|
||



* Department of Life Sciences, Graduate School of Arts and Sciences, University of Tokyo, 3-8-1 Komaba, Meguro-ku, Tokyo
153;
Department of Applied Chemistry, Kogakuin University, Shinjuku-ku, Tokyo 163-91; § Cellular Signaling Laboratory,
Institute of Physical and Chemical Research (RIKEN), 2-1 Hirosawa, Wako-shi, Saitama 351-01; and
Department of Biophysics
and Biochemistry, School of Science, University of Tokyo, 7-3-1 Hongo, Bunkyo-ku, Tokyo 113, Japan
The gapA gene encoding a novel RasGTPase-activating protein (RasGAP)-related protein was
found to be disrupted in a cytokinesis mutant of Dictyostelium that grows as giant and multinucleate cells in
a dish culture. The predicted sequence of the GAPA
protein showed considerable homology to those of
Gap1/Sar1 from fission yeast and the COOH-terminal
half of mammalian IQGAPs, the similarity extending
beyond the RasGAP-related domain. In suspension
culture, gapA
cells showed normal growth in terms of
the increase in cell mass, but cytokinesis inefficiently
occurred to produce spherical giant cells. Time-lapse
recording of the dynamics of cell division in a dish culture revealed that, in the case of gapA
cells, cytokinesis was very frequently reversed at the step in which the
midbody connecting the daughter cells should be severed. Earlier steps of cytokinesis in the gapA
cells
seemed to be normal, since myosin II was accumulated
at the cleavage furrow. Upon starvation, gapA
cells
developed and formed fruiting bodies with viable
spores, like the wild-type cells. These results indicate
that the GAPA protein is specifically involved in the
completion of cytokinesis. Recently, it was reported
that IQGAPs are putative effectors for Rac and
CDC42, members of the Rho family of GTPases, and
participate in reorganization of the actin cytoskeleton.
Thus, it is possible that Dictyostelium GAPA participates in the severing of the midbody by regulating the
actin cytoskeleton through an interaction with a member of small GTPases.
Cytokinesis is the final stage of the cell cycle, in
which the cytoplasm of a cell is divided equally in
the two daughter cells after the segregation of nuclei (Satterwhite and Pollard, 1992 Members of the Rho family of small GTPases, CDC42,
Rac, and Rho proteins, regulate the formation of filopodia, lamellipodia, and stress fibers and focal adhesions, respectively, events that involve reorganization of the actin
cytoskeleton (Ridley and Hall, 1992 The cellular slime mold, Dictyostelium discoideum, is an
ideal model organism for studying cytokinesis, since the
basic mechanisms of Dictyostelium cytokinesis resemble
those of higher eukaryotic cells. Furthermore, genetic and
reverse genetic approaches are possible with the Dictyostelium system. Dictyostelium cells lacking myosin II generated by homologous recombination (De Lozanne and Spudich, 1987) or through expression of the corresponding
antisense RNA (Knecht and Loomis, 1987 To identify novel genes involved in cytokinesis, we have
screened Dictyostelium cytokinesis mutants that grow as
giant and multinucleate cells (Adachi et al., 1994 Dictyostelium Strains and Cell Culture
All the strains used in this study were derived from Dictyostelium discoideum AX2 (Watts and Ashworth, 1970 Southern Blot Analysis
Genomic DNA was isolated from Dictyostelium cells according to Bain
and Tsang (1991) Reverse Transcription-PCR
Total RNA was isolated from 2 × 107 vegetative cells using a QuickPrep®
total RNA extraction kit (Pharmacia Biotech, Piscataway, NJ). 0.67 µg of total RNA was used for a single-tube reaction for first strand synthesis with
a Ready-To-Go T-primed first strand kit (Pharmacia Biotech) according
to the instruction manual. The reaction mixture was divided into two
tubes. To each tube, distilled water, gapA primers (AGAAAAACTGTCATCTATAGCG and GTTGTTGTAATTTCATTGGGTG) or myosin
II heavy chain primers (TGGTCTAGATTCACAAGCCACTATC and TTGTTCTCGAGCTTCTTCAATACGAGC), and AmpliTaq® Gold (Perkin-Elmer Corp., Norwalk, CT) were added, and then the PCR was performed as described in the manual. 10 µl of the reaction mixture was then
subjected to 1.5% agarose gel electrophoresis, and the amplified DNA
was detected according to Sambrook et al. (1989) Molecular Cloning and Sequence Analysis of the
gapA Gene
The general methods for recombinant DNA were described previously
(Sambrook et al., 1989
Dictyostelium Transformation
The procedures for Dictyostelium transformation were previously described (Adachi et al., 1994 Cell Staining
Dictyostelium cells were grown axenically on coverslips as described
above. Fluorescence microscopy was performed according to Fukui et al.
