|
||
© The Rockefeller University Press,
0021-9525/1997//685 $5.00
The Journal of Cell Biology, Volume 137, Number 3,
, 1997 685-701
Article |
The Laminin
Chains: Expression, Developmental Transitions, and Chromosomal Locations of
1-5, Identification of Heterotrimeric Laminins 8–11, and Cloning of a Novel
3 Isoform



Department of Internal Medicine (Renal Division),
Department of Neurology, Washington University School of Medicine, St. Louis, Missouri, 63110; and || Mammalian Genetics Laboratory, ABL-Basic Research Program, National Cancer Institute-Frederick Cancer Research and Development Center, Frederick, Maryland 21702
Laminin trimers composed of
, β, and
chains are major components of basal laminae (BLs) throughout the body. To date, three
chains (
1–3) have been shown to assemble into at least seven heterotrimers (called laminins 1–7). Genes encoding two additional
chains (
4 and
5) have been cloned, but little is known about their expression, and their protein products have not been identified. Here we generated antisera to recombinant
4 and
5 and used them to identify authentic proteins in tissue extracts. Immunoprecipitation and immunoblotting showed that
4 and
5 assemble into four novel laminin heterotrimers (laminins 8–11:
4β1
1,
4β2
1,
5β1
1, and
5β2
1, respectively). Using a panel of nucleotide and antibody probes, we surveyed the expression of
1-5 in murine tissues. All five chains were expressed in both embryos and adults, but each was distributed in a distinct pattern at both RNA and protein levels. Overall,
4 and
5 exhibited the broadest patterns of expression, while expression of
1 was the most restricted. Immunohistochemical analysis of kidney, lung, and heart showed that the
chains were confined to extracellular matrix and, with few exceptions, to BLs. All developing and adult BLs examined contained at least one
chain, all
chains were present in multiple BLs, and some BLs contained two or three
chains. Detailed analysis of developing kidney revealed that some individual BLs, including those of the tubule and glomerulus, changed in laminin chain composition as they matured, expressing up to three different
chains and two different β chains in an elaborate and dynamic progression. Interspecific backcross mapping of the five
chain genes revealed that they are distributed on four mouse chromosomes. Finally, we identified a novel full-length
3 isoform encoded by the Lama3 gene, which was previously believed to encode only truncated chains. Together, these results reveal remarkable diversity in BL composition and complexity in BL development.
Abbreviations used in this paper: BL, basal lamina; cM, centiMorgan; E, embryonic day; EHS, Englebreth-Holm-Swarm; RFLP, restriction fragment length polymorphism; RT-PCR, reverse transcription coupled–PCR.
Laminins are components of all basal laminae (BLs)1 throughout the bodies of vertebrates and invertebrates. In mammals they play at least three essential roles. First, they are major structural elements of BLs, forming one of two self-assembling networks (the other is composed of the collagens IV) to which other glycoproteins and proteoglycans of the BL attach (for review see Yurchenco and O'Rear, 1994; Timpl, 1996). Second, they interact with cell surface components such as dystroglycan to attach cells to the extracellular matrix (for review see Henry and Campbell, 1996). Third, they are signaling molecules that interact with cellular receptors such as the integrins to convey morphogenetically important information to the cell's interior (for review see Clark and Brugge, 1995; Mercurio, 1995; Yamada and Miyamoto, 1995). For example, laminin promotes myogenesis in skeletal muscle, outgrowth of neurites from central and peripheral neurons, and mesenchymal to epithelial transitions in kidney (Foster et al., 1987; Klein et al., 1988; Reichardt and Tomaselli, 1991; Vachon et al., 1996).
Laminin was initially isolated from tumor cells as a heterotrimer of A, B1, and B2 subunits (Chung et al., 1979; Timpl et al., 1979), later renamed
1, β1, and
1 (Burgeson et al., 1994). Molecular cloning revealed that the three subunits were encoded by distinct but homologous genes (Martin and Timpl, 1987). Subsequently, homologues of the
1 chain (merosin, or
2; Ehrig et al., 1990) and the β1 chain (s-laminin, or β2; Hunter et al., 1989b) were isolated, revealing a previously unsuspected heterogeneity of laminins. Five additional laminin chains have now been identified, all of which clearly belong to the
, β, or
subfamilies (
3–5, β3, and
2; Kallunki et al., 1992; Ryan et al., 1994; Aberdam et al., 1994b; Richards et al., 1994; Gerecke et al., 1994; Miner et al., 1995). All native laminins isolated to date are composed of one
, one β, and one
chain, and seven distinct heterotrimers have been identified (for review see Engvall and Wewer, 1996). The existence of multiple chains that oligomerize with a defined stoichiometry provides a means to generate functional diversity within a common structural framework (Sanes et al., 1990).
Here we focus on the
subfamily of laminin chains. This is the largest subfamily, with five members identified to date in mammals. Interactions of cells with laminin
chains are critical for cell–matrix interactions. For example, at least six distinct integrin heterodimers (
1β1,
2β1,
3β1,
6β1,
7β1, and
vβ3), as well as dystroglycan, heparin, and the adhesion molecule–associated glycoconjugate HNK-1/L2, bind to sites on laminin
chains (Rao and Kefalides, 1990; Gee et al., 1993; Hall et al., 1993; Sung et al., 1993; Mercurio, 1995; Mecham and Hinek, 1996; Colognato, H., and P.D. Yurchenco. 1996. Mol. Biol. Cell. 7(Suppl.):67a). Moreover, both dystroglycan and some integrins can distinguish amongst different
chains, suggesting that
chain diversity is functionally significant (Mercurio, 1995; Pall et al., 1996). In direct support of this notion, mutations in two
chains,
2 and
3, lead to congenital muscular dystrophy and junctional epidermolysis bullosa, respectively (Sunada et al., 1994; Xu et al., 1994; Helbling-Leclerc et al., 1995; McGrath et al., 1995). In Drosophila, mutation of the only known laminin
chain is embryonically lethal, leading to defects in numerous tissues (Henchcliffe et al., 1993; Yarnitzky and Volk, 1995; Garcia-Alonso et al., 1996).
Despite their importance, limited information is available about the distribution of the
chains (see, e.g., Engvall et al., 1990; Sanes et al., 1990; Vuolteenaho et al., 1994; Virtanen et al., 1995, 1996). Moreover, the
1 chain has been studied most intensively in human tissues with a single mAb (4C7; Engvall et al., 1986, 1990) whose specificity for
1 has been questioned (Ekblom, 1996). For the recently discovered
4 and
5 chains, no direct evidence has been presented to show that they form heterotrimers, and no data on cellular localization have been reported. Accordingly, we have generated and characterized antibodies to the
4 and
5 chains and used them to identify four novel laminin heterotrimers: laminin-8 (
4β1
1), laminin-9 (
4β2
1), laminin-10 (
5β1
1), and laminin-11 (
5β2
1). Using a panel of antibodies and cDNA probes, we analyzed the distribution of all five laminin
chains in embryonic and adult mice. We show that the
chains are expressed in overlapping but distinct patterns, with each BL containing at least one of the known
chains. Moreover, we demonstrate that some individual BLs contain different complements of
chains at distinct stages of their development. Finally, we identify a novel isoform of
3 and report the chromosomal locations of all five
chains in mice.
| Materials and Methods |
|---|
|
|
|---|
3B.
5. Surprisingly, the reaction generated a novel 209-bp fragment that was similar but not identical to known
chains. We hypothesized that this fragment could be part of a laminin
3B cDNA extending 5' of that reported by Galliano et al. (1995). To test this hypothesis, two primers were used in RT-PCR from adult lung RNA to attempt to amplify the potentially intervening cDNA: sense, 5'AGCGGGACCCAGAGGTC3' (from the novel product); antisense, 5'TGCCTCACAGACAATCTCACC3' (from near the 5' end of the sequence in Galliano et al. [1995]). RT-PCR conditions were as described (Miner and Sanes, 1994), with the addition of Taq Extender PCR Additive (Stratagene Cloning Systems, La Jolla, CA). A 2.2-kb fragment was sequenced with a Taq DyeDeoxy Terminator cycle sequencing kit (Applied Biosystems, Inc., Foster City, CA), and sequence was analyzed on the BLAST server at the National Center for Biotechnology Information (Altschul et al., 1990). Sequence was obtained from multiple clones to resolve errors introduced by Taq polymerase amplification.
Laminin
4.
A mouse laminin
4 cDNA fragment was amplified by RT-PCR from E17.5 placenta using degenerate primers based on the human amino acid sequence (Richards et al., 1994). The primers, designed to amplify the mouse segment homologous to nucleotides 1,800–2,607, were: sense, 5'TCNATGATGTTYGAYGGNCARTC3'; antisense, 5'CGNCCRCTRCTRAANCCRAARTC3'. The fragment was isolated on a low melting point gel and ligated into the pCRII vector (Invitrogen, San Diego, CA). The DNA and deduced amino acid sequences were determined and have been deposited into GenBank under accession number U88352.
