin A chain, Genomics, 1994, 22, 237–239.[Medline]

Richards A Al-Imara L Pope FM. The complete cDNA sequence of laminin 4 and its relationship to the other human laminin chains, Eur J Biochem, 1996, 238, 813–821.[Medline]

Rousselle P Lunstrum GP Keene DR Burgeson RE. Kalinin: an epithelium-specific basement membrane adhesion molecule that is a component of anchoring filaments, J Cell Biol, 1991, 114, 567–576.[Abstract/Free Full Text]

Ryan MC Tizard R VanDevanter DR Carter WG. Cloning of the LamA3 gene encoding the 3 chain of the adhesive ligand epiligrin, J Biol Chem, 1994, 269, 22779–22787.[Abstract/Free Full Text]

Sanes JR Chiu AY. The basal lamina of the neuromuscular junction, Cold Spring Harbor Symp Quant Biol, 1983, 48, 667–678.[Abstract/Free Full Text]

Sanes JR Engvall E Butkowski R Hunter DD. Molecular heterogeneity of basal laminae: isoforms of laminin and collagen IV at the neuromuscular junction and elsewhere, J Cell Biol, 1990, 111, 1685–1699.[Abstract/Free Full Text]

Sasaki M Kleinman HK Huber H Deutzmann R Yamada Y. Laminin, a multidomain protein: the A chain has a unique globular domain and homology with the basement membrane proteoglycan and the laminin B chains, J Biol Chem, 1988, 263, 16536–16544.[Abstract/Free Full Text]

Sewry CA Chevallay M Tome FMS. Expression of laminin subunits in human fetal skeletal muscle, Histochem J, 1995, 27, 497–504.[Medline]

Slee J. The morphology and development of ragged—a mutant affecting the skin and hair of the house mouse. II. Genetics, embryology and gross juvenile morphology, J Genet, 1957, 55, 570–584.

Sorokin L Ekblom P. Development of tubular and glomerular cells of the kidney, Kidney Int, 1992, 41, 657–664.[Medline]

Sorokin LM Conzelmann S Ekblom P Battaglia C Aumailley M Timpl R. Monoclonal antibodies against laminin A chain fragment E3 and their effects on binding to cells and proteoglycan and on kidney development, Exp Cell Res, 1992, 201, 137–144.[Medline]

Sunada Y Bernier SM Kozak CA Yamada Y Campbell KP. Deficiency of merosin in dystrophic dy mice and genetic linkage of laminin M chain gene to dylocus, J Biol Chem, 1994, 269, 13729–13732.[Abstract/Free Full Text]

Sung U O'Rear JJ Yurchenco PD. Cell and heparin binding in the distal long arm of laminin: identification of active and cryptic sites with recombinant and hybrid glycoprotein, J Cell Biol, 1993, 123, 1255–1268.[Abstract/Free Full Text]

Timpl R. Macromolecular organization of basement membranes, Curr Opin Cell Biol, 1996, 8, 618–624.[Medline]

Timpl R Rhode H Robey PG Rennard SI Foidart JM Martin GR. Laminin—A glycoprotein from basement membranes, J Biol Chem, 1979, 254, 9933–9937.[Abstract/Free Full Text]

Vachon PH Loechel F Xu H Wewer UM Engvall E. Merosin and laminin in myogenesis; specific requirement for merosin in myotube stability and survival, J Cell Biol, 1996, 134, 1483–1497.[Abstract/Free Full Text]

Verrando P Partouche O Pisani A Ortonne J-P. The 6/2 (AA3) polyclonal antibody identifying a 37 kD keratinocyte protein reacts also with BM-600/nicein, the basement membrane component bound by the monoclonal antibody GB3, Exp Derm, 1992, 1, 52–58.[Medline]

Virtanen I Laitinen L Korhonen M. Differential expression of laminin polypeptides in developing and adult human kidney, J Histochem Cytochem, 1995, 43, 621–628.[Abstract]

Virtanen I Laitinen A Tani T Paakko P Laitinen LA Burgeson RE Lehto V-P. Differential expression of laminins and their integrin receptors in developing and adult human lung, Am J Respir Cell Mol Biol, 1996, 15, 184–196.[Abstract]

Vuolteenaho R Nissinen M Sainio K Byers M Eddy R Hirvonen H Shows TB Sariola H Engvall E Tryggvason K. Human laminin M chain (merosin): complete primary structure, chromosomal assignment, and expression of the M and A chain in human fetal tissues, J Cell Biol, 1994, 124, 381–394.[Abstract/Free Full Text]

Wilkie TM Gilbert DJ Olsen AS Chen X-N Amatruda TT Korenberg JR Trask BJ de Jong P Reed RR Simon MI et al.. Evolution of the mammalian G protein subunit multigene family, Nat Genet, 1992, 1, 85–91.[Medline]

Xu H Wu X-R Wewer UM Engvall E. Murine muscular dystrophy caused by a mutation in the laminin 2 (Lama2)gene, Nat Genet, 1994, 8, 297–302.[Medline]

Yamada KM Miyamoto S. Integrin transmembrane signaling and cytoskeletal control, Curr Opin Cell Biol, 1995, 7, 681–689.[Medline]