(1987) Dictyostelium Development
108 axenically growing cells were washed twice with 17 mM potassium
phosphate buffer (pH 6.5), and then spread on an 1.5% agarose plate
(6 cm) containing the same buffer. Starved cells were developed at 22°C
for 24 h.
Molecular Cloning of the Dictyostelium Cytokinesis
Gene from REMI Mutant D42-2
We have already reported three Dictyostelium cytokinesis
mutants (Adachi et al., 1994 One of the mutants, D42-2, was further analyzed. Fig. 1
shows the restriction map of genomic DNA around the tag
integration site of D42-2 determined by Southern blotting.
Involvement of the disrupted gene in cytokinesis was confirmed in two ways. First, mutant strains with a phenotype
identical to that of D42-2 were regenerated by homologous recombination. The rescued NdeI fragment of D42-2
containing Dictyostelium DNA at both ends of the tag plasmid was introduced into the wild-type AX2 strain by
electroporation. At high frequency (54%, n = 262), the
transformants showed an identical phenotype to the original mutant (Fig. 2, C and G). Restriction maps of the genomic DNA of the regenerated mutants confirmed the location of insertion of the tag, as shown in Fig. 1 (data not
shown). These results indicate that the integration of the
tag is responsible for the mutant phenotype.
Second, genetic complementation of the mutant phenotype with the intact gene was examined. To clone the entire gene, EcoRI and HindIII fragments of the D42-2 DNA
including the 5
A Gene Encoding a Novel IQGAP-related Protein Is
Disrupted in the D42-2 Strain
DNA sequencing of the HindIII-ClaI fragment revealed
an open reading frame interrupted by three putative introns with typical features of Dictyostelium introns (Figs. 1
and 4). The intron-exon boundaries were confirmed by sequence analysis of cDNA clones prepared from the vegetative mRNA (data not shown). It was found that the tag
was inserted into the fourth exon of the gene in the D42-2
DNA (Figs. 1 and 4), and that the open reading frame is
2,580 bp in length and codes for a protein of 860 amino acids (molecular mass = 98.8 kD).
The deduced amino acid sequence of this protein was
compared with the NBRF-PIR and SWISS PLOT databases, which revealed that it is very closely related to Gap1/
Sar1 from fission yeast (Imai et al., 1991
Reversion of Cytokinesis Observed in gapA To determine the step(s) at which GAPA acts during cytokinesis, the phenotype of gapA
Second, the dynamics of cell division on a glass surface
were monitored by means of time-lapse video recording.
gapA
Development of gapA When starved on phosphate agar, gapA
The phenotypes of the REMI mutant shown above were
identical to those of the null strain lacking most of the coding sequence of the gapA gene (data not shown).
Although it has been established that the astral microtubules determine the position of the contractile ring (Rappaport, 1990 Dictyostelium cells lacking the IQGAP-related protein,
GAPA, grow as giant and multinucleate cells both on a
substratum and in suspension culture. Observation of cell
division of gapA Similar reversed cytokinesis has been reported for a cell
line in which the expression level of calmodulin is reduced
about twofold through expression of the corresponding
antisense RNA (Liu et al., 1992 Since a RasGAP-related domain lies in the middle of
the GAPA protein, GAPA could activate the GTPase activity of Ras. Genetic (Imai et al., 1991 In Dictyostelium, eight Cdc42/Rac-related proteins have
been identified (Bush et al., 1993 Very recently, two other IQGAP-related proteins were
found in Dictyostelium (Faix and Dittrich, 1996
). In cytokinesis, an actin contractile ring first appears at the equator of a cell,
which then constricts to generate the cleavage furrow. This
constriction requires force generated by conventional myosin II. Thus, depletion of myosin II results in cytokinesis
defects (Mabuchi and Okuno, 1977
; De Lozanne and Spudich, 1987; Knecht and Loomis, 1987
). The furrowing
proceeds to form a narrow cytoplasmic bridge called the
midbody that is eventually severed. These processes in cytokinesis should be spatially and temporally regulated,
otherwise the components of the cell cannot be equally
distributed between the daughter cells. In contrast with
the detailed understanding of mitotic regulation, however, much less is known about the signal transduction pathways
regulating cytokinesis.
