|
||
Chains: Expression, Developmental Transitions,
and Chromosomal Locations of
1-5, Identification of
Heterotrimeric Laminins 8-11, and Cloning of a Novel
3 Isoform




* Department of Anatomy and Neurobiology,
Department of Internal Medicine (Renal Division), § Department of Neurology,
Washington University School of Medicine, St. Louis, Missouri, 63110; and
Mammalian Genetics Laboratory, ABL-Basic
Research Program, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, Maryland 21702
Laminin trimers composed of
,
, and
chains are major components of basal laminae (BLs)
throughout the body. To date, three
chains (
1-3)
have been shown to assemble into at least seven heterotrimers (called laminins 1-7). Genes encoding two
additional
chains (
4 and
5) have been cloned, but
little is known about their expression, and their protein
products have not been identified. Here we generated
antisera to recombinant
4 and
5 and used them to
identify authentic proteins in tissue extracts. Immunoprecipitation and immunoblotting showed that
4 and
5 assemble into four novel laminin heterotrimers
(laminins 8-11:
4
1
1,
4
2
1,
5
1
1, and
5
2
1,
respectively). Using a panel of nucleotide and antibody probes, we surveyed the expression of
1-5 in murine
tissues. All five chains were expressed in both embryos
and adults, but each was distributed in a distinct pattern
at both RNA and protein levels. Overall,
4 and
5 exhibited the broadest patterns of expression, while expression of
1 was the most restricted. Immunohistochemical analysis of kidney, lung, and heart showed
that the
chains were confined to extracellular matrix
and, with few exceptions, to BLs. All developing and
adult BLs examined contained at least one
chain, all
chains were present in multiple BLs, and some BLs
contained two or three
chains. Detailed analysis of
developing kidney revealed that some individual BLs,
including those of the tubule and glomerulus, changed
in laminin chain composition as they matured, expressing up to three different
chains and two different
chains in an elaborate and dynamic progression. Interspecific backcross mapping of the five
chain genes revealed that they are distributed on four mouse chromosomes. Finally, we identified a novel full-length
3
isoform encoded by the Lama3 gene, which was previously believed to encode only truncated chains. Together, these results reveal remarkable diversity in BL
composition and complexity in BL development.
Laminins are components of all basal laminae (BLs)1
throughout the bodies of vertebrates and invertebrates. In mammals they play at least three essential roles. First, they are major structural elements of BLs,
forming one of two self-assembling networks (the other is
composed of the collagens IV) to which other glycoproteins and proteoglycans of the BL attach (for review see
Yurchenco and O'Rear, 1994 Laminin was initially isolated from tumor cells as a heterotrimer of A, B1, and B2 subunits (Chung et al., 1979 Here we focus on the Despite their importance, limited information is available about the distribution of the Isolation of cDNAs
Laminin Laminin RNA Analyses
RNA was prepared from mouse tissues by acid guanidinium phenol/chloroform extraction (Chomczynski and Sacchi, 1987 Antibodies
Rat mAbs to mouse laminin To generate antibodies to the laminin Immunohistochemistry
Mouse tissues were frozen fresh and sectioned at 4-8 µm on a cryostat.
Antibodies were diluted in 1% (wt/vol) BSA in PBS and incubated on sections for 1-2 h. After rinsing off unbound primary antibody with PBS, secondary antibodies were applied for 1-2 h. Sections were rinsed again, and
then mounted in glycerol-para-phenylenediamine and observed with epifluorescent illumination. Since the laminin Western Blots and Immunoprecipitations
For immunoblotting, tissues from rat were used because a greater range of
mAbs was available against rat than against mouse laminin Samples were solubilized by boiling in SDS gel loading buffer with or
without DTT. The proteins were then separated by SDS-PAGE and
transferred to nitrocellulose using standard methods. Fusion proteins, reduced native laminins, and nonreduced native laminins were separated on
12%, 7%, and 3.5% polyacrylamide gels, respectively. After blotting, filters were blocked with nonfat dry milk/0.3% Tween-20 in PBS, and then
incubated with antibodies overnight. For detecting the fusion proteins, antisera were preadsorbed to an unrelated fusion protein containing the
common pET 23 leader and His tag sequences. Bound antibodies were
detected with either HRP-conjugated second antibody (for rabbit) or biotinylated second antibody with HRP-conjugated Z-avidin (Zymed Laboratories, South San Francisco, CA) (for guinea pig), and Renaissance
chemiluminescent substrate (DuPont/New England Nuclear, Boston, MA).
For immunoprecipitations, laminins were first partially purified from
adult rat lung by the protocol of Lindblom et al. (1994) Laminins were immunoprecipitated essentially by the method of Green
et al. (1992) Interspecific Mouse Backcross Mapping
Interspecific backcross progeny were generated by mating (C57BL/6J × Mus spretus) F1 females and C57BL/6J males as described (Copeland and
Jenkins, 1991 Descriptions of most of the probes and RFLPs for the loci used to position the Lama loci in the interspecific backcross have been reported.
These include: Gnas, chromosome 2 (Wilkie et al., 1992 The Laminin The
The only laminin gene so far shown to encode more
than a single polypeptide is the laminin
There is a discrepancy between our sequence and that of
Galliano et al. (1995) Differential Expression of Laminin As a first step in assessing the distribution of the laminin
We next tested RNAs prepared from the same tissues
but at a late fetal (E17.5) stage. In general, patterns of expression seen in the fetus were similar to those seen in
adults, although levels of expression were generally higher
in the fetus (Fig. 3 B). Laminin To map
When compared with the RNase protection results from
E17.5 (Fig. 3 B), it is apparent that the main sites of expression are already established by E15.5: Identification of Laminin The
To detect laminin The Mr of the anti- Cellular Distribution of Laminin The laminin Laminin
To extend these studies, we examined two other BL-rich
tissues, heart and lung. As in kidney, the laminin Several conclusions can be drawn from these results.
First, all laminin Finally, it is interesting to compare the distribution of
the individual Developmental Transitions in Laminin
We next used our panel of antisera to ask when developing BLs acquire their complement of laminin
Nephrogenesis begins when the epithelial ureteric bud
grows out of the mesonephric duct, invades loose metanephric mesenchyme, and induces it to condense into a
sphere (Fig. 7 A). The condensed mesenchyme then epithelializes, forming a vesicle, and secretes a BL around its
periphery (Fig. 7 B). One side of the vesicle and then the
other invaginates to form, successively, a comma-shaped and an S-shaped figure (Fig. 7, C and D); during this process, a blood vessel invades the primary invagination.
Next, the distal portion of the S-shaped body fuses with
the ureteric bud to form the tubule, and the invading vessel branches within the widening invagination to form the
rudimentary capillary loops of the glomerulus (Fig. 7 E).
Further ramification of the capillary loops and their enclosure by glomerular constriction lead successively to the immature and mature glomeruli (Fig. 7, F and G). Multiple
waves of induction of cortical mesenchyme by the branching
and lengthening ureteric bud make nephrogenesis a graded
process that continues from E11 until postnatally, with
newly forming nephrons just beneath the cortical surface
and more mature stages at increasingly deep levels (Abrahamson, 1991 To search for potential developmental transitions in
laminin
At the S-shaped stage, distinct portions of the nephron
that will give rise to the glomerular filtration apparatus,
Bowman's capsule, and the tubule can be distinguished.
Interestingly, BLs in each of these regions bore a different
complement of laminin As summarized in Fig. 7, E-G, and documented in Fig.
8, d, g, and h, each stretch of BL underwent further
changes in laminin It is interesting to compare the laminin To determine whether the isoform transitions detected
at the protein level reflected regulation of gene expression, we performed in situ hybridizations on P1 kidney sections using probes for the
Identification of Heterotrimers Containing the Laminin
Current understanding of the structure and function of
BLs is based on the assumption that all laminins are heterotrimers of Table I.
Composition of Laminin Trimers
To definitively identify the Parallel results were obtained from material precipitated by antibodies to laminin Two observations indicated that the complexes containing Chromosomal Mapping of Lama Genes
The murine chromosomal locations of Lama1-Lama5
were determined using an interspecific backcross mapping
panel derived from crosses of [(C57BL/6J × M. spretus)
F1 X C57BL/6J] mice. Mouse genomic or cDNA fragments
specific for each locus were used as probes in Southern
blot hybridization analysis of C57BL/6J and M. spretus genomic DNA that was separately digested with several different restriction enzymes to identify informative RFLPs
(see Materials and Methods). The strain distribution pattern of each RFLP in the interspecific backcross was then
determined by following the presence or absence of
RFLPs specific for M. spretus in backcross mice.
