|
||




* Zentrum für Molekulare Biologie der Universität Heidelberg, 69120 Heidelberg, Germany;
Max-Delbrück-Zentrum für
Molekulare Medizin, 13122 Berlin-Buch, Germany; § Abteilung Molekulare Biologie der Mitose, Deutsches
Krebsforschungszentrum, 69120 Heidelberg, Germany;
European Molecular Biology Laboratory, 69117 Heidelberg, Germany; ¶ Institut für Biochemie, Humboldt Universität Berlin, 10115 Berlin, Germany; and ** University of Geneva, Department of
Molecular Biology, CH-1211 Geneva 4, Switzerland
The importin-
/
complex and the GTPase
Ran mediate nuclear import of proteins with a classical
nuclear localization signal. Although Ran has been implicated also in a variety of other processes, such as cell
cycle progression, a direct function of Ran has so far
only been demonstrated for importin-mediated nuclear
import. We have now identified an entire class of ~20
potential Ran targets that share a sequence motif related to the Ran-binding site of importin-
. We have
confirmed specific RanGTP binding for some of them,
namely for two novel factors, RanBP7 and RanBP8, for CAS, Pse1p, and Msn5p, and for the cell cycle regulator
Cse1p from Saccharomyces cerevisiae. We have studied
RanBP7 in more detail. Similar to importin-
, it prevents the activation of Ran's GTPase by RanGAP1 and
inhibits nucleotide exchange on RanGTP. RanBP7
binds directly to nuclear pore complexes where it competes for binding sites with importin-
, transportin, and
apparently also with the mediators of mRNA and U
snRNA export. Furthermore, we provide evidence for
a Ran-dependent transport cycle of RanBP7 and demonstrate that RanBP7 can cross the nuclear envelope
rapidly and in both directions. On the basis of these results, we propose that RanBP7 might represent a nuclear transport factor that carries an as yet unknown
cargo, which could apply as well for this entire class of
related RanGTP-binding proteins.
The nuclear pore complexes (NPC)1 are the sites
where the exchange of macromolecules between
nucleus and cytoplasm occurs (Feldherr et al., 1984 The nuclear import of proteins with a classical nuclear
localization signal (NLS) is to date the best characterized
nucleocytoplasmic transport pathway (for reviews see Görlich and Mattaj, 1996 The small GTPase Ran (Drivas et al., 1990 It is likely that at least some properties of importin- In addition to importin- Although a direct involvement of Ran has so far only
been demonstrated in the importin-dependent transport
pathway, perturbations in the Ran system have severe effects on a great variety of cellular functions, such as RNA
processing, RNA export, regulation of chromosome structure, cell cycle progression, initiation of replication, microtubule structure, etc. (for review see Dasso, 1993 Here we describe a novel superfamily of Ran-binding
proteins, which includes about a dozen factors in yeast and
probably even more in higher eukaryotes. The members of
this superfamily share with importin- Purification of RanBP7 and Binding Assays
For small scale purification, 100 µl of a Xenopus egg extract (plus energy-regenerating system) was diluted 10-fold in binding buffer (50 mM Tris/
HCl, pH 7.5, 200 mM NaCl, 10 mM magnesium acetate), and a post-ribosomal supernatant was prepared. This was rotated overnight with 20 µl
IgG Sepharose to which a z-tagged IBB domain (Görlich et al., 1996a Antibodies
Antibodies were raised in rabbits against recombinant Xenopus RanBP7.
Affinity purification was on sulfo-Link (Pierce, Rockford, IL) to which
RanBP7 had been coupled. The anti-RanBP7 antibody is monospecific on
blots with total Xenopus egg extract (not shown). Antibodies against importin- Molecular Cloning
Based on the partial peptide sequences obtained from RanBP7, two degenerate oligonucleotides AA(AG)ATGAT(TCA)GA(AG)AA(AG)CA (TC)GG and AA(AG)GCNAT(TCA)TT(TC)CA(AG)AA(AG) were
synthesized and used to identify full length cDNA clones in a Xenopus oocyte cDNA library. For expression and in vitro translation, RanBP7 was
cloned into the pQE70 (Qiagen, Hilden, Germany), zz70, and T7-70 vectors (see below). Comparison of the Xenopus RanBP7 sequence with the
GenBank/EMBL/DDBJ database identified a similar cDNA-clone (IMAGE
Consortium clone ID34250; ACC 360021; Lennon et al., 1996 The complete coding sequence of human RanBP8, human CAS, and
human transportin were amplified by PCR from HeLa cDNA and cloned into the NcoI/BamH1 sites of pQE60 or zz60. The zz60 vector was generated by an in-frame insertion into the NcoI site of pQE60 of a BspHI/
NcoI fragment containing two z domains from protein A. The DNAs encoding Cse1p, Pse1p, Pdr6p, or the NH2-terminal 682 amino acids of
Msn5p were obtained by PCR amplification from genomic Saccharomyces
cerevisiae DNA, using primers containing the appropriate restriction sites
for subsequent cloning into expression vectors. Cse1p was cloned into the
NcoI/BamHI sites of z60, Pdr6p, and the Msn5p fragment, and the Pse1p
fragments were cloned into SphI/BamHI sites of zz70 (a pQE70 derivative in which two z domains are fused in front of the multi-cloning site).
Sequence Analysis and Homology Searches
RanBP7 was subjected to a variety of sequence analysis tools (Bork and
Gibson, 1996 The sequence data for the following aligned proteins are available from
GenBank/EMBL/DDBJ under accession numbers given: Xenopus RanBP7,
U71082; human RanBP8, U77494; human CAS, U33268; S. cerevisiae Cse1p,
P33307; S. cerevisiae Lph2p, U43503; S. cerevisiae Nmd5p, P46970; S. cerevisiae D9509.15p, U32274; S. cerevisiae Yrb4p, P40069; human importin- In Vitro Translation
Importin- Oocyte Injections
To study nuclear export, RanBP7 was translated in vitro and injected
into nuclei of Xenopus oocytes as described (Kambach and Mattaj, 1992 Microinjection of RNA and analysis by denaturing gel electrophoresis
and autoradiography were performed as described (Jarmolowski et al.,
1994 Expression and Purification of Recombinant Proteins
The expression and purification of the following factors was as described
previously: importin- Transportin was expressed at 15°C with a COOH-terminal his-tag, with
or without an NH2-terminal z-tag. Purification was with nickel agarose followed by chromatography on MonoQ (Pharmacia). Activity was verified
in an import assay using a fluorescent nucleoplasmin core-M9 fusion as a
substrate.