RNA Analyses
RNA was prepared from mouse tissues by acid guanidinium phenol/chloroform extraction (Chomczynski and Sacchi, 1987). RNase protections were performed as described (Miner and Wold, 1991) using [32P]UTP-labeled probes and 5 µg (E17.5) or 7.5 µg (adult) of total RNA per hybridization. A probe for elongation factor 1
was included to control for the quality and amount of input RNA. For Northern analysis, a filter containing poly(A)-selected RNA from several adult mouse tissues (Clontech, Palo Alto, CA) was hybridized according to the manufacturer's instructions. In situ hybridizations were performed with 35S-UTP–labeled probes as described (Lentz et al., 1997). The laminin
chain probes used for RNase protection assays and in situ hybridizations were as described (Lentz et al., 1997).
Antibodies
Rat mAbs to mouse laminin
1 (clones 198 and 200; Sorokin et al., 1992) were gifts from Lydia Sorokin (Institute for Experimental Medicine, Erlangen, Germany). A rabbit antiserum to human laminin
2 cross-reactive with the mouse protein (Vachon et al., 1996) was kindly provided by Peter Yurchenco (Robert Wood Johnson Medical School, Piscataway, NJ). A rabbit antiserum to mouse laminin
3 (Aberdam et al., 1994a,b) was a gift from Daniel Aberdam (INSERM U385, Nice, France). Mouse mAbs to rat laminin chains β1 (C21, C22), β2 (D7, D19, D27), and
1 (D18) were produced and characterized in our laboratory and have been described previously (Sanes and Chiu, 1983; Hunter et al., 1989b; Sanes et al., 1990; Green et al., 1992). A guinea pig antiserum against a recombinant COOHterminal fragment of laminin β2 was produced as described (Sanes et al., 1990). A rat mAb to laminin
1 was purchased from Chemicon (Temecula, CA). Second antibodies were purchased as follows: fluorescein- and HRP-conjugated goat anti–rabbit antibodies from Boehringer Mannheim Biochemicals (Indianapolis, IN); fluorescein-conjugated goat anti–rat antibodies from Cappel/Organon Teknika (Durham, NC); Cy3-conjugated goat anti–rabbit antibodies from Jackson ImmunoResearch Laboratories (West Grove, PA); biotinylated goat anti–guinea pig antibodies from Sigma Chemical Co. (St. Louis, MO).
To generate antibodies to the laminin
4 and
5 chains, the laminin
4 cDNA described above, another containing nucleotides 3,670–4,391 (described in Lentz et al., 1997), and a laminin
5 fragment comprising nucleotides 4,243–4,926 (SacI to EcoRV) were each cloned in frame into the pET 23 vector (Novagen, Madison, WI). Proteins were produced in BL21(DE3) bacteria, and inclusion bodies were isolated according to a protocol supplied by Novagen. Fusion proteins were gel isolated as described (Miner and Sanes, 1994) and used to immunize rabbits (Caltag, Healdsburg, CA). For both
4 and
5, two separately immunized rabbits generated antisera that displayed qualitatively similar patterns of reactivity on both sections and immunoblots. The higher titer antiserum to each immunogen was used for the studies reported here.
Immunohistochemistry
Mouse tissues were frozen fresh and sectioned at 4–8 µm on a cryostat. Antibodies were diluted in 1% (wt/vol) BSA in PBS and incubated on sections for 1–2 h. After rinsing off unbound primary antibody with PBS, secondary antibodies were applied for 1–2 h. Sections were rinsed again, and then mounted in glycerol-para-phenylenediamine and observed with epifluorescent illumination. Since the laminin
4 antisera only recognized denatured antigen, the following protocol was used when staining with these antibodies: sections were fixed in 2% paraformaldehyde in PBS for 20 min, rinsed in PBS, incubated with 100 mM glycine in PBS for 10 min, incubated in 0.05% SDS in PBS for 30 min at 50°C, and then rinsed in PBS before the antibody was applied. Anti-
5 stained untreated and SDS- denatured sections in qualitatively similar patterns.
Western Blots and Immunoprecipitations
For immunoblotting, tissues from rat were used because a greater range of mAbs was available against rat than against mouse laminin β and
chains (see above). Lungs and kidneys from saline-perfused adult rats were homogenized in ice-cold 40 mM Tris, pH 7.5, 15 mM NaCl, and 2 mM CaCl2 (H buffer) containing protease inhibitors (0.1 mM PMSF, 1 mM benzamidine, and 1 µg/ml soybean trypsin inhibitor) using a Polytron. Crude membrane fractions were recovered at 20,000 g, washed once with H buffer containing PMSF, resuspended in H buffer containing 10 mM EDTA, 2 mM EGTA, PMSF, and soybean trypsin inhibitor (H+E buffer), and stored at –10°C. To improve immunoblotting sensitivity for BL components, the crude pellet was extracted by brief sonication in H+E buffer with 0.1 M NaCl and 1% Triton X-100, pelleted at 50,000 g, and resuspended in H+E buffer. However, data qualitatively similar to those presented in Results were obtained with the crude pellet. Protein content was assayed with bicinchoninic acid reagents ( Pierce Chemical Co., Rockford, IL) using BSA as a standard. Purified Engelbreth-Holm-Swarm (EHS) laminin-1 was obtained from Gibco BRL (Gaithersburg, MD).
Samples were solubilized by boiling in SDS gel loading buffer with or without DTT. The proteins were then separated by SDS-PAGE and transferred to nitrocellulose using standard methods. Fusion proteins, reduced native laminins, and nonreduced native laminins were separated on 12%, 7%, and 3.5% polyacrylamide gels, respectively. After blotting, filters were blocked with nonfat dry milk/0.3% Tween-20 in PBS, and then incubated with antibodies overnight. For detecting the fusion proteins, antisera were preadsorbed to an unrelated fusion protein containing the common pET 23 leader and His tag sequences. Bound antibodies were detected with either HRP-conjugated second antibody (for rabbit) or biotinylated second antibody with HRP-conjugated Z-avidin ( Zymed Laboratories, South San Francisco, CA) (for guinea pig), and Renaissance chemiluminescent substrate ( DuPont/ New England Nuclear, Boston, MA).
For immunoprecipitations, laminins were first partially purified from adult rat lung by the protocol of Lindblom et al. (1994), modified as follows: crude membranes were prepared as described above, and then extracted repeatedly over 12 h with 50 mM Tris, pH 7.5, 0.15 M NaCl, 10 mM EDTA, and 10 mM EGTA (TBS/EDTA). The pooled extracts were diluted to 90 mM NaCl, adjusted to pH 8.3, and loaded onto a DEAE– Sepharose CL-4B column ( Pharmacia, Uppsala, Sweden). The column was eluted with 1.0 M NaCl, and fractions containing laminin β2 (detected by immunoblotting) were pooled and brought to 50% saturation with ammonium sulfate. Precipitated material was resuspended in TBS/EDTA, brought to 10% glycerol, 0.6 M KCl, and 0.05% Tween-20, and then fractionated on a Sepharose CL-4B column. Fractions containing laminin β2 were pooled and passed through CM–Sepharose CL-6B; the flow-through was resubjected to DEAE–Sepharose chromatography. Protein eluted with 0.5 M NaCl was stored at –70°C with 0.1 mM PMSF. Protein was measured by Bradford assay (Bio Rad Laboratories, Hercules, CA). SDSPAGE of this fraction under reducing conditions displayed a heterogeneous population of proteins >180 kD, along with the laminin-binding protein entactin (150 kD) as a major constituent.
Laminins were immunoprecipitated essentially by the method of Green et al. (1992), modified as follows: laminin samples were incubated with antiβ1 mAbs (a mixture of C21 and C22) or anti-β2 antibodies (a mixture of D7, D19, and D27) in 50 mM Tris, pH 8.0, 100 mM NaCl, 2 mM EDTA, 1% NP-40, and 0.05% sodium deoxycholate (IP buffer). Immune complexes were isolated using protein A–Sepharose 4B ( Pharmacia) that was preblocked with 4 mg/ml IgG-free BSA ( Sigma Chemical Co.) and washed in IP buffer. Rabbit anti–mouse IgG (Fc) antibodies (Jackson ImmunoResearch Laboratories) were included to bridge mAbs to protein A. Precipitated laminins were dissolved by boiling in SDS-PAGE sample buffer, separated by SDS-PAGE, and then detected by Western blotting as above.