Backcross mapping refined previously reported chromosomal locations for Lama1-3 and provided the first data
on mouse chromosomal locations of Lama4 and Lama5
(Fig. 11). Lama1 has previously been reported to map to
the distal region of mouse chromosome 17 in this interspecific backcross (Okazaki et al., 1993
Previous studies have shown that the Lama2 gene encodes the dystrophia muscularis (dy) mouse mutation (Sunada et al., 1994 Several of the LAMA genes have also been mapped to
human chromosomes (summarized in Fig. 11). LAMA1
maps to human 18p11.32-p11.22, LAMA2 to 6q22-q23,
LAMA3 to 18q11.2, and LAMA4 to 6q21. LAMA1 is currently the only gene that maps to human chromosome 18 and mouse chromosome 17. Thus, LAMA1 defines a new
region of homology between mouse and human chromosomes. In contrast, the mouse and human map locations of
LAMA2-4 confirm and extend the known regions of homology between mouse and human chromosomes (Fig. 11;
data not shown). LAMA5 has not been mapped in humans. However, the distal region of mouse chromosome 2 shares a region of homology with human chromosome
20q13, suggesting that LAMA5 will map to 20q13 in humans, as well. As noted in the Introduction, the LAMA2 gene is mutated in some congenital muscular dystrophies,
and the LAMA3 gene is mutated in a subset of patients
with a skin blistering disease, junctional epidermolysis
bullosa. No human mutations that suggest a BL defect map
to the vicinity of the human LAMA1 or LAMA4 locus or
to the predicted LAMA5 locus.
Conclusion
The laminins are major components of BLs throughout
the body, and their (1) The (2) All five of the laminin (3) All developing and adult BLs studied to date contain
at least one of the known (4) Laminin (5) The main patterns of (6) Laminins (7) The five The patterns of expression that we have documented indicate that the Note Added in Proof. A third
; Timpl, 1996
). Second, they
interact with cell surface components such as dystroglycan
to attach cells to the extracellular matrix (for review see
Henry and Campbell, 1996
). Third, they are signaling molecules that interact with cellular receptors such as the integrins to convey morphogenetically important information to the cell's interior (for review see Clark and Brugge,
1995
; Mercurio, 1995
; Yamada and Miyamoto, 1995
). For
example, laminin promotes myogenesis in skeletal muscle,
outgrowth of neurites from central and peripheral neurons, and mesenchymal to epithelial transitions in kidney
(Foster et al., 1987
; Klein et al., 1988
; Reichardt and Tomaselli, 1991
; Vachon et al., 1996
).
;
Timpl et al., 1979
), later renamed
1,
1, and
1 (Burgeson et al., 1994
). Molecular cloning revealed that the three
subunits were encoded by distinct but homologous genes
(Martin and Timpl, 1987
). Subsequently, homologues of
the
1 chain (merosin, or
2; Ehrig et al., 1990
) and the
1
chain (s-laminin, or
2; Hunter et al., 1989b
) were isolated,
revealing a previously unsuspected heterogeneity of laminins. Five additional laminin chains have now been identified, all of which clearly belong to the
,
, or
subfamilies
(
3-5,
3, and
2; Kallunki et al., 1992
; Ryan et al., 1994
;
Aberdam et al., 1994b
; Richards et al., 1994
; Gerecke et
al., 1994
; Miner et al., 1995
). All native laminins isolated to
date are composed of one
, one
, and one
chain, and
seven distinct heterotrimers have been identified (for review see Engvall and Wewer, 1996
). The existence of multiple chains that oligomerize with a defined stoichiometry
provides a means to generate functional diversity within a
common structural framework (Sanes et al., 1990
).
subfamily of laminin chains. This
is the largest subfamily, with five members identified to
date in mammals. Interactions of cells with laminin
chains
are critical for cell-matrix interactions. For example, at least
six distinct integrin heterodimers (
1
1,
2
1,
3
1,
6
1,
7
1, and
v
3), as well as dystroglycan, heparin, and the
adhesion molecule-associated glycoconjugate HNK-1/L2,
bind to sites on laminin
chains (Rao and Kefalides, 1990
;
Gee et al., 1993
; Hall et al., 1993
; Sung et al., 1993
; Mercurio, 1995
; Mecham and Hinek, 1996
; Colognato, H., and
P.D. Yurchenco. 1996. Mol. Biol. Cell. 7(Suppl.):67a). Moreover, both dystroglycan and some integrins can distinguish amongst different
chains, suggesting that
chain diversity is functionally significant (Mercurio, 1995
; Pall et al.,
1996
). In direct support of this notion, mutations in two
chains,
2 and
3, lead to congenital muscular dystrophy
and junctional epidermolysis bullosa, respectively (Sunada
et al., 1994
; Xu et al., 1994
; Helbling-Leclerc et al., 1995
;
McGrath et al., 1995
). In Drosophila, mutation of the only
known laminin
chain is embryonically lethal, leading to
defects in numerous tissues (Henchcliffe et al., 1993
; Yarnitzky and Volk, 1995
; Garcia-Alonso et al., 1996
).
chains (see, e.g., Engvall et al., 1990
; Sanes et al., 1990
; Vuolteenaho et al., 1994
;
Virtanen et al., 1995
, 1996
). Moreover, the
1 chain has
been studied most intensively in human tissues with a single mAb (4C7; Engvall et al., 1986
, 1990) whose specificity
for
1 has been questioned (Ekblom, 1996
). For the recently discovered
4 and
5 chains, no direct evidence has
been presented to show that they form heterotrimers, and
no data on cellular localization have been reported. Accordingly, we have generated and characterized antibodies
to the
4 and
5 chains and used them to identify four
novel laminin heterotrimers: laminin-8 (
4
1
1), laminin-9
(
4
2
1), laminin-10 (
5
1
1), and laminin-11 (
5
2
1).
Using a panel of antibodies and cDNA probes, we analyzed the distribution of all five laminin
chains in embryonic and adult mice. We show that the
chains are expressed in overlapping but distinct patterns, with each BL
containing at least one of the known
chains. Moreover,
we demonstrate that some individual BLs contain different complements of
chains at distinct stages of their development. Finally, we identify a novel isoform of
3 and
report the chromosomal locations of all five
chains in mice.
Materials and Methods
3B.
We performed the reverse transcription-coupled PCR
(RT-PCR) using embryonic day (E) 17.5 mouse lung RNA and primers designed to amplify sequences encoding the NH2-terminal portion of domain VI of laminin
5. Surprisingly, the reaction generated a novel 209-bp
fragment that was similar but not identical to known
chains. We hypothesized that this fragment could be part of a laminin
3B cDNA extending
5
of that reported by Galliano et al. (1995)
. To test this hypothesis, two
primers were used in RT-PCR from adult lung RNA to attempt to amplify
the potentially intervening cDNA: sense, 5
AGCGGGACCCAGAGGTC3
(from the novel product); antisense, 5
TGCCTCACAGACAATCTCACC3
(from near the 5
end of the sequence in Galliano et al.
[1995]). RT-PCR conditions were as described (Miner and Sanes, 1994
),
with the addition of Taq Extender PCR Additive (Stratagene Cloning
Systems, La Jolla, CA). A 2.2-kb fragment was sequenced with a Taq
DyeDeoxy Terminator cycle sequencing kit (Applied Biosystems, Inc.,
Foster City, CA), and sequence was analyzed on the BLAST server at the
National Center for Biotechnology Information (Altschul et al., 1990
). Sequence was obtained from multiple clones to resolve errors introduced by
Taq polymerase amplification.
4.
A mouse laminin
4 cDNA fragment was amplified by
RT-PCR from E17.5 placenta using degenerate primers based on the human amino acid sequence (Richards et al., 1994
). The primers, designed to amplify the mouse segment homologous to nucleotides 1,800-2,607, were:
sense, 5
TCNATGATGTTYGAYGGNCARTC3
; antisense, 5
CGNCCRCTRCTRAANCCRAARTC3
. The fragment was isolated on a low melting point gel and ligated into the pCRII vector (Invitrogen, San Diego,
CA). The DNA and deduced amino acid sequences were determined and
have been deposited into GenBank under accession number U88352.
). RNase protections
were performed as described (Miner and Wold, 1991
) using [32P]UTP-labeled probes and 5 µg (E17.5) or 7.5 µg (adult) of total RNA per hybridization. A probe for elongation factor 1
was included to control for the
quality and amount of input RNA. For Northern analysis, a filter containing poly(A)-selected RNA from several adult mouse tissues (Clontech,
Palo Alto, CA) was hybridized according to the manufacturer's instructions. In situ hybridizations were performed with 35S-UTP-labeled probes
as described (Lentz et al., 1997
). The laminin
chain probes used for
RNase protection assays and in situ hybridizations were as described (Lentz
et al., 1997
).