Fluorescence Labeling
Labeling of importin- NPC Binding Assay
The binding assay was essentially performed as an import assay with permeabilized cells as described earlier (Görlich et al., 1996a Enzymatic Assays
Labeling of Ran with Overlay Blots
The basic method followed a published protocol (Lounsbury et al., 1994 Identification of RanBP7 as Copurifying
with Importin- The IBB domain is that part of importin-
The finding that RanBP7 copurifies with importin- To find out whether the expression of RanBP7 is restricted to Xenopus oocytes or also common to other tissues, we raised antibodies against recombinant RanBP7
and found them to cross-react with a 120-kD protein in a
variety of cells, including HeLa cells. Furthermore, the complex of RanBP7 and importin- RanBP7 Is a Novel Ran-Binding Protein
Mammalian cells contain a number of Ran-binding proteins that can be detected by overlay blots using Ran
loaded with [32P]GTP as a probe (Coutavas et al., 1993 It should be noted that the 120-kD band in the total
HeLa extract actually represents a mixture of different
Ran-binding proteins (RanBPs) of similar size. Besides
RanBP7, it includes at least one additional protein called
RanBP5 (Deane et al., 1997 The RanBP7-Importin- Because importin-
The RanBP7/Importin- The RanBP7/importin- To show that RanGTP can also dissociate a preformed
RanBP7/importin- Sequence and Homologies of RanBP7
The Xenopus RanBP7 cDNA codes for a protein of 119 kD.
The peptide sequences from HeLa RanBP7 and a human
RanBP7 sequence tag (Acc R49703) indicate that human
RanBP7 is ~95% identical to the Xenopus protein. On the
basis of an expressed sequence tag we have also cloned another relative, RanBP8, which is a human protein with
61% identity to RanBP7 (Fig. 3).
Database searches with the Blast series of programs (Altschul et al., 1994 RanBP7 Shares a Common NH2-terminal
Sequence Motif with a Protein Superfamily that
Includes Importin- To identify more distant members of this new family, iterative profile searches (Birney et al., 1996
The Conserved NH2-terminal Motif Appears to Account
for Interaction with RanGTP
The region of high similarity comprises residues 1-150 in
importin- The first protein tested for Ran binding is human CAS.
We probed this blot with Ran We next tested Ran binding to full length Pse1p (Chow
et al., 1992 Effects of RanBP7 and RanBP8 on the RanGTPase
Having identified an entire class of novel targets for Ran
function, we wanted to investigate the interaction of a representative of this class with Ran in more detail. Ran can
cycle between a GDP and GTP-bound state, where the intrinsic rates of nucleotide exchange and GTP hydrolysis
are very low. Catalysis by specific factors can increase
these rates up to 105-fold (Bischoff and Ponstingl, 1991a Fig. 6 A shows that RanBP7 and RanBP8 inhibit, like
importin-
Fig. 6 B shows that RanBP8 inhibits the RCC1-mediated nucleotide exchange on RanGTP (RanBP7 has the
same effect, not shown). The effect is specific for the GTP
form; RanGDP is not affected. RanBP8 and RanBP7 thus
behave like importin- Like importin- RanBP7 Can Shuttle between Nucleus and Cytoplasm
RanBP7 is, at steady state, a predominantly cytoplasmic
protein (see below). To test if it can cross the nuclear envelope like importin-
We next wanted to know if the nuclear export of
RanBP7 is active and dependent on specific factors. As
RanBP7 is a Ran-binding protein, we reason that its interaction with Ran might be crucial for its transport across
the nuclear envelope. As detailed in the introduction, there
is a strikingly asymmetric distribution of the Ran system.
The GDP/GTP exchange factor RCC1, which loads Ran with
GTP, is exclusively nuclear. Its antagonist, the GTPase-activating protein RanGAP1 is excluded from the nucleoplasm and depletes RanGTP from the cytoplasm. As a
consequence, the RanGTP concentration should be high
in the nucleus and very low in the cytoplasm. We wanted
to know if the breakdown of this RanGTP gradient would affect the nuclear export of RanBP7. To deplete the nuclear RanGTP pool, we injected Rna1p (RanGAP1 from
S. pombe) into nuclei of Xenopus oocytes. As seen from
Fig. 7 A, this treatment severely reduced the rate of RanBP7
export. Strikingly, export was restored if the Rna1p-resistant RanQ69L mutant (GTP form) was prebound to
RanBP7 before nuclear injection. Two conclusions are
suggested from this experiment. First, RanBP7 requires
nuclear RanGTP for export, and second, RanBP7 is exported out of the nucleus as a complex with RanGTP. This
also excludes the possibility that RanBP7 leaves the nucleus by simple diffusion. Because RanGTP dissociates RanBP7 from importin- At a steady state, RanBP7 is 90-95% cytoplasmic, and
5-10% are found in the nuclear fraction (Fig. 7 B, control).
