|
||


* Institut für Allgemeine Mikrobiologie, Universität Bern, CH-3012 Bern, Switzerland;
Schweizerisches Tropeninstitut,
CH-4051 Basel, Switzerland; and § Institut für Parasitologie, Universität Bern, CH-3012 Bern, Switzerland
African trypanosomes are not passively transmitted, but they undergo several rounds of differentiation and proliferation within their intermediate host, the tsetse fly. At each stage, the survival and successful replication of the parasites improve their chances of continuing the life cycle, but little is known about specific molecules that contribute to these processes. Procyclins are the major surface glycoproteins of the insect forms of Trypanosoma brucei. Six genes encode proteins with extensive glutamic acid-proline dipeptide repeats (EP in the single-letter amino acid code), and two genes encode proteins with an internal pentapeptide repeat (GPEET). To study the function of procyclins, we have generated mutants that have no EP genes and only one copy of GPEET. This last gene could not be replaced by EP procyclins, and could only be deleted once a second GPEET copy was introduced into another locus. The EP knockouts are morphologically indistinguishable from the parental strain, but their ability to establish a heavy infection in the insect midgut is severely compromised; this phenotype can be reversed by the reintroduction of a single, highly expressed EP gene. These results suggest that the two types of procyclin have different roles, and that the EP form, while not required in culture, is important for survival in the fly.
Two tropical diseases, human sleeping sickness and
nagana in domestic animals, are caused by the protozoon Trypanosoma brucei, which is transmitted
by tsetse flies. The spread of the parasite is strictly dependent on the insect vector, and consequently, these diseases
are restricted to sub-Saharan Africa between the latitudes
14°N and 29°S. When trypanosomes are taken up by the insect during a blood meal from an infected animal, it is by
no means certain that their progeny will complete the cycle that allows transmission to a new host. Bloodstream
forms lose infectivity for the mammalian host within 24 h
in the fly midgut (6), while new transmissable parasites
only appear in the salivary glands after a lag of 3 wk or
more, and then only in a few percent of infected flies (48).
There are several hurdles to be overcome before further
transmission can take place. The first prerequisite for successful transmission is that bloodstream forms must differentiate into procyclic forms in the midgut, become established, and proliferate. The majority of infections do not
proceed beyond this stage, yet for the cycle to be completed, the parasites have to migrate to the fly salivary
glands, where they differentiate further into epimastigote
forms and subsequently into mature metacyclic forms that
are capable of initiating a fresh infection when they are transmitted to a new mammalian host. A number of parameters may influence the efficiency of parasite transmission. The strain of trypanosome, the species of tsetse fly,
the sex of the fly, and the presence of rickettsiae-like organisms in the midgut cells have all been implicated (reviewed in 28). In addition, two types of activity have been
identified in tsetse flies: one is trypanocidal and kills procyclic forms in the gut, while the second stimulates parasite maturation in the mouthparts. Specific sugars such as
glucosamine (27), or lectins such as Con A or WGA (28), can modulate either the establishment of infections by
procyclic forms or the production of mature salivary gland
forms, leading to the proposal that the tsetse fly factors are
themselves lectins.
As trypanosomes cycle between mammals and the tsetse
fly, they alternately express two types of surface coats.
Bloodstream forms are covered by a dense layer of variant
surface glycoproteins (VSG)1 that shields underlying
membrane proteins and prevents lysis of the parasites by
serum components (for reviews see 12 and 33). The antigenic variation of bloodstream forms and their consequent evasion of the host immune response are caused by the
consecutive expression of potentially as many as 1,000 different VSG genes. When bloodstream form trypanosomes
differentiate to procyclic forms, however, the parasite surface is completely remodeled. VSG synthesis is repressed
(32), and the coat is shed as it is progressively replaced by
a new, invariant coat composed of procyclins (37, 50). Procyclins are also known as procyclic acidic repetitive proteins (29). They are also detected on epimastigote forms of
the parasite (34), but in turn are lost when metacyclic forms activate the expression of a specific subset of VSG
genes in preparation for transfer to the mammalian host.
In marked contrast to the VSG genes, there is only a
small number of procyclin genes. These have been mapped
in detail, and representative members of each type have
been sequenced (for reviews see 10, 17, 38). The procyclin
promoters (5, 43) and mRNA processing signals (20, 21,
41, 47), which differ from those of higher eukaryotes, have
also been characterized. Depending on the strain of T. brucei, there are six or seven genes that encode proteins
with extensive glutamic acid-proline repeats (EP forms;
13, 24, 29, 36, 39). Two further genes, which are indistinguishable from each other, encode proteins containing
several pentapeptide repeats followed by three dipeptide
repeats (GPEET forms; 31). There are three EP forms of
procyclin that are closely related to each other over their
entire coding regions, differing principally in the length of
the dipeptide repeats and the presence or absence of an
N-linked glycosylation site (Fig. 1). The precursor of the GPEET form has the same highly conserved signal peptide and hydrophobic COOH-terminal peptides as the EP
forms, but apart from these, there are only two small
stretches of identity between the mature proteins. EP procyclins have been isolated from different strains of T. brucei (8, 14, 35), and it has been estimated that there are ~6
million molecules per cell. A battery of mAbs have been
mapped to defined epitopes, including the dipeptide repeat itself (35). No antibodies specific for GPEET were
available, however, and although the mRNA could be detected (31), it was not certain whether it was translated,
since the protein could not be detected using procedures
that were designed to purify procyclins on the basis of
their negative charge at low pH (8) or the presence of a
glycolipid anchor (14).
Although a decade has elapsed since the production of
the first mAbs against procyclins (34) and the cloning of
the genes (29, 36), their function has remained unresolved.
By analogy with the VSG coat of bloodstream forms, procyclins might protect the parasites from the insect immune
response or from lytic enzymes. The fact that procyclins
are also largely resistant to several proteases (14) would
confer obvious advantages in the digestive tract of the fly.
In support of this hypothesis, T. congolense, another species of trypanosome that is transmitted by the tsetse, expresses an unrelated set of procyclins known as GARPs
(for glutamic acid/alanine-rich proteins; 1, 2), which are
also protease resistant. It has also been proposed that different domains of procyclins might be the targets for the
tsetse factor(s) that might bind to either the N-linked carbohydrate moieties or to sugar residues in the glycolipid
anchor (28).
With the advent of stable transfection systems for trypanosomes and an expanding repertoire of selectable markers, it has now become feasible to study the function of
procyclins by creating deletion mutants by homologous recombination. Using this approach, we have been able to
show that the EP and GPEET forms of procyclin are functionally distinct, and that the EP form, while not essential in culture, plays an important role in the fly.
Culture and Stable Transformation of Trypanosomes
T. brucei 427 (11) and all derivatives were cultured at 27°C in SDM-79
containing 5% heat-inactivated FBS (7). Transfections were performed as
described (46), using 5 µg plasmid digested with the appropriate restriction enzymes to release the insert. G418 (46), phleomycin (22), and hygromycin (26) have been used previously to select stable transformants of T. brucei. Nourseothricin (obtained from Prof. U. Gräfe, Institut für Naturstoff-Forschung, Jena, Germany) and puromycin (Sigma, Buchs, Switzerland) were used for the first time in this study. The initial selection of nourseothricin-resistant cells was carried out with 150 µg · ml Construction of Recombinant Plasmids
Four constructs (pKON, pKOP, pKOH, and pKOS) were designed to delete tandemly linked procyclin genes. Each construct consists of four modules: a pBluescript backbone, locus-specific 5
Pro A/B locus-specific 5 The plasmid pKOS Reexpression of procyclin genes was achieved by using a bicistronic
cassette derived from the Pro A locus. The construction of the original
plasmid pGAPRONE will be described in detail elsewhere (16a). The
plasmid pEP Primers: Pro C:CTGTCGACTTGCCGCGTAAC
Fig. 1.