1 (clones 198 and 200; Sorokin et al., 1992
)
were gifts from Lydia Sorokin (Institute for Experimental Medicine, Erlangen, Germany). A rabbit antiserum to human laminin
2 cross-reactive
with the mouse protein (Vachon et al., 1996
) was kindly provided by Peter
Yurchenco (Robert Wood Johnson Medical School, Piscataway, NJ). A
rabbit antiserum to mouse laminin
3 (Aberdam et al., 1994a
,b) was a gift
from Daniel Aberdam (INSERM U385, Nice, France). Mouse mAbs to
rat laminin chains
1 (C21, C22),
2 (D7, D19, D27), and
1 (D18) were
produced and characterized in our laboratory and have been described
previously (Sanes and Chiu, 1983
; Hunter et al., 1989b
; Sanes et al., 1990
;
Green et al., 1992
). A guinea pig antiserum against a recombinant COOHterminal fragment of laminin
2 was produced as described (Sanes et al., 1990
). A rat mAb to laminin
1 was purchased from Chemicon (Temecula, CA). Second antibodies were purchased as follows: fluorescein- and
HRP-conjugated goat anti-rabbit antibodies from Boehringer Mannheim
Biochemicals (Indianapolis, IN); fluorescein-conjugated goat anti-rat antibodies from Cappel/Organon Teknika (Durham, NC); Cy3-conjugated
goat anti-rabbit antibodies from Jackson ImmunoResearch Laboratories
(West Grove, PA); biotinylated goat anti-guinea pig antibodies from
Sigma Chemical Co. (St. Louis, MO).
4 and
5 chains, the laminin
4
cDNA described above, another containing nucleotides 3,670-4,391 (described in Lentz et al., 1997
), and a laminin
5 fragment comprising nucleotides 4,243-4,926 (SacI to EcoRV) were each cloned in frame into the
pET 23 vector (Novagen, Madison, WI). Proteins were produced in
BL21(DE3) bacteria, and inclusion bodies were isolated according to a
protocol supplied by Novagen. Fusion proteins were gel isolated as described (Miner and Sanes, 1994
) and used to immunize rabbits (Caltag,
Healdsburg, CA). For both
4 and
5, two separately immunized rabbits
generated antisera that displayed qualitatively similar patterns of reactivity on both sections and immunoblots. The higher titer antiserum to each immunogen was used for the studies reported here.
4 antisera only recognized denatured antigen, the following protocol was used when staining with these
antibodies: sections were fixed in 2% paraformaldehyde in PBS for 20 min, rinsed in PBS, incubated with 100 mM glycine in PBS for 10 min, incubated in 0.05% SDS in PBS for 30 min at 50°C, and then rinsed in PBS
before the antibody was applied. Anti-
5 stained untreated and SDS-
denatured sections in qualitatively similar patterns.
and
chains
(see above). Lungs and kidneys from saline-perfused adult rats were homogenized in ice-cold 40 mM Tris, pH 7.5, 15 mM NaCl, and 2 mM CaCl2
(H buffer) containing protease inhibitors (0.1 mM PMSF, 1 mM benzamidine, and 1 µg/ml soybean trypsin inhibitor) using a Polytron. Crude membrane fractions were recovered at 20,000 g, washed once with H buffer
containing PMSF, resuspended in H buffer containing 10 mM EDTA, 2 mM EGTA, PMSF, and soybean trypsin inhibitor (H+E buffer), and
stored at
10°C. To improve immunoblotting sensitivity for BL components, the crude pellet was extracted by brief sonication in H+E buffer
with 0.1 M NaCl and 1% Triton X-100, pelleted at 50,000 g, and resuspended in H+E buffer. However, data qualitatively similar to those presented in Results were obtained with the crude pellet. Protein content was
assayed with bicinchoninic acid reagents (Pierce Chemical Co., Rockford,
IL) using BSA as a standard. Purified Engelbreth-Holm-Swarm (EHS) laminin-1 was obtained from Gibco BRL (Gaithersburg, MD).
, modified as follows: crude membranes were prepared as described above, and then extracted repeatedly over 12 h with 50 mM Tris, pH 7.5, 0.15 M NaCl, 10 mM EDTA, and 10 mM EGTA (TBS/EDTA). The pooled extracts were
diluted to 90 mM NaCl, adjusted to pH 8.3, and loaded onto a DEAE-
Sepharose CL-4B column (Pharmacia, Uppsala, Sweden). The column was
eluted with 1.0 M NaCl, and fractions containing laminin
2 (detected
by immunoblotting) were pooled and brought to 50% saturation with ammonium sulfate. Precipitated material was resuspended in TBS/EDTA,
brought to 10% glycerol, 0.6 M KCl, and 0.05% Tween-20, and then fractionated on a Sepharose CL-4B column. Fractions containing laminin
2
were pooled and passed through CM-Sepharose CL-6B; the flow-through
was resubjected to DEAE-Sepharose chromatography. Protein eluted
with 0.5 M NaCl was stored at
70°C with 0.1 mM PMSF. Protein was
measured by Bradford assay (Bio Rad Laboratories, Hercules, CA). SDSPAGE of this fraction under reducing conditions displayed a heterogeneous population of proteins >180 kD, along with the laminin-binding protein entactin (150 kD) as a major constituent.
, modified as follows: laminin samples were incubated with anti
1 mAbs (a mixture of C21 and C22) or anti-
2 antibodies (a mixture of D7,
D19, and D27) in 50 mM Tris, pH 8.0, 100 mM NaCl, 2 mM EDTA, 1%
NP-40, and 0.05% sodium deoxycholate (IP buffer). Immune complexes
were isolated using protein A-Sepharose 4B (Pharmacia) that was preblocked with 4 mg/ml IgG-free BSA (Sigma Chemical Co.) and washed in
IP buffer. Rabbit anti-mouse IgG (Fc) antibodies (Jackson ImmunoResearch Laboratories) were included to bridge mAbs to protein A. Precipitated laminins were dissolved by boiling in SDS-PAGE sample buffer,
separated by SDS-PAGE, and then detected by Western blotting as above.
). DNA isolation, restriction enzyme digestion, agarose gel
electrophoresis, and Southern blot transfer and hybridization were performed essentially as described (Jenkins et al., 1982
). All blots were prepared with Zetabind nylon membrane (Cuno, Inc., Meriden, CT). Probes,
which were specific for each locus, were labeled with [32P]dCTP using a
random primed labeling kit (Amersham Corp., Arlington Heights, IL) or
a nick translation labeling kit (Boehringer Mannheim Biochemicals); washing was done to a final stringency of 0.8-1.0 × SSC and 0.1% SDS at 65°C.
The probe and restriction fragment length polymorphisms (RFLPs) for
Lama1 have been described previously (Okazaki et al., 1993
). The Lama2
probe, a ~360-bp fragment of mouse cDNA from domain G, detected
fragments of 10.5 kb in C57BL/6J (B) DNA and 5.4 and 4.2 kb in M. spretus (S) DNA after digestion with PstI. The Lama3 probe, a ~500-bp fragment of mouse cDNA from domains I/II, detected EcoRV fragments of
10.5 kb (B) and ~23.0 kb (S). A second probe, a genomic clone containing
a portion of domain VI of laminin
3B, gave results identical to those
obtained with the domain I/II probe. The Lama4 probe, a ~800-bp fragment of mouse cDNA from domain G, detected BglII fragments of 4.4 and 1.7 kb (B) and 6.0 kb (S). The Lama5 probe, a ~7.5-kb fragment of
mouse genomic DNA from domains V and IVb, detected BamHI fragments of 4.2, 3.7, and 3.3 kb (B) and 4.2, 3.3, 2.3, and 1.8 kb (S). The presence or absence of M. spretus-specific fragments was followed in backcross mice. A total of 205 N2 mice were used to map each Lama locus.
); Myb, Fyn, and
Ros1, chromosome 10 (Justice et al., 1990
); Fert and Tik, chromosome 17 (Fishel et al., 1993
; Okazaki et al., 1993
); and Tpl2, Cdh2, and Ttr, chromosome 18 (Justice et al., 1992
, 1994). One locus has not been reported previously for this interspecific backcross: the Mc3r probe, a 2.0-kb BamHI/
XhoI fragment of mouse cDNA, was kindly provided by Roger Cone
(Vollum Institute, Portland, OR) and detected SphI fragments of 3.5 kb (B) and 5.9 kb (S). Recombination distances were calculated as described
(Green, 1981
) using the computer program SPRETUS MADNESS. Gene
order was determined by minimizing the number of recombination events
required to explain the allele distribution patterns.