Yarnitzky T Volk T. Laminin is required for heart, somatic muscles, and gut development in the Drosophilaembryo, Dev Biol, 1995, 169, 609–618.[Medline]

Yurchenco PD O'Rear JJ. Basal lamina assembly, Curr Opin Cell Biol, 1994, 6, 674–681.[Medline]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Facebook

Reddit

Technorati

Twitter

This article has been cited by other articles:

• Taniguchi, Y., Ido, H., Sanzen, N., Hayashi, M., Sato-Nishiuchi, R., Futaki, S., Sekiguchi, K. (2009). The C-terminal Region of Laminin {beta} Chains Modulates the Integrin Binding Affinities of Laminins. J. Biol. Chem. 284: 7820-7831 [Abstract] [Full Text]  
• Baleato, R. M., Guthrie, P. L., Gubler, M.-C., Ashman, L. K., Roselli, S. (2008). Deletion of Cd151 Results in a Strain-Dependent Glomerular Disease Due to Severe Alterations of the Glomerular Basement Membrane. Am. J. Pathol. 173: 927-937 [Abstract] [Full Text]  
• Nishimune, H., Valdez, G., Jarad, G., Moulson, C. L., Muller, U., Miner, J. H., Sanes, J. R. (2008). Laminins promote postsynaptic maturation by an autocrine mechanism at the neuromuscular junction. JCB 182: 1201-1215 [Abstract] [Full Text]  
• Gorfu, G., Virtanen, I., Hukkanen, M., Lehto, V.-P., Rousselle, P., Kenne, E., Lindbom, L., Kramer, R., Tryggvason, K., Patarroyo, M. (2008). Laminin isoforms of lymph nodes and predominant role of {alpha}5-laminin(s) in adhesion and migration of blood lymphocytes. J. Leukoc. Biol. 84: 701-712 [Abstract] [Full Text]  
• Mahoney, Z. X., Stappenbeck, T. S., Miner, J. H. (2008). Laminin {alpha}5 influences the architecture of the mouse small intestine mucosa. J. Cell Sci. 121: 2493-2502 [Abstract] [Full Text]  
• Patton, B. L., Wang, B., Tarumi, Y. S., Seburn, K. L., Burgess, R. W. (2008). A single point mutation in the LN domain of LAMA2 causes muscular dystrophy and peripheral amyelination. J. Cell Sci. 121: 1593-1604 [Abstract] [Full Text]  
• Jakobsson, L., Domogatskaya, A., Tryggvason, K., Edgar, D., Claesson-Welsh, L. (2008). Laminin deposition is dispensable for vasculogenesis but regulates blood vessel diameter independent of flow. FASEB J. 22: 1530-1539 [Abstract] [Full Text]  
• Sataranatarajan, K., Mariappan, M. M., Lee, M. J., Feliers, D., Choudhury, G. G., Barnes, J. L., Kasinath, B. S. (2007). Regulation of Elongation Phase of mRNA Translation in Diabetic Nephropathy: Amelioration by Rapamycin. Am. J. Pathol. 171: 1733-1742 [Abstract] [Full Text]  
• Kabosova, A., Azar, D. T., Bannikov, G. A., Campbell, K. P., Durbeej, M., Ghohestani, R. F., Jones, J. C. R., Kenney, M. C., Koch, M., Ninomiya, Y., Patton, B. L., Paulsson, M., Sado, Y., Sage, E. H., Sasaki, T., Sorokin, L. M., Steiner-Champliaud, M.-F., Sun, T.-T., SundarRaj, N., Timpl, R., Virtanen, I., Ljubimov, A. V. (2007). Compositional Differences between Infant and Adult Human Corneal Basement Membranes. IOVS 48: 4989-4999 [Abstract] [Full Text]  
• Abrahamson, D. R., Isom, K., Roach, E., Stroganova, L., Zelenchuk, A., Miner, J. H., St. John, P. L. (2007). Laminin Compensation in Collagen {alpha}3(IV) Knockout (Alport) Glomeruli Contributes to Permeability Defects. J. Am. Soc. Nephrol. 18: 2465-2472 [Abstract] [Full Text]  
• Abrahamson, D. R., St. John, P. L., Isom, K., Robert, B., Miner, J. H. (2007). Partial Rescue of Glomerular Laminin {alpha}5 Mutations by Wild-Type Endothelia Produce Hybrid Glomeruli. J. Am. Soc. Nephrol. 18: 2285-2293 [Abstract] [Full Text]  
• Xu, R., Chandrasekharan, K., Yoon, J. H., Camboni, M., Martin, P. T. (2007). Overexpression of the Cytotoxic T Cell (CT) Carbohydrate Inhibits Muscular Dystrophy in the dyW Mouse Model of Congenital Muscular Dystrophy 1A. Am. J. Pathol. 171: 181-199 [Abstract] [Full Text]  
• Harvey, S. J., Jarad, G., Cunningham, J., Rops, A. L., van der Vlag, J., Berden, J. H., Moeller, M. J., Holzman, L. B., Burgess, R. W., Miner, J. H. (2007). Disruption of Glomerular Basement Membrane Charge through Podocyte-Specific Mutation of Agrin Does Not Alter Glomerular Permselectivity. Am. J. Pathol. 171: 139-152 [Abstract] [Full Text]  