Alignment of EP and GPEET procyclin precursor sequences obtained from the following sources: EP1 (29), EP2 (39),
EP3 (36), and GPEET (31). N-linked glycosylation sites in EP1
and EP3 are marked by an asterisk. Processing sites are marked
by arrows: the NH2-terminal cleavage site of an EP form was determined by direct protein sequencing (35). The site of GPI anchor addition was deduced from amino acid composition analysis
of purified procyclins (8). Underlined capital letters denote
amino acids conserved in all four polypeptides, and lowercase letters denote amino acids that diverge from the consensus sequence.
[View Larger Version of this Image (45K GIF file)]
Materials and Methods
1 increasing
to a final concentration of 500 µg · ml
1. Puromycin was used at an initial
concentration of 1 µg · ml
1 increasing to a final concentration of 5 µg · ml
1. No detectable cross-resistance to these five antibiotics was observed.
Trypanosome clones were obtained by limiting dilution in SDM-79 supplemented with 20% FBS.
flanking sequences together
with the procyclin promoter and 5
untranslated region (UTR) of the procyclin
gene, an antibiotic-resistance gene, and 3
flanking sequences.
The four constructs are shown schematically in Fig. 2 A.
Fig. 2.
(A) Schematic depiction of the four procyclin loci in T. brucei strain 427 together with the constructs used to knock out paired procyclin
and
genes by homologous recombination.
The numbers in brackets above the EP procyclin genes refer to
the polypeptides in Fig. 1. In each case, the procyclin genes are at
the start of a polycistronic transcription unit that contains at least
one additional gene (3, 4, 25). PAG, procyclin-associated gene;
GRESAG, gene related to expression site associated gene 2 (ESAG 2). Homologous recombination was targeted by locusspecific sequences upstream of the promoters. Integration downstream of the procyclin genes occurred via a common sequence
within the 5
UTR of all three PAGs (25) without affecting the
open reading frames. Before electroporation, the plasmids
pKON and pKOPwere digested with KpnI (K) and Xba I (X);
pKOH, pKOS, and pKOS
(see Fig. 3 C) were digested with SalI
(S) and XbaI. Additional sites: HindIII (H) and BamHI (B). The
black and grey bars depict locus-specific sequences upstream of
the promoters. At least 4 kb upstream of the transcription start
site is conserved between the Pro A and B loci. The two copies of
the Pro C locus have 640 bp in common with the other two loci,
including the promoter, but have unrelated sequences further upstream (9, 40). (B) Lineage of trypanosome clones obtained from
T. brucei 427. Deletion mutants are named after the antibiotic
used for selection, followed by a specific clone number and a letter denoting the locus where integration occurred. The plasmids
pEP
164-PUR and pGPEET
164-PUR are described in the
Materials and Methods, and the former is shown schematically in
Fig. 5. Clones beginning with the designation N6-EP are derivatives of Nour 6C in which a single copy of an EP procyclin gene
has been reintroduced into the Pro A locus. N6-GPEET cells
have one endogenous copy of GPEET in the Pro C locus and a
second copy in the Pro A locus (see text and Fig. 6).
[View Larger Version of this Image (17K GIF file)]
Fig. 3.
(A) Southern blot
analysis of sequential deletion mutants. Genomic DNA
was digested with PstI, which
separates the Pro A and Pro
B loci from the two copies of
Pro C. The blot was hybridized with a probe (EP) corresponding to the coding region of EP1, and was washed
under stringent conditions
(0.1 × SSC, 0.05% SDS at 65°C). (B) Northern blot
analysis of deletion mutants.
Total RNA was isolated
from individual clones and
hybridized with a longer probe of 460 bp, EP* (see
Materials and Methods).
This probe was used because
it is 75% identical to the corresponding region of the
GPEET transcript and includes two regions, a stretch
of 110 bases at the 5
end and
180 bases at the 3
end, which
are >93% identical. Posthybrization washes were performed under moderately stringent conditions (1 × SSC, 0.05% SDS, 65°C) to maximize the signal obtained with GPEET. The blot was
normalized by hybridization with a probe containing tandemly linked
- and
-tubulin genes (42), and was quantified on a PhosphorImager. (C) Schematic depiction of the integration of selectable markers into the last Pro C locus. A construct designed to delete both procyclin genes (pKOS) replaced only the EP gene. A second construct, designed to delete the GPEET gene (pKOS
), gave rise to stable
transformants that were antibiotic resistant but had retained both procyclin genes.
[View Larger Version of this Image (26K GIF file)]
Fig. 5.
Overexpression of EP in Nour 6C retransformants. (A)
Schematic drawing of the replacement of the Neo gene in the Pro
A locus of Nour 6C cells by integration of the bicistronic construct pEP
164-PUR. Puromycin-resistant clones were isolated
and analyzed for correct integration (data not shown). The deletion of the first 164 bp of the procyclin
3
UTR increases expression of a reporter gene approximately twofold compared to
the wild-type 3
UTR (16a, 18). (B) Northern blot analysis of procyclin expression. The blots were hybridized sequentially with
probes for EP procyclin and tubulin, and were normalized as described in the legend to Fig. 3. N6-EP
1A has five times more
steady-state procyclin mRNA and N6-EP
2A has three times
more than the wild-type 427. (C) Transmission electron microscopy reveals irregularities (arrows) in the surface of cells that
overexpress EP. Bar, 500 nm.
[View Larger Version of this Image (41K GIF file)]
Fig. 6.
Ectopic integration of GPEET does not result in overexpression. The construct pGPEET
164-PUR was used to integrate a tagged GPEET gene into the Pro A locus of N6-GPEET
1A trypanosomes, and the expression of GPEET mRNA in this
cell line was compared to that in 427 and Nour 6C. (A) Blots were
hybridized with probes corresponding to the GPEET coding region and tubulin. A, the truncated GPEET transcript from the
Pro A locus; C, the endogenous transcript from the Pro C locus.
Once the second endogenous copy of GPEET was deleted (clone
2CKO 7), only the smaller transcript could be detected. (B)
Western blot analysis: total cell lysates (2 × 106 cell equivalents
per lane) were separated by SDS-PAGE and transferred to nitrocellulose. The membrane was incubated with anti-GPEET (K1)
polyclonal serum, and bound antibody was detected by enhanced chemiluminescence. K1 antiserum reacts primarily with two
polypeptides of 20 and 21 kD. At longer exposures, variable
amounts of several larger polypeptides can also be detected. All
can be specifically inhibited by coincubation with 1 µg · ml
1 of
the synthetic peptide (GPEET)3C (data not shown). It is possible that the higher molecular weight species represent O-glycosylated and/or phosphorylated forms of GPEET, or forms with additional modifications to the GPI-anchor. In contrast to GPEET,
EP procyclins migrate as a diffuse band of 40-45 kD (35).