Results and Discussion
Chain Family: Identification of
Full-Length
3
subfamily of laminin chains currently contains five
members. Fig. 1 shows the domain structure of these chains
based on the nomenclature of Sasaki et al. (1988)
. All
chains contain a carboxyl-terminal globular G domain and
-helical domains I and II. The previously described fulllength
1 and
2 chains contain six additional domains
(IIIa-VI) that alternate between cysteine-rich stretches
containing EGF-like repeats (IIIa, IIIb, and V) and globular regions (IVa, IVb, and VI) (Engvall and Wewer, 1996
). The newest member of the family,
5, is also a full-length
chain, but it is larger than
1 or
2, owing to the greater
number of EGF-like repeats in domain V and a larger domain IVb (Miner et al., 1995
). In contrast, laminins
3A and
4 are severely truncated chains that contain only a single
cysteine-rich domain (IIIa) downstream of a short aminoterminal domain (Ryan et al., 1994
; Galliano et al., 1995
;
Iivanainen et al., 1995
; Richards et al., 1996
). Of the vertebrate
chains,
5 may be most like the ancestral
chain,
because of its similarity in both domain structure and sequence to the only known invertebrate
chain, Drosophila A (Miner et al., 1995
).
Fig. 1.
The laminin
chain subfamily. Numbering of domains
is based on accepted nomenclature (Sasaki et al., 1988
; Engvall
and Wewer, 1996
). Numbers of laminin-type cysteine-rich (EGFlike) repeats, rounded to the nearest integer, are indicated within
each domain IIIa, IIIb, or V. Note that laminins
3A and
3B
share domains G, I/II, and IIIa but have distinct NH2 termini.
[View Larger Version of this Image (23K GIF file)]
3 gene. The two
known products,
3A and
3B, differ at their amino termini, resulting from alternative splicing and/or alternative
promoter usage. The shorter
3A chain was the first to be
identified by both immunological methods (Rousselle et al.,
1991
) and by cDNA cloning (Aberdam et al., 1994b
). Subsequently, however, multiple
3 cDNAs were identified in
human (Ryan et al., 1994
) and mouse (Galliano et al., 1995
),
suggesting the existence of a second, longer isoform called
3B. Sequence analysis (Galliano et al., 1995
) indicated
that
3B contains two cysteine-rich (IIIa and IIIb) and
two globular (IVa and IV
) domains in addition to the G
and I/II domains, but no domains V or VI. This would make it the sole "mid-sized"
chain. However, we have
obtained mouse cDNAs (see Materials and Methods) that
extend the previously reported sequence 5
by ~2.2 kb
(Fig. 2). This novel sequence encodes the NH2-terminal
portion of domain IVb, a complete domain V, and what is
likely all but a few amino acids of a domain VI. These domains are most similar in sequence and predicted tertiary structure to the analogous domains of laminin
5. For example, the amino acid sequence of domain VI is 74% identical to that of
5, but only 54 and 51% identical to those
of
1 and
2, respectively. A probe from the 5
end of this
sequence recognized ~10-kb bands on Northern blots of
mouse RNA from adult brain, lung, and kidney (data not
shown). The proposed
3B structure is shown in Fig. 1, indicating its unique NH2 terminus and the COOH terminus
it shares with
3A.
Fig. 2.
Nucleotide and deduced amino acid sequences of the
laminin
3B chain, 5
and NH2-terminal to those reported by
Galliano et al. (1995)
. Overlapping nucleotides are in lowercase.
The Galliano sequence contains a single deoxyguanosine (parentheses) not found in our sequence, which shifts the reading frame
and leads to an encoded methionine (bottom line, italics). Domains
are marked as in Fig. 1. This was hypothesized to be the initiator
for translation. An adhesive tripeptide sequence, LRE (Hunter
et al., 1989a
), is indicated by bullets; another LRE is located in
the G domain (Galliano et al., 1995
). These sequence data are
available from GenBank under accession number U88353.
[View Larger Version of this Image (86K GIF file)]
: a single base near the 5
end of their
reported sequence is absent from our cDNAs (see last line
of Fig. 2). As a result of this insertion, the methionine residue that Galliano et al. (1995)
suggested to initiate translation of
3B and the following amino acid are encoded in a
different reading frame than is the extended sequence reported here (Fig. 2). Possible explanations for this discrepancy include a polymorphism between mouse strains, alternative splicing of exons that differ by only one base,
RNA editing, sequencing error, or cDNA cloning artifact. We cannot exclude any of these possibilities, although we
consider the first three unlikely and note that our sequence, derived from multiple cDNAs, generates a single
uninterrupted open reading frame (~9.8 kb) extending
through the region of discrepancy. Therefore, we favor the
interpretation that there is no mid-sized form of laminin
3, but only the severely truncated
3A and the full-length
3B form reported here. Full-length
3B would thus contain ~3,300 amino acids and have a molecular mass of
~360 kD. Thus, the
subfamily of laminin chains currently consists of four long (
1,
2,
3B, and
5) and two
short (
3A and
4) proteins.
Chain Genes in
Embryos and Adults
chains, we performed RNase protection analyses on RNA
isolated from a set of eight adult tissues plus a late-term
(E17.5) placenta (Fig. 3 A). Laminin
1 was readily detectable only in placenta, but long autoradiographic exposures
revealed low levels in kidney. Laminin
2 RNA was present
at levels above background (yeast RNA lane) in heart,
kidney, lung, muscle, and skin. Laminin
3A/B was expressed primarily in lung, skin, and intestine, although very low levels of this RNA were also detectable in kidney. In contrast, laminin
4 RNA was present in all tissues
at low (liver) to moderate (lung) levels. Laminin
5 transcripts were also easily detectable in all tissues, although
levels were very low in liver. Thus, each laminin
chain is
expressed in a distinct pattern. Interestingly, the two most
recently discovered laminins,
4 and
5, are the most
widely expressed. The
2 and
3 chains show more restricted patterns of expression. In general,
2 levels were highest in tissues with large mesodermally derived components (skeletal and cardiac muscle), whereas
3 levels
were highest in organs that are rich in epithelia (skin, intestine, and lung). The notion that
2 and
3 are predominantly mesodermal and epithelial products, respectively,
has been proposed (Vuolteenaho et al., 1994
; Aberdam
et al., 1994a
). Finally, expression of laminin
1, the initially described
chain, was the most severely restricted of
the five.
Fig. 3.
Ribonuclease protection analysis of laminin
chain expression in (A) adult and (B) E17.5 mouse tissues. A probe for
elongation factor 1
was used to control for the amount of input
RNA in both embryos (B) and adults (not shown). Each
chain
is expressed in a distinct pattern in the adult and, in general, these
patterns are established by birth. The
5 chain is the most highly
expressed, and
1 is the most restricted. B, brain; I, intestine; H,
heart; K, kidney; Li, liver; Lu, lung; M, skeletal muscle; S, skin; P, placenta; Y, yeast RNA. The sample of E17.5 placental RNA was included in the panel of adult RNAs to allow comparison between experiments. nd, not done.
[View Larger Version of this Image (88K GIF file)]
1 was again the least
widely expressed
chain, although its RNA was readily
detected in fetal kidney as well as in placenta. Likewise,
laminins
2-5 were expressed at moderate to high levels in
a variety of tissues, consistent with patterns seen in adults. Thus, the distinct patterns of laminin
chain expression
found in adult tissues are, for the most part, established
before birth.
chain expression in younger embryos (E15.5),
we used in situ hybridization. Laminin
1 was detected in
the kidney and in the meninges of the central nervous system (Fig. 4 a). Laminin
2 was observed primarily in the
developing skeletal musculature, in dorsal root ganglia,
and in kidney (Fig. 4 b). Laminin
3A/B was strongly expressed in skin, lung, olfactory epithelium, and the superficial layers of the tongue and palate (Fig. 4 c). Laminin
4
was expressed strongly in mesenchymal tissues of the head, in dorsal root ganglia, and in intestine, and was observed
diffusely in skeletal and cardiac muscle (Fig. 4 d). Finally,
laminin
5 was expressed in a pattern similar to
3, with
additional sites of expression in salivary gland, in intestine,
and in the most superficial cells of the liver (Fig. 4 e).
Fig. 4.
In situ hybridization of laminin
chain probes to E15.5 embryo parasagittal sections. (a)
1, (b)
2, (c)
3, (d)
4, and (e)
5.
1 shows restricted expression in kidney and meninges (arrowheads);
2 and
4 show widespread expression in mesenchymal cells and
derivatives as well as in dorsal root ganglia (arrowheads); and
3 and
5 transcripts localize primarily to epithelia. (f-h) High power
views of (f)
3, (g)
4, and (h)
5 expression in lung.
3 and
5 are concentrated in the epithelial lung buds, and
4 to the mesenchyme.
H, heart; K, kidney; L, lung; SG, salivary gland; T, tongue (muscle). Bars: (d) 1 mm; (h) 50 µm.
[View Larger Version of this Image (208K GIF file)]
2 and
4 in
muscle,
3 and
5 in skin, and
3-5 in lung. There are,
however, a few differences. For example,
2 is barely detectable in heart at E15.5 but is expressed strongly at
E17.5; the presence of
4 in heart at E15.5 suggests that
there may be a developmental transition in
chain expression in the heart in which
4 is joined by
2. In addition, a
particularly interesting pattern of
3-
5 chain expression
was observed in the lung, as shown at higher power in Fig.