If this distribution reflects the dynamics of import and export, then endogenous RanBP7 should shift to the nucleus
if its re-export from the nucleus is inhibited by a nuclear
injection of Rna1p (S. pombe RanGAP1). As seen from
Fig. 7 B this treatment does not change the localization of
any of the major cytoplasmic proteins (Fig. 7 B, Coomassie), however, ~50% of the total RanBP7 are indeed chased into the nucleus. Considering that the nucleus has
only 1/10 of the volume of the cytoplasm, this is not just
equilibration between nucleus and cytoplasm but rather is
a 10-fold accumulation in the nuclei. The treatment also
causes an increase in nuclear importin- RanBP7 and RanBP8 Bind to Nuclear Pore Complexes
Having shown that RanBP7 can cross the nuclear envelope, we wanted to know whether RanBP7 makes a direct
contact to nuclear pores. To test this, permeabilized cells
were incubated with z-tagged importin-
RanBP7 could bind directly to NPCs or only in a complex with importin- The data already suggest that RanBP7 binds to NPC not
via importin- Fig. 9 shows that importin-
As a consequence of the competition for NPC binding
between the different transport mediators, excess of one
transport receptor should compete the transport mediated
by another one. Indeed, we have previously shown that
dominant-negative importin-
The small GTPase Ran has been implicated in a variety of
cellular functions, such as transport into and out of the nucleus, regulation of cell cycle progression, and chromatin
structure (for reviews see Dasso, 1993 The members of the RanBP7/Cse1p/importin- In importin- It should be emphasized that the RanBP7/Cse1p/importin- The interaction with the nuclear pore complex appears
to be a second characteristic of the RanBP7/Cse1p/importin- We have previously observed that importin- RanBP7 and RanBP8 are Ran-binding proteins with
similar properties as importin- The disassembly of the RanBP7/RanGTP requires the
concerted action of RanBP1 and RanGAP1 (Fig. 6). We suggest the following working model for this process: the intermediate of disassembly is the trimeric RanBP7/RanGTP/
RanBP1 complex (Fig. 6 C), which appears to be in a fast
equilibrium with free RanBP7 and the dimeric RanGTP/
RanBP1 complex (Bischoff, F.R., and D. Görlich, manuscript in preparation). The latter is an excellent substrate
for RanGAP1, which triggers GTP hydrolysis and thereby
makes the disassembly of the complex irreversible. RanBP1
is essential for nuclear transport in yeast (Schlenstedt et
al., 1995b The RanBP7/RanGTP complex should form only in the
nucleus; however, its disassembly is most likely cytoplasmic because the two factors required for disassembly,
RanGAP1 and RanBP1, are excluded from the nucleoplasm (Hopper et al., 1990 RanBP7 is at a steady state predominantly cytoplasmic,
and only ~5% is found in the nuclear fraction. However,
this situation becomes strikingly different if nuclear export
of RanBP7 is inhibited, and then ~50% of RanBP7 can be
shifted to the nucleus. Considering that the nucleus accounts for only 1/10 of the volume of the oocyte, RanBP7
has become 10-fold concentrated in the nucleus compared to the cytoplasm. This accumulation cannot be explained
by simple diffusion. Taken together, RanBP7 can cross the
nuclear envelope rapidly and in both directions. Although
we have not yet identified a cargo, RanBP7's properties
resemble those of a shuttling transport receptor. We do not
know if RanBP7 would confer import or export. In analogy to importin- In Xenopus eggs or HeLa cells, RanBP7 and importin- The members of the RanBP7/Cse1p/importin- Taken together, yeast might use about a dozen independent nuclear transport pathways. From expressed, sequenced tags in the data base it appears there might be
considerably more in higher organisms. This probably enables eukaryotes to make full use of their compartmentalization and to use specific regulated nuclear pathways to
control key cellular events.
).
Transport through the NPCs is bidirectional and comprises a multitude of substrates. Small molecules can passively diffuse through the NPC. The transport of proteins
and RNAs >40-60 kD is, however, generally an active
process, i.e., it is energy dependent (Newmeyer et al., 1986
)
and mediated by saturable transport receptors (Goldfarb
et al., 1986
; Michaud and Goldfarb, 1991
; Jarmolowski et al.,
1994
). To accomplish multiple rounds of transport, these
transport receptors are thought to shuttle between nucleus and cytoplasm (Goldfarb et al., 1986
). An import receptor,
for example, has to bind its import substrate initially in the
cytoplasm, release it after NPC passage into the nucleus,
and return to the cytoplasm without the cargo. Conversely, an export factor has to bind the export substrate
only in the nucleus and on the way out. This model predicts asymmetry in these transport cycles and implies that
the binding of the transport receptor to its cargo is regulated by the different environments of nucleus and cytoplasm.
; Koepp and Silver, 1996
; Schlenstedt,
1996
). The signal contains one or more clusters of basic
amino acids (for review see Dingwall and Laskey, 1991
)
and is recognized by the importin-
/
complex (for references see Sweet and Gerace, 1995
; Panté and Aebi, 1996
). The
subunit provides the NLS binding site (Imamoto et al.,
1995
; Weis et al., 1995
) and is therefore also called the
NLS receptor (Adam and Gerace, 1991
). The
subunit
accounts for the interaction with the NPC (Görlich et al.,
1995
; Moroianu et al., 1995
) and carries importin-
with the
NLS substrate into the nucleus. The translocation into the
nucleus is terminated by the disassembly of the importin
complex, and both subunits are returned probably separately to the cytoplasm. Importin-
interacts with -
via its
importin-
binding domain (IBB domain; Görlich et al.,
1996a
; Weis et al., 1996a
). Binding to importin-
with an
IBB domain is sufficient for nuclear entry, and the IBB
domain can therefore be regarded as the nuclear targeting
signal of importin-
. The export domain of importin-
has
not yet been identified, but it is distinct from the IBB domain.
; Bischoff and
Ponstingl, 1991b
; Belhumeur et al., 1993
) plays a key role
in NLS-dependent protein import (Melchior et al., 1993
;
Moore and Blobel, 1993
). GTP hydrolysis by Ran is absolutely essential for import (Melchior et al., 1993
; Moore
and Blobel, 1993
; Schlenstedt et al., 1995a
; Palacios et al.,
1996
) and is possibly even its sole source of energy (Weis
et al., 1996b
). Although the molecular mechanism of import is far from being understood, it appears that Ran fulfils at least two distinct functions in this process: first, Ran's GTP cycle probably drives translocation into the nucleus
(Melchior et al., 1993
; Moore and Blobel, 1993
; Weis et al.,
1996b
), which appears to involve the binding of (cytoplasmic) RanGDP to the NPC, followed by nucleotide exchange and GTP hydrolysis, but it does not involve binding
of RanGTP to importin-
(Görlich et al., 1996b
). Unfortunately, nothing is known of how Ran's GTP cycle would
translate into a directed movement through the NPC. Secondly, Ran regulates the interaction between importin-
and -
(Rexach and Blobel, 1995
; Chi et al., 1996
; Görlich
et al., 1996b
). Binding of RanGTP to importin-
disassembles the importin-
/
complex at the nuclear side of the
NPC, thereby terminating translocation (Görlich et al.,
1996b
). The asymmetric distribution of Ran's principal
GDP/GTP exchange factor (RCC1; Bischoff and Ponstingl, 1991a
) and GTPase activating protein (RanGAP1,
or RNA1 in yeast; Bischoff et al., 1995a
; Becker et al.,
1995
) crucially determines where the importin heterodimer
can form and where it is forced to dissociate. RCC1 is a
nuclear, chromatin-bound protein (Ohtsubo et al., 1987
,
1989
) that generates RanGTP in the nucleus, whereas free
RanGTP is depleted from the cytoplasm by RanGAP1,
which is excluded from the nucleoplasm (Hopper et al.,
1990
; Matunis et al., 1996
; Mahajan et. al, 1997). Thus, low
RanGTP levels in the cytoplasm allow importin-
to bind -
,
and the high RanGTP concentration in the nuclear compartment dissociates the importin complex. The concentration of free RanGTP can, in this model, be regarded as a marker for cytoplasmic identity (low RanGTP) and nuclear identity (high RanGTP), which is "sensed" by the
Ran-binding site in importin-
.