; Ridley et al., 1992
;
Nobes and Hall, 1995
). Recently, it was found that these
proteins are also involved in cytokinesis, an event in which
the actin cytoskeleton plays a central role. In sand dollar
(Mabuchi et al., 1993
) and Xenopus (Kishi et al., 1993
;
Drechsel et al., 1996
) eggs, microinjection of a Rho-specific inhibitor, C3 exoenzyme from Clostridium botulinum,
prevents the progression of cytokinesis. Both a human cell
line expressing a constitutively activated mutant of
CDC42Hs (Dutartre et al., 1996
) and a Dictyostelium strain
lacking the racE gene encoding a Rac/CDC42-related protein (Larochelle et al., 1996
) produced giant and multinucleate cells as a result of the impairment of cytokinesis.
Rho-type GTPases appear to regulate these cytoskeletal events through cytoplasmic targets rather than nuclear
ones (Vojtek and Cooper, 1995
). Recently, putative cytoplasmic targets for CDC42/Rac (Hart et al., 1996
; Brill et
al., 1996
; McCallum et al., 1996
; Kuroda et al., 1996
) and
Rho (Watanabe et al., 1996
; Amano et al., 1996a
,b; Matsui
et al., 1996
; Kimura et al., 1996
) were identified. Some of
them might be specifically involved in cytokinesis.
) became multinucleate cells as a result of severe defects in cytokinesis.
However, these cells were not lethal, since their growth
was supported by traction-mediated cytofission, a process
dependent on the attachment of cells to a solid surface
(De Lozanne and Spudich, 1987; Fukui et al., 1990
). This
viable and multinucleate phenotype of Dictyostelium mutants enables us to identify genes involved in cytokinesis,
either by disrupting genes encoding known proteins or by
random tagging mutagenesis followed by cloning of the
disrupted genes. Such screening will identify molecules
regulating cytokinesis as well as those directly or indirectly
associated with the contractile ring. Actually, genes encoding the subunits of myosin II (De Lozanne and Spudich, 1987; Manstein et al., 1989
; Pollenz et al., 1992
; Chen et al., 1994
, 1995), actin-binding proteins (de Hostos et al., 1993;
Haugwitz et al., 1994
; Faix et al., 1996
), calmodulin (Liu et al.,
1992
), and a Rac protein (Larochelle et al., 1996
) have
been identified as the cytokinesis genes in Dictyostelium.
) using an
efficient tagging method called restriction enzyme-mediated integration (REMI)1 (Kuspa and Loomis, 1992
). By
analyzing one such mutant, we identified a Dictyostelium
IQGAP-related protein, GAPA, which is required for cleavage of the midbody in the final stage of cytokinesis. Interacting with CDC42 and Rac, mammalian IQGAPs act as
effectors for these GTPases to regulate reorganization of
the actin cytoskeleton (Hart et al., 1996
; Brill et al., 1996
;
McCallum et al., 1996
; Kuroda et al., 1996
). Like other
IQGAPs, the GAPA protein in Dictyostelium cells could
regulate late cytokinesis through the actomyosin system.
Materials and Methods
). The cytokinesis mutant, D42-2,
was described previously (Adachi et al., 1994
). The wild-type AX2 and
mutant strains were grown axenically in HL5 medium (Sussman, 1987
) containing Proteose Peptone No. 2 or No. 3 (Difco Laboratories, Inc., Detroit, MI) at 22°C. For suspension culture, cells were shaken at 150 rpm.