4, f-h.
3 and
5 were confined to the epithelial lung buds
at this stage, while
4 was expressed only in the surrounding mesenchyme. This complementary pattern of expression suggests that these chains may play distinct roles in
lung development:
3 and
5 in branching morphogenesis,
and
4 in the organization of the mesenchyme.
4 and
5 Proteins
1-3 chains were first identified by biochemical and
immunochemical methods (Timpl et al., 1979
; Leivo and
Engvall, 1988
; Rousselle et al., 1991
; Carter et al., 1991
; Verrando et al., 1992
). In contrast,
4 and
5 were identified
as cDNAs by molecular cloning (Richards et al., 1994
; Iivanainen et al., 1995
; Miner et al., 1995
). Sequence analysis implies that the
4 and
5 cDNAs encode laminin-like
proteins, but it is crucial to demonstrate this directly. To
this end, we used
4 and
5 cDNAs to produce recombinant proteins in bacteria, and then used the proteins to generate antisera in rabbits. Each antiserum specifically
recognized its immunogen on Western blots (Fig. 5 A), and
immunoreactivity was removed by incubation with the
corresponding fusion protein. Since
3B and
5 sequences
are closely related (see above), we also tested anti-
5 on a
recombinant fragment from the corresponding domains of
3B. No cross-reaction was detected (data not shown).
Fig. 5.
Identification of laminin
4 and
5 proteins in lung and
kidney. (A) Characterization of antisera. The
4 and
5 fusion
proteins used to immunize rabbits were fractionated by SDSPAGE on 12% gels and transferred to blots. Strips were probed
either with no primary antibody (lanes 1 and 4), with the anti-
4
antiserum (lanes 2 and 5), or with the anti-
5 antiserum (lanes 3 and 6). Each antiserum specifically recognized its cognate immunogen. (B) Solubilized and reduced crude membranes from adult
rat lung and kidney and purified laminin-1 were fractionated on
7% gels and transferred to blots. Strips were probed either with
anti-laminin-1 (lanes 1, 6, and 10), nonimmune (lanes 2, 7, and
11), antilaminin
4 (lanes 3, 8, and 12), or anti-laminin
5 (lanes
4, 5, 9, and 13). The anti-
4 serum recognized a protein of ~180
kD in lung and kidney. The
5 antiserum recognized several
bands in lung and kidney (lanes 4 and 9), the largest of which,
~450 kD, was observed only after long exposures (lane 5, arrowheads). Neither serum recognized laminin
1 (lanes 12 and 13).
n.i., nonimmune serum; x, nonspecific bands seen in all lung lanes
with long exposures.
[View Larger Version of this Image (54K GIF file)]
4 and
5 proteins, we prepared extracts of adult lung and kidney; lung was chosen because it
expresses both chains at high levels (Fig. 3 A), and kidney
was chosen because it was the focus of immunohistochemical studies detailed below. Tissue BL proteins and purified laminin-1 (
1/
1/
1) were reduced, fractionated by
gel electrophoresis, and transferred to nitrocellulose filters, which were then probed with antisera to laminins
4
or
5 or with an antiserum to laminin-1. Results are shown
in Fig. 5 B. Anti-
4 recognized an ~180-kD protein in
both lung and kidney (Fig. 5 B, lanes 3 and 8). Anti-
5 recognized large proteins of ~380 and ~350 kD, as well as a
smaller protein of ~210 kD, in both tissues (Fig. 5 B, lanes
4 and 9). Additional specific anti-
5-reactive bands of
high Mr (~450 kD) were observed with longer exposure times in several experiments (Fig. 5 B, lane 5). Neither
anti-
4 nor anti-
5 reacted with the ~400-kD
1 chain of
laminin-1 (Fig. 5 B, lanes 12 and 13), although this chain
was readily detected by a polyclonal antiserum to laminin-1
(lane 10). Nonimmune rabbit serum was not reactive with
any of the laminin chains (Fig. 5 B, lanes 2, 7, and 11).
Thus, the laminin
4 and
5 chains are present in adult
lung and kidney, and this is consistent with results of
RNase protection assays (Fig. 3 A).
4-reactive protein, ~180 kD, is consistent with the size predicted from the open reading frame
of the cDNA (190 kD; Iivanainen et al., 1995
; Richards et al.,
1996
). Likewise, the ~450-kD
5 chain is of the expected
size for this presumably glycosylated protein. The observation that smaller
5-immunoreactive bands (380, 350, and
210 kD) are more abundant than the 450-kD species indicates that
5 is subject to posttranslational cleavage. Multiple protease inhibitors were used in preparing tissue, and
the relative abundance of the bands in the extracts remained constant for several weeks at 4°C. We therefore
suspect that this cleavage occurred in situ, as has been reported for laminins
2 and
3 (Ehrig et al., 1990
; Marinkovich et al., 1992a
), rather than during isolation.
Chains
in Adult Tissues
1-3 chains have been shown to be associated
with BLs in a variety of tissues, as have the
and
chains.
Here we asked whether
4 and
5 are components of BLs,
and whether their expression overlaps those of the
1-3
chains. In addition, we wanted to know whether all BLs
contained at least one
chain, as the finding of an apparently
-free BL might suggest the existence of additional
chains. We began by using our
4 and
5 antisera, along
with previously characterized antibodies to
1-3 (see Materials and Methods), to investigate the expression patterns of the laminin
chains in kidney, a tissue that contains numerous heterogeneous yet well-characterized BLs
(Abrahamson et al., 1989
; Sanes et al., 1990
; Abrahamson
and Leardkamolkarn, 1991
; Abrahamson and St. John,
1993; Miner and Sanes, 1994
; Virtanen et al., 1995
).
1 was readily detected in the BLs of a subset
of renal tubules (primarily proximal), as shown previously
(Horikoshi et al., 1988
; Sorokin et al., 1992
). The
1 chain
was absent from glomerular BL but was present in the
glomerular mesangium, an amorphous matrix that is one
of the few sites in which laminins are present outside of a
formed BL (Fig. 6 a). No
1 was detectable in the BLs of
arteries, veins, or capillaries. In the peripheral portion of
the kidney, laminin
2 was largely restricted to the mesangium, in agreement with previous studies of human
kidney (Fig. 6 b; Sanes et al., 1990
; Virtanen et al., 1995
).
At deeper levels, however, some tubules were weakly
2
positive, particularly in the transitional zone between the
cortex and medulla (the corticomedullary junction; Fig. 6 b,
inset). Laminin
3 was absent from glomeruli, tubules, and
vasculature of the renal cortex (data not shown), but it was
present in the epithelial BL that lines the papilla (Fig. 6 c).
Laminin
4 was absent from all renal, epithelial, and arterial BLs (Fig. 6 d) but was found in many capillaries of the
medulla (not shown). Finally, laminin
5 was detected in virtually all BLs, including those of glomeruli, arteries, and all tubules (Fig. 6 e). Thus, all five of the known
chains
are present in adult kidney, but each is expressed in a
unique pattern.
Fig. 6.
Immunohistochemical localization of laminin
chains in adult mouse kidney (a-e), heart (f-j), and lung (k-o). All five
chains were present in adult BLs, but each chain was distributed in a distinct pattern.
1 was found only in kidney mesangium and in a
subset of tubular BLs (primarily proximal) (a).
2 was present in mesangium (b), in a subset of corticomedullary tubular BLs (b, inset),
and in cardiomyocyte BLs (g).
3 was detected in kidney papillary BL (c) and in lung alveolar BL (m).
4 was absent from renal cortex
(d) but found in capillaries of both the renal medulla (not shown) and heart (i), and in alveolar BLs in lung (n).
5 showed the most
widespread expression: in all kidney BLs
glomerular, tubular, and arterial (e); in heart blood vessels and in some cardiomyocyte BLs
(j); and in lung alveolar BL (o). G, glomerulus; M, mesangium; bv, blood vessel. Bar, 50 µm.