are
shared by the mediators of the other nucleocytoplasmic
transport pathways. This is emphasized by the recent identification of the importin-
-related transportin (Pollard et al.,
1996
) as an import receptor recognizing the M9 domain,
the nuclear targeting signal in hnRNP A1 (Michael et al.,
1995
), and of yeast transportin (Kap 104p) as an import receptor for mRNA binding proteins (Aitchison et al., 1996
).
Furthermore, importin-
or its NPC-binding domain cross-compete with other pathways, such as M9-dependent import, NES-mediated nuclear export, and the export of
mRNA and U snRNA (Kutay et al., 1997
). This would suggest that these other transport receptors share at least some
binding sites at the NPC and take a similar path through
the nuclear pore complex as importin-
.
, a number of other Ran-binding proteins are detectable in eukaryotic cells, e.g., in overlay blots using Ran
-[32P]GTP as a probe. These can be
grouped into two classes (Lounsbury et al., 1994
, 1996
):
first, those with a RanBP1 homology domain including the
Ran binding protein 1 (RanBP1) itself (Coutavas et al.,
1993
; Bischoff et al., 1995b
) and the nuclear pore protein RanBP2, which has four RanBP1 homology domains (Wu
et al., 1995
; Yokoyama et al., 1995
). Their binding to Ran
can be competed by RanBP1. Second, importin-
and so
far unidentified protein(s) of ~120 kD whose Ran-binding
is competed by importin-
but not by excess of RanBP1
(Lounsbury et al., 1994
, 1996
). Both RanBP1 and importin-
inhibit the nucleotide exchange on RanGTP (Coutavas et al., 1993
; Lounsbury et al., 1994
, 1996
; Bischoff et al.,
1995b
; Görlich et al., 1996b
). However, they do not cross-compete with each other for Ran binding but instead bind
to different, nonoverlapping sites on Ran (Chi et al., 1996
;
Kutay et al., 1997
; Lounsbury and Macara, 1997
). Another
striking difference is that RanBP1 facilitates the activation
of Ran's GTPase by RanGAP1 (Beddow et al., 1995
; Bischoff et al., 1995b
), whereas the importin-
/RanGTP complex is entirely GAP resistant (Floer and Blobel, 1996
;
Görlich et al., 1996b
).
; Sazer, 1996
). One could argue that these effects are all secondary
consequences from an impaired NLS-dependent protein
import. However, it is also possible that these defects are
more direct and that eukaryotic cells contain many immediate targets of Ran function.
an NH2-terminal
sequence motif that appears to account for RanGTP binding. Indeed we could confirm the interaction with Ran for
the following factors: RanBP7 and RanBP8, two novel, related proteins described here, Cse1p, a cell cycle regulator in yeast, CAS, which is required for apoptosis in cultured
human cells, and for Msn5p and Pse1p from yeast. Of these
we have characterized RanBP7 and RanBP8 in more detail.
Both resemble closely importin-
in their interaction with
Ran, and both bind directly to nuclear pore complexes.
RanBP7 can cross the nuclear membrane rapidly and in
both directions. We provide evidence for a transport cycle in which RanBP7 first enters the nucleus, binds RanGTP
inside the nucleus as a prerequisite for rapid re-export to
the cytoplasm, after which the RanBP7/RanGTP complex
becomes finally disassembled by the concerted action of
RanBP1 and RanGAP1 in the cytoplasm. We propose that
during these transport cycles, RanBP7 would normally carry an as yet unidentified cargo. This means, RanBP7
and possibly also the other members of the RanBP7/Cse1p/
importin-
superfamily could function as transport receptors that shuttle between nucleus and cytoplasm. RanBP7
and importin-
form an abundant, heterodimeric complex
in the cytoplasm that appears to have a function different from nuclear import of proteins with a classical NLS. It
might be a way to regulate either RanBP7 or importin-
function. Alternatively, the RanBP7/importin-
complex
might constitute an import receptor with a substrate specificity different from that of the importin-
/
complex.
Materials and Methods
) had
been prebound. The nonbound fraction was removed, and the beads were
washed six times in binding buffer plus 0.005% digitonin, including a 1-h
wash step. Bound proteins were eluted with 1 M magnesium chloride plus
50 mM Tris/HCl, pH 7.5, and precipitated with 90% isopropanol (final).
For sequence analysis, the purification was scaled up 50 times and performed in a column mode. The bound proteins were separated on an SDS gel and visualized by Coomassie staining. The RanBP7 band was excised
and digested with trypsin. Peptides were separated by HPLC, and several
peaks were sequenced. Analysis of human RanBP7 was essentially the same,
except that a 50 µg/ml digitonin extract from HeLa cells (for small scale)
or a HeLa extract prepared by mild sonication (large scale) was used as the
starting material. The binding to the BSA-NLS conjugate has been described previously (Görlich et al., 1996a
). The other analytical binding assays were performed analogous to the small-scale binding described above. Material bound to z-importin-
or z-RanBP7 was eluted with SDS instead of
magnesium chloride. Additional modifications are described in the legends.
, importin-
, and Ran have been described before (Görlich et al.,
1995
b
).