Penicillin G sodium and streptomycin sulfate (GIBCO BRL, Gaithersburg, MD) were always added to the medium at concentrations of 6 U/ml
and 6 µg/ml, respectively. For marker selection, blasticidin S (Funakoshi
Co., Tokyo, Japan) and/or G418 (Difco Laboratories, Inc.) were used at
the final concentrations of 4 µg/ml and 10 µg/ml, respectively.
. Gel electrophoresis and electroblotting of digested
DNA were performed as previously described (Adachi et al., 1994
).
Southern hybridization and detection were carried out with a DIG DNA
labeling and detection kit (Boehringer Mannheim Biochemicals, Indianapolis, IN) or a direct nucleic acid labeling and enhanced chemiluminescence detection system (Amersham Corp., Arlington Heights, IL) according to the manufacturer's instructions.
.
). Fragments of the gapA gene were cloned from
the genomic DNA of the D42-2 strain by the plasmid rescue method as
previously described (Adachi et al., 1994
), except that Escherichia coli
STBL2 (GIBCO BRL) was used as the host for the plasmids to prevent
deletion of the Dictyostelium DNA in E. coli cells. First, EcoRI (12.6-kb)
and HindIII (7.5-kb) fragments containing E. coli plasmid pUC118 (Vieira and Messing, 1987
) with the 5
or 3
half of the gapA gene were rescued (see Fig. 1) and termed p42-2Eco and p42-2Hind, respectively. The
DNA sequences of these fragments were determined with an SQ5500 DNA
sequencer (Hitachi Co., Tokyo, Japan) and a Thermo Sequenase core sequencing kit with 7-deaza-dGTP (Amersham Corp.). The intact gapA gene
was reconstructed as a 4.1-kb HindIII-ClaI fragment as follows. The gene
fragment containing the insertion point of the D42-2 mutant was amplified by PCR from AX2 genomic DNA using an LA-PCR kit (Takara, Tokyo, Japan). The amplified DNA was cloned into pUC118 (Vieira and
Messing, 1987
), and the sequence from the BamHI site to the BsmI site of
the insert was confirmed to be identical to the corresponding regions of
the plasmid-rescued fragments. By ligation of this BamHI-BsmI fragment
with the rescued HindIII-BamHI (p42-1Eco) and BsmI-ClaI (p42-2Hind)
fragments, and cloning into pUC119 (Vieira and Messing, 1987
), plasmid
p42-2CPX carrying the intact gapA gene was obtained. The reconstructed
HindIII-ClaI fragment was inserted into the Dictyostelium shuttle vector,
pATANB43 (Dynes and Firtel, 1989
), using the linker sequences to construct p43-L, which was used for the genetic complementation experiments.
Fig. 1.
Restriction map around the Dictyostelium gapA gene
and the tag integration site of the REMI mutant, D42-2. Genomic
DNA from the D42-2 strain was digested with the restriction enzymes indicated, and then analyzed by Southern blotting using
linearized pUC118, a portion of the tag, as a probe. Information
obtained on restriction analysis of the rescued plasmids is also included. The four exons of the gapA gene are indicated by thick
lines. bsr, blasticidin S-resistance marker.
[View Larger Version of this Image (12K GIF file)]
). For regeneration of gapA
cells by homologous recombination, 10 µg of linearized p42-2Nde, the DNA fragment derived from D42-2 rescued with the NdeI restriction enzyme, was used for
each electroporation with the AX2 strain. For complementation of the
D42-2 strain with the p43-L plasmid, 2 µg of plasmid DNA was used for
each electroporation, and the transformants were selected by G418.
. Briefly, cells on coverslips were fixed in methanol containing 1%
formaldehyde for 5 min at
10°C, and then washed three times with PBS.
For the observation of nuclei, the cells were stained with PBS containing
0.1 µg/ml of 4
,6-diamidino-2-phenylindole for 30 min at 37°C, washed
with PBS, and then observed under an Axiovert 35 equipped with an LD
Achroplan ×40 objective (Zeiss, Oberkochen, Germany). For the observation of myosin II, the cells were flattened by the agar-overlay technique
(Fukui et al., 1987
), and then fixed as described above. The fixed cells
were first incubated with PBS containing anti-Dictyostelium myosin II mAbs DM2 (Yumura et al., 1984), for 30 min at 37°C, rinsed with PBS, and then
stained with 25× diluted fluorescein-conjugated goat anti-mouse IgG antibodies (Biosource, Camarillo, CA) under the same conditions. After
washing with PBS, the cells were observed with a Plan-Neofluar ×100 oil
immersion objective.