[View Larger Version of this Image (111K GIF file)]
chains
were primarily restricted to BLs, and each chain was expressed in a distinct pattern. In the heart, laminins
1 and
3 were undetectable (Fig. 6, f and h). Laminin
2 was
abundant in the myocyte BLs (Fig. 6 g), as reported previously (Leivo and Engvall, 1988
; Paulsson et al., 1991
), while
laminin
4, as in the kidney, was restricted to capillaries
(Fig. 6 i). Laminin
5 was present in arterioles and capillaries and was also found at low levels in many myocyte BLs (Fig. 6 j). In lung, laminin
3 was present in alveolar
BL (Fig. 6 m), consistent with a recent report by Virtanen
et al. (1996). The
5 chain was colocalized with
3 in most
alveolar BLs (Fig. 6 o), while laminin
4 was detected in a
large subset of these BLs (Fig. 6 n). The identity of the
4positive BLs remains to be determined. Interestingly, however, in developing lung, protein localization mirrors the
RNA localization documented above:
3 and
5 are concentrated in the epithelial lung buds, with
4 in the mesenchyme (data not shown; Miner, J.H., manuscript in preparation). Laminins
1 and
2 were not detectable in lung
(Fig. 6, k and l).
chains are confined to the extracellular
matrix and, with the exception of the glomerular mesangium, to BLs. Cytoplasmic deposits of laminins were
not detected, nor were any laminin
chains present in the
interstitial collagen- and fibronectin-rich matrix between
tubules (in kidney) or myocytes (in heart). Second, each
chain is expressed in a unique pattern. Third, each BL contains at least one
chain. Fourth, BLs can contain either a
single
chain (e.g.,
5 in glomerular BL) or multiple
chains (e.g.,
1 and
5 in proximal tubular BL or
3,
4,
and
5 in some alveolar BLs). Fifth, even a single BL can
vary in laminin composition along its length (e.g.,
1 and
5 in proximal portions of tubular BL,
5 in distal portions, and
2 and
5 at the corticomedullary junction).
Sixth, as surmised from studies at the RNA level (see above),
1 is most restricted in its expression, and
5 is the most
broadly distributed in adult BLs. Together, these results support the idea that the functional diversity of BLs is
achieved in part by laminin
chain diversity.
chains to that previously documented for
1. Many studies, including some from our laboratory,
have used the mAb 4C7 (Engvall et al., 1986
) to assess the
distribution of
1 (Engvall et al., 1990
; Sanes et al., 1990
;
Virtanen et al., 1995
, 1996
; Sewry et al., 1995
; Durham and
Snyder, 1995
). This antibody was shown to recognize a
laminin
chain distinct from
2 at a time when only two
chains had been described (Engvall et al., 1990
), but since
this antibody does not recognize mouse protein, it could not be tested on bona fide laminin
1 as originally isolated
and cloned from the EHS tumor. 4C7-immunoreactive
material is more broadly distributed than is
1-immunoreactive material, as recognized by mAbs that bind to mouse
laminin
1 (Sorokin et al., 1992
) and were used here. Interestingly, the array of BLs recognized by 4C7 most
closely resembles that stained by anti-
5 in heart, lung, and kidney (Fig. 6), as well as in skeletal muscle (Patton,
B.L., J.H. Miner, and J.R. Sanes, unpublished results). Unfortunately, direct comparisons are not feasible because
4C7 does not recognize mouse or rat antigen, and our anti
5 antiserum does not recognize rabbit or human antigen.
However, we speculate that 4C7 may recognize the laminin
5 chain, either instead of or in addition to
1.
Chain Expression
chains.
Based on the studies of adult organs detailed above, and
on the fact that laminins have been implicated as important in renal development and function (Klein et al., 1988
;
Noakes et al., 1995
), we focused on kidney for this analysis. In fact, we found a complex and dynamic pattern of
laminin
chain expression in the BLs of the developing
nephron. To document these results, it is first necessary to
summarize the main stages of nephrogenesis (Fig. 7).
Fig. 7.
Schematic summary of kidney development,
and expression patterns of
the laminin
chains in various nephron segment BLs.
The laminin
and
chains
expressed in the developing
glomerular BL (GBM) and
its progenitors are boxed.
See text for details.
[View Larger Version of this Image (53K GIF file)]
; Sorokin and Ekblom, 1992
; Davies, 1993
).
chain expression, we stained sections of E15.5
and neonatal mouse kidney with antibodies to laminins
1-5. Results are summarized in Fig. 7 and examples are
shown in Fig. 8. Before vesicle formation, the only BL
near the cortical surface was that of the ureteric bud. This
BL was rich in laminin
5 (Fig. 8 a) throughout its length
and also contained
1 (Fig. 8 g) in the cortical portions. The first-formed BL of the nephron, that of the vesicle,
contained laminins
1 (not shown) and
4 (Fig. 8 b). Laminin
1 was detected in the BL of some but not all vesicles,
suggesting that it appears after
4 near the end of the vesicle stage. In the comma,
1 and
4 remained (Fig. 8, c and
e) and were joined by
5 (Fig. 8 a). At this stage, significant heterogeneity became evident within the single BL
that surrounded each comma: laminin
4 was present at
higher levels in the tuft than in the periphery (Fig. 8 c), whereas laminin
5 was clearly present in the periphery
but was virtually absent from the tuft (Fig. 8 a). Thus, the
BL of the tuft, which is the precursor of the glomerular BL,
becomes molecularly distinct from continuous but nonglomerular stretches of BL at an early stage of nephrogenesis.
Fig. 8.
Immunohistochemical analysis of laminins
1,
4,
5, and
1 in developing kidney shows the dynamic pattern of
chain accumulation depicted schematically in Fig. 7. All sections are from P1 mouse kidney except c, which is from E15.5. b
, c, d
, f
, g, and h
are double exposures of doubly labeled sections; antibodies listed first and second are shown in green and red, respectively, and regions of overlap are indicated by yellow and light orange. Single exposure companions are shown in b (for b
), d (for d
), f (for f
), and h (for h
). U,
ureteric bud; V, vesicle; C, comma-shaped structure; S, S-shaped structure; CL, capillary loop; mG, maturing glomerulus; bv, blood vessel. (Arrows) Progenitors of glomerular BL. Bar, 50 µm.
[View Larger Version of this Image (66K GIF file)]
chains. The progenitor of the
glomerular BL was rich in
4 and
5 and contained low
levels of
1; the progenitor of Bowman's capsule BL was
rich in all three chains; and the progenitor of the tubular
BL contained abundant
1, low levels of
5, and no detectable
4 (Fig. 8, d and f). In addition, the invading vessel, destined to generate the capillary loops of the glomerulus, was coated by a BL with yet a fourth composition:
rich in
4 but with no detectable
1 or
5.
chain composition as the nephron
matured. (1) In the BL of Bowman's capsule,
4 declined
in level by the capillary loop stage and disappeared from
the capsule in the immature glomerulus. Levels of
1 declined later, leaving the mature capsular BL rich in
5, poor in
1, and without detectable
4. (2) Tubular BL became richer in
5 as development proceeded. Different
segments of the tubule either maintained or lost
1, or acquired
2, as described above (Fig. 6, a-e). (3) Arteriolar
BL lost
4 and acquired
5 at a late stage of development.
(4) The glomerular BL first lost
4 and then lost
1, leaving
5 as the only detectable laminin
chain in the adult.
(5) Finally, the mesangial matrix was first detectable at the
capillary loop stage, where it was
4 positive. Later,
4
disappeared from this matrix, and
1 and
2 accumulated.
chain transitions in glomerular BL to those previously documented
for the laminin
and collagen IV
chains (Abrahamson
and St. John, 1993; Miner and Sanes, 1994
; Noakes et al.,
1995
; Virtanen et al., 1995
). Laminin
1 and collagen
1,2(IV) chains are present in the primitive comma and
S-shaped figure BLs. At the capillary loop stage, they are
joined by laminin
2 and collagen
3-5(IV) in the developing glomerular BL. At the immature glomerulus stage,
laminin
1 and collagen
1,2(IV) levels begin to decline,
leaving only laminin
2 and collagen
3-5(IV) in the mature glomerular BL. The later appearance of
5 and
2
raises the possibility that these two events are linked.
However, the initial accumulation of laminin
5 occurs at
the S-shaped stage, while laminin
2 and collagen
35(IV) do not appear until the capillary loop stage (Fig. 7, D and E). Likewise, the roughly parallel disappearance of
laminins
1,
4, and
1 raises the possibility that this developmental step reflects loss of
1
1- or
4
1-containing
trimers. However, laminin
1 was detectable in maturing
glomerular BLs that lacked laminins
1 and
4 (data not
shown), suggesting that elimination of these molecules is
not obligatorily linked. Surprisingly, therefore, the developmental transitions in laminin
and
chains appear to
be regulated independently. If all laminin chains occur in
/
/
trimers (see below), these results suggest that
1
1-,
1
2-,
4
1-,
4
2-,
5
1-, and
5
2-containing trimers
are potentially present, at least transiently, in developing
glomerular BL.