) that was
subsequently shown to code for the NH2 terminus of human RanBP8. The
sequence information of the complete coding region of RanBP8 was obtained by 3
race (Primer: GGATGAAGAGCTGTGGCAAGAAGATCC and Oligo dT18) using KlenTaq enzyme (Clontech Laboratories, Palo Alto, CA) and a human cDNA as a template. The human cDNA was prepared from HeLa cell mRNA using the direct mRNA kit (OligoTex; Qiagen) and a cDNA synthesis kit (Great Length cDNA Kit; Clontech Laboratories).
). Database searches with the Blast series of programs (Altschul et al., 1994
) revealed significant similarity with RanBP8 (described
in this paper), Nmd5p, D9509.15p, HRC1004p (an open reading frame from
S. cerevisiae), CAS (Brinkmann et al., 1995
), Cse1p (Xiao et al., 1993
), and
Lph2p. These were aligned using Clustal W (Thompson et al., 1994
) and
Macaw (Schuler et al., 1991
). The most significant blocks accumulated in
the first 150 residues of these proteins. To identify more distant members of this new family, iterative profile searches (Birney et al., 1996
; Bork and
Gibson, 1996
) were performed based on an alignment of the conserved
NH2-terminal region. New members of this emerging family were accepted and incorporated into the profile for the next iteration when (a)
their scores were higher than 5,000, (b) they were clearly separated from
the first false positive, and (c) when the profile matched the NH2 terminus
of the respective sequence. Each newly identified member was subjected
to reciprocal database searches (Bork and Gibson, 1996
). This procedure
left several putative homologues in the "twilight zone" of the profile search method applied (Birney et al., 1996
) and the superfamily described
here might be even larger.
,
L38951; S. cerevisiae importin-
, U19028; S. cerevisiae HRC1004, S53939;
human RanBP5, Y08890; S. cerevisiae Pse1p, P32337; S. cerevisiae Crm1p,
P30822; S. cerevisiae Mtr10p, U55020; C. elegans C49h3.7, U42436; S. cerevisiae Los1p, P33418; S. cerevisiae Msn5p, X93302; C. elegans T16g12.3,
Z30317; S. cerevisiae Pdr6p, P32767, Schizosaccharomyces pombe Crm1p,
p14068, S. pombe HRC1004, z69730.
and human transportin were cloned into the T7-60 vector, Xenopus RanBP7 into T7-70. T7-60 and -70 are pQE60 and pQE70 derivatives, respectively, in which the promoter/RBS elements were replaced by
a T7 promoter and the 5
untranslated region from Xenopus
globin to
enhance translation efficiency. Labeled proteins were generated by coupled transcription/translation in the reticulocyte TNT system (Promega
Biotech, Madison, WI) for 2 h at 30°C.
).
Two internal injection controls for nuclear integrity were used: the hemoglobin from the reticulocyte lysate, and 14C-labeled BSA (Amersham
Buchler, Braunschweig, Germany) which was coinjected. The distribution
of endogenous proteins in total oocytes, nuclear, and cytoplasmic fractions was determined by SDS-PAGE followed by Coomassie staining or
Western blotting.
). The concentration of the recombinant importin-
and RanBP7 in
the injected samples was ~40 µM. The mutant RNAs used (U1
Sm,
U5
Sm) lack protein binding sites required for the nuclear reimport of
these RNAs and thus remain in the cytoplasm after export from the nucleus. U6
ss RNA is not exported and is used as an internal control for
nuclear injection.
, nucleoplasmin core domain, z-tagged IBB domain
from Xenopus importin-
(Görlich et al., 1996a
), NTF2 (Kutay et al., 1997
),
Ran, RanBP1, and S. pombe Rna1p (Bischoff et al., 1995a
,b
). z-Tagged
RanBP1 was expressed from the zz60 vector and purified via a COOH-terminal his-tag. RanQ69L was expressed from pQE32 (Qiagen) and purified on nickel-NTA agarose (Qiagen), and after nucleotide exchange for
GTP, RanQ69L was concentrated on SP Sepharose FF (Pharmacia,
Uppsala, Sweden). For transport studies, S. pombe Rna1p was expressed
from pQE60 or zz60, and its enzymatic activity was verified by a GAP assay. For some experiments, importin-
was expressed with an NH2-terminal z-tag and purified on an IBB domain coupled to sulfoLink, followed
by gel filtration on Superdex 200 (Pharmacia). RanBP7 and RanBP8 were
expressed with COOH-terminal his-tags from the pQE70 and pQE60 vectors, respectively. For some experiments two z-domains were fused to their NH2 termini. Expression of RanBP7 and RanBP8 was in the BLR/
Rep4 strain at 15°C, and purification was on nickel agarose followed by
chromatography on MonoQ. Pse1p, Cse1p, CAS, Msn5p, and Pdr6p were
expressed with NH2-terminal z-tags.
has been described before (Kutay et al., 1997
).
RanBP7 and transportin were labeled with fluorescein 5
maleimide as
follows: the recombinant proteins were purified on nickel agarose and
MonoQ, omitting DTT and mercaptoethanol during the MonoQ step. The
protein concentration was estimated from the UV absorbance at 280 nm
(Edelhoch, 1967
) and fluorescein 5
maleimide, dissolved in dimethylformamide, and was added at a 1:1 molar ratio. The reaction was allowed to
proceed for 4 h on ice, quenched with 50 mM mercaptoethanol, and the labeled proteins were purified on a Superdex 200 HR column equilibrated
in 20 mM Hepes/KOH, 80 mM potassium acetate, 3 mM magnesium acetate. Human IgG was labeled with Fluos (Boehringer Mannheim, Mannheim, Germany) and purified on Superdex 200.
,b
). The binding
buffer contained 20 mM Hepes/KOH, pH 7.5, 140 mM potassium acetate,
4 mM magnesium acetate, 1 mM DTT, 250 mM sucrose, and 2 mg/ml nucleoplasmin core, 2 mg/ml BSA, plus 1 mg/ml aprotinin to block nonspecific binding, 1.5 µM Ran (GDP form), 150 nM RanBP1, 150 nM Rna1p,
150 nM NTF2, and an energy-regenerating system containing 0.5 mM
GTP and ATP, 10 mM creatine phosphate, and 50 µg/ml creatine kinase.