[View Larger Version of this Image (35K GIF file)]
flanking sequences, promoter, and 5
UTR: a
900-bp fragment flanked by the KpnI and HindIII sites was subcloned
from the plasmid pGARP-neo (18). ProC locus-specific 5
flanking sequences, including the procyclin promoter and 5
UTR were amplified by
PCR from the plasmid pCP1 (24) using the primers Pro C and PCH. All
constructs contained the same 3
flanking sequences consisting of the last
19 bp of the procyclin
gene, the intergenic region, and the first 426 bp of
PAG 1 (25). The appropriate fragment was amplified from the plasmid
pAP4 (24) using the primers KO1 and KO2. All antibiotic-resistance
genes were cloned as HindIII/BamHI cassettes. The neomycin-resistance gene (Neo) was amplified from pSV2neo (45) with the primers Neo1 and
Neo2. The phleomycin-resistance gene (Phleo) was derived in two steps
from the plasmid pHD63 (kindly provided by Christine Clayton, Zentrum
für Molekulare Biologie, Heidelberg, Germany). The plasmid was first
linearized with NcoI and treated with Klenow to generate blunt ends. The
coding region was excised with StuI, cloned into the EcoRV site of pBluescript, and subsequently transferred using the HindIII and BamHI sites
from the polylinker. The hygromycin-resistance gene (Hyg) was subcloned from the plasmid pBS HYG A (16). The plasmid was digested with
XbaI, and the ends were repaired with Klenow. After digestion with
BamHI, the coding region was inserted between the EcoRV and BamHI
sites of pBS, and then subcloned as a HindIII/BamHI fragment to give the
plasmid pKOH. The streptothricin acetyltransferase gene (SAT-1), which
confers resistance to nouseothricin, was amplified from the plasmid pLEX
SAT (23) using the primers SAT-1H and SAT-1B, and was cloned via the
synthetic HindIII and BamHI sites. Replacement of Hyg in pKOH with
SAT-1 gave rise to pKOS; the substitution of Neo for Hyg produced the
Pro C locus-specific construct pKOCN.
, which was designed to replace the first procyclin
gene in the Pro C locus, was constructed by replacing the 3
flanking sequence of pKOS with a BamHI/XbaI fragment extending from nucleotide
165 in the 3
UTR of the procyclin
gene (
164) to a PvuII site in the intergenic region (18, 41).
164-PUR is shown schematically in Fig. 5. EP1, EP2, and
GPEET forms of procyclin were amplified from the plasmids pAP2,
pAP4, and pCP1, respectively (24), using the universal procyclin primers
ABC-H and ABC-B, and cloned as HindIII/BamHI fragments. The puromycin resistance gene was derived from pVN3.1 (16). The coding region
was excised with NotI and NcoI, and the ends were repaired by treatment
with Klenow. The fragment was subsequently cloned between the EcoRV
and SmaI sites in pBS(KS+). A clone containing the insert in the correct
orientation was then used to remodel the 5
HindIII site into an NheI site
and the 3
BamHI site into a ClaI site. In both cases, this was achieved by
cleavage with the appropriate enzyme, treatment with Klenow, and religation.
PCH:GTAAGCTTGTGAATTTTACTT
| KO1:TAGGATCCATTCGTATGGTTTTGTC |
| KO2:TATCTAGAGGGCAGTGCAGT |
| Neo1:CGCAAGCTTATGATTGAACAAGATGGA |
| Neo2:TAAGGATCCTCAGAAGAACTCGTC |
| SAT-1H:GCAAGCTTATGAAGATTTCG |
| SAT-1B:ATGGATCCTTAGGCGTCATC |
| ABC-H:TAAAGCTTATGGCACCTCGTT |
| ABC-B:CCGGGATCCGCTTAGAATG |
The synthetic restriction sites used in cloning are underlined.
Isolation of DNA and RNA; Southern and Northern Blot Analyses
DNA and RNA were isolated as described (37, 49). Northern and Southern blot analyses were performed using standard procedures. Probes corresponding precisely to the EP and GPEET coding regions were amplified
as described for the constructs pEP
164-PUR and pGPEET
164-PUR.
A longer probe, EP*, including the entire 5
UTR and 91 bp of the 3
UTR, was amplified from pAP2 using the primers SPU (GCTCACGCGCCTTCGAGTT) and TO4 (24). A tubulin genomic clone, 3B,
contains tandemly linked copies of
- and
-tubulin (42). Signals were
quantified using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
Antibodies and Western Blots
The procyclin-specific mAb TBRP1/247 was generously provided by Terry W. Pearson (University of Victoria, Victoria, Canada). This mAb has previously been shown to recognize EP dipeptide repeats (35). Polyclonal anti-GPEET antibodies (K1) were raised in rabbits using a synthetic peptide, (GPEET)3C, coupled to KLH (Affiniti Research Products Limited, Nottingham, UK). Western blots were performed as described previously (19), using K1 antiserum at a dilution of 1:1,000.
Double-labeling Immunofluorescence
Parasites were washed twice with PBS and were fixed in suspension with PBS containing 3% paraformaldehyde and 0.05% glutaraldehyde for 15 min at room temperature. During fixation, they were allowed to settle down onto poly-lysine-coated (100 µg/ml) glass coverslips. The coverslips were subsequently incubated in blocking buffer (PBS/0.5%BSA/50 mM lysine) for 1 h. Antibody incubations were performed in blocking buffer in the following order: (a) anti-EP mAb 247 (1:200); (b) goat anti-mouse FITC (1:100; Cappel Laboratories, Cochranville, PA); (c) polyclonal rabbit anti-GPEET (1:200); and (d) goat anti-rabbit Texas red (1:100; Becton Dickinson Immunocytometry Systems, Mountain View, CA). Antibodies were applied for 40 min at 24°C in a humid chamber. After labeling, coverslips were washed extensively 6 times for 5 min each in PBS. They were then mounted onto glass slides using a mixture of gelvatol/glycerol and viewed using a Laborlux fluorescence microscope (E. Leitz, Inc., Rockleigh, NJ).
Transmission Electron Microscopy
Trypanosomes were prefixed by the addition of 3% paraformaldehyde to the medium, and were washed three times in 100 mM sodium phosphate buffer, pH 7.2, containing 3% paraformaldehyde at 4°C. Cells were then resuspended in 2% glutaraldehyde in 0.1 M cacodylate buffer (Fluka Chemie AG, Buchs, Switzerland), pH 7.3, for 4 h at room temperature. After washing in cacodylate buffer, they were treated with 2% osmium tetroxide in veronal acetate buffer, pH 7.4, for 1 h at 4°C, followed by buffer rinses. They were then treated with 0.25% tannic acid (Mallinkrodt, St. Louis, MO) in 0.05 M cacodylate buffer for 30 min, followed by washing with 1% Na2SO4 in 0.1 M cacodylate for 10 min, and were then incubated in 1% uranyl acetate in veronal acetate buffer for 1 h at room temperature (44). The parasites were dehydrated through a graded series of ethanol (70-95- 100%) and embedded in Epon 812 resin (Fluka Chemie). After polymerizing the resin at 65°C for 48 h, ultrathin sections were cut with a diamond knife using an ultramicrotome (Reichert Jung, Austria, Vienna) and the grids were stained with lead citrate and uranyl acetate. All preparations were observed using a transmission electron microscope (model 600; Philips Technologies, Cheshire, CT) operating at 60 kV.