1-5 chains. As noted above,
nephrons at all stages of development are present in a corticomedullary gradient in neonates, with the most primitive just beneath the cortical surface and the most mature
at deeper levels. Laminin
4 transcripts were clustered at
the cortex, as expected from its early appearance in vesicular BL (Fig. 9 d). Laminin
1 transcripts were detected in
cortical and subcortical clusters, consistent with the expression of this chain in late vesicle, comma, and S-shaped
stages (Fig. 9 a). Segments of tubules were also
1 positive, and lower level expression (above background) was
found throughout the kidney. Low levels of laminin
5 RNA
were present in the superficial layer of the cortex, consistent with the later appearance of this chain in the developing nephron. Occasional clusters that were observed are
likely to be the tips of the ureteric buds that have BLs rich in
5 (Fig. 9 e). Deep in the medulla, laminin
5 RNA was
abundant in the collecting ducts, which are derived from
the
5-positive ureteric bud.
5 labeling was not abundant
in all structures that contained the protein (e.g., capillary
loop stage glomeruli), suggesting that, in some cases,
5
RNA is unstable or simply present at low levels but translated efficiently. Laminin
2 RNA was concentrated in the
deep cortical and medullary portions of the kidney (Fig. 9 b),
consistent with its localization in a subset of tubules (Fig. 6 b).
Laminin
3 RNA was not detectable within the renal cortex
but was found at P15 in the papilla (data not shown), consistent with its protein localization in adult kidney (Fig. 6 c).
Fig. 9.
In situ hybridization of laminin
chain probes to P1 kidney sections.
1 was observed in primitive structures in the cortex and
in some tubules (a).
2 was absent from the cortical structures but distributed diffusely in the interior (b).
4 was detected primarily in
clusters at the cortex (vesicle and comma stage nephrons) but also diffusely in the medulla (d).
5 was mainly in the collecting ducts, but
there were also grain clusters in the inner cortex and in the medulla (e).
3 was absent (c), and a sense control was negative (f). These
patterns suggest that the developmental transitions demonstrated immunohistochemically in Figs. 7 and 8 reflect, in part, developmental
transitions in
chain gene expression. The cortical surface of the kidney is outlined in white. Insets in a-e show higher power views of
the cortex. Bars: (f) 0.5 mm; (a, inset) 0.1 mm.
[View Larger Version of this Image (151K GIF file)]
4 or
5 Chain
,
, and
subunits, covalently joined by disulfide bonds (Burgeson et al., 1994
). Such trimeric structures have been demonstrated for the
1-3 chains, which
form laminins 1-7 (Table I), but not for
4 and
5. We
therefore asked whether the
4 and
5 chains also occur
as components of trimers. To this end, we fractionated proteins from lung and kidney on SDS gels under nonreducing conditions such that laminins migrate as trimers,
the relative sizes of which depend on the constituent
,
,
and
chains. Nitrocellulose blots were then probed with antibodies to
4 or
5 (Fig. 10 A). Both lung and kidney contained high Mr complexes that reacted with the
4 (Fig. 10
A, lanes 3 and 7) or
5 (lanes 4 and 8) antisera but not
with nonimmune serum (lanes 2 and 6). The
4 complexes were ~500-600 kD, and the
5 complexes were ~700-800
kD. These values are consistent with Mrs predicted for laminin trimers. None of the
4- or
5-immunoreactive bands
(
450 kD) that had been seen after reduction (Fig. 5 B)
were detectable under these nonreducing conditions, indicating that all of the monomeric species were associated
with larger, disulfide-bonded complexes. Moreover, the approximate difference in Mr between the
4- and
5-containing complexes (~200 kD) is consistent with the difference
in Mr between the full-length
4 and
5 chains themselves.
An antiserum to laminin-1, which recognizes the
1,
1, and
1 chains, blotted material at the Mrs of all
4- and
5containing complexes (Fig. 10 A, lanes 1 and 5), whereas
anti-
4 and anti-
5 did not recognize laminin-1 (lanes 11 and 12). Together, these results suggest that laminins
4
and
5 occur in heterotrimers with
1 and/or
1 chains.
Fig. 10.
Biochemical identification of laminins-8, -9, -10, and -11. (A) Detection of laminin complexes containing
4 and
5. Crude membrane preparations from adult lung and kidney and purified laminin-1 were solubilized without reducing agent and fractionated by SDS-PAGE on 3.5% polyacrylamide gels. Proteins were
transferred to nitrocellulose and probed with nonimmune (n.i.)
serum (lanes 2, 6, and 10) or with antibodies to laminin-1 (lanes 1,
5, and 9),
4 (lanes 3, 7, and 11), or
5 (lanes 4, 8, and 12). The
size of the laminin-1 trimer (~800 kD) is indicated. Lung contained at least two complexes containing
4 (lane 3), while kidney contained multiple
5-positive complexes (lane 8). Laminin-1 contained little or no detectable
4 or
5. (B) Identification of laminin trimers from adult lung. Laminins were solubilized, partially
purified, and then immunoprecipitated with antibodies to laminin
1 (lanes 1-5),
2 (lanes 6-10),
1 (lanes 11-13), or without primary antibody (lanes 14-18). The precipitates were then fractionated on nonreducing gels and probed without primary antibody
(lanes 1, 6, 11, and 14), or with antibodies to laminins
2 (lanes 2,
7, and 15),
4 (lanes 3, 8, 12, and 16),
5 (lanes 4, 9, 13, and 17),
and
1 (lanes 5, 10, and 18). Four novel laminin trimers were
identified: laminin-8 (
4
1
1), laminin-9 (
4
2
1), laminin-10
(
5
1
1), and laminin-11 (
5
2
1).
[View Larger Version of this Image (49K GIF file)]
4- and
5-containing complexes as laminin heterotrimers, we solubilized and partially purified laminins from lung. Lung was chosen for this
set of experiments because, unlike kidney, it expresses both
4 and
5 chains at high levels in adulthood (Figs. 3 and 6).
Lung homogenates were extracted with EDTA, EGTA,
NaCl, and Triton X-100, and the extracts were then fractioned by a combination of ion exchange and size exclusion chromatography (see Materials and Methods). The
resulting laminin-rich fraction was then subjected to immunoprecipitation with mAbs specific for laminin
1 or
2. Precipitates were separated on gels under nonreducing
conditions, electroblotted onto nitrocellulose, and probed
with antibodies specific for individual laminin chains (Fig.
10 B). Antibodies to laminin
1 precipitated a series of complexes of ~500-800 kD (Fig. 10 B, lanes 1-5). All the
complexes comigrated with
1 (Fig. 10 B, lane 5), but none
contained
2 (lane 2). Individual complexes reacted with
either anti-
4 (Fig. 10 B, lane 3) or with anti-
5 (lane 4)
but not with both. Complexes containing
4 had Mrs of
~500-600 kD, and those with
5 had Mrs of ~700-800 kD,
corresponding to Mrs of the nonreduced
4 and
5 complexes observed by immunoblotting crude lung samples (Fig. 10 A). Controls in which the primary antibody was omitted
did not contain laminins (Fig. 10 B, lanes 14-18). Thus, the
laminin
4 and
5 chains are both associated with
1 in
distinct heterotrimers.
2 (Fig. 10 B, lanes 6-10).
All of the laminin
2-reactive material precipitated by
these antibodies (Fig. 10 B, lane 7) reacted with anti
1
(lane 10) and with either anti-
4 (lane 8) or anti-
5 (lane
9) but not both. Complexes containing
4 had Mrs of
~500-600 kD, and those with
5 had Mrs of ~700-800 kD,
corresponding to those detected in crude lung samples
(Fig. 10 A). Electrophoresis of the immunoprecipitates under reducing conditions revealed that the major
4- and
5-reactive bands detected in crude extracts (Fig. 5 B)
were complexed with
2 (data not shown). Thus, lung also
contains distinct laminin heterotrimers that include
4+
2 and
5+
2.
4
1,
4
2,
5
1, and
5
2 also contained the
1 chain.
First, an mAb to
1 precipitated
4- and
5-containing
complexes (Fig. 10 B, lanes 11-13) that were equivalent in
Mr to those precipitated by anti-
1 or anti-
2. Second, as
noted above, anti-
1 and anti-
2 precipitated
1-containing
complexes that comigrated with all of the
4- and
5immunoreactive trimers (Fig. 10 B, lanes 5 and 10). Together,
these results provide strong evidence for the existence of
laminin trimers with chain compositions of
4
1
1,
4
2
1,
5
1
1, and
5
2
1. In accordance with recently adopted
rules of nomenclature (Burgeson et al., 1994
), these are
named laminins 8-11, respectively (Table I).
; Doyle et al., 1996
).
Lama2 mapped to the proximal region of mouse chromosome 10, 4.5 centiMorgans (cM) distal of Myb and 3.9 cM
proximal of Fyn. This result is in good agreement with previous studies that map Lama2 3.2 ± 1.8 cM distal of Myb
on mouse chromosome 10 (Sunada et al., 1994
). We have
also confirmed the recent results of Aberdam et al. (1994b)
and Griffith et al. (1996)
by assigning Lama3 to the proximal region of chromosome 18. In our interspecific cross, Lama3 mapped 1.6 cM distal of Tpl1 and 1.1 cM proximal
of Cdh2. Lama4 is linked to Lama2 on chromosome 10 and does not recombine with Fyn in 129 animals typed in
common, suggesting that the two loci are within 2.3 cM of
each other (upper 95% confidence limit). Finally, Lama5
mapped to the very distal region of mouse chromosome 2, 2.2 cM distal of Gnas. Thus, the five Lama loci were distributed on four different mouse autosomes, indicating
that most of the Lama genes have become dispersed
through evolution.