• Wilkinson, L., Gilbert, T., Kinna, G., Ruta, L.-A., Pennisi, D., Kett, M., Little, M. H. (2007). Crim1KST264/KST264 Mice Implicate Crim1 in the Regulation of Vascular Endothelial Growth Factor-A Activity during Glomerular Vascular Development. J. Am. Soc. Nephrol. 18: 1697-1708 [Abstract] [Full Text]  
• Chia, J., Kusuma, N., Anderson, R., Parker, B., Bidwell, B., Zamurs, L., Nice, E., Pouliot, N. (2007). Evidence for a Role of Tumor-Derived Laminin-511 in the Metastatic Progression of Breast Cancer. Am. J. Pathol. 170: 2135-2148 [Abstract] [Full Text]  
• Ogawa, T., Tsubota, Y., Hashimoto, J., Kariya, Y., Miyazaki, K. (2007). The Short Arm of Laminin {gamma}2 Chain of Laminin-5 (Laminin-332) Binds Syndecan-1 and Regulates Cellular Adhesion and Migration by Suppressing Phosphorylation of Integrin beta4 Chain. Mol. Biol. Cell 18: 1621-1633 [Abstract] [Full Text]  
• Sugawara, K., Tsuruta, D., Kobayashi, H., Ikeda, K., Hopkinson, S. B., Jones, J. C.R., Ishii, M. (2007). Spatial and Temporal Control of Laminin-332 (5) and -511 (10) Expression During Induction of Anagen Hair Growth. J. Histochem. Cytochem. 55: 43-55 [Abstract] [Full Text]  
• Aisenbrey, S., Zhang, M., Bacher, D., Yee, J., Brunken, W. J., Hunter, D. D. (2006). Retinal Pigment Epithelial Cells Synthesize Laminins, Including Laminin 5, and Adhere to Them through {alpha}3- and {alpha}6-Containing Integrins. IOVS 47: 5537-5544 [Abstract] [Full Text]  
• Kasinath, B. S., Mariappan, M. M., Sataranatarajan, K., Lee, M. J., Feliers, D. (2006). mRNA Translation: Unexplored Territory in Renal Science. J. Am. Soc. Nephrol. 17: 3281-3292 [Abstract] [Full Text]  
• Shannon, M. B., Patton, B. L., Harvey, S. J., Miner, J. H. (2006). A Hypomorphic Mutation in the Mouse Laminin {alpha}5 Gene Causes Polycystic Kidney Disease. J. Am. Soc. Nephrol. 17: 1913-1922 [Abstract] [Full Text]  
• DeBiase, P. J., Lane, K., Budinger, S., Ridge, K., Wilson, M., Jones, J. C.R. (2006). Laminin-311 (Laminin-6) Fiber Assembly by Type I-like Alveolar Cells. J. Histochem. Cytochem. 54: 665-672 [Abstract] [Full Text]  
• Bajanca, F., Luz, M., Raymond, K., Martins, G. G., Sonnenberg, A., Tajbakhsh, S., Buckingham, M., Thorsteinsdottir, S. (2006). Integrin {alpha}6{beta}1-laminin interactions regulate early myotome formation in the mouse embryo. Development 133: 1635-1644 [Abstract] [Full Text]  
• El-Aouni, C., Herbach, N., Blattner, S. M., Henger, A., Rastaldi, M. P., Jarad, G., Miner, J. H., Moeller, M. J., St-Arnaud, R., Dedhar, S., Holzman, L. B., Wanke, R., Kretzler, M. (2006). Podocyte-Specific Deletion of Integrin-Linked Kinase Results in Severe Glomerular Basement Membrane Alterations and Progressive Glomerulosclerosis. J. Am. Soc. Nephrol. 17: 1334-1344 [Abstract] [Full Text]  
• Bystrom, B., Virtanen, I., Rousselle, P., Gullberg, D., Pedrosa-Domellof, F. (2006). Distribution of laminins in the developing human eye.. IOVS 47: 777-785 [Abstract] [Full Text]  
• Miner, J. H., Go, G., Cunningham, J., Patton, B. L., Jarad, G. (2006). Transgenic isolation of skeletal muscle and kidney defects in laminin {beta}2 mutant mice: implications for Pierson syndrome. Development 133: 967-975 [Abstract] [Full Text]  
• Vainionpaa, N., Kikkawa, Y., Lounatmaa, K., Miner, J. H., Rousselle, P., Virtanen, I. (2006). Laminin-10 and Lutheran blood group glycoproteins in adhesion of human endothelial cells. Am. J. Physiol. Cell Physiol. 290: C764-C775 [Abstract] [Full Text]  
• Davis, G. E., Senger, D. R. (2005). Endothelial Extracellular Matrix: Biosynthesis, Remodeling, and Functions During Vascular Morphogenesis and Neovessel Stabilization. Circ. Res. 97: 1093-1107 [Abstract] [Full Text]  