Infection of Tsetse Flies and Determination of Midgut Infection Rates
Pupae of Glossina moritans centralis were obtained from the tsetse unit of
the International Livestock Research Institute (Nairobi, Kenya). The pupae were kept at 27°C until emergence. Teneral flies were collected over a
period of 4 d before they were offered a first blood meal by membrane
feeding. The meal consisted of washed horse RBCs in SDM-79 culture
medium (7) and procyclic forms of T. brucei 427 or cloned derivatives.
The infectious meal was prepared in the following way: defibrinated horse
blood (TCS Biologicals, Buckingham, UK) was centrifuged at 800 g for 15 min, and the pelleted RBCs were washed three times in an equal volume
of serum-free SDM-79. Procyclic trypanosomes were grown for one passage in medium without the antibiotics used for selection. They were pelleted by centrifugation (800 g for 10 min) and suspended in SDM-79 containing 20% heat-inactivated FBS at a density of 5 × 106 ml
1. Teneral
flies were infected by artificial feeding on a silicone membrane on two
consecutive days (days 0 and 1). The blood, membrane, and all other materials used for feeding were sterile. Flies that did not take a blood meal
on at least one occasion were excluded from the experiment. The flies
were subsequently fed on horse blood three times per week. On days 12-
14, the flies were killed with ether, and the midguts were removed and examined for the presence of trypanosomes. Infections were scored as qualitatively as light, intermediate, or heavy. Weak was defined as a midgut that revealed ~1 trypanosome per field in 20 fields, and where none of the
fields contained more than 5 trypanosomes. An infection was scored as
heavy if the average per field was 100-200 parasites, and if the field with
the highest trypanosome density contained >300 parasites. An infection
was scored as intermediate if it could not be placed in either the weak or
the heavy group. An exact determination of the number of trypanosomes
contained in each midgut would have been much too time consuming and
not feasible for the several hundred flies used in each experiment. Infection rates were calculated taking the surviving flies as 100%. Means and
standard deviations were calculated for each group for heavy infections
and total infections.
Deletion of Tandemly Linked Procyclin Genes by Homologous Recombination
There are four procyclin expression sites in T. brucei 427: Pro A, Pro B, and two copies of Pro C (Fig. 2 A). Four constructs were designed in such a way that a pair of procyclin genes would be deleted simultaneously and replaced by a selectable marker. Fig. 2 B shows the pedigree of clones that were generated by sequential transformation with plasmids conferring resistance to neomycin or G418 (pKON), phleomycin (pKOP), hygromycin (pKOH), and nourseothricin or streptothricin (pKOS). Deletion mutants were named according to their newly acquired antibiotic resistance, followed by the clone number and a letter denoting the procyclin locus that had been replaced (e.g., Phleo 2B). A minimum of three independent clones was analyzed after each transformation.
Theoretically, the two constructs pKON and pKOP were capable of integrating into either the Pro A or the Pro B locus, but the three clones analyzed after transformation with pKON had all deleted the procyclin genes from Pro A (see clone Neo 2A in Fig. 3 A). Northern blot analysis also indicated that most of the transcripts most likely originate from this locus, since removing two genes was sufficient to reduce the steady-state levels of procyclin mRNA to 31% of the wild type (Fig. 3 B). Neo 2A trypanosomes were then transfected with the plasmid pKOP and cultured with both G418 and phleomycin to select transformants with deletions in the Pro B locus and to eliminate transformants in which the phleomycin-resistance gene had merely replaced the neomycin-resistance gene in the Pro A locus. After demonstrating that the procyclin genes had been deleted from the Pro B locus (Fig. 3 A, Phleo 7B), resulting in a further reduction in mRNA to 12% of the control (Fig. 3 B), this clone was transfected with the Pro C-specific construct pKOH. One of the hygromycin-resistant clones, Hyg 6C, was in turn transfected with pKOS to delete the last two procyclin genes from the second Pro C locus. The final set of clones that was obtained (Fig. 2 B, Nour 1-6) was selected in the presence of all four antibiotics.
Retention of One Copy of a GPEET Procyclin Gene
Southern blot analysis of the nourseothricin-resistant
clone Nour 6 revealed a fragment of ~12 kb that still hybridized with a procyclin probe, albeit extremely weakly,
under stringent conditions (data not shown). To exclude
that we were dealing with a mixed population in which a
minority of cells had acquired resistance but had somehow
retained the last procyclin locus, Nour 6 cells were again
cloned by limiting dilution. Three daughter clones were
examined; all three showed the same pattern of hybridization as the parental clone. More significantly, when RNA
was isolated from these cells, procyclin transcripts could
clearly be detected at 5-6% of the wild-type level (see
Nour 6C in Fig. 3 B), which was comparable to the level in
Hyg 6C cells, which still contain two procyclin genes. By
using a combination of Southern blot analysis and PCR, it
was established that Nour 6C trypanosomes had retained the first gene in the Pro C locus, which encodes the
GPEET form of procyclin, and that recombination most
probably occurred via a conserved stretch of 70 bp that
spans the splice acceptor site and 5
UTR of all procyclin
genes (Fig. 3 C). To confirm these results, pKOS was used
to transfect a second hygromycin-resistant clone, Hyg 12C
(Fig. 2 B). Once again, the resulting clones (SAT 1-5) had
retained the same gene (data not shown).
The fact that the last procyclin gene could not be deleted would suggest that trypanosomes need at least one of
the eight genes to survive in culture, but is the type of procyclin important? To answer this question, hygromycin-
resistant trypanosomes were transfected with the plasmid
pKOS
, which was designed to eliminate the GPEET
gene while leaving the EP gene intact (Fig. 3 C). Several nourseothricin-resistant clones were analyzed (Fig. 2 B,
KOS
1-6), but in all cases, they showed aberrant integration of the construct and still expressed GPEET (see below). These results indicate that the two types of procyclin
are not equivalent: the EP form is dispensable when trypanosomes are maintained in culture, while at least one
GPEET gene seems to be required.
Coexpression of EP and GPEET Procyclins
GPEET procyclins have not been localized previously
since no antibodies were available. To study whether
GPEET was also expressed on the surface of procyclic
forms, we first generated specific antibodies by immunizing rabbits with a synthetic peptide (see Materials and
Methods). A well-characterized mAb, TBRP1/247, reacts with the dipeptide repeat of EP procyclins (35). When trypanosomes were labeled simultaneously with anti-GPEET
and anti-EP antibodies, it could be demonstrated that all
wild-type cells coexpressed both forms of procyclin on
their surfaces (Fig. 4 A). In contrast, only the GPEET
form was detectable on Nour 6C cells. Despite the fact
that the deletion mutants no longer expressed EP, they
were morphologically indistinguishable from the wild-type
cells. To examine these trypanosomes in more detail,
transmission electron microscopy was performed on ultrathin sections (Fig. 4 B). Once again, there were no significant differences between the cell surfaces of wild-type
and Nour 6C cells. Furthermore, the 427 and Nour 6C trypanosomes grew at virtually the same rate in culture (average population doubling times 9.5 and 9 h, respectively). We could also find no alterations in their susceptibility to
various proteases (trypsin, chymotrypsin, and Pronase) or
to lysis by complement (data not shown).