Binding to the NPC was allowed for 10 min at room temperature. The
other details are given in the legend. The nuclei were fixed with paraformaldehyde/glutaraldehyde, spun onto coverslips, and analyzed by confocal microscopy.
-[32P]GTP, GTPase, and nucleotide exchange assays were performed as described (Bischoff et al., 1994
, 1995b
; Görlich
et al., 1996b
; Kutay et al., 1997
). The reactions were performed in 20 mM
Hepes/KOH, pH 7.4, 100 mM NaCl, 1 mM MgCl2, 1 mM sodium azide,
0.05% hydrolyzed gelatin.
,
1996
) with some modifications. Briefly, proteins were separated by SDS-PAGE and transferred onto nitrocellulose. The blot was then incubated
for 1 h at 4°C in renaturation buffer containing 20 mM MOPS, pH 7.1, 100 mM sodium acetate, 5 mM magnesium acetate, 5 mM dithiothreitol,
0.5% bovine serum albumin, 0.05% Tween 20, and subsequently for 30 min at 25°C in renaturation buffer plus 100 µM unlabeled GTP (10 ml total volume). After 10 min, 100 µl of 1 nM Ran
-[32P]GTP was added
alone or with either 5 µM RanBP1 or importin-
. After a further 10 min
the blot was washed five times in renaturation buffer and subjected to autoradiography at
70°C. Overlays with Gsp1p were performed the same
way as with Ran.
Results
to which the
subunit binds with high affinity. At high salt concentrations, importin-
appears to bind from a complete cytosol
as a single polypeptide to an immobilized IBB domain
(Görlich et al., 1996a
,b
). At more physiological ionic
strength (200 mM), however, a second band of 120 kD
copurifies reproducibly (Fig. 1 A, lane 2). The binding of
importin-
and the 120-kD protein to the IBB domain is
highly specific by a number of criteria. First, binding requires a functional IBB domain (not shown). Second, the
binding of both polypeptides is sensitive to RanGTP.
RanGTP binds to importin-
and thereby prevents interaction with importin-
or the IBB domain. We used here
the GTPase-deficient RanQ69L mutant which remains in
its GTP-bound form, even in the presence of the cytoplasmic RanGAP1 (Klebe et al., 1995
). If 10 µM RanQ69L
GTP was added to the starting material, neither importin-
nor the 120-kD protein was recovered in the bound fraction (Fig. 1 A, lane 3). Third, binding is competed by excess
of the nonimmobilized IBB domain (Fig. 1 B, lane 4). For
reasons detailed below, we will refer to the 120-kD protein as Ran binding protein 7 (RanBP7). To facilitate further
analysis, we obtained partial peptide sequences from
RanBP7, used this information to clone the corresponding
gene from a Xenopus oocyte cDNA library, and expressed
RanBP7 in Escherichia coli. The RanBP7 sequence and its
homologies to other proteins are discussed below.
Fig. 1.
A 120-kD Ran-binding protein copurifies with importin-
. (A) A Xenopus egg extract (high speed supernatant, lane 1)
was subjected to binding to an immobilized IBB domain at 200 mM
NaCl. The starting material (lane 1) and the bound fractions (lanes
2-4) were analyzed by SDS-PAGE followed by Coomassie staining. Two bands are specifically recovered in the IBB-bound fraction, importin-
, and a copurifying 120-kD protein that is referred to here as RanBP7. Note, the addition of 10 µM RanQ69L
GTP or nonimmobilized IBB competitor (50 µM) prevent binding of both importin-
and RanBP7 (lanes 3 and 4, respectively).
(B) RanBP7 was expressed in E. coli. A lysate was prepared and
subjected to binding to an IBB column or to an IBB column to
which importin-
had been prebound. The starting material and
the bound fractions were analyzed by SDS-PAGE followed by Coomassie staining. Note, binding of RanBP7 to the IBB domain is via importin-
. (C) A digitonin (50 µg/ml) extract from HeLa cells was prepared and bound to an immobilized IBB domain as
in A. Analysis was by Coomassie staining and by immunoblotting
with affinity purified antibodies raised against RanBP7, importin-
, importin-
(Rch1p), and Ran. Again, two bands were recovered
specifically in the bound fraction: importin-
and a 120-kD protein that cross-reacts with the anti-Xenopus RanBP7 antibody. (D)
A blot of HeLa cell extract and the corresponding IBB-bound
fraction (as in C) was probed with a RanBP1/Ran
-[32P]GTP complex, followed by autoradiography. In the IBB-bound fraction, both importin-
and RanBP7 give a strong signal. In the crude lysate, importin-
and a double band of 120 kD is detected. The latter consists probably of several Ran-binding proteins, in addition to RanBP7.
[View Larger Version of this Image (40K GIF file)]
on
an IBB column can be explained in two ways. First, importin-
and RanBP7 could each bind independently to the
IBB domain, or, secondly, RanBP7 could bind via importin-
. To distinguish between these possibilities, we subjected a lysate from E. coli expressing RanBP7 to binding
to an IBB column. As seen from Fig. 1 B, RanBP7 was recovered in the bound fraction only when importin-
was
added. Thus, RanBP7 binds to the IBB domain via importin-
and is therefore an importin-
binding protein.
can be purified on an immobilized IBB domain from a HeLa cell extract in the same way as from an egg extract (Fig. 1 C). The identity of the
copurifying 120-kD polypeptide was verified in two ways:
by Western blotting using affinity purified anti-RanBP7
antibodies and by peptide sequencing of the 120-kD band,
where all 52 residues of obtained partial sequence
matched human RanBP7 (not shown).
;
Lounsbury et al., 1994
, 1996
). These Ran-binding proteins
fall into two classes. The first class includes those containing a RanBP1 homology domain whose Ran binding is
competed by RanBP1, i.e., RanBP1 itself (23 kD; Coutavas et al., 1993
), and RanBP2 (358 kD; Wu et al., 1995
;
Yokoyama et al., 1995
). In contrast, the signals of the second class comprising 90- and 120-kD bands cannot be competed with RanBP1. The signal is even further enhanced
when the blot is probed with the RanBP1/RanGTP complex (Lounsbury et al., 1996
; Kutay et al., 1997
). The 90-kD band corresponds to importin-
and is recovered in the
IBB-bound fraction (Fig. 1 D). The 120-kD protein which
copurifies with importin-
, also gives a significant signal in
the overlay. It is therefore RanGTP binding and referred
to as Ran binding protein 7.