Interspecific Mouse Backcross Mapping
Interspecific backcross progeny were generated by mating (C57BL/6J x Mus spretus) F1 females and C57BL/6J males as described (Copeland and Jenkins, 1991). DNA isolation, restriction enzyme digestion, agarose gel electrophoresis, and Southern blot transfer and hybridization were performed essentially as described (Jenkins et al., 1982). All blots were prepared with Zetabind nylon membrane (Cuno, Inc., Meriden, CT). Probes, which were specific for each locus, were labeled with [32P]dCTP using a random primed labeling kit ( Amersham Corp., Arlington Heights, IL) or a nick translation labeling kit ( Boehringer Mannheim Biochemicals); washing was done to a final stringency of 0.8–1.0 x SSC and 0.1% SDS at 65°C. The probe and restriction fragment length polymorphisms (RFLPs) for Lama1 have been described previously (Okazaki et al., 1993). The Lama2 probe, a
360-bp fragment of mouse cDNA from domain G, detected fragments of 10.5 kb in C57BL/6J (B) DNA and 5.4 and 4.2 kb in M. spretus (S) DNA after digestion with PstI. The Lama3 probe, a
500-bp fragment of mouse cDNA from domains I/II, detected EcoRV fragments of 10.5 kb (B) and
23.0 kb (S). A second probe, a genomic clone containing a portion of domain VI of laminin
3B, gave results identical to those obtained with the domain I/II probe. The Lama4 probe, a
800-bp fragment of mouse cDNA from domain G, detected BglII fragments of 4.4 and 1.7 kb (B) and 6.0 kb (S). The Lama5 probe, a
7.5-kb fragment of mouse genomic DNA from domains V and IVb, detected BamHI fragments of 4.2, 3.7, and 3.3 kb (B) and 4.2, 3.3, 2.3, and 1.8 kb (S). The presence or absence of M. spretus–specific fragments was followed in backcross mice. A total of 205 N2 mice were used to map each Lama locus.
Descriptions of most of the probes and RFLPs for the loci used to position the Lama loci in the interspecific backcross have been reported. These include: Gnas, chromosome 2 (Wilkie et al., 1992); Myb, Fyn, and Ros1, chromosome 10 (Justice et al., 1990); Fert and Tik, chromosome 17 (Fishel et al., 1993; Okazaki et al., 1993); and Tpl2, Cdh2, and Ttr, chromosome 18 (Justice et al., 1992, 1994). One locus has not been reported previously for this interspecific backcross: the Mc3r probe, a 2.0-kb BamHI/ XhoI fragment of mouse cDNA, was kindly provided by Roger Cone (Vollum Institute, Portland, OR) and detected SphI fragments of 3.5 kb (B) and 5.9 kb (S). Recombination distances were calculated as described (Green, 1981) using the computer program SPRETUS MADNESS. Gene order was determined by minimizing the number of recombination events required to explain the allele distribution patterns.
| Results and Discussion |
|---|
|
|
|---|
Chain Family: Identification of Full-Length
3
subfamily of laminin chains currently contains five members. Fig. 1 shows the domain structure of these chains based on the nomenclature of Sasaki et al. (1988). All
chains contain a carboxyl-terminal globular G domain and
-helical domains I and II. The previously described fulllength
1 and
2 chains contain six additional domains (IIIa–VI) that alternate between cysteine-rich stretches containing EGF-like repeats (IIIa, IIIb, and V) and globular regions (IVa, IVb, and VI) (Engvall and Wewer, 1996). The newest member of the family,
5, is also a full-length chain, but it is larger than
1 or
2, owing to the greater number of EGF-like repeats in domain V and a larger domain IVb (Miner et al., 1995). In contrast, laminins
3A and
4 are severely truncated chains that contain only a single cysteine-rich domain (IIIa) downstream of a short aminoterminal domain (Ryan et al., 1994; Galliano et al., 1995; Iivanainen et al., 1995; Richards et al., 1996). Of the vertebrate
chains,
5 may be most like the ancestral
chain, because of its similarity in both domain structure and sequence to the only known invertebrate
chain, Drosophila A (Miner et al., 1995).
|
3 gene. The two known products,
3A and
3B, differ at their amino termini, resulting from alternative splicing and/or alternative promoter usage. The shorter
3A chain was the first to be identified by both immunological methods (Rousselle et al., 1991) and by cDNA cloning (Aberdam et al., 1994b). Subsequently, however, multiple
3 cDNAs were identified in human (Ryan et al., 1994) and mouse (Galliano et al., 1995), suggesting the existence of a second, longer isoform called
3B. Sequence analysis (Galliano et al., 1995) indicated that
3B contains two cysteine-rich (IIIa and IIIb) and two globular (IVa and IV'') domains in addition to the G and I/II domains, but no domains V or VI. This would make it the sole "mid-sized"
chain. However, we have obtained mouse cDNAs (see Materials and Methods) that extend the previously reported sequence 5' by
2.2 kb (Fig. 2). This novel sequence encodes the NH2-terminal portion of domain IVb, a complete domain V, and what is likely all but a few amino acids of a domain VI. These domains are most similar in sequence and predicted tertiary structure to the analogous domains of laminin
5. For example, the amino acid sequence of domain VI is 74% identical to that of
5, but only 54 and 51% identical to those of
1 and
2, respectively. A probe from the 5' end of this sequence recognized
10-kb bands on Northern blots of mouse RNA from adult brain, lung, and kidney (data not shown). The proposed
3B structure is shown in Fig. 1, indicating its unique NH2 terminus and the COOH terminus it shares with
3A.
|
3B and the following amino acid are encoded in a different reading frame than is the extended sequence reported here (Fig. 2). Possible explanations for this discrepancy include a polymorphism between mouse strains, alternative splicing of exons that differ by only one base, RNA editing, sequencing error, or cDNA cloning artifact. We cannot exclude any of these possibilities, although we consider the first three unlikely and note that our sequence, derived from multiple cDNAs, generates a single uninterrupted open reading frame (
9.8 kb) extending through the region of discrepancy. Therefore, we favor the interpretation that there is no mid-sized form of laminin
3, but only the severely truncated
3A and the full-length
3B form reported here. Full-length
3B would thus contain
3,300 amino acids and have a molecular mass of
360 kD. Thus, the
subfamily of laminin chains currently consists of four long (
1,
2,
3B, and
5) and two short (
3A and
4) proteins.
Differential Expression of Laminin
Chain Genes in Embryos and Adults
As a first step in assessing the distribution of the laminin
chains, we performed RNase protection analyses on RNA isolated from a set of eight adult tissues plus a late-term (E17.5) placenta (Fig. 3 A). Laminin
1 was readily detectable only in placenta, but long autoradiographic exposures revealed low levels in kidney. Laminin
2 RNA was present at levels above background (yeast RNA lane) in heart, kidney, lung, muscle, and skin. Laminin
3A/B was expressed primarily in lung, skin, and intestine, although very low levels of this RNA were also detectable in kidney. In contrast, laminin
4 RNA was present in all tissues at low (liver) to moderate (lung) levels. Laminin
5 transcripts were also easily detectable in all tissues, although levels were very low in liver. Thus, each laminin
chain is expressed in a distinct pattern. Interestingly, the two most recently discovered laminins,
4 and
5, are the most widely expressed. The
2 and
3 chains show more restricted patterns of expression. In general,
2 levels were highest in tissues with large mesodermally derived components (skeletal and cardiac muscle), whereas
3 levels were highest in organs that are rich in epithelia (skin, intestine, and lung). The notion that
2 and
3 are predominantly mesodermal and epithelial products, respectively, has been proposed (Vuolteenaho et al., 1994; Aberdam et al., 1994a). Finally, expression of laminin
1, the initially described
chain, was the most severely restricted of the five.
|
1 was again the least widely expressed
chain, although its RNA was readily detected in fetal kidney as well as in placenta. Likewise, laminins
2–5 were expressed at moderate to high levels in a variety of tissues, consistent with patterns seen in adults. Thus, the distinct patterns of laminin
chain expression found in adult tissues are, for the most part, established before birth.
To map
chain expression in younger embryos (E15.5), we used in situ hybridization. Laminin
1 was detected in the kidney and in the meninges of the central nervous system (Fig. 4 a). Laminin
2 was observed primarily in the developing skeletal musculature, in dorsal root ganglia, and in kidney (Fig. 4 b). Laminin
3A/B was strongly expressed in skin, lung, olfactory epithelium, and the superficial layers of the tongue and palate (Fig. 4 c). Laminin
4 was expressed strongly in mesenchymal tissues of the head, in dorsal root ganglia, and in intestine, and was observed diffusely in skeletal and cardiac muscle (Fig. 4 d). Finally, laminin
5 was expressed in a pattern similar to
3, with additional sites of expression in salivary gland, in intestine, and in the most superficial cells of the liver (Fig. 4 e).
|
2 and
4 in muscle,
3 and
5 in skin, and
3–5 in lung. There are, however, a few differences. For example,
2 is barely detectable in heart at E15.5 but is expressed strongly at E17.5; the presence of
4 in heart at E15.5 suggests that there may be a developmental transition in
chain expression in the heart in which
4 is joined by
2. In addition, a particularly interesting pattern of
3–
5 chain expression was observed in the lung, as shown at higher power in Fig. 4, f–h.
3 and
5 were confined to the epithelial lung buds at this stage, while
4 was expressed only in the surrounding mesenchyme. This complementary pattern of expression suggests that these chains may play distinct roles in lung development:
3 and
5 in branching morphogenesis, and
4 in the organization of the mesenchyme.