• Nakashima, Y., Kariya, Y., Yasuda, C., Miyazaki, K. (2005). Regulation of Cell Adhesion and Type VII Collagen Binding by the {beta}3 Chain Short Arm of Laminin-5: Effect of Its Proteolytic Cleavage. J Biochem 138: 539-552 [Abstract] [Full Text]  
• Maatta, M., Butzow, R., Luostarinen, J., Petajaniemi, N., Pihlajaniemi, T., Salo, S., Miyazaki, K., Autio-Harmainen, H., Virtanen, I. (2005). Differential Expression of Laminin Isoforms in Ovarian Epithelial Carcinomas Suggesting Different Origin and Providing Tools for Differential Diagnosis. J. Histochem. Cytochem. 53: 1293-1300 [Abstract] [Full Text]  
• Buzza, M. S., Zamurs, L., Sun, J., Bird, C. H., Smith, A. I., Trapani, J. A., Froelich, C. J., Nice, E. C., Bird, P. I. (2005). Extracellular Matrix Remodeling by Human Granzyme B via Cleavage of Vitronectin, Fibronectin, and Laminin. J. Biol. Chem. 280: 23549-23558 [Abstract] [Full Text]  
• Jones, J. C. R., Lane, K., Hopkinson, S. B., Lecuona, E., Geiger, R. C., Dean, D. A., Correa-Meyer, E., Gonzales, M., Campbell, K., Sznajder, J. I., Budinger, S. (2005). Laminin-6 assembles into multimolecular fibrillar complexes with perlecan and participates in mechanical-signal transduction via a dystroglycan-dependent, integrin-independent mechanism. J. Cell Sci. 118: 2557-2566 [Abstract] [Full Text]  
• Gratton, M. A., Rao, V. H., Meehan, D. T., Askew, C., Cosgrove, D. (2005). Matrix Metalloproteinase Dysregulation in the Stria Vascularis of Mice with Alport Syndrome: Implications for Capillary Basement Membrane Pathology. Am. J. Pathol. 166: 1465-1474 [Abstract] [Full Text]  
• Tryggvason, K., Wartiovaara, J. (2005). How Does the Kidney Filter Plasma?. Physiology 20: 96-101 [Abstract] [Full Text]  
• Miner, J. H. (2005). Building the Glomerulus: A Matricentric View. J. Am. Soc. Nephrol. 16: 857-861 [Full Text]  
• Yang, D., Bierman, J., Tarumi, Y. S., Zhong, Y.-P., Rangwala, R., Proctor, T. M., Miyagoe-Suzuki, Y., Takeda, S., Miner, J. H., Sherman, L. S., Gold, B. G., Patton, B. L. (2005). Coordinate control of axon defasciculation and myelination by laminin-2 and -8. JCB 168: 655-666 [Abstract] [Full Text]  
• Adair-Kirk, T. L., Atkinson, J. J., Kelley, D. G., Arch, R. H., Miner, J. H., Senior, R. M. (2005). A Chemotactic Peptide from Laminin {alpha}5 Functions as a Regulator of Inflammatory Immune Responses via TNF{alpha}-mediated Signaling. J. Immunol. 174: 1621-1629 [Abstract] [Full Text]  
• Wondimu, Z., Geberhiwot, T., Ingerpuu, S., Juronen, E., Xie, X., Lindbom, L., Doi, M., Kortesmaa, J., Thyboll, J., Tryggvason, K., Fadeel, B., Patarroyo, M. (2004). An endothelial laminin isoform, laminin 8 ({alpha}4{beta}1{gamma}1), is secreted by blood neutrophils, promotes neutrophil migration and extravasation, and protects neutrophils from apoptosis. Blood 104: 1859-1866 [Abstract] [Full Text]  
• Niimi, T., Hayashi, Y., Futaki, S., Sekiguchi, K. (2004). SOX7 and SOX17 Regulate the Parietal Endoderm-specific Enhancer Activity of Mouse Laminin {alpha}1 Gene. J. Biol. Chem. 279: 38055-38061 [Abstract] [Full Text]  
• Kariya, Y., Yasuda, C., Nakashima, Y., Ishida, K., Tsubota, Y., Miyazaki, K. (2004). Characterization of Laminin 5B and NH2-terminal Proteolytic Fragment of Its {alpha}3B Chain: PROMOTION OF CELLULAR ADHESION, MIGRATION, AND PROLIFERATION. J. Biol. Chem. 279: 24774-24784 [Abstract] [Full Text]  
• Breitkreutz, D., Mirancea, N., Schmidt, C., Beck, R., Werner, U., Stark, H.-J., Gerl, M., Fusenig, N. E. (2004). Inhibition of basement membrane formation by a nidogen-binding laminin {gamma}1-chain fragment in human skin-organotypic cocultures. J. Cell Sci. 117: 2611-2622 [Abstract] [Full Text]  
• Miner, J. H., Li, C., Mudd, J. L., Go, G., Sutherland, A. E. (2004). Compositional and structural requirements for laminin and basement membranes during mouse embryo implantation and gastrulation. Development 131: 2247-2256 [Abstract] [Full Text]  