Fig. 11.
Chromosomal locations of Lama loci in the mouse
genome, as determined from interspecific backcross analysis. The
number of recombinant N2 animals is presented over the total number of N2 animals typed to the left of the chromosome maps between each pair of loci. The recombination frequencies, expressed
as genetic distance in centimorgans (± one standard error) are
also shown. The upper 95% confidence limit of the recombination distance is given in parentheses when no recombinants were
found between loci. Gene order was determined by minimizing
the number of recombination events required to explain the allele distribution patterns. The positions of loci on human chromosomes, where known, are shown to the right of the chromosome maps. (Asterisk) The human LAMA5 gene is predicted to
reside on chromosome 20q13. References for the human map positions of loci cited in this study can be obtained from GDB (Genome Data Base), a computerized database of human linkage information maintained by The William H. Welch Medical Library
of The Johns Hopkins University (Baltimore, MD).
[View Larger Version of this Image (15K GIF file)]
; Xu et al., 1994
), but no targeted or spontaneous mouse mutants have been reported for lama1, 3,
4, or 5. Therefore, we compared our maps of mouse chromosomes 2, 10, 17, and 18 with composite mouse maps that
report the map locations of many uncloned mouse mutations (obtained from the Mouse Genome Database, maintained at The Jackson Laboratory, Bar Harbor, ME). Mutations in the vicinity of the Lama genes include thin fur
(thf) near the Lama1 locus; ataxia (ax), twirler (Tw), and
balding (bal) near the Lama3 locus; waltzer (v) and kidney
disease (kd) near the Lama4 locus; and ragged (Ra) and
wasted (wst) near the Lama5 locus. For most of these mutations, the reported phenotypes are not suggestive of a
BL defect. For ragged, however, the phenotype is an intriguing one. The mutation Ra shows semidominance, and
the coats of heterozygotes have a thin ragged appearance.
Homozygotes are naked, many die in utero, and there are
internal visceral defects (Carter and Phillips, 1954
; Slee,
1957
). Another semidominant allele of ragged, Ra < op > (opossum) (Green and Mann, 1961
), is homozygous lethal before E11, which, because of its expression in many tissues, might be expected for a Lama5 mutant. Also, since
5 is expressed in the skin, a mutation may affect the function of hair follicles, which could lead to the ragged coat
appearance. Moreover, the disruption of heterotrimeric
laminin structure by a defective
chain could explain the
semidominant phenotype of both ragged alleles identified
to date.
chains are ligands for most cellular
laminin receptors identified to date, including at least six
integrins, dystroglycan, and several glycoconjugates (see
Introduction). Yet the distribution of the laminin
chains
has not previously been studied in detail, and the existence
of the two most recently identified chains (
4 and
5) has
been deduced from cDNA sequence but not shown directly at the protein level. We have therefore generated a
panel of antibody and cDNA reagents and have used it to
localize the
chain genes on mouse chromosomes and the
chain RNAs and proteins in developing and adult tissues.
We have also identified a new isoform of laminin
3 and
provided direct evidence for the existence of four novel laminin heterotrimers. Our main conclusions are as follows:
subfamily of laminin genes currently consists
of five members, which encode six proteins. Four (
1,
2,
3B, and
5) are full-sized chains, and two (
3A and
4)
are truncated chains (Fig. 1). The previously hypothesized
mid-sized
chain (
3B) may not, in fact, exist (Fig. 2).
chain genes are expressed in
both embryos and adults, but each is expressed in a distinct pattern (Figs. 3 and 4). Their products are confined to
the extracellular matrix and, with a few exceptions (e.g.,
the glomerular mesangium), to BLs (Fig. 6).
chains, and some contain two
or three distinct
chains. Although additional
chains
may well exist, our results provide no evidence for them
and no clues as to their nature or distribution.
5 is the most widely distributed
chain in
adult BLs, and
1 is the most restricted. The
2 chain is
particularly abundant in mesodermally derived tissues
(e.g., skeletal and cardiac muscle), and
3 is concentrated
in epithelial BLs. The restricted distribution of
1 is inconsistent with the broad distribution of immunoreactive material recognized by a widely used mAb, 4C7. This discrepancy, together with data on the distribution of
2-5, raises
the possibility that 4C7 recognizes the
5 chain, in addition to or instead of
1.
chain expression are established embryonically (Fig. 4), but some individual BLs
change in
chain composition as development proceeds.
In kidney, for example, forming glomeruli express three
different
chains in a dynamic progression. Moreover,
distinct portions of a continuous BL, such as that of the
nephron, can contain distinct complements of
chains, and these change during development as well (Figs. 7 and 8).
1-5 all form heterotrimers with
and
chains. At present, 11 distinct heterotrimers have been
identified in mammalian cells or tissues, including at least
two containing each
chain (Table I). The four heterotrimers identified in this study (Fig. 10) have been named
laminins-8 (
4
1
1), -9 (
4
2
1), -10 (
5
1
1), and -11 (
5
2
1).
chain genes are distributed on four chromosomes in mouse, and probably on three chromosomes
in human. The two
chain genes present on a single chromosome in both species (
2 and
4) are not tightly linked,
and two chains present on the same chromosome in humans (
1 and
3) are on different chromosomes in mouse
(Fig. 11). Thus, there is no evidence for functionally important linkage of the
chain genes.
chains contribute importantly to the molecular diversity of BLs. Together with evidence that some
cellular receptors can distinguish among
chains and that
naturally occurring mutations of
2 and
3 have tissuespecific phenotypes (see Introduction), our results suggest
that differences among
chains are critical to the multiplicity of roles that BLs play both during development and
in maturity.
3 transcript with a distinct 5
end and
translation start site has now been identified by D. Aberdam and colleagues. It encodes a protein intermediate in size between the
3B isoform reported here and the
3A isoform described by Galliano et al.
(1995)
. Thus, there may be three isoforms of laminin
3: short (A), fulllength (B), and mid-sized (C) (Aberdam, D., personal communication).
Received for publication 24 December 1996 and in revised form 13 February 1997.
Please address all correspondence to Joshua R. Sanes, Department of Anatomy and Neurobiology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110. Tel.: (314) 362-2507. Fax: (314) 747-1150.We are grateful to Drs. Lydia Sorokin, Peter Yurchenco, and Daniel Aberdam for gifts of antisera and to Renate Lewis, Jeanette Cunningham, and Ellen Ryan for technical assistance. J.H. Miner was supported in part by a Damon Runyon-Walter Winchell Cancer Research Fund fellowship.
This work was supported by grants from the National Institutes of Health.
BL, basal lamina; cM, centiMorgan; E, embryonic day; EHS, Englebreth-Holm-Swarm; RFLP, restriction fragment length polymorphism; RT-PCR, reverse transcription coupled-PCR.
3
1 in epithelial basement membranes.
Cell.
65:
599-610
[Medline].
1,
1, and
1 laminin subunits during rabbit fetal lung development.
Dev. Dyn.
203:
408-421
[Medline].
3
chain.
J. Biol. Chem.
270:
21820-21826
2-chain gene (LAMA2) cause
merosin-deficient congenital muscular dystrophy.
Nat. Genet.
11:
216-218
[Medline].
an extracellular matrix
receptor linked to the cytoskeleton.
Curr. Opin. Cell Biol.
8:
625-631
[Medline].
4 chain.
FEBS Lett.
365:
183-188
[Medline].
3,
4, and
5 chains in rodent
basal laminae: sequence, distribution, association with laminins, and developmental switches.
J. Cell Biol.
127:
879-891
5, and widespread expression in adult mouse tissues.
J. Biol.
Chem.
270:
28523-28526
2:
nephrosis despite molecular compensation by laminin
1.
Nat. Genet.
10:
400-406
[Medline].
4 and its relationship to the other human laminin
chains.
Eur.
J. Biochem.
238:
813-821
[Medline].
3 chain of the adhesive ligand epiligrin.
J.
Biol. Chem.
269:
22779-22787
a mutant affecting
the skin and hair of the house mouse. II. Genetics, embryology and gross juvenile morphology.
J. Genet.
55:
570-584
.
A glycoprotein from basement membranes.
J. Biol. Chem.
254:
9933-9937
subunit multigene family.
Nat. Genet.
1:
85-91
[Medline].
2 (Lama2) gene.
Nat. Genet.
8:
297-302
[Medline].
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|