Results
) isolated by REMI (Kuspa and
Loomis, 1992
). On a substratum, these mutant strains grow
and generate considerable numbers of giant and multinucleate cells that sometimes contain >100 nuclei as a result
of their cytokinesis defects. Into the genomic DNA of
these mutants, a single copy of the tag plasmid, pUCBsr
Bam, was inserted (Adachi et al., 1994
).
Fig. 2.
Size and shape of axenically growing Dictyostelium cells. (A-D) Cells were grown on coverslips, fixed, and then stained with 4
,6-diamidino-2-phenylindole. A phase-contrast image was laid over a fluorescent one. (E-H) Cells were grown in suspension (150 rpm), and living cells were observed by phase-contrast microscopy. (A and E) The parental strain, AX2; (B and F) the cytokinesis mutant, D42-2; (C and G) one of the mutants regenerated through homologous recombination, D42-2HR11; (D and H) the D42-2 strain harboring the p43-L plasmid carrying an intact gapA gene. Bar, 50 µm.
[View Larger Version of this Image (52K GIF file)]
and 3
halves of the disrupted gene (Fig. 1)
were rescued. Through ligation of the rescued fragments,
the intact HindIII-ClaI fragment (4.1 kb) was reconstructed
and inserted into a Dictyostelium shuttle vector, and the
resultant plasmid, p43-L, was used to transform the D42-2
strain. All the transformants showed the wild-type phenotype (Fig. 2, D and H), indicating that this 4.1-kb fragment
carries the gene involved in cytokinesis. Southern blot
analysis showed that the gene exists as a single copy (Fig. 3
A). The absence of a transcript of the gene in vegetative
mutant cells was confirmed by the reverse transcription-
PCR method, using the myosin II heavy chain transcript as
a control (Fig. 3 B).
Fig. 3.
Southern blot (A) and reverse transcription-PCR (B)
analyses of wild-type AX2 (W) and mutant D42-2 (M) cells. (A)
2.5 µg of genomic DNA digested with either ClaI or HindIII was
loaded into each lane. The transferred DNA was probed with the
full-length gapA cDNA. (B) DNA amplified with the same amount
of total RNA and specific primers was loaded onto each lane. For
details, see Materials and Methods.
[View Larger Version of this Image (54K GIF file)]
Fig. 4.
DNA sequence of the Dictyostelium gapA gene and the
deduced amino acid sequence of the GAPA protein. The coding
DNA sequences (exons) are indicated by capital letters, and the
5
and 3
flanking sequences as well as introns are shown in lowercase letters. (Boxed region) RasGAP-related domain (GRD).
In cytokinesis mutant D42-2, the tag was inserted into the underlined GATC sequence in the fourth exon. These sequence data
are available from EMBL/GenBank/DDBJ under accession number D88027.