• Blaess, S., Graus-Porta, D., Belvindrah, R., Radakovits, R., Pons, S., Littlewood-Evans, A., Senften, M., Guo, H., Li, Y., Miner, J. H., Reichardt, L. F., Muller, U. (2004). {beta}1-Integrins Are Critical for Cerebellar Granule Cell Precursor Proliferation. J. Neurosci. 24: 3402-3412 [Abstract] [Full Text]  
• Kummer, T. T., Misgeld, T., Lichtman, J. W., Sanes, J. R. (2004). Nerve-independent formation of a topologically complex postsynaptic apparatus. JCB 164: 1077-1087 [Abstract] [Full Text]  
• Sengle, G., Kobbe, B., Morgelin, M., Paulsson, M., Wagener, R. (2003). Identification and Characterization of AMACO, a New Member of the von Willebrand Factor A-like Domain Protein Superfamily with a Regulated Expression in the Kidney. J. Biol. Chem. 278: 50240-50249 [Abstract] [Full Text]  
• Suzuki, N., Nakatsuka, H., Mochizuki, M., Nishi, N., Kadoya, Y., Utani, A., Oishi, S., Fujii, N., Kleinman, H. K., Nomizu, M. (2003). Biological Activities of Homologous Loop Regions in the Laminin {alpha} Chain G Domains. J. Biol. Chem. 278: 45697-45705 [Abstract] [Full Text]  
• Virtanen, I., Korhonen, M., Petajaniemi, N., Karhunen, T., Thornell, L.-E., Sorokin, L. M., Konttinen, Y. T. (2003). Laminin Isoforms in Fetal and Adult Human Adrenal Cortex. J. Clin. Endocrinol. Metab. 88: 4960-4966 [Abstract] [Full Text]  
• Khazenzon, N. M., Ljubimov, A. V., Lakhter, A. J., Fujita, M., Fujiwara, H., Sekiguchi, K., Sorokin, L. M., Petajaniemi, N., Virtanen, I., Black, K. L., Ljubimova, J. Y. (2003). Antisense inhibition of laminin-8 expression reduces invasion of human gliomas in vitro. Molecular Cancer Therapeutics 2: 985-994 [Abstract] [Full Text]  
• Nagakubo, D., Murai, T., Tanaka, T., Usui, T., Matsumoto, M., Sekiguchi, K., Miyasaka, M. (2003). A High Endothelial Venule Secretory Protein, Mac25/Angiomodulin, Interacts with Multiple High Endothelial Venule-Associated Molecules Including Chemokines. J. Immunol. 171: 553-561 [Abstract] [Full Text]  
• Huang, C.-c., Hall, D. H., Hedgecock, E. M., Kao, G., Karantza, V., Vogel, B. E., Hutter, H., Chisholm, A. D., Yurchenco, P. D., Wadsworth, W. G. (2003). Laminin {alpha} subunits and their role in C. elegans development. Development 130: 3343-3358 [Abstract] [Full Text]  
• Previtali, S. C., Nodari, A., Taveggia, C., Pardini, C., Dina, G., Villa, A., Wrabetz, L., Quattrini, A., Feltri, M. L. (2003). Expression of Laminin Receptors in Schwann Cell Differentiation: Evidence for Distinct Roles. J. Neurosci. 23: 5520-5530 [Abstract] [Full Text]  
• Adair-Kirk, T. L., Atkinson, J. J., Broekelmann, T. J., Doi, M., Tryggvason, K., Miner, J. H., Mecham, R. P., Senior, R. M. (2003). A Site on Laminin {alpha}5, AQARSAASKVKVSMKF, Induces Inflammatory Cell Production of Matrix Metalloproteinase-9 and Chemotaxis. J. Immunol. 171: 398-406 [Abstract] [Full Text]  
• Kikkawa, Y., Virtanen, I., Miner, J. H. (2003). Mesangial cells organize the glomerular capillaries by adhering to the G domain of laminin {alpha}5 in the glomerular basement membrane. JCB 161: 187-196 [Abstract] [Full Text]  
• Niimi, T., Hayashi, Y., Sekiguchi, K. (2003). Identification of an Upstream Enhancer in the Mouse Laminin alpha 1 Gene Defining Its High Level of Expression in Parietal Endoderm Cells. J. Biol. Chem. 278: 9332-9338 [Abstract] [Full Text]  
• Inagaki, J., Sugiura-Ogasawara, M., Nomizu, M., Nakatsuka, M., Ikuta, K., Suzuki, N., Kaihara, K., Kobayashi, K., Yasuda, T., Shoenfeld, Y., Aoki, K., Matsuura, E. (2003). An association of IgG anti-laminin-1 autoantibodies with endometriosis in infertile patients. Hum Reprod 18: 544-549 [Abstract] [Full Text]  
• Gonzalez, A. M., Gonzales, M., Herron, G. S., Nagavarapu, U., Hopkinson, S. B., Tsuruta, D., Jones, J. C. R. (2002). Complex interactions between the laminin alpha 4 subunit and integrins regulate endothelial cell behavior in vitro and angiogenesis in vivo. Proc. Natl. Acad. Sci. USA 99: 16075-16080 [Abstract] [Full Text]  