Reexpression of EP Procyclins
The deletion mutants were the end-product of several
rounds of transfection and cloning, so we might have unwittingly selected cells with altered properties, such as
changes in transmissibility, that were unlinked to the presence or absence of procyclins. Before we embarked on a
set of experiments to assess the role of procyclins in the
tsetse fly, Nour 6C trypanosomes were retransformed with a construct containing an EP gene. Since Northern blot
analysis indicated that ~70% of the transcripts in wildtype cells were derived from the two genes in the Pro A locus (compare 427 and Neo 2A in Fig. 3 B), we constructed
a bicistronic plasmid containing an EP 1 gene (Fig. 1) and
the puromycin-resistance gene (Fig. 5 A, pEP
164-PUR)
and targeted it to the Pro A locus by a combination of
flanking sequences and drug selection. The procyclin coding sequence in this construct is followed by a truncated 3
UTR that increases expression twofold over the wild-type
3
UTR (16a, 18), so it was anticipated that the single EP
gene in the retransformed cells would give rise to between
70 and 100% of the amount of procyclin found in wildtype cells. When two clones were examined, however, it
was found that they overexpressed the RNA fivefold (N6EP
1A) or threefold (N6-EP
2A) relative to the wildtype cells (Fig. 5 B), and this was also reflected by the
amount of EP detected by Western blot analysis (data not
shown). The retransformants grew slightly more slowly
than either 427 or Nour 6C (average population doubling
time 10.3 h), and although no changes in morphology could be detected when the trypanosomes were examined
by light microscopy, transmission electron microscopy revealed slight distortions of the surface membranes (Fig. 5
C). We also observed that when these cells were passaged
for several months, there was tendency for a proportion of
the population to stop expressing the gene, and that this
was exacerbated in the absence of puromycin.
Ectopic Expression of GPEET
Since EP procyclins could be overexpressed, it was expected that this would also hold true for GPEET when a
similar construct was integrated into the Pro A locus. The EP
coding region in the construct shown in Fig. 5 A was replaced with GPEET, and the new construct, pGPEET
164PUR, was used to transfect Nour 6C cells. Trypanosome
clones were analyzed for correct integration of the construct (data not shown). These cells now contained two
GPEET genes, the endogenous gene in the Pro C locus,
and a second copy in the Pro A locus, whose transcripts
could be distinguished on the basis of their size (Fig. 6 A,
N6-GPEET 1A). Unlike the EP retransformants, however, these cells did not show increased levels of steadystate RNA. On the contrary, quantitation of the Northern blots revealed a 25% reduction in the relative amount of
RNA from the gene in the Pro C locus that was compensated for by transcription of the gene in the Pro A locus.
Recombinational hot and cold spots have been described in other lower eukaryotes, such as yeast, and an alternative explanation for the retention of the last GPEET copy was that it was inaccessible for integration. To test this possibility, the N6-GPEET 1A cell line was transfected with a plasmid (Fig. 2 A, pKOCN) that was designed to delete the GPEET gene and the flanking SAT gene. Several stable transformants were examined and shown to have the predicted integration of the Neo gene (data not shown) and to express only the truncated form of the GPEET mRNA (Fig. 6 A, 2CKO 7). Interestingly, the steady-state level of this mRNA had now increased to the same level as that of the endogenous mRNA in Nour 6C cells. In addition, Western blot analysis confirmed that there were similar amounts of the protein in the different cell lines (Fig. 6 B). These results confirm that the gene in the Pro C locus can be deleted provided a second copy is present, and they suggest that GPEET expression is much more tightly regulated than that of EP procyclins.
EP Procyclins Enhance Infections in the Tsetse fly Midgut
When procyclic form trypanosomes are mixed with RBCs
and fed to tsetse flies through an artificial membrane, they
are capable of establishing an infection in the gut with the
same efficiency as bloodstream forms. To assess the role of
procyclins on survival in vivo, tsetse flies were infected
with either wild-type trypanosomes, EP null mutants
(Nour 6C), or EP overexpressors (N6-EP
2A and N6EP
1A). The flies were dissected 12-14 d later and examined for the presence of parasites. Infections in midgutpositive flies could be clearly classified into three categories:
weak, intermediate, and heavy. Five separate experiments
are shown in Fig. 7. More than 1,100 flies were examined
in total, but since these experiments were performed with
different batches over a period of 12 mo, direct comparisons can only be made within an experiment. Despite the
inherent variability of the system, it is striking that wild-type trypanosomes gave rise to heavy infections in 16.7-26.8%
of the flies (mean 21.0 ± 4.2%), whereas the Nour 6C deletion mutants caused heavy infections in only 2.4-5.4% of
flies (mean 3.8 ± 1.2%). In general, there were also more
flies that were negative or only weakly infected with Nour
6C. N6-EP
2A cells, which overexpress the EP1 form of
procyclin (Fig. 1), were considerably more successful at establishing heavy infections (10.4 and 14.7%, Fig. 7, experiments III and IV) than their EP-negative parent, although
they were not as efficient as the wild type. N6-EP
2A trypanosomes express a glycosylated form of EP, corresponding to EP1 in Fig. 1 (7a, 35). To assess the importance of
N-linked carbohydrates, we also tested a trypanosome
clone (N6-EP
1A) that overexpressed a form of EP without a glycosylation site (Fig. 1, EP2). These cells were
equally effective at promoting strong infections as the N6EP
2A cells were (11.1%, Fig. 7, experiment V), suggesting that N-linked sugars do not play a crucial role.
2A cells
that overexpress the glycosylated EP1 form (see Fig. 1). Experiment
V was performed with N6-EP
1A
trypanosomes that overexpress a
nonglycosylated form corresponding to EP2.
There were significant differences in the number of heavy infections produced by EP-positive cells (wild-type 427 and both forms of N6-EP) and EP-negative cells, as well as in the number of total infections (Fig. 7). In contrast, although there was a small, but significant difference in the number of heavy infections produced by 427 and N6-EP cells, the total infection rate fell within the same range. In conclusion, these results demonstrate that the expression of EP procyclins correlates with improved survival and growth within the fly, but other determinants must also be involved, since even Nour 6C cells are capable of establishing heavy infections in a small percentage of flies.
The analysis of deletion mutants has provided new insights into the expression and function of the different forms of procyclin. While it has been known for some time that the procyclin messenger RNAs that can be detected in a cloned line of trypanosomes must stem from at least two of the four expression sites (24, 30), it could not be ruled out that individual procyclic forms used only a single expression site, as is normally the case for the VSG expression site in bloodstream forms. In the course of deleting the procyclin genes, we inserted different selectable markers into each of the four loci and obtained parasites that were resistant to all four antibiotics, demonstrating that it was possible for all the loci to be transcribed simultaneously. Despite the fact that the promoters are virtually identical in sequence (9, 40), the contributions of the expression sites are not equal, since ~70% of the procyclin transcripts could be attributed to the Pro A locus, 18% to Pro B, and 12% to the two copies of Pro C. It remains to be established whether the Pro A locus is dominant in all isolates, or whether procyclic forms have the capacity to switch between loci.