[View Larger Version of this Image (91K GIF file)]
; Wang et al., 1991
)
and the COOH-terminal half of IQGAP1 from human
(Weissbach et al., 1994
) (Fig. 5). In the middle of the homologous regions of these three proteins lies a conserved sequence for RasGTPase-activating proteins (RasGAPs)
called the GAP-related domain (GRD; Figs. 4 and 5). Thus,
we named this protein GAPA, and the gene gapA, from its
sequence similarity to RasGAPs. The homology of the
Dictyostelium GAPA to the members of the RasGAP family other than IQGAP1, IQGAP2 (recently identified homologue of IQGAP1 [Brill et al., 1996
]), and Gap1/Sar1 is
restricted to the GAP-related domain. Fig. 6 shows amino
acid sequence alignment of the most conserved region of
the GRDs of typical RasGAP-related proteins. The most
prominent feature is that the Phe-Leu residues in the invariant FLRXXXPAXXXP (X: any amino acid) motif are
replaced by Tyr-Tyr residues only in GAPA and IQGAP1
(in IQGAP2 also Tyr-Tyr). It was reported that substitution of the invariant Leu with an Ile residue resulted in the
loss of the activity of p120GAP (Brownbridge et al., 1993
),
and that RasGAP activity was not detected for IQGAPs (Hart et al., 1996
; Brill et al., 1996
; McCallum et al., 1996
). In contrast with IQGAPs, both biochemical (Hart et al.,
1996
) and genetic (Imai et al., 1991
; Wang et al., 1991
)
analyses indicated that yeast Gap1/Sar1 activates the GTPase
of yeast RAS2, and the invariant Phe-Leu residues are
conserved in this protein. These suggest that GAPA might
be much more related functionally to IQGAPs than to
Gap1/Sar1. On the basis of this finding, we looked for the
sequence motifs that were found in the NH2-terminal half
of IQGAPs (Weissbach et al., 1994
; Hart et al., 1996
) (Fig.
6) in the NH2-terminal region of GAPA. One putative IQ
motif (I145AEIQELKRNMVAE158; the conserved residues are underlined) was found in the region where the
homology between IQGAP1 and GAPA starts, although
the conserved arginine was replaced by glutamic acid158.
We found neither a calponin homology domain, an IQGAP repeat, nor a WW domain (Sudol et al., 1995
).
Fig. 5.
Schematic drawing of the similarity among the members of the IQGAP family. Identical residues (%) were calculated. CH, calponin homology domain; IR, IQGAP repeats; WW,
WW domain; IQ, four repeats of the calmodulin-binding motif;
GRD, RasGAP-related domain; Hs, Homo sapiens; Dd, Dictyostelium discoideum; Sp, Schizosaccharomyces pombe.
[View Larger Version of this Image (21K GIF file)]
Fig. 6.
Amino acid sequence alignment of the most conserved
region of RasGAP-related proteins. Identical residues are shaded.
The invariant FLRXXXPAXXXP motifs are boxed. Dm, Drosophila melanogaster; Sc, Saccharomyces cerevisiae. GenBank accession numbers: Dd GAPA, D88027; Hs IQGAP1, D63875; Sp
Sar1/Gap1, D10457; Hs p120GAP, M23379; Dm GAP1, M86655;
Sc Bud2, L19162; Hs NF1, M89914; Sc Ira1, M24378. The sequence of GAP1IP4BP was taken from the original paper
(Cullen et al., 1995
).
[View Larger Version of this Image (31K GIF file)]
Cells
cells was further characterized. First, the growth of gapA
cells in suspension
culture was examined. It is known that Dictyostelium cells
lacking myosin II grow as multinucleate cells on a substratum (De Lozanne and Spudich, 1987; Knecht and Loomis,
1987
) like gapA
cells. In this case, the growth is not supported by "real" cytokinesis but by traction-mediated
cytofission, which is dependent on the solid surface (Fukui
et al., 1990
), and the cells cannot survive in suspension culture. Unlike myosin II-deficient cells, gapA
cells grew in
suspension culture (Fig. 7). The rate of increase in cell
number was, however, much lower than that of the wildtype cells (Fig. 7 A). In contrast, the rates of increase in
cell mass, monitored as the turbidity of the culture, were
similar to each other (Fig. 7 B). Thus, the mutant strain
also produced spherical giant cells in suspension culture
(Fig. 2, B and F). These results suggest that, in the gapA
cells, cytokinesis was not completed at a considerable frequency.
Fig. 7.
Growth of Dictyostelium cells in axenic suspension.
Wild-type AX2 and gapA
D42-2 cells were diluted in fresh medium at 105 cells per ml, and then shaken at 22°C and 150 rpm.
Their growth was monitored as the increase in cell number (A) or
turbidity (B; absorbance at 660 nm) with the same culture.