• Jiang, F.-X., Naselli, G., Harrison, L. C. (2002). Distinct Distribution of Laminin and Its Integrin Receptors in the Pancreas. J. Histochem. Cytochem. 50: 1625-1632 [Abstract] [Full Text]  
• Kikkawa, Y., Moulson, C. L., Virtanen, I., Miner, J. H. (2002). Identification of the Binding Site for the Lutheran Blood Group Glycoprotein on Laminin alpha 5 through Expression of Chimeric Laminin Chains in Vivo. J. Biol. Chem. 277: 44864-44869 [Abstract] [Full Text]  
• Zuk, A., Matlin, K. S. (2002). Induction of a laminin isoform and alpha 3beta 1-integrin in renal ischemic injury and repair in vivo. Am. J. Physiol. Renal Physiol. 283: F971-F984 [Abstract] [Full Text]  
• Okazaki, I., Suzuki, N., Nishi, N., Utani, A., Matsuura, H., Shinkai, H., Yamashita, H., Kitagawa, Y., Nomizu, M. (2002). Identification of Biologically Active Sequences in the Laminin alpha 4 Chain G Domain. J. Biol. Chem. 277: 37070-37078 [Abstract] [Full Text]  
• Petajaniemi, N., Korhonen, M., Kortesmaa, J., Tryggvason, K., Sekiguchi, K., Fujiwara, H., Sorokin, L., Thornell, L.-E., Wondimu, Z., Assefa, D., Patarroyo, M., Virtanen, I. (2002). Localization of Laminin {alpha}4-Chain in Developing and Adult Human Tissues. J. Histochem. Cytochem. 50: 1113-1130 [Abstract] [Full Text]  
• Natoli, T. A., Liu, J., Eremina, V., Hodgens, K., Li, C., Hamano, Y., Mundel, P., Kalluri, R., Miner, J. H., Quaggin, S. E., Kreidberg, J. A. (2002). A Mutant Form of the Wilms' Tumor Suppressor Gene WT1 Observed in Denys-Drash Syndrome Interferes with Glomerular Capillary Development. J. Am. Soc. Nephrol. 13: 2058-2067 [Abstract] [Full Text]  
• Murase, S.-i., Horwitz, A. F. (2002). Deleted in Colorectal Carcinoma and Differentially Expressed Integrins Mediate the Directional Migration of Neural Precursors in the Rostral Migratory Stream. J. Neurosci. 22: 3568-3579 [Abstract] [Full Text]  
• Doi, M., Thyboll, J., Kortesmaa, J., Jansson, K., Iivanainen, A., Parvardeh, M., Timpl, R., Hedin, U., Swedenborg, J., Tryggvason, K. (2002). Recombinant Human Laminin-10 (alpha 5beta 1gamma 1). PRODUCTION, PURIFICATION, AND MIGRATION-PROMOTING ACTIVITY ON VASCULAR ENDOTHELIAL CELLS. J. Biol. Chem. 277: 12741-12748 [Abstract] [Full Text]  
• Sterk, L. M. T., Geuijen, C. A. W., van den Berg, J. G., Claessen, N., Weening, J. J., Sonnenberg, A. (2002). Association of the tetraspanin CD151 with the laminin-binding integrins {alpha}3{beta}1, {alpha}6{beta}1, {alpha}6{beta}4 and {alpha}7{beta}1 in cells in culture and in vivo. J. Cell Sci. 115: 1161-1173 [Abstract] [Full Text]  
• Thyboll, J., Kortesmaa, J., Cao, R., Soininen, R., Wang, L., Iivanainen, A., Sorokin, L., Risling, M., Cao, Y., Tryggvason, K. (2002). Deletion of the Laminin {alpha}4 Chain Leads to Impaired Microvessel Maturation. Mol. Cell. Biol. 22: 1194-1202 [Abstract] [Full Text]  
• Andrews, K. L., Mudd, J. L., Li, C., Miner, J. H. (2002). Quantitative Trait Loci Influence Renal Disease Progression in a Mouse Model of Alport Syndrome. Am. J. Pathol. 160: 721-730 [Abstract] [Full Text]  
• Bonner, J., O'Connor, T. P. (2001). The Permissive Cue Laminin Is Essential for Growth Cone Turning In Vivo. J. Neurosci. 21: 9782-9791 [Abstract] [Full Text]  
• Oksanen, J., Sorokin, L.M., Virtanen, I., Hormia, M. (2001). The Junctional Epithelium around Murine Teeth differs from Gingival Epithelium in its Basement Membrane Composition. JDR 80: 2093-2097 [Abstract]  
• Miner, J. H. (2001). Mystery solved: discovery of a novel integrin ligand in the developing kidney. JCB 154: 257-260 [Abstract] [Full Text]  
• Ljubimova, J. Y., Lakhter, A. J., Loksh, A., Yong, W. H., Riedinger, M. S., Miner, J. H., Sorokin, L. M., Ljubimov, A. V., Black, K. L. (2001). Overexpression of {alpha}4 Chain-containing Laminins in Human Glial Tumors Identified by Gene Microarray Analysis. Cancer Res. 61: 5601-5610 [Abstract] [Full Text]  