The Pro A and Pro B loci both contain two genes for EP procyclins, while each of the two Pro C loci contains a GPEET gene followed by an EP gene. Three pairs of genes were sequentially deleted by homologous recombination, but all attempts to knock out the last pair, from a Pro C locus, invariably left one GPEET gene intact. Constructs that were designed to remove this gene, while leaving the neighboring copy of EP, resulted in aberrant integrations and the retention of GPEET. Other attempts to delete both GPEET genes from the Pro C loci were also unsuccessful, even when the four EP genes from the other two loci were still present (Ruepp, S., and A. Furger, unpublished observation). Once a tagged copy of GPEET was integrated into the Pro A locus, however, it was possible to delete the last endogenous gene, confirming that it was not intrinsically inaccessible to recombination. These results indicate that the two forms of procyclin are not functionally equivalent, since it is possible to generate null mutants for EP (e.g., Nour 6C), but not for GPEET.
The two forms of procyclin also do not appear to be subject to the same control mechanisms. The integration of a
single EP gene (with a truncated 3
UTR that increased
expression) into the Pro A locus of Nour 6C trypanosomes
was sufficient to produce up to five times more mRNA
and protein than wild-type cells. In contrast, when a
GPEET gene with the identical 3
UTR was integrated into the same locus, the amount of steady-state RNA was
only one quarter of that of Pro C-derived transcript. Once
the GPEET gene was deleted from the Pro C locus, however, there was an increase in the amount of the transcript
from the Pro A locus. These data suggest first that these
cells can only tolerate a narrow range of GPEET expression, and secondly that the level of steady-state RNA
might be determined by a regulatory element in the coding region.
The evidence for GPEET expression was formerly restricted to the detection of the mRNA (31), since there were no antibodies that were specific for this form. By using antibodies raised against a synthetic pentapeptide repeat, we have shown that GPEET is coexpressed with EP on the surface of T. brucei 427. Western blot analysis with the same antibodies demonstrated that the two forms of procyclin have markedly different electrophoretic mobilities. EP migrates as a broad band in the range 40-45 kD (35), whereas GPEET is predominantly detected as a doublet of 20/21 kD (Fig. 6 B). It is interesting to note that acidic proteins of the same size were also detected when cells were labeled with proline and separated on two- dimensional gels (8). Furthermore, procyclic form trypanosomes labeled with tritiated myristic acid incorporated a small proportion of the label into proteins of 20/21 kD (15), which is consistent with the fact that GPEET, like EP, is GPI anchored (7a, 46a).
The first requirement for successful transmission of T. brucei is the establishment of an infection in the fly midgut. To study the role of EP, the properties of four trypanosome clones were compared: wild-type cells with the full
complement of genes, the EP null mutant Nour 6C, and
two EP overexpressors derived from Nour 6C (N6-EP
2A and N6-EP
1A), which both produced about three
times more EP than wild-type cells. Removal of the EP
coat had no significant effect on the growth characteristics
or morphology of Nour 6C procyclic forms in culture, nor
could we detect an alteration in their sensitivity to several
proteases or complement compared to wild-type cells. In
contrast, N6-EPa 2A trypanosomes grew more erratically
than either 427 or Nour 6C, and transmission electron microscopy revealed that they had a more ruffled surface (Fig. 5 C). Furthermore, EP expression in these cells was
not completely stable: EP-negative cells could be detected
in cultures that had been passaged for several months in
the presence of the appropriate antibiotic, and these
tended to overgrow the EP-positive cells when the selective pressure was removed. Although 427 and Nour 6C
trypanosomes were virtually indistinguishable in culture, striking differences emerged when we compared their infectivity for tsetse flies. Wild-type cells were 5 to 10 times
more likely to give rise to heavy midgut infections than
Nour 6C cells; the correlation between EP expression and
the degree of infection was confirmed by the finding that
both of the EP overexpressors were also capable of producing heavy infections three to four times more often
than Nour 6C trypanosomes. In light of our results, it
would seem that some of the functions that have previously been proposed for procyclins may be oversimplifications. For example, it has been suggested that procyclins
might be a target for a trypanocidal factor
possibly a lectin
in the fly midgut (28). If this were the case for EP,
Nour 6C cells should survive better than the wild-type
strain, but the converse is true. In addition, cells that overexpress either EP 1 or EP 2 behave very similarly, which
would argue against a role for N-linked carbohydrates in the interaction.
Our results clearly demonstrate the importance of one class of procyclins in the first stage of transmission. Procyclins may also play a role in the later stages of differentiation, but this cannot be tested with derivatives of strain 427; these parasites establish normal midgut infections, but do not migrate to the salivary glands. Experiments to determine the effects on parasite maturation using transmissible strains may not be trivial, however. When procyclic forms are maintained in culture for more than a few months, they lose the ability to complete the cycle, so that repeated rounds of transfection and selection to remove several genes may result in changes in transmissibility that are unlinked to procyclin expression. There might be alternative ways to determine whether procyclins are involved in parasite tropism. In contrast to T. brucei, the epimastigote and metacyclic forms of T. congolense develop in the proboscis. It should be possible to investigate the role of surface molecules by expressing heterologous procyclins in the two species (19) and studying their route through the fly.
The procyclin coat has previously been regarded as both homogeneous and invariant. We now know that although it is composed of closely related surface glycoproteins, these appear to have distinct functions in different contexts. The requirement for GPEET by procyclic culture forms suggests that it might either play a role in parasite- parasite interactions or function as a receptor for an unknown soluble ligand. The finding that EP is not required in culture but is important for survival in vivo implies that its prime importance lies in parasite-tsetse interactions, which may involve the recognition of soluble, matrix- or cell-associated ligands. At the present time, we can only speculate on the biological relevance of the three variants of EP that are encoded in the genome (see Fig. 1). Our data show that both glycosylated and unglycosylated forms can function equally well in enhancing midgut infections in Glossina morsitans centralis, but this does not exclude specific functions for either form at a later stage in the life cycle. It should also be borne in mind that T. brucei can infect different species of tsetse flies, although not necessarily with equal efficiency (28). It is possible that the survival in a given species of tsetse fly is favored by a certain form of EP, and that the expression of different variants has enabled the parasite to increase its host range. Finally, changes in the balance between EP and GPEET might also explain why some stocks of trypanosomes can be more readily transmitted than others.
Received for publication 2 December 1996 and in revised form 20 February 1997.
Please address all correspondence to I. Roditi, Institut für Allgemeine Mikrobiologie, Universität Bern, Baltzerstrasse 4, CH-3012 Bern, Switzerland. Tel.: (41) 31-631-4647. Fax: (41) 31-631-4684. e-mail: roditi{at}imb.unibe.chWe thank Steve Beverley for providing the hygromycin- and puromycinresistance genes, Rob McMaster for the SAT-1 gene, Christine Clayton for the phleomycin-resistance gene, and Terry Pearson for the mAb TBRP1/247. S.K. Moloo (International Livestock Research Institute, Nairobi) is thanked for supplying us with tsetse fly pupae, and Ruth Nüesch is thanked for technical assistance with the fly experiments. We are also grateful to Dirk Dobbelaere and Richard Braun for reading the manuscript, and to Peter Bütikofer, Mike Ferguson, and Achim Treumann for communicating unpublished results.
This work was supported by a Helmut Horten Incentive award and by a grant from the Swiss National Science Foundation to I. Roditi.
The relative amounts of EP and GPEET expressed by procyclic forms have now been determined independently by Bütikofer et al. and Treumann et al. The ratio of two forms of procyclin can vary markedly between strains (Bütikofer et al., 1997) or between different passages of the same culture (Treumann et al., 1997), with a shift toward increased GPEET expression with time. The clone of T. brucei 427 used in these experiments stably expresses about onefold more GPEET than EP, as measured by the incorporation of labeled precursors into the GPI anchors of the two forms. The requirement for GPEET is not simply due to the high levels of expression, however, because we have been unable to delete the last copy in derivatives of T. brucei 427 in which the ratios are reversed.