Identification of Laminin
4 and
5 Proteins
The
1–3 chains were first identified by biochemical and immunochemical methods (Timpl et al., 1979; Leivo and Engvall, 1988; Rousselle et al., 1991; Carter et al., 1991; Verrando et al., 1992). In contrast,
4 and
5 were identified as cDNAs by molecular cloning (Richards et al., 1994; Iivanainen et al., 1995; Miner et al., 1995). Sequence analysis implies that the
4 and
5 cDNAs encode laminin-like proteins, but it is crucial to demonstrate this directly. To this end, we used
4 and
5 cDNAs to produce recombinant proteins in bacteria, and then used the proteins to generate antisera in rabbits. Each antiserum specifically recognized its immunogen on Western blots (Fig. 5 A), and immunoreactivity was removed by incubation with the corresponding fusion protein. Since
3B and
5 sequences are closely related (see above), we also tested anti-
5 on a recombinant fragment from the corresponding domains of
3B. No cross-reaction was detected (data not shown).
|
4 and
5 proteins, we prepared extracts of adult lung and kidney; lung was chosen because it expresses both chains at high levels (Fig. 3 A), and kidney was chosen because it was the focus of immunohistochemical studies detailed below. Tissue BL proteins and purified laminin-1 (
1/β1/
1) were reduced, fractionated by gel electrophoresis, and transferred to nitrocellulose filters, which were then probed with antisera to laminins
4 or
5 or with an antiserum to laminin-1. Results are shown in Fig. 5 B. Anti-
4 recognized an
180-kD protein in both lung and kidney (Fig. 5 B, lanes 3 and 8). Anti-
5 recognized large proteins of
380 and
350 kD, as well as a smaller protein of
210 kD, in both tissues (Fig. 5 B, lanes 4 and 9). Additional specific anti-
5–reactive bands of high Mr (
450 kD) were observed with longer exposure times in several experiments (Fig. 5 B, lane 5). Neither anti-
4 nor anti-
5 reacted with the
400-kD
1 chain of laminin-1 (Fig. 5 B, lanes 12 and 13), although this chain was readily detected by a polyclonal antiserum to laminin-1 (lane 10). Nonimmune rabbit serum was not reactive with any of the laminin chains (Fig. 5 B, lanes 2, 7, and 11). Thus, the laminin
4 and
5 chains are present in adult lung and kidney, and this is consistent with results of RNase protection assays (Fig. 3 A).
The Mr of the anti-
4–reactive protein,
180 kD, is consistent with the size predicted from the open reading frame of the cDNA (190 kD; Iivanainen et al., 1995; Richards et al., 1996). Likewise, the
450-kD
5 chain is of the expected size for this presumably glycosylated protein. The observation that smaller
5-immunoreactive bands (380, 350, and 210 kD) are more abundant than the 450-kD species indicates that
5 is subject to posttranslational cleavage. Multiple protease inhibitors were used in preparing tissue, and the relative abundance of the bands in the extracts remained constant for several weeks at 4°C. We therefore suspect that this cleavage occurred in situ, as has been reported for laminins
2 and
3 (Ehrig et al., 1990; Marinkovich et al., 1992a), rather than during isolation.
Cellular Distribution of Laminin
Chains in Adult Tissues
The laminin
1–3 chains have been shown to be associated with BLs in a variety of tissues, as have the β and
chains. Here we asked whether
4 and
5 are components of BLs, and whether their expression overlaps those of the
1–3 chains. In addition, we wanted to know whether all BLs contained at least one
chain, as the finding of an apparently
-free BL might suggest the existence of additional
chains. We began by using our
4 and
5 antisera, along with previously characterized antibodies to
1–3 (see Materials and Methods), to investigate the expression patterns of the laminin
chains in kidney, a tissue that contains numerous heterogeneous yet well-characterized BLs (Abrahamson et al., 1989; Sanes et al., 1990; Abrahamson and Leardkamolkarn, 1991; Abrahamson and St. John, 1993; Miner and Sanes, 1994; Virtanen et al., 1995).
Laminin
1 was readily detected in the BLs of a subset of renal tubules (primarily proximal), as shown previously (Horikoshi et al., 1988; Sorokin et al., 1992). The
1 chain was absent from glomerular BL but was present in the glomerular mesangium, an amorphous matrix that is one of the few sites in which laminins are present outside of a formed BL (Fig. 6 a). No
1 was detectable in the BLs of arteries, veins, or capillaries. In the peripheral portion of the kidney, laminin
2 was largely restricted to the mesangium, in agreement with previous studies of human kidney (Fig. 6 b; Sanes et al., 1990; Virtanen et al., 1995). At deeper levels, however, some tubules were weakly
2 positive, particularly in the transitional zone between the cortex and medulla (the corticomedullary junction; Fig. 6 b, inset). Laminin
3 was absent from glomeruli, tubules, and vasculature of the renal cortex (data not shown), but it was present in the epithelial BL that lines the papilla (Fig. 6 c). Laminin
4 was absent from all renal, epithelial, and arterial BLs (Fig. 6 d) but was found in many capillaries of the medulla (not shown). Finally, laminin
5 was detected in virtually all BLs, including those of glomeruli, arteries, and all tubules (Fig. 6 e). Thus, all five of the known
chains are present in adult kidney, but each is expressed in a unique pattern.
|
chains were primarily restricted to BLs, and each chain was expressed in a distinct pattern. In the heart, laminins
1 and
3 were undetectable (Fig. 6, f and h). Laminin
2 was abundant in the myocyte BLs (Fig. 6 g), as reported previously (Leivo and Engvall, 1988; Paulsson et al., 1991), while laminin
4, as in the kidney, was restricted to capillaries (Fig. 6 i). Laminin
5 was present in arterioles and capillaries and was also found at low levels in many myocyte BLs (Fig. 6 j). In lung, laminin
3 was present in alveolar BL (Fig. 6 m), consistent with a recent report by Virtanen et al. (1996). The
5 chain was colocalized with
3 in most alveolar BLs (Fig. 6 o), while laminin
4 was detected in a large subset of these BLs (Fig. 6 n). The identity of the
4positive BLs remains to be determined. Interestingly, however, in developing lung, protein localization mirrors the RNA localization documented above:
3 and
5 are concentrated in the epithelial lung buds, with
4 in the mesenchyme (data not shown; Miner, J.H., manuscript in preparation). Laminins
1 and
2 were not detectable in lung (Fig. 6, k and l).
Several conclusions can be drawn from these results. First, all laminin
chains are confined to the extracellular matrix and, with the exception of the glomerular mesangium, to BLs. Cytoplasmic deposits of laminins were not detected, nor were any laminin
chains present in the interstitial collagen– and fibronectin-rich matrix between tubules (in kidney) or myocytes (in heart). Second, each
chain is expressed in a unique pattern. Third, each BL contains at least one
chain. Fourth, BLs can contain either a single
chain (e.g.,
5 in glomerular BL) or multiple
chains (e.g.,
1 and
5 in proximal tubular BL or
3,
4, and
5 in some alveolar BLs). Fifth, even a single BL can vary in laminin composition along its length (e.g.,
1 and
5 in proximal portions of tubular BL,
5 in distal portions, and
2 and
5 at the corticomedullary junction). Sixth, as surmised from studies at the RNA level (see above),
1 is most restricted in its expression, and
5 is the most broadly distributed in adult BLs. Together, these results support the idea that the functional diversity of BLs is achieved in part by laminin
chain diversity.
Finally, it is interesting to compare the distribution of the individual
chains to that previously documented for
1. Many studies, including some from our laboratory, have used the mAb 4C7 (Engvall et al., 1986) to assess the distribution of
1 (Engvall et al., 1990; Sanes et al., 1990; Virtanen et al., 1995, 1996; Sewry et al., 1995; Durham and Snyder, 1995). This antibody was shown to recognize a laminin
chain distinct from
2 at a time when only two
chains had been described (Engvall et al., 1990), but since this antibody does not recognize mouse protein, it could not be tested on bona fide laminin
1 as originally isolated and cloned from the EHS tumor. 4C7-immunoreactive material is more broadly distributed than is
1-immunoreactive material, as recognized by mAbs that bind to mouse laminin
1 (Sorokin et al., 1992) and were used here. Interestingly, the array of BLs recognized by 4C7 most closely resembles that stained by anti-
5 in heart, lung, and kidney (Fig. 6), as well as in skeletal muscle (Patton, B.L., J.H. Miner, and J.R. Sanes, unpublished results). Unfortunately, direct comparisons are not feasible because 4C7 does not recognize mouse or rat antigen, and our anti
5 antiserum does not recognize rabbit or human antigen. However, we speculate that 4C7 may recognize the laminin
5 chain, either instead of or in addition to
1.