) and probably also RanBP8
(see below). Further candidates are RanBP4 and RanBP6
(Hartmann, E., unpublished observations), which are human homologues to the S. cerevisiae proteins Yrb4p
(Schlenstedt, G., E. Smirnova, R. Deane, J. Solsbacher, U. Kutay, D. Görlich, H. Ponstingl, and F.R. Bischoff, manuscript submitted for publication) and Pse1p, respectively.
However, of these, only RanBP7 appears to be recovered
in the IBB-bound fraction, as judged by microsequencing of the 120-kD band (not shown).
Interaction Appears
Unrelated to NLS-mediated Protein Import
is a key mediator of NLS-mediated
nuclear protein import, we wanted to know if it interacts
with RanBP7 to promote this process. In this case, a quaternary NLS/importin-
/
/RanBP7 complex should be the
active species. However, the experiment shown in Fig. 2 A
makes this assumption unlikely: only importin-
and -
,
but hardly any RanBP7, copurify on an immobilized BSA-NLS conjugate. Consistent with that, RanBP7 does not stimulate import of nucleoplasmin into nuclei of permeabilized
cells (not shown). One possibility would be that importin-
binds RanBP7 to modify its substrate specificity. This could
then allow the transport of cargoes that carry signals other
than a classical NLS. Alternatively, the heterodimer might
form to regulate importin-
and/or RanBP7 function.
Fig. 2.
The RanBP7-importin-
interaction is regulated by
Ran and appears unrelated to NLS-mediated nuclear protein import. (A) A Xenopus egg extract (high speed supernatant) was
bound either to an immobilized BSA-NLS conjugate or an IBB
domain. The starting material and the bound fractions were analyzed by immunoblots against RanBP7, importin-
, and -
. Note,
whereas equal amounts of importin-
were found in both bound
fractions, RanBP7 was recovered only with IBB column but hardly
at all with the NLS conjugate. (B) z-Tagged RanBP7 was prebound to IgG Sepharose and used to bind importin-
out of a Xenopus egg extract (z is an IgG binding domain from Straphylococcus aureus protein A). Binding was with or without the addition of
10 µM RanQ69L GTP. Starting material and bound fractions were
analyzed by immunoblotting against Ran and importin-
, but the
z-tag is also detected by this procedure. Note that importin-
but
no Ran bound to RanBP7 in the absence of RanQ69L. If however, the Ran mutant was added, importin-
binding was abolished, and instead, Ran (Q69L) was recovered in the bound fraction. (C) RanBP7 was expressed in E. coli. A lysate was prepared and subjected to binding to z-tagged importin-
that had been preabsorbed to IgG Sepharose. Elution from the beads was either with SDS, which also releases z-importin-
from the column,
or with RanQ69L GTP which dissociates RanBP7 from importin-
.
*, dimerized Ran; **, IgG light chain.
[View Larger Versions of these Images (38 + 46K GIF file)]
Complex Is Dissociated
by RanGTP
heterodimer can be formed by
binding importin-
from a Xenopus egg extract to z-tagged
RanBP7 (Fig. 2 B). In this case, binding of Ran is not observed, probably because the extract contains Ran only in
its GDP-bound form for which RanBP7 has no detectable
affinity (see below). If RanQ69L GTP that is stabilized in
the GTP-bound form is added to the starting material,
then two effects are observed. First, Ran is now recovered in the RanBP7-bound fraction, confirming RanBP7 as a
RanGTP-binding protein. Second, the formation of the
RanBP7/importin-
complex is prevented.
complex, we performed the experiment
shown in Fig. 2 C. RanBP7 was expressed in E. coli and
bound to importin-
that was immobilized on IgG Sepharose
via a z-tag. SDS elutes both RanBP7 and z-importin-
from the column. When the elution was performed with
RanGTP, z-importin-
remained matrix bound, however RanBP7 was dissociated from importin-
and recovered in
the eluate (Fig. 2 C). Thus, the RanBP7/importin-
complex does not form in the presence of RanGTP. Furthermore, a preformed complex is dissociated by RanGTP addition.
Fig. 3.
Molecular cloning of Xenopus RanBP7 and human
RanBP8 and their similarities to S. cerevisiae Nmd5p. Xenopus
RanBP7 was cloned from an oocyte library using partial peptide
sequence information from the purified protein. RanBP8 was
found in the data base as an expressed human sequence tag similar to RanBP7 and was subsequently cloned from HeLa cDNA.
Shown are the aligned amino acid sequences from Xenopus
RanBP7, human RanBP8, and S. cerevisiae Nmd5p. Residues identical in all three proteins are indicated by #, and similar amino acids by *. The sequence data for Xenopus RanBP7 and
human RanBP8 are available from GenBank/EMBL/DDBJ under accession numbers U71082 and U77494, respectively.
[View Larger Version of this Image (95K GIF file)]
) revealed significant similarity of RanBP7
and RanBP8 to S. cerevisiae Nmd5p (26% identity; Fig. 3),
S. cerevisiae D9509.15p, and a number of further proteins
of similar length, i.e., 95-130 kD. In the multiple alignment
of these sequences (Schuler et al., 1991
; Thompson et al.,
1994
) the most significant blocks were found within the
NH2-terminal 150 residues of each protein.
; Bork and Gibson, 1996
) were performed based on an alignment of the
conserved NH2-terminal region (for details see Materials
and Methods section). The results of the procedure are
shown in Fig. 4 A. They included more than 20 sequences
from different eukaryotes, such as human and yeast importin-
, S. cerevisiae Cse1p, human CAS, S. cerevisiae
Crm1p, Nmd5p, etc. This protein superfamily consists of
several subgroups, as indicated in Fig. 4 B. The cellular
functions attributed to these proteins appear very diverse,
but it is possible that all relate to nuclear function. For example, importin-
is the key mediator of NLS-dependent
nuclear protein import, while Cse1p has been shown to be
required for the destruction of B-type cyclins in the yeast
nucleus (Irniger et al., 1995
), and human CAS appears to
be required for cell proliferation and apoptosis (Brinkmann et al., 1995
). Mtr10 was found in a genetic screen for
mutants defective in mRNA export from the yeast nucleus
(Kadowaki et al., 1994
). We reasoned that the common sequence motif in these proteins might relate to a common
function.