UTR, untranslated region; VSG, variant surface glycoproteins.
| 1. | Bayne, R.A.L., E.A. Kilbride, F.A. Lainson, L. Tetley, and J.D. Barry. 1993. A major surface antigen of procyclic stage Trypanosoma congolense. Mol. Biochem. Parasitol. 61: 295-310 [Medline]. |
| 2. | Beecroft, R.P., I. Roditi, and T.W. Pearson. 1993. Identification and characterization of a major surface glycoprotein from procyclic stage Trypanosoma congolense. Mol. Biochem. Parasitol. 61: 285-294 [Medline]. |
| 3. |
Berberof, M.,
A. Pays, and
E. Pays.
1991.
A similar gene is shared by both
variant surface glycoprotein and procyclin gene transcription units of
Trypanosoma brucei.
Mol. Cell. Biol.
11:
1473-1479
|
| 4. | Berberof, M., A. Pays, S. Lips, P. Tebabi, and E. Pays. 1996. Characterization of a transcriptional terminator the of the procyclin PARP A unit of Trypanosoma brucei. Mol. Cell. Biol. 16: 914-924 [Abstract]. |
| 5. |
Brown, S.D.,
J. Huang, and
L.H.T. van der Ploeg.
1992.
The promoter for
the procyclic acidic repetitive protein (PARP) genes of Trypanosoma
brucei shares features with RNA polymerase I promoters.
Mol. Cell.
Biol.
12:
2644-2652
|
| 6. | Bruce, D. 1915. The Croonian lectures on trypanosomes. Lancet. ii:55-63. |
| 7. | Brun, R., and M. Schoenenberger. 1979. Cultivation and in vitro cloning of procyclic culture forms of Trypanosoma brucei in a semi-defined medium. Acta Tropica. 36: 289-292 [Medline]. |
| 7a. | Bütikofer, P., S. Ruepp, M. Boschung, and I. Roditi. 1997. "GPEET" procyclin is the major surface glycoprotein of Trypanosoma brucei brucei procyclin culture forms. Biochem. J. In press. |
| 8. |
Clayton, C.E., and
M.R. Mowatt.
1989.
The procyclic acid repetitive proteins of Trypanosoma brucei: purification and post-translational modification.
J. Biol. Chem.
264:
15088-15093
|
| 9. |
Clayton, C.E.,
J.P. Fueri,
J.E. Itzhaki,
V. Bellofatto,
D.R. Sherman,
G.S. Wisdom,
S. Vijayasarathy, and
M.R. Mowatt.
1990.
Transcription of the
procyclic acidic repetitive protein genes of Trypanosoma brucei.
Mol.
Cell. Biol.
10:
3036-3047
|
| 10. | Clayton, C., and H.-R. Hotz. 1996. Post-transcriptional control of PARP gene expression. Mol. Biochem. Parasitol. 77: 1-6 [Medline]. |
| 11. | Cross, G.A.M., and J.C. Manning. 1973. Cultivation of Trypanosoma brucei ssp. in semi-defined media. Parasitology. 67: 315-331 [Medline]. |
| 12. | Cross, G.A.M.. 1996. Antigenic variation in trypanosomes: secrets surface slowly. Bioessays. 18: 283-291 [Medline]. |
| 13. | Dorn, P.L, R.A. Aman, and J.C. Boothroyd. 1991. Inhibition of protein synthesis results in super-induction of procyclin (PARP) RNA levels. Mol. Biochem. Parasitol. 44: 133-139 [Medline]. |
| 14. | Ferguson, M.A.F., P. Murray, H. Rutherford, and M.J. McConville. 1993. A simple purification of procyclic acidic repetitive protein and demonstration of a sialylated glycosyl-phosphatidylinositol membrane anchor. Biochem. J. 291: 51-55 . |
| 15. | Field, M.C., A.K. Menon, and G.A.M. Cross. 1991. A glycosylphosphatidylinositol protein anchor from procyclic stage Trypanosoma brucei: lipid structure and biosynthesis. EMBO (Eur. Mol. Biol. Organ.) J. 10: 2731-2739 [Medline]. |
| 16. | Freedman, D.J., and S.M. Beverley. 1993. Two more independent selectable markers for stable transformation of Leishmania. Mol. Biochem. Parasitol. 62: 37-44 [Medline]. |
| 16a. | Furger, A., N. Schürch, U. Kurath, and I. Roditi. 1997. Trypanosoma brucei: elements in the procyclin mRNA 3 untranslated region regulate expression in insect forms by modulating RNA stability and translation.
Mol. Cell. Biol. In press.
|
| 17. | Hehl, A., and I. Roditi. 1994. The regulation of procyclin expression in Trypanosoma brucei: making or breaking the rules? Parasitol. Today. 10: 442-445 . [Medline] |
| 18. |
Hehl, A.,
E. Vassella,
R. Braun, and
I. Roditi.
1994.
A conserved stem-loop
structure in the 3 untranslated region of procyclin mRNAs regulates expression in Trypanosoma brucei
Proc. Natl. Acad. Sci. USA.
91:
370-374
|
| 19. | Hehl, A., T.W. Pearson, J.D. Barry, R. Braun, and I. Roditi. 1995. Expression of GARP, a major surface glycoprotein of Trypanosoma congolense, on the surface of Trypanosoma brucei: characterisation and use as a surface marker. Mol. Biochem. Parasitol. 70: 45-58 [Medline]. |
| 20. |
Huang, J., and
L.H.T. van der Ploeg.
1991.
Requirement of a polypyrimidine tract for trans-splicing in trypanosomes: discriminating the PARP
promoter from the immediately adjacent 3 splice acceptor site.
EMBO
(Eur. Mol. Biol. Organ.) J.
10:
3877-3855
[Medline].
|
| 21. |
Hug, M.,
H.-R. Hotz,
C. Hartmann, and
C. Clayton.
1994.
Hierarchies of
RNA-processing signals in a trypanosome surface antigen mRNA precursor.
Mol. Cell. Biol.
14:
7428-7435
|
| 22. |
Jefferies, D.,
P. Tebabi,
D. Le Ray, and
E. Pays.
1993.
The ble resistance
gene as a new selectable marker for Trypanosoma brucei: fly transmission of procyclic stable transformants to produce antibiotic resistant
bloodstrean forms.
Nucleic Acids Res.
21:
191-195
|
| 23. | Joshi, P.B., J.R. Webb, J.E. Davies, and W.R. McMaster. 1995. The gene encoding streptothricin acetyl transferase (sat) as a selectable marker for Leishmania expression vectors. Gene (Amst.). 156: 145-149 [Medline]. |
| 24. |
Koenig, E.,
H. Delius,
M. Carrington,
R.O. Williams, and
I. Roditi.
1989.
Duplication and transcription of procyclin genes in Trypanosoma brucei.
Nucleic Acids Res.