Developmental Transitions in Laminin
Chain Expression
We next used our panel of antisera to ask when developing BLs acquire their complement of laminin
chains. Based on the studies of adult organs detailed above, and on the fact that laminins have been implicated as important in renal development and function (Klein et al., 1988; Noakes et al., 1995), we focused on kidney for this analysis. In fact, we found a complex and dynamic pattern of laminin
chain expression in the BLs of the developing nephron. To document these results, it is first necessary to summarize the main stages of nephrogenesis (Fig. 7).
|
To search for potential developmental transitions in laminin
chain expression, we stained sections of E15.5 and neonatal mouse kidney with antibodies to laminins
1–5. Results are summarized in Fig. 7 and examples are shown in Fig. 8. Before vesicle formation, the only BL near the cortical surface was that of the ureteric bud. This BL was rich in laminin
5 (Fig. 8 a) throughout its length and also contained
1 (Fig. 8 g) in the cortical portions. The first-formed BL of the nephron, that of the vesicle, contained laminins
1 (not shown) and
4 (Fig. 8 b). Laminin
1 was detected in the BL of some but not all vesicles, suggesting that it appears after
4 near the end of the vesicle stage. In the comma,
1 and
4 remained (Fig. 8, c and e) and were joined by
5 (Fig. 8 a). At this stage, significant heterogeneity became evident within the single BL that surrounded each comma: laminin
4 was present at higher levels in the tuft than in the periphery (Fig. 8 c), whereas laminin
5 was clearly present in the periphery but was virtually absent from the tuft (Fig. 8 a). Thus, the BL of the tuft, which is the precursor of the glomerular BL, becomes molecularly distinct from continuous but nonglomerular stretches of BL at an early stage of nephrogenesis.
|
chains. The progenitor of the glomerular BL was rich in
4 and
5 and contained low levels of
1; the progenitor of Bowman's capsule BL was rich in all three chains; and the progenitor of the tubular BL contained abundant
1, low levels of
5, and no detectable
4 (Fig. 8, d and f). In addition, the invading vessel, destined to generate the capillary loops of the glomerulus, was coated by a BL with yet a fourth composition: rich in
4 but with no detectable
1 or
5.
As summarized in Fig. 7, E–G, and documented in Fig. 8, d, g, and h, each stretch of BL underwent further changes in laminin
chain composition as the nephron matured. (1) In the BL of Bowman's capsule,
4 declined in level by the capillary loop stage and disappeared from the capsule in the immature glomerulus. Levels of
1 declined later, leaving the mature capsular BL rich in
5, poor in
1, and without detectable
4. (2) Tubular BL became richer in
5 as development proceeded. Different segments of the tubule either maintained or lost
1, or acquired
2, as described above (Fig. 6, a–e). (3) Arteriolar BL lost
4 and acquired
5 at a late stage of development. (4) The glomerular BL first lost
4 and then lost
1, leaving
5 as the only detectable laminin
chain in the adult. (5) Finally, the mesangial matrix was first detectable at the capillary loop stage, where it was
4 positive. Later,
4 disappeared from this matrix, and
1 and
2 accumulated.
It is interesting to compare the laminin
chain transitions in glomerular BL to those previously documented for the laminin β and collagen IV
chains (Abrahamson and St. John, 1993; Miner and Sanes, 1994; Noakes et al., 1995; Virtanen et al., 1995). Laminin β1 and collagen
1,2(IV) chains are present in the primitive comma and S-shaped figure BLs. At the capillary loop stage, they are joined by laminin β2 and collagen
3-5(IV) in the developing glomerular BL. At the immature glomerulus stage, laminin β1 and collagen
1,2(IV) levels begin to decline, leaving only laminin β2 and collagen
3-5(IV) in the mature glomerular BL. The later appearance of
5 and β2 raises the possibility that these two events are linked. However, the initial accumulation of laminin
5 occurs at the S-shaped stage, while laminin β2 and collagen
35(IV) do not appear until the capillary loop stage (Fig. 7, D and E). Likewise, the roughly parallel disappearance of laminins
1,
4, and β1 raises the possibility that this developmental step reflects loss of
1β1- or
4β1-containing trimers. However, laminin β1 was detectable in maturing glomerular BLs that lacked laminins
1 and
4 (data not shown), suggesting that elimination of these molecules is not obligatorily linked. Surprisingly, therefore, the developmental transitions in laminin
and β chains appear to be regulated independently. If all laminin chains occur in
/β/
trimers (see below), these results suggest that
1β1-,
1β2-,
4β1-,
4β2-,
5β1-, and
5β2-containing trimers are potentially present, at least transiently, in developing glomerular BL.
To determine whether the isoform transitions detected at the protein level reflected regulation of gene expression, we performed in situ hybridizations on P1 kidney sections using probes for the
1–5 chains. As noted above, nephrons at all stages of development are present in a corticomedullary gradient in neonates, with the most primitive just beneath the cortical surface and the most mature at deeper levels. Laminin
4 transcripts were clustered at the cortex, as expected from its early appearance in vesicular BL (Fig. 9 d). Laminin
1 transcripts were detected in cortical and subcortical clusters, consistent with the expression of this chain in late vesicle, comma, and S-shaped stages (Fig. 9 a). Segments of tubules were also
1 positive, and lower level expression (above background) was found throughout the kidney. Low levels of laminin
5 RNA were present in the superficial layer of the cortex, consistent with the later appearance of this chain in the developing nephron. Occasional clusters that were observed are likely to be the tips of the ureteric buds that have BLs rich in
5 (Fig. 9 e). Deep in the medulla, laminin
5 RNA was abundant in the collecting ducts, which are derived from the
5-positive ureteric bud.
5 labeling was not abundant in all structures that contained the protein (e.g., capillary loop stage glomeruli), suggesting that, in some cases,
5 RNA is unstable or simply present at low levels but translated efficiently. Laminin
2 RNA was concentrated in the deep cortical and medullary portions of the kidney (Fig. 9 b), consistent with its localization in a subset of tubules (Fig. 6 b). Laminin
3 RNA was not detectable within the renal cortex but was found at P15 in the papilla (data not shown), consistent with its protein localization in adult kidney (Fig. 6 c).
|
4 or
5 Chain
, β, and
subunits, covalently joined by disulfide bonds (Burgeson et al., 1994). Such trimeric structures have been demonstrated for the
1–3 chains, which form laminins 1–7 (Table I), but not for
4 and
5. We therefore asked whether the
4 and
5 chains also occur as components of trimers. To this end, we fractionated proteins from lung and kidney on SDS gels under nonreducing conditions such that laminins migrate as trimers, the relative sizes of which depend on the constituent
, β, and
chains. Nitrocellulose blots were then probed with antibodies to
4 or
5 (Fig. 10 A). Both lung and kidney contained high Mr complexes that reacted with the
4 (Fig. 10 A, lanes 3 and 7) or
5 (lanes 4 and 8) antisera but not with nonimmune serum (lanes 2 and 6). The
4 complexes were
500–600 kD, and the
5 complexes were
700–800 kD. These values are consistent with Mrs predicted for laminin trimers. None of the
4- or
5-immunoreactive bands (
450 kD) that had been seen after reduction (Fig. 5 B) were detectable under these nonreducing conditions, indicating that all of the monomeric species were associated with larger, disulfide-bonded complexes. Moreover, the approximate difference in Mr between the
4- and
5-containing complexes (
200 kD) is consistent with the difference in Mr between the full-length
4 and
5 chains themselves. An antiserum to laminin-1, which recognizes the
1, β1, and
1 chains, blotted material at the Mrs of all
4- and
5containing complexes (Fig. 10 A, lanes 1 and 5), whereas anti-
4 and anti-
5 did not recognize laminin-1 (lanes 11 and 12). Together, these results suggest that laminins
4 and
5 occur in heterotrimers with β1 and/or
1 chains.
|
|
4- and
5-containing complexes as laminin heterotrimers, we solubilized and partially purified laminins from lung. Lung was chosen for this set of experiments because, unlike kidney, it expresses both
4 and
5 chains at high levels in adulthood (Figs. 3 and 6). Lung homogenates were extracted with EDTA, EGTA, NaCl, and Triton X-100, and the extracts were then fractioned by a combination of ion exchange and size exclusion chromatography (see Materials and Methods). The resulting laminin-rich fraction was then subjected to immunoprecipitation with mAbs specific for laminin β1 or β2. Precipitates were separated on gels under nonreducing conditions, electroblotted onto nitrocellulose, and probed with antibodies specific for individual laminin chains (Fig. 10 B). Antibodies to laminin β1 precipitated a series of complexes of
500–800 kD (Fig. 10 B, lanes 1–5). All the complexes comigrated with
1 (Fig. 10 B, lane 5), but none contained β2 (lane 2). Individual complexes reacted with either anti-
4 (Fig. 10 B, lane 3) or with anti-
5 (lane 4) but not with both. Complexes containing
4 had Mrs of
500–600 kD, and those with
5 had Mrs of
700–800 kD, corresponding to Mrs of the nonreduced
4 and
5 complexes observed by immunoblotting crude lung samples (Fig. 10 A). Controls in which the primary antibody was omitted did not contain laminins (Fig. 10 B, lanes 14–18). Thus, the laminin
4 and
5 chains are both associated with β1 in distinct heterotrimers.
Parallel results were obtained from material precipitated by antibodies to laminin β2 (Fig. 10 B, lanes 6–10). All of the laminin β2-reactive material precipitated by these antibodies (Fig. 10 B, lane 7) reacted with anti
1 (lane 10) and with either anti-
4 (lane 8) or anti-
5 (lane 9) but not both. Complexes containing
4 had Mrs of
500–600 kD, and those with
5 had Mrs of
700–800 kD, corresponding to those detected in crude lung samples (Fig. 10 A). Electrophoresis of the immunoprecipitates under reducing conditions revealed that the major
4- and
5-reactive bands detected in crude extracts (Fig. 5 B) were complexed with β2 (data not shown). Thus, lung also contains distinct laminin heterotrimers that include
4+β2 and
5+β2.