[View Larger Version of this Image (15K GIF file)]
cells (Fig. 8, lower frames) stopped protruding pseudopodia, became rounded, and then became constricted to
produce daughter cells linked by a thin cytoplasmic bridge
(midbody; Fig. 8, arrowheads). By this stage, cytokinesis of
the gapA
cells was similar to that of the wild-type cells
(Fig. 8, upper frames), although it sometimes took longer
for constriction in the mutant. This bridge, however, frequently remained intact for a long time, and finally cytokinesis was reversed to yield a single cell (Fig. 8, filled triangle). This reversion occurred for ~50% (n = 44) of the
smallest mutant cells that attempted to divide into two.
The failed cytokinesis accumulated to produce giant and
multinucleate cells. These results suggest that, in gapA
cells, earlier stages of cytokinesis are rarely affected,
whereas the fidelity of the latest severing of the midbody is
greatly reduced. Consistent with this notion, myosin II was
localized at the cleavage furrow in the dividing mutant
cells as in the dividing wild-type cells (Fig. 9). In interphase mutant cells, myosin II was also predominantly localized at the periphery of the cells, as in the wild-type
cells. The localization of actin filaments in interphase mutant cells was also indistinguishable from that in the wildtype cells (data not shown).
Fig. 8.
Reversion of cytokinesis
observed in gapA
cells. Wildtype AX2 (upper frames) and mutant D42-2 (lower frames) cells
were axenically grown on coverslips. Cell division was observed
under a microscope connected to
a time-lapse video recorder. The
number in each frame indicates
the time in min. In the lower
frames (D42-2), the mutant cells
(open and filled triangles) attempted to divide into two daughter cells. For the cell with the
filled triangle, cytokinesis was reversed at the step where the two
daughter cells were connected by
a thin cytoplasmic bridge (midbody; arrowhead). In contrast, the
cell with the open triangle completed cytokinesis like wild-type cells. Bar, 10 µm.
[View Larger Version of this Image (134K GIF file)]
Fig. 9.
Localization of myosin II at the cleavage furrow. (A and B) AX2; (C-F) D42-2. Axenically growing cells were fixed by the
agar-overlay method (Fukui et al., 1987
). Myosin II was visualized by means of indirect immunofluorescence using DM2 mAbs against
Dictyostelium myosin II (B, D, and F). (A, C, and E) Phase contrast. Bar, 10 µm.
[View Larger Version of this Image (64K GIF file)]
Cells Is Normal
cells developed
and formed normal fruiting bodies with viable spores at
the same time as the wild-type cells (Fig. 10). The increase
in size of the plaque on the bacterial lawn and the terminal
phenotype were also unaffected by the mutation (data not
shown). These results indicate that the GAPA protein is
not required for Dictyostelium development and phagocytosis.
Fig. 10.
Development of Dictyostelium cells upon starvation.
(Left) AX2; (Right) D42-2. Vegetative cells were washed and
then plated onto phosphate agar. The developed phenotype was
observed after 24 h. Bar, 100 µm.
[View Larger Version of this Image (64K GIF file)]
Discussion
), the molecular nature of this signal remains
to be determined. The timing of the initiation and progression of cytokinesis should be strictly regulated, possibly by
molecules controlling the cell cycle, such as Cdc2 kinase.
Myosin II is required for furrowing, and activation and/or
inactivation of the myosin ATPase by such molecules
could control constriction of the contractile ring. Actually,
it was demonstrated that phosphorylation of myosin II regulatory light chain by Cdc2/Cyclin could regulate the
timing of cytokinesis (Satterwhite et al., 1992
). In addition,
myosin II could be regulated through the signal from a
small GTPase Rho during constriction, considering the
findings that Rho is involved in cytokinesis (Mabuchi et al.,
1993
; Kishi et al., 1993
), and that the phosphorylation of
myosin II regulatory light chain, which activates the ATPase of myosin II, is regulated by effectors of Rho, Rho kinase, and myosin phosphatase (Kimura et al., 1996
; Amano
et al., 1996a
). As for the termination of cytokinesis, however, the existence of a signal for severing of the midbody
remains to be confirmed.
cells indicated that multinucleate cells
are produced through the frequent reversion of cytokinesis at the step in which the cytoplasmic bridge (midbody)
connecting the daughter cells should be severed. Earlier
stages of cytokinesis characterized by accumulation of myosin II at the furrow were not affected by the gapA
mutation. Development upon starvation and vegetative growth
in terms of the increase in cell mass were also not affected.