17:
8727-8739
|
| 25. | Koenig-Martin, E., M. Yamage, and I. Roditi. 1992. A procyclin-associated gene in Trypanosoma brucei encodes a polypeptide related to ESAG 6 and 7. Mol. Biochem. Parasitol. 55: 135-146 [Medline]. |
| 26. | Lee, M.G., and L.H.T. van der Ploeg. 1991. The hygromycin B-resistanceencoding gene as a selectable marker for stable transformation of Trypanosoma brucei. Gene (Amst.). 105: 255-257 [Medline]. |
| 27. | Maudlin, I., and S.C. Welburn. 1988. The role of lectins and trypanosome genotype in the maturation of midgut infections in Glossina morsitans. Trop. Med. Parasitol. 39: 56-58 [Medline]. |
| 28. | Maudlin, I., and S.C. Welburn. 1994. Maturation of trypanosome infections in tsetse. Exp. Parasitol. 79: 202-205 [Medline]. |
| 29. | Mowatt, M.R., and C.E. Clayton. 1987. Developmental regulation of a novel repetitive protein of Trypanosoma brucei. Mol. Cell. Biol. 7: 2833-2844 . |
| 30. |
Mowatt, M.R., and
C.E. Clayton.
1988.
Polymorphisms in the procyclic
acidic repetitive protein (PARP) gene family of Trypanosoma brucei.
Mol. Cell. Biol.
8:
4055-4062
|
| 31. |
Mowatt, M.R.,
G.S. Wisdom, and
C.E. Clayton.
1989.
Variation of tandem
repeats in the developmentally regulated procyclic acidic repetitive proteins of Trypanosoma brucei.
Mol. Cell. Biol.
9:
1332-1335
|
| 32. | Overath, P., J. Czichos, U. Stock, and C. Nonnengaesser. 1983. Repression of glycoprotein synthesis and release of surface coat during transformation of Trypanosoma brucei. EMBO (Eur. Mol. Biol. Organ.) J. 2: 1721-1728 [Medline]. |
| 33. | Pearson, T.W. 1993. The immunology of African trypanosomiasis. In Clinical Aspects of Immunology, 5th ed. P.J. Lachmann, D.K. Peters, F.S. Rosen, and M.J. Walport, editors. Blackwell Scientific Publications, Oxford. 1599-1612. |
| 34. | Richardson, J.P., L. Jenni, R.P. Beecroft, and T.W. Pearson. 1986. Procyclic tsetse fly midgut forms and culture forms of African trypanosomes share stage- and species-specific surface antigens identified by monoclonal antibodies. J. Immunol. 136: 2259-2264 [Abstract]. |
| 35. | Richardson, J.P., R.P. Beecroft, D.L. Tolson, M.K. Liu, and T.W. Pearson. 1988. Procyclin: an unusual immunodominant glycoprotein surface antigen from the procyclic stage of African trypanosomes. Mol. Biochem. Parasitol. 31: 203-216 [Medline]. |
| 36. | Roditi, I., M. Carrington, and M. Turner. 1987. Expression of a polypeptide containing a dipeptide repeat is confined to the insect stage of Trypanosoma brucei. Nature (Lond.). 325: 272-274 [Medline]. |
| 37. |
Roditi, I.,
H. Schwarz,
T.W. Pearson,
R.P. Beecroft,
M.K. Liu,
J.P. Richardson,
H.-J. Bühring,
J. Pleiss,
R. Bülow,
R.O. Williams, and
P. Overath.
1989.
Procyclin gene expression and loss of the variant surface glycoprotein during differentiation of Trypanosoma brucei.
J. Cell Biol.
108:
737-746
|
| 38. | Roditi, I., and T.W. Pearson. 1990. The procyclin coat of African trypanosomes. Parasitol. Today. 6: 79-82 . [Medline] |
| 39. | Rudenko, G., D. Bishop, K. Gottesdiener, and L.H.T. van der Ploeg. 1989. Alpha-amanitin resistant transcription of protein coding genes in insect and bloodstream from Trypanosoma brucei. EMBO (Eur. Mol. Biol. Organ.) J. 8: 4259-4263 [Medline]. |
| 40. |
Rudenko, G.,
S. LeBlanq,
J. Smith,
M.G.S. Lee,
A. Rattray, and
L.H.T. van
der Ploeg.
1990.
Procyclic acidic repetitive protein genes (PARP) genes
located in an unusually small -amanitin-resistant transcription unit:
PARP promoter activity assayed by transient DNA transfection of Trypanosoma brucei.
Mol. Cell. Biol.
10:
3492-3504
|
| 41. |
Schürch, N.,
A. Hehl,
E. Vassella,
R. Braun, and
I. Roditi.
1994.
Accurate
polyadenylation of procyclin mRNAs in Trypanosoma brucei is determined by pyrimidine-rich elements in the intergenic regions.
Mol. Cell.
Biol.
14:
3668-3675
|
| 42. |
Seebeck, T.,
P.A. Whittaker,
M.A. Imboden,
N. Hardman, and
R. Braun.
1983.
Tubulin genes of Trypanosoma brucei: a tightly clustered family of
alternating genes.
Proc. Natl. Acad. Sci. USA.
80:
4634-4638
|
| 43. | Sherman, D.R., L. Janz, M. Hug, and C. Clayton. 1991. Anatomy of the parp gene promoter of Trypanosoma brucei. EMBO (Eur. Mol. Biol. Organ.) J. 10: 3379-3386 [Medline]. |
| 44. |
Simionescu, N., and
M. Simionescu.
1976.
Galloylglucoses of low molecular
weight as mordant in electron microscopy.
J. Cell Biol.
70:
608-621
|
| 45. | Southern, P.J., and P. Berg. 1982. Transformation of mammalian cells to antibiotic resistance with a bacterial gene under control of the SV40 early region promoter. J. Mol. Appl. Genet. 1: 327-341 [Medline]. |
| 46. | Ten Asbroek, A.L.M.A., M. Ouellette, and P. Borst. 1990. Targeted insertion of the neomycin phosphotransferase gene into the tubulin gene cluster of Trypanosoma brucei. Nature (Lond.). 348: 174-175 [Medline]. |
| 46a. | Treumann, A., N. Zitzmann, A. Hülsmeier, A.R. Prescott, A. Almond, J. Sheehan, and M. Ferguson. 1997. Structural characterization of two forms of procyclic acidic repetitive protein expressed by procyclic forms of Trypanosoma brucei. J. Mol. Biol. In press. |
| 47. |
Vassella, E.,
R. Braun, and
I. Roditi.
1994.
Control of polyadenylation and
alternative splicing of transcripts from adjacent genes in a procyclin expression site: a dual role for polypyrimidine tracts in trypanosomes?
Nucleic Acids Res.
22:
1359-1364
|
| 48. | Vickerman, K., L. Tetley, K.A.K. Hendry, and C.M.R. Turner. 1988. Biology of African trypanosomes in the tsetse fly. Biol. Cell. 64: 109-119 [Medline]. |
| 49. |
Young, J.R.,
J.E. Donelson,
P.A.O. Majiwa,
S.Z. Shapiro, and
R.O. Williams.
1982.
Analysis of genomic rearrangements associated with two variable antigen genes of Trypanosoma brucei.
Nucleic Acids Res.
10:
803-819
|
| 50. | Ziegelbauer, K., M. Quinten, H. Schwarz, T.W. Pearson, and P. Overath. 1990. Synchronous differentiation of Trypanosoma brucei from bloodstream to procyclic forms in vitro. Eur. J. Biochem. 192: 373-378 [Medline]. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|