Two observations indicated that the complexes containing
4β1,
4β2,
5β1, and
5β2 also contained the
1 chain. First, an mAb to
1 precipitated
4- and
5-containing complexes (Fig. 10 B, lanes 11–13) that were equivalent in Mr to those precipitated by anti-β1 or anti-β2. Second, as noted above, anti-β1 and anti-β2 precipitated
1-containing complexes that comigrated with all of the
4- and
5immunoreactive trimers (Fig. 10 B, lanes 5 and 10). Together, these results provide strong evidence for the existence of laminin trimers with chain compositions of
4β1
1,
4β2
1,
5β1
1, and
5β2
1. In accordance with recently adopted rules of nomenclature (Burgeson et al., 1994), these are named laminins 8–11, respectively (Table I).
Chromosomal Mapping of Lama Genes
The murine chromosomal locations of Lama1–Lama5 were determined using an interspecific backcross mapping panel derived from crosses of [(C57BL/6J x M. spretus) F1 X C57BL/6J] mice. Mouse genomic or cDNA fragments specific for each locus were used as probes in Southern blot hybridization analysis of C57BL/6J and M. spretus genomic DNA that was separately digested with several different restriction enzymes to identify informative RFLPs (see Materials and Methods). The strain distribution pattern of each RFLP in the interspecific backcross was then determined by following the presence or absence of RFLPs specific for M. spretus in backcross mice.
Backcross mapping refined previously reported chromosomal locations for Lama1–3 and provided the first data on mouse chromosomal locations of Lama4 and Lama5 (Fig. 11). Lama1 has previously been reported to map to the distal region of mouse chromosome 17 in this interspecific backcross (Okazaki et al., 1993; Doyle et al., 1996). Lama2 mapped to the proximal region of mouse chromosome 10, 4.5 centiMorgans (cM) distal of Myb and 3.9 cM proximal of Fyn. This result is in good agreement with previous studies that map Lama2 3.2 ± 1.8 cM distal of Myb on mouse chromosome 10 (Sunada et al., 1994). We have also confirmed the recent results of Aberdam et al. (1994b) and Griffith et al. (1996) by assigning Lama3 to the proximal region of chromosome 18. In our interspecific cross, Lama3 mapped 1.6 cM distal of Tpl1 and 1.1 cM proximal of Cdh2. Lama4 is linked to Lama2 on chromosome 10 and does not recombine with Fyn in 129 animals typed in common, suggesting that the two loci are within 2.3 cM of each other (upper 95% confidence limit). Finally, Lama5 mapped to the very distal region of mouse chromosome 2, 2.2 cM distal of Gnas. Thus, the five Lama loci were distributed on four different mouse autosomes, indicating that most of the Lama genes have become dispersed through evolution.
|
5 is expressed in the skin, a mutation may affect the function of hair follicles, which could lead to the ragged coat appearance. Moreover, the disruption of heterotrimeric laminin structure by a defective
chain could explain the semidominant phenotype of both ragged alleles identified to date. Several of the LAMA genes have also been mapped to human chromosomes (summarized in Fig. 11). LAMA1 maps to human 18p11.32-p11.22, LAMA2 to 6q22-q23, LAMA3 to 18q11.2, and LAMA4 to 6q21. LAMA1 is currently the only gene that maps to human chromosome 18 and mouse chromosome 17. Thus, LAMA1 defines a new region of homology between mouse and human chromosomes. In contrast, the mouse and human map locations of LAMA2–4 confirm and extend the known regions of homology between mouse and human chromosomes (Fig. 11; data not shown). LAMA5 has not been mapped in humans. However, the distal region of mouse chromosome 2 shares a region of homology with human chromosome 20q13, suggesting that LAMA5 will map to 20q13 in humans, as well. As noted in the Introduction, the LAMA2 gene is mutated in some congenital muscular dystrophies, and the LAMA3 gene is mutated in a subset of patients with a skin blistering disease, junctional epidermolysis bullosa. No human mutations that suggest a BL defect map to the vicinity of the human LAMA1 or LAMA4 locus or to the predicted LAMA5 locus.
Conclusion
The laminins are major components of BLs throughout the body, and their
chains are ligands for most cellular laminin receptors identified to date, including at least six integrins, dystroglycan, and several glycoconjugates (see Introduction). Yet the distribution of the laminin
chains has not previously been studied in detail, and the existence of the two most recently identified chains (
4 and
5) has been deduced from cDNA sequence but not shown directly at the protein level. We have therefore generated a panel of antibody and cDNA reagents and have used it to localize the
chain genes on mouse chromosomes and the
chain RNAs and proteins in developing and adult tissues. We have also identified a new isoform of laminin
3 and provided direct evidence for the existence of four novel laminin heterotrimers. Our main conclusions are as follows:
(1) The
subfamily of laminin genes currently consists of five members, which encode six proteins. Four (
1,
2,
3B, and
5) are full-sized chains, and two (
3A and
4) are truncated chains (Fig. 1). The previously hypothesized mid-sized
chain (
3B) may not, in fact, exist (Fig. 2).
(2) All five of the laminin
chain genes are expressed in both embryos and adults, but each is expressed in a distinct pattern (Figs. 3 and 4). Their products are confined to the extracellular matrix and, with a few exceptions (e.g., the glomerular mesangium), to BLs (Fig. 6).
(3) All developing and adult BLs studied to date contain at least one of the known
chains, and some contain two or three distinct
chains. Although additional
chains may well exist, our results provide no evidence for them and no clues as to their nature or distribution.
(4) Laminin
5 is the most widely distributed
chain in adult BLs, and
1 is the most restricted. The
2 chain is particularly abundant in mesodermally derived tissues (e.g., skeletal and cardiac muscle), and
3 is concentrated in epithelial BLs. The restricted distribution of
1 is inconsistent with the broad distribution of immunoreactive material recognized by a widely used mAb, 4C7. This discrepancy, together with data on the distribution of
2–5, raises the possibility that 4C7 recognizes the
5 chain, in addition to or instead of
1.
(5) The main patterns of
chain expression are established embryonically (Fig. 4), but some individual BLs change in
chain composition as development proceeds. In kidney, for example, forming glomeruli express three different
chains in a dynamic progression. Moreover, distinct portions of a continuous BL, such as that of the nephron, can contain distinct complements of
chains, and these change during development as well (Figs. 7 and 8).
(6) Laminins
1–5 all form heterotrimers with β and
chains. At present, 11 distinct heterotrimers have been identified in mammalian cells or tissues, including at least two containing each
chain (Table I). The four heterotrimers identified in this study (Fig. 10) have been named laminins-8 (
4β1
1), -9 (
4β2
1), -10 (
5β1
1), and -11 (
5β2
1).
(7) The five
chain genes are distributed on four chromosomes in mouse, and probably on three chromosomes in human. The two
chain genes present on a single chromosome in both species (
2 and
4) are not tightly linked, and two chains present on the same chromosome in humans (
1 and
3) are on different chromosomes in mouse (Fig. 11). Thus, there is no evidence for functionally important linkage of the
chain genes.
The patterns of expression that we have documented indicate that the
chains contribute importantly to the molecular diversity of BLs. Together with evidence that some cellular receptors can distinguish among
chains and that naturally occurring mutations of
2 and
3 have tissuespecific phenotypes (see Introduction), our results suggest that differences among
chains are critical to the multiplicity of roles that BLs play both during development and in maturity.
| Note Added in Proof: |
|---|
|
|
|---|
3 transcript with a distinct 5' end and translation start site has now been identified by D. Aberdam and colleagues. It encodes a protein intermediate in size between the
3B isoform reported here and the
3A isoform described by Galliano et al. (1995). Thus, there may be three isoforms of laminin
3: short (A), fulllength (B), and mid-sized (C) (Aberdam, D., personal communication).
| Acknowledgments |
|---|
This work was supported by grants from the National Institutes of Health.
Submitted: 24 December 1996
Revised: 13 February 1997
Please address all correspondence to Joshua R. Sanes, Department of Anatomy and Neurobiology, Washington University School of Medicine, 660 South Euclid Avenue, St. Louis, MO 63110. Tel.: (314) 362-2507. Fax: (314) 747-1150.
| References |
|---|
|
|
|---|
Aberdam D Aguzzi A Baudoin C Galliano M-F Ortonne J-P Meneguzzi G Developmental expression of nicein adhesion protein (laminin-5) subunits suggests multiple morphogenic roles, Cell Adhes Commun, 1994a, 2, 115–129.[Medline]
Aberdam D Galliano MF Mattei M-G Pisani-Spadafora A Ortonne J-P Meneguzzi G. Assignment of mouse nicein genes to chromosomes 1 and 18, Mamm Genome, 1994b, 5, 229–233.[Medline]
Abrahamson DR. Glomerulogenesis in the developing kidney, Semin Nephrol, 1991, 11, 375–389.[Medline]
Abrahamson DR Leardkamolkarn V. Development of kidney tubular basement membranes, Kidney Int, 1991, 39, 382–393.[Medline]
Abrahamson DR St. John PL. Laminin distribution in developing glomerular basement membranes, Kidney Int, 1993, 43, 73–78.[Medline]
Abrahamson DR Irwin MH St. John PL Perry EW Accavitti MA Heck LW Couchman JR. Selective immunoreactivities of kidney basement membranes to monoclonal antibodies against laminin: localization of the end of the long arm and the short arms to discrete microdomains, J Cell Biol, 1989, 109, 3477–3491.