Thus, we propose that the GAPA protein is specifically involved in the signal required for accurate cleavage of the
midbody.
). It might be possible that,
in the signaling pathway required for cleavage of the midbody, interaction between GAPA and calmodulin is essential, and the resultant complex transduces the signal of elevation of the calcium level observed during cytokinesis (Chang and Meng, 1995
). A putative IQ motif, a calmodulin-binding sequence, is present in the GAPA protein,
although the binding to calmodulin has to be confirmed
biochemically. In mammalian IQGAPs, four successive
calmodulin-binding IQ-motifs (Hart et al., 1996
; Brill et al.,
1996
) are present at a position corresponding to the putative IQ motif of GAPA (Fig. 4).
; Wang et al., 1991
)
and biochemical (Hart et al., 1996
) analyses showed that
Sar1/Gap1 from fission yeast, one of the GAPA-related
proteins (Fig. 4), activates yeast Ras. However, the other
GAPA relatives, mammalian IQGAPs, do not interact with
Ras, but bind to and inhibit the GTPases of CDC42 and
Rac, members of the Rho family of GTPases (Hart et al.,
1996
; Bain and Tsang, 1991
; McCallum et al., 1996
). Invariant Phe-Leu residues in the most conserved region of
the RasGAP-related domain are replaced by Tyr-Tyr residues in both IQGAPs and GAPA, but not in Sar1/Gap1
(Fig. 6). Substitution of this conserved leucine of p120GAP
resulted in loss of the GAP activity toward Ras (Brownbridge et al., 1993
). Like mammalian IQGAPs, GAPA might
interact with a CDC42/Rac-related GTPase but not with a
Ras-related protein (five Ras-related proteins were found
in Dictyostelium [Daniel et al., 1993
]). Actually, a crude
extract of gapA
cells retained the GAP activity toward
H-ras and Dictyostelium RasG, a counterpart of Ras in
vegetative Dictyostelium cells (data not shown).
; Larochelle et al., 1996
).
RacE, a novel Rac/Cdc42-related protein, is specifically
required for cytokinesis (Larochelle et al., 1996
). In suspension culture, racE
cells become multinucleate cells, as
well as do the gapA
cells. However, in contrast with
gapA
cells, racE
cells never divide like myosin II-deficient cells. The phenotypical difference between gapA
and racE
cells suggests that these proteins participate in
distinct pathways in cytokinesis. The fact that racE
cells
resemble myosin II-deficient cells and that they only grow on dishes through traction-mediated cytofission might suggest that RacE could control the myosin function during
earlier stages in cytokinesis, unlike GAPA.
; Lee et al.,
1997
). Disruption of the genes encoding other IQGAPrelated proteins caused developmental defects in contrast
with the gapA
cells, suggesting that their functions are
distinct from that of GAPA. For one of them, DGAP1,
disruption of the corresponding gene had no effect on cytokinesis, while overexpression of this protein caused cytokinesis defects (Faix and Dittrich, 1996
). The cells overproducing DGAP1 by threefold became multinucleate and
divided through traction-mediated cytofission when placed on a substratum. These phenotypes resemble those of
racE
and myosin II-deficient cells. DGAP1 might interact with RacE and be involved in earlier stages of cytokinesis. Gene disruption of DdRasGAP1, another Dictyostelium IQGAP-related protein, caused cytokinesis defects
only in suspension culture (Lee et al., 1997
) unlike the
gapA
cells. The presence of closely related but different
IQGAP-related proteins in Dictyostelium cells implies distinct pathways of cytokinesis regulation that may involve
different members of small GTPases.
Received for publication 3 January 1997 and in revised form 3 March 1997.
1. Abbreviations used in this paper: GRD, GTPase-activating protein- related domain; RasGAP, RasGTPase-activating protein; REMI, restriction enzyme-mediated integration.We thank Drs. Takahisa Ohta and Masayoshi Kawaguchi for helpful discussions. We also thank Dr. Shigehiko Yumura for the anti-myosin II antibodies.
This work was supported by grants-in-aid for Scientific Research from the Ministry of Education, Science, and Culture of Japan to H. Adachi and K. Sutoh.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|