Fig. 4.
The RanBP7/importin-
/Cse1p superfamily. (A) Multiple alignment of amino acids 6-141 from RanBP7 with the NH2 termini
of other proteins that have a similar NH2-terminal sequence motif. Positions in red match the consensus. The consensus was defined by
the two most frequent amino acids in each position. Proteins named in blue have been shown to bind Ran (see main text and Fig. 5). S. pombe Crm1p and HRC1004 also match the motif but are not shown in the figure. (For accession numbers see Materials and Methods.) (B) Relationship between the proteins shown in A. The tree was calculated from the entire coding sequences and not just from the NH2
termini. Proteins named in red have been shown to bind RanGTP (see also below).
[View Larger Versions of these Images (96 + 19K GIF file)]
Fig. 5.
Human CAS and the yeast proteins Pse1p, Cse1p, and
Msn5p are Ran (Gsp1p) binding. Indicated proteins were expressed in E. coli, and the total lysates were separated by SDS-PAGE and transferred onto nitrocellulose. The blot in A was
probed with 10 pM Ran
-[32P]GTP in the presence of a 5,000-fold molar excess of RanBP1, followed by autoradiography. The
negative control was a lysate from E. coli expressing importin-
.
The blots in B were probed with 10 pM Gsp1p
-[32P]GTP
(Gsp1p is Ran from S. cerevisiae). The negative control was importin-
, as in A. Pse1p 1-257 and Pse1p 1-409 are fragments of
Pse1p comprising of the NH2-terminal 257 or 409 residues.
Msn5p was expressed as an NH2-terminal fragment comprised of
the NH2-terminal 682 residues.
[View Larger Version of this Image (66K GIF file)]
. We recently mapped the Ran binding domain
in importin-
to the NH2-terminal 364 residues (Kutay et al.,
1997
). The NH2-terminal region from the profile search appears to constitute the conserved core of this domain. That
the experimentally found Ran binding domain is larger
than the stretch of conserved amino acids can be explained
with the need for folding to bring the key residues into the
proper spatial position. The conservation profile suggests that these proteins might be targets of Ran function. In
this case one would not only predict that proteins like Pse1p
and Cse1p bind Ran (or Gsp1p, the yeast Ran, respectively; Belhumeur et al., 1993
) but also that the interaction
is mediated by the NH2 termini of these proteins. To test
the predictions for at least some of the candidates, we expressed human CAS and the yeast proteins Pse1p, Cse1p,
Msn5p, and Pdr6p in E. coli, separated the lysates by SDS-PAGE, transferred the proteins onto nitrocellulose, and probed for Ran interaction using Ran (or yeast Gsp1p)
charged with labeled GTP as a probe.
-[32P]GTP in the presence
of a 5,000-fold excess of RanBP1. This procedure detects
Ran-binding proteins of the importin-
type but not Ran binding proteins like RanBP1 or RanBP2. As seen from
Fig. 5 A, a control lysate expressing importin-
which does
not bind Ran, is negative, but the recombinantly expressed
CAS protein gives a positive signal, just as importin-
. The
CAS-RanGTP interaction is strongly competed by importin-
(not shown). Thus, human CAS binds RanGTP in a
similar way as importin-
.
) and NH2-terminal fragments of Pse1p from S. cerevisiae using
-[32P]GTP loaded Gsp1p, the Ran homologue of S. cerevisiae. Fig. 5 B shows that full length Pse1p
and its 409 NH2-terminal amino acids are positive in this
Ran-binding assay. The binding is specific, as it is only observed with the GTP form of Gsp1p and is competed by
yeast importin-
(not shown). The NH2-terminal 257 residues, however, are not sufficient to give a significant signal. Thus, the Gsp1 (Ran)-binding domain of yeast Pse1p
maps approximately as the Ran binding domain of importin-
(the NH2-terminal 364 amino acids are required for
Ran binding). The same figure also demonstrates the
Gsp1p binding activity of S. cerevisiae Cse1p (Xiao et al.,
1993
) and Msn5p (ACC X93302), whereas Pdr6p (Chen et al., 1991
), which also came up in the profile search (Fig. 4), and the control lysates gave no signal.
;
Bischoff et al., 1994
, 1995a
; Becker et al., 1995
; Klebe et al.,
1995
). The major GTPase activating protein is cytoplasmic
RanGAP1 (Rna1p in yeast); the principal GTP/GDP exchange factor is RCC1.
(Floer and Blobel, 1996
; Görlich et al., 1996b
),
the GAP stimulation of the Ran GTPase. From the dose
dependence one can estimate the affinities of these factors
for RanGTP. The dissociation constant from RanGTP is ~25
nM for RanBP7, 4 nM for RanBP8, and 0.8 nM for importin-
, measured under identical conditions. It should be
noted that RanBP7 and RanBP8 also inhibit the intrinsic
GTPase activity of Ran (not shown).
Fig. 6.
Enzymatic interactions of RanBP7 and
RanBP8 with Ran. (A)
RanBP7 and RanBP8 inhibit
GAP induction of GTPase
activity of Ran. 50 pM Ran
-[32P]GTP was preincubated for 30 min with the indicated concentrations of importin-
, RanBP7, and
RanBP8. 5 nM Rna1p (RanGAP from S. pombe) was
added, and GTP hydrolysis
was allowed for 5 min. Hydrolysis of Ran-bound GTP
was measured as released
-[32P]phosphate. When using a very low Ran concentration as in this experiment, the
method can be used to estimate the KD of the Ran-binding proteins for RanGTP.
These are ~0.8, 25, and 3 nM
for importin-
, RanBP7, and
RanBP8, respectively. (B)
Effect of RanBP8 on guanine nucleotide exchange on Ran.
30 pM Ran
-[32P]GDP or 50 pM Ran
-[32P]GTP were
preincubated for 30 min with
indicated concentrations of
RanBP8. The exchange reaction was started by