Altschul SF Gish W Miller W Myers EW Lipman DJ. Basic local alignment search tool, J Mol Biol, 1990, 215, 403–410.[Medline]
Beck K Hunter I Engel J. Structure and function of laminin: anatomy of a multidomain glycoprotein, FASEB (Fed Am Soc Exp Biol) J, 1990, 4, 148–160.[Abstract]
Burgeson RE Chiquet M Deutzmann R Ekblom P Engel J Kleinman H Martin GR Ortonne J-P Paulsson M Sanes J et al.. A new nomenclature for laminins, Matrix Biol, 1994, 14, 209–211.[Medline]
Carter TC Phillips RJS. Ragged, a semidominant coat texture mutant, J Hered, 1954, 45, 151–154.
Carter WG Ryan MC Gahr PJ. Epiligrin, a new cell adhesion ligand for integrin
3β1 in epithelial basement membranes, Cell, 1991, 65, 599–610.[Medline]
Champliaud M-F Lunstrum GP Rousselle P Nishiyama T Keene DR Burgeson RE. Human amnion contains a novel laminin variant, laminin 7, which like laminin 6, covalently associates with laminin 5 to promote stable epithelial-stromal attachment, J Cell Biol, 1996, 132, 1189–1198.
Chomczynski P Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal Biochem, 1987, 162, 156–159.[Medline]
Chung AE Jaffe R Freeman IL Vergnes JP Braginsk JE Carlin B. Properties of a basement membrane related glycoprotein synthesized by a mouse embryonal carcinoma-derived cell line, Cell, 1979, 16, 277–287.[Medline]
Clark EA Brugge JS. Integrins and signal transduction pathways: the road taken, Science (Wash DC), 1995, 268, 233–239.
Copeland NG Jenkins NA. Development and applications of a molecular genetic linkage map of the mouse genome, Trends Genet, 1991, 7, 113–118.[Medline]
Davies J. How to build a kidney, Semin Cell Biol, 1993, 4, 213–219.[Medline]
Doyle J Hoffman S Ucla C Reith W Mach B Stubbs L. Locations of human and mouse genes encoding the RFX1 and RFX2transcription factor proteins, Genomics, 1996, 35, 227–230.[Medline]
Durham PL Snyder JM. Characterization of
1, β1, and
1 laminin subunits during rabbit fetal lung development, Dev Dyn, 1995, 203, 408–421.[Medline]
Ehrig K Leivo I Argraves WS Ruoslahti E Engvall E. Merosin, a tissue-specific basement membrane protein, is a laminin-like protein, Proc Natl Acad Sci USA, 1990, 87, 3264–3268.
Ekblom P. Receptors for laminins during epithelial morphogenesis, Curr Opin Cell Biol, 1996, 8, 700–706.[Medline]
Engvall E Wewer UM. Domains of laminin, J Cell Biochem, 1996, 61, 493–501.[Medline]
Engvall E Davis GE Dickerson K Ruoslahti E Varon S Manthorpe M. Mapping of domains in human laminin using monoclonal antibodies: localization of the neurite-promoting site, J Cell Biol, 1986, 103, 2457–2465.
Engvall E Earwicker D Haaparanta T Ruoslahti E Sanes JR. Distribution and isolation of four laminin variants; tissue restricted distribution of heterotrimers assembled from five different subunits, Cell Regul, 1990, 1, 731–740.[Medline]
Fishel R Lescoe MK Rao MRS Copeland NG Jenkins NA Garber J Kane M Kolodner R. The human mutator gene homolog MSF2and its association with hereditary nonpolyposis colon cancer, Cell, 1993, 75, 1027–1038.[Medline]
Foster RF Thompson JM Kaufman SJ. A laminin substrate promotes myogenesis in rat skeletal muscle cultures: analysis of replication and development using antidesmin and anti-BrdUrd monoclonal antibodies, Dev Biol, 1987, 122, 11–20.[Medline]
Galliano M-F Aberdam D Aguzzi A Ortonne J-P Meneguzzi G. Cloning and complete primary structure of the mouse laminin
3 chain, J Biol Chem, 1995, 270, 21820–21826.
Garcia-Alonso L Fetter RD Goodman CS. Genetic analysis of Laminin A in Drosophila: extracellular matrix containing laminin A is required for ocellar axon pathfinding, Development (Camb), 1996, 122, 2611–2621.[Abstract]
Gee SH Blacher RW Douville PJ Provost PR Yurchenco PD Carbonetto S. Laminin-binding protein 120 from brain is closely related to the dystrophin-associated glycoprotein, dystroglycan, and binds with high affinity to the major heparin binding domain of laminin, J Biol Chem, 1993, 268, 14972–14980.
Gerecke SR Wagman DW Champliaud MF Burgeson RE. The complete primary structure for a novel laminin chain, the laminin B1k chain, J Biol Chem, 1994, 269, 11073–11080.
Green, E.L. 1981. Linkage, recombination and mapping. In Genetics and Probability in Animal Breeding Experiments. Oxford University Press, New York. 77–113.
Green EL Mann SJ. Opossum, a semi-dominant lethal mutation affecting hair and other characteristics of mice, J Hered, 1961, 52, 223–227.
Green TL Hunter DD Chan W Merlie JP Sanes JR. Synthesis and assembly of the synaptic cleft protein S-laminin by cultured cells, J Biol Chem, 1992, 267, 2014–2022.
Griffith AJ Radice GL Burgess DL Kohrman DC Hansen GM Justice ML Johnson KR Davisson MT Meisler MH. Location of the 9257 and ataxia mutations on mouse Chromosome 18, Mamm Genome, 1996, 7, 417–419.[Medline]
Hall H Liu L Schachner M Schmitz B. The L2/NHK-1 carbohydrate mediates adhesion of neural cells to laminin, Eur J Neurosci, 1993, 5, 34–42.[Medline]
Helbling-Leclerc A Zhang X Topaloglu H Cruaud C Tesson F Weissenbach J Tome FM Schwartz K Fardeau M Tryggvason K Guicheney P. Mutations in the laminin
2-chain gene (LAMA2) cause merosin-deficient congenital muscular dystrophy, Nat Genet, 1995, 11, 216–218.[Medline]
Henchcliffe C Garcia-Alonso L Tang J Goodman CS. Genetic analysis of laminin A reveals diverse functions during morphogenesis in Drosophila. , Development (Camb), 1993, 118, 325–337.[Abstract]
Henry MD Campbell KP. Dystroglycan—an extracellular matrix receptor linked to the cytoskeleton, Curr Opin Cell Biol, 1996, 8, 625–631.[Medline]
Horikoshi S Koide H Shirai T. Monoclonal antibodies against laminin A chain and B chain in the human and mouse kidneys, Lab Invest, 1988, 58, 532–538.[Medline]
Hunter DD Porter BE Bulock JW Adams SP Merlie JP Sanes JR. Primary sequence of a motor neuron-selective adhesive site in the synaptic basal lamina protein S-laminin, Cell, 1989a, 59, 905–913.[Medline]
Hunter DD Shah V Merlie JP Sanes JR. A laminin-like adhesive protein concentrated in the synaptic cleft of the neuromuscular junction, Nature (Lond), 1989b, 338, 229–234.[Medline]
Iivanainen A Sainio K Sariola H Tryggvason K. Primary structure and expression of a novel human laminin
4 chain, FEBS Lett, 1995, 365, 183–188.[Medline]
Jenkins NA Copeland NG Taylor BA Lee BK. Organization, distribution, and stability of endogenous ecotropic murine leukemia virus DNA sequences in chromosomes of Mus musculus. , J Virol, 1982, 43, 26–36.
Justice MJ Siracusa LD Gilbert DJ Heisterkamp N Groffen J Chada K Silan CM Copeland NG Jenkins NA. A genetic linkage map of mouse chromosome 10: localization of eighteen molecular markers using a single interspecific backcross, Genetics, 1990, 125, 855–866.[Abstract]
Justice MJ Gilbert DJ Kinzler KW Vogelstein B Buchberg AM Ceci JD Matsuda Y Chapman VM Patriotis C Makris A et al.. A molecular genetic linkage map of mouse chromosome 18 reveals extensive linkage conservation with human chromosomes 5 and 18, Genomics, 1992, 13, 1281–1288.[Medline]
Justice MJ Morse HC III Jenkins NA Copeland NG. Identification of Evi-3, a novel common site of retroviral integration in mouse AKXD B-cell lymphomas, J Virol, 1994, 68, 1293–1300.
Kallunki P Sainio K Eddy R Byers M Kallunki T Sariola H Beck K Hirvonen H Shows TB Tryggvason K. A truncated laminin chain homologous to the B2 chain: structure, spatial expression, and chromosomal assignment, J Cell Biol, 1992, 119, 679–693.