• Määttä, M., Virtanen, I., Burgeson, R., Autio–Harmainen, H. (2001). Comparative Analysis of the Distribution of Laminin Chains in the Basement Membranes in Some Malignant Epithelial Tumors: The {{alpha}}1 Chain of Laminin Shows a Selected Expression Pattern in Human Carcinomas. J. Histochem. Cytochem. 49: 711-726 [Abstract] [Full Text]  
• PONCE, M. L., NOMIZU, M., KLEINMAN, H. K. (2001). An angiogenic laminin site and its antagonist bind through the {alpha}v{beta}3 and {alpha}5{beta}1 integrins. FASEB J. 15: 1389-1397 [Abstract] [Full Text]  
• St. John, P. L., Wang, R., Yin, Y., Miner, J. H., Robert, B., Abrahamson, D. R. (2001). Glomerular laminin isoform transitions: errors in metanephric culture are corrected by grafting. Am. J. Physiol. Renal Physiol. 280: F695-F705 [Abstract] [Full Text]  
• KASHTAN, C. E., KIM, Y., LEES, G. E., THORNER, P. S., VIRTANEN, I., MINER, J. H. (2001). Abnormal Glomerular Basement Membrane Laminins in Murine, Canine, and Human Alport Syndrome: Aberrant Laminin {{alpha}}2 Deposition Is Species Independent. J. Am. Soc. Nephrol. 12: 252-260 [Abstract] [Full Text]  
• Spessotto, P., Yin, Z., Magro, G., Deutzmann, R., Chiu, A., Colombatti, A., Perris, R. (2001). Laminin Isoforms 8 and 10 Are Primary Components of the Subendothelial Basement Membrane Promoting Interaction with Neoplastic Lymphocytes. Cancer Res. 61: 339-347 [Abstract] [Full Text]  
• Geberhiwot, T, Assefa, D, Kortesmaa, J, Ingerpuu, S, Pedraza, C, Wondimu, Z, Charo, J, Kiessling, R, Virtanen, I, Tryggvason, K, Patarroyo, M (2001). Laminin-8 (alpha4beta1gamma1) is synthesized by lymphoid cells, promotes lymphocyte migration and costimulates T cell proliferation. J. Cell Sci. 114: 423-433 [Abstract]  
• Gonzales, M., Weksler, B., Tsuruta, D., Goldman, R. D., Yoon, K. J., Hopkinson, S. B., Flitney, F. W., Jones, J. C. R. (2001). Structure and Function of a Vimentin-associated Matrix Adhesion in Endothelial Cells. Mol. Biol. Cell 12: 85-100 [Abstract] [Full Text]  
• Siler, U., Seiffert, M., Puch, S., Richards, A., Torok-Storb, B., Muller, C. A., Sorokin, L., Klein, G. (2000). Characterization and functional analysis of laminin isoforms in human bone marrow. Blood 96: 4194-4203 [Abstract] [Full Text]  
• Fischer, E., Mougenot, B., Callard, P., Ronco, P., Rossert, J. (2000). Abnormal expression of glomerular basement membrane laminins in membranous glomerulonephritis. Nephrol Dial Transplant 15: 1956-1964 [Abstract] [Full Text]  
• Pierce, R. A., Griffin, G. L., Miner, J. H., Senior, R. M. (2000). Expression Patterns of Laminin alpha 1 and alpha 5 in Human Lung during Development. Am. J. Respir. Cell Mol. Bio. 23: 742-747 [Abstract] [Full Text]  
• Pedraza, C., Geberhiwot, T., Ingerpuu, S., Assefa, D., Wondimu, Z., Kortesmaa, J., Tryggvason, K., Virtanen, I., Patarroyo, M. (2000). Monocytic Cells Synthesize, Adhere to, and Migrate on Laminin-8 ({alpha}4{beta}1{gamma}1). J. Immunol. 165: 5831-5838 [Abstract] [Full Text]  
• Cosgrove, D., Rodgers, K., Meehan, D., Miller, C., Bovard, K., Gilroy, A., Gardner, H., Kotelianski, V., Gotwals, P., Amatucci, A., Kalluri, R. (2000). Integrin {alpha}1{beta}1 and Transforming Growth Factor-{beta}1 Play Distinct Roles in Alport Glomerular Pathogenesis and Serve as Dual Targets for Metabolic Therapy. Am. J. Pathol. 157: 1649-1659 [Abstract] [Full Text]  
• Erickson, A. C., Couchman, J. R. (2000). Still More Complexity in Mammalian Basement Membranes. J. Histochem. Cytochem. 48: 1291-1306 [Abstract] [Full Text]  
• Libby, R. T., Champliaud, M.-F., Claudepierre, T., Xu, Y., Gibbons, E. P., Koch, M., Burgeson, R. E., Hunter, D. D., Brunken, W. J. (2000). Laminin Expression in Adult and Developing Retinae: Evidence of Two Novel CNS Laminins. J. Neurosci. 20: 6517-6528 [Abstract] [Full Text]  