Klein G Langegger M Timpl R Ekblom P. Role of laminin A chain in the development of epithelial cell polarity, Cell, 1988, 55, 331–341.[Medline]
Leivo I Engvall E. Merosin, a protein specific for basement membranes of Schwann cell, striated muscle, and trophoblast, is expressed late in nerve and muscle development, Proc Natl Acad Sci USA, 1988, 85, 1544–1548.
Lentz SI Miner JH Sanes JR Snider WD. Distribution of the ten known laminin chains in the pathways and targets of developing sensory axons, J Comp Neurol, 1997, 378, 547–561.[Medline]
Lindblom A Marsh T Fauser C Engel J Paulsson M. Characterization of native laminin from bovine kidney and comparison with other laminin variants, Eur J Biochem, 1994, 219, 383–392.[Medline]
Marinkovich MP Lunstrum GP Burgeson RE. The anchoring filament protein kalinin is synthesized and secreted as a high molecular weight precursor, J Biol Chem, 1992a, 267, 17900–17906.
Marinkovich MP Lunstrum GP Keene DR Burgeson RE. The dermal-epidermal junction of human skin contains a novel laminin variant, J Cell Biol, 1992b, 119, 695–703.
Martin GR Timpl R. Laminin and other basement membrane components, Annu Rev Cell Biol, 1987, 3, 57–85.
McGrath JA Kivirikko S Ciatti S Moss C Dunnill GS Eady RA Rodeck CH Christiano AM Uitto J. A homozygous nonsense mutation in the alpha 3 chain gene of laminin 5 (LAMA3) in Herlitz junctional epidermolysis bullosa: prenatal exclusion in a fetus at risk, Genomics, 1995, 29, 282–284.[Medline]
Mecham, R.P., and A. Hinek. 1996. Non-integrin laminin receptors. In The Laminins. P. Ekblom and R. Timpl, editors. Harwood Academic Publishers, Amsterdam. 159–183.
Mercurio AM. Laminin receptors: achieving specificity through cooperation, Trends Cell Biol, 1995, 5, 419–423.[Medline]
Miner JH Sanes JR. Collagen IV
3,
4, and
5 chains in rodent basal laminae: sequence, distribution, association with laminins, and developmental switches, J Cell Biol, 1994, 127, 879–891.
Miner JH Wold BJ. c-mycinhibition of MyoD and myogenin-initiated myogenic differentiation, Mol Cell Biol, 1991, 11, 2842–2851.
Miner JH Lewis RM Sanes JR. Molecular cloning of a novel laminin chain,
5, and widespread expression in adult mouse tissues, J Biol Chem, 1995, 270, 28523–28526.
Noakes PG Miner JH Gautam M Cunningham JM Sanes JR Merlie JP. The renal glomerulus of mice lacking s-laminin/laminin β2: nephrosis despite molecular compensation by laminin β1, Nat Genet, 1995, 10, 400–406.[Medline]
Okazaki T Yoshida BN Avraham KB Wang H Wuenschell CW Jenkins NA Copeland NG Anderson DJ Mori N. Molecular diversity of the SCG10/Stathmin gene family in the mouse, Genomics, 1993, 18, 360–373.[Medline]
Pall EA Bolton KM Ervasti JM. Differential heparin inhibition of skeletal muscle alpha-dystroglycan binding to laminins, J Biol Chem, 1996, 271, 3817–3821.
Paulsson M Saladin K Engvall E. The 300-kDa chains of murine and bovine heart laminin are related to the human placenta merosin heavy chain and replace the A chain in some laminin variants, J Biol Chem, 1991, 266, 17545–17551.
Rao CN Kefalides NA. Identification and characterization of a 43 kilodalton laminin fragment from the "A" chain (long arm) with high-affinity heparin binding and mammary epithelial cell adhesion-spreading activities, Biochemistry, 1990, 29, 6768–6777.[Medline]
Reichardt LF Tomaselli KJ. Extracellular matrix molecules and their receptors: functions in neural development, Annu Rev Neurosci, 1991, 14, 531–570.[Medline]
Richards AJ Al-Imara L Carter NP Lloyd JC Leversha MA Pope FM. Localization of the gene (LAMA4) to chromosome 6q21 and isolation of a partial cDNA encoding a variant laminin A chain, Genomics, 1994, 22, 237–239.[Medline]
Richards A Al-Imara L Pope FM. The complete cDNA sequence of laminin
4 and its relationship to the other human laminin
chains, Eur J Biochem, 1996, 238, 813–821.[Medline]
Rousselle P Lunstrum GP Keene DR Burgeson RE. Kalinin: an epithelium-specific basement membrane adhesion molecule that is a component of anchoring filaments, J Cell Biol, 1991, 114, 567–576.
Ryan MC Tizard R VanDevanter DR Carter WG. Cloning of the LamA3 gene encoding the
3 chain of the adhesive ligand epiligrin, J Biol Chem, 1994, 269, 22779–22787.
Sanes JR Chiu AY. The basal lamina of the neuromuscular junction, Cold Spring Harbor Symp Quant Biol, 1983, 48, 667–678.
Sanes JR Engvall E Butkowski R Hunter DD. Molecular heterogeneity of basal laminae: isoforms of laminin and collagen IV at the neuromuscular junction and elsewhere, J Cell Biol, 1990, 111, 1685–1699.
Sasaki M Kleinman HK Huber H Deutzmann R Yamada Y. Laminin, a multidomain protein: the A chain has a unique globular domain and homology with the basement membrane proteoglycan and the laminin B chains, J Biol Chem, 1988, 263, 16536–16544.
Sewry CA Chevallay M Tome FMS. Expression of laminin subunits in human fetal skeletal muscle, Histochem J, 1995, 27, 497–504.[Medline]
Slee J. The morphology and development of ragged—a mutant affecting the skin and hair of the house mouse. II. Genetics, embryology and gross juvenile morphology, J Genet, 1957, 55, 570–584.
Sorokin L Ekblom P. Development of tubular and glomerular cells of the kidney, Kidney Int, 1992, 41, 657–664.[Medline]
Sorokin LM Conzelmann S Ekblom P Battaglia C Aumailley M Timpl R. Monoclonal antibodies against laminin A chain fragment E3 and their effects on binding to cells and proteoglycan and on kidney development, Exp Cell Res, 1992, 201, 137–144.[Medline]
Sunada Y Bernier SM Kozak CA Yamada Y Campbell KP. Deficiency of merosin in dystrophic dy mice and genetic linkage of laminin M chain gene to dylocus, J Biol Chem, 1994, 269, 13729–13732.
Sung U O'Rear JJ Yurchenco PD. Cell and heparin binding in the distal long arm of laminin: identification of active and cryptic sites with recombinant and hybrid glycoprotein, J Cell Biol, 1993, 123, 1255–1268.
Timpl R. Macromolecular organization of basement membranes, Curr Opin Cell Biol, 1996, 8, 618–624.[Medline]
Timpl R Rhode H Robey PG Rennard SI Foidart JM Martin GR. Laminin—A glycoprotein from basement membranes, J Biol Chem, 1979, 254, 9933–9937.
Vachon PH Loechel F Xu H Wewer UM Engvall E. Merosin and laminin in myogenesis; specific requirement for merosin in myotube stability and survival, J Cell Biol, 1996, 134, 1483–1497.
Verrando P Partouche O Pisani A Ortonne J-P. The 6/2 (AA3) polyclonal antibody identifying a 37 kD keratinocyte protein reacts also with BM-600/nicein, the basement membrane component bound by the monoclonal antibody GB3, Exp Derm, 1992, 1, 52–58.[Medline]
Virtanen I Laitinen L Korhonen M. Differential expression of laminin polypeptides in developing and adult human kidney, J Histochem Cytochem, 1995, 43, 621–628.[Abstract]
Virtanen I Laitinen A Tani T Paakko P Laitinen LA Burgeson RE Lehto V-P. Differential expression of laminins and their integrin receptors in developing and adult human lung, Am J Respir Cell Mol Biol, 1996, 15, 184–196.[Abstract]
Vuolteenaho R Nissinen M Sainio K Byers M Eddy R Hirvonen H Shows TB Sariola H Engvall E Tryggvason K. Human laminin M chain (merosin): complete primary structure, chromosomal assignment, and expression of the M and A chain in human fetal tissues, J Cell Biol, 1994, 124, 381–394.
Wilkie TM Gilbert DJ Olsen AS Chen X-N Amatruda TT Korenberg JR Trask BJ de Jong P Reed RR Simon MI et al.. Evolution of the mammalian G protein
subunit multigene family, Nat Genet, 1992, 1, 85–91.[Medline]
Xu H Wu X-R Wewer UM Engvall E. Murine muscular dystrophy caused by a mutation in the laminin
2 (Lama2)gene, Nat Genet, 1994, 8, 297–302.[Medline]
Yamada KM Miyamoto S. Integrin transmembrane signaling and cytoskeletal control, Curr Opin Cell Biol, 1995, 7, 681–689.[Medline]
Yarnitzky T Volk T. Laminin is required for heart, somatic muscles, and gut development in the Drosophilaembryo, Dev Biol, 1995, 169, 609–618.[Medline]
Yurchenco PD O'Rear JJ. Basal lamina assembly, Curr Opin Cell Biol, 1994, 6, 674–681.[Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|