• Andrews, K. L., Betsuyaku, T., Rogers, S., Shipley, J. M., Senior, R. M., Miner, J. H. (2000). Gelatinase B (MMP-9) Is Not Essential in the Normal Kidney and Does Not Influence Progression of Renal Disease in a Mouse Model of Alport Syndrome. Am. J. Pathol. 157: 303-311 [Abstract] [Full Text]  
• Orian-Rousseau, V, Aberdam, D, Rousselle, P, Messent, A, Gavrilovic, J, Meneguzzi, G, Kedinger, M, Simon-Assmann, P (2000). Human colonic cancer cells synthesize and adhere to laminin-5. Their adhesion to laminin-5 involves multiple receptors among which is integrin alpha2beta1. J. Cell Sci. 111: 1993-2004 [Abstract]  
• Kortesmaa, J., Yurchenco, P., Tryggvason, K. (2000). Recombinant Laminin-8 (alpha 4beta 1gamma 1). PRODUCTION, PURIFICATION, AND INTERACTIONS WITH INTEGRINS. J. Biol. Chem. 275: 14853-14859 [Abstract] [Full Text]  
• Nielsen, P. K., Gho, Y. S., Hoffman, M. P., Watanabe, H., Makino, M., Nomizu, M., Yamada, Y. (2000). Identification of a Major Heparin and Cell Binding Site in the LG4 Module of the Laminin alpha 5 Chain. J. Biol. Chem. 275: 14517-14523 [Abstract] [Full Text]  
• Piras, G., El Kharroubi, A., Kozlov, S., Escalante-Alcalde, D., Hernandez, L., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Stewart, C. L. (2000). Zac1 (Lot1), a Potential Tumor Suppressor Gene, and the Gene for varepsilon -Sarcoglycan Are Maternally Imprinted Genes: Identification by a Subtractive Screen of Novel Uniparental Fibroblast Lines. Mol. Cell. Biol. 20: 3308-3315 [Abstract] [Full Text]  
• Oliviero, P., Chassagne, C., Salichon, N., Corbier, A., Hamon, G., Marotte, F., Charlemagne, D., Rappaport, L., Samuel, J.-L. (2000). Expression of laminin {alpha}2 chain during normal and pathological growth of myocardium in rat and human. Cardiovasc Res 46: 346-355 [Abstract] [Full Text]  
• Sunderland, W. J., Son, Y.-J., Miner, J. H., Sanes, J. R., Carlson, S. S. (2000). The Presynaptic Calcium Channel Is Part of a Transmembrane Complex Linking a Synaptic Laminin (alpha 4beta 2gamma 1) with Non-Erythroid Spectrin. J. Neurosci. 20: 1009-1019 [Abstract] [Full Text]  
• Son, Y.-J., Scranton, T. W., Sunderland, W. J., Baek, S. J., Miner, J. H., Sanes, J. R., Carlson, S. S. (2000). The Synaptic Vesicle Protein SV2 Is Complexed with an alpha 5-Containing Laminin on the Nerve Terminal Surface. J. Biol. Chem. 275: 451-460 [Abstract] [Full Text]  
• Furuyama, A, Mochitate, K (2000). Assembly of the exogenous extracellular matrix during basement membrane formation by alveolar epithelial cells in vitro. J. Cell Sci. 113: 859-868 [Abstract]  
• Kikkawa, Y, Sanzen, N, Fujiwara, H, Sonnenberg, A, Sekiguchi, K (2000). Integrin binding specificity of laminin-10/11: laminin-10/11 are recognized by alpha 3 beta 1, alpha 6 beta 1 and alpha 6 beta 4 integrins. J. Cell Sci. 113: 869-876 [Abstract]  
• Relan, N. K., Yang, Y., Beqaj, S., Miner, J. H., Schuger, L. (1999). Cell Elongation Induces Laminin {alpha}2 Chain Expression in Mouse Embryonic Mesenchymal Cells: Role in Visceral Myogenesis. JCB 147: 1341-1350 [Abstract] [Full Text]  
• Skyldberg, B., Salo, S., Eriksson, E., Aspenblad, U., Moberger, B., Tryggvason, K., Auer, G. (1999). Laminin-5 as a Marker of Invasiveness in Cervical Lesions. JNCI J Natl Cancer Inst 91: 1882-1887 [Abstract] [Full Text]  

This Article Abstract Full Text (PDF, 2241K) PPT slides of all figures Alert me when this article is cited Citation Map Services Email this article Similar articles in this journal Similar articles in PubMed Alert me to new content in the JCB Download to citation manager Citing Articles Citing Articles via HighWire Citing Articles via CrossRef Citing Articles via Google Scholar Google Scholar Articles by Miner, J. H. Articles by Sanes, J. R. Search for Related Content PubMed PubMed Citation Articles by Miner, J. H. Articles by Sanes, J. R. Pubmed/NCBI databases Gene GEO Profiles HomoloGene OMIM Protein UniGene Substance via MeSH Social Bookmarking                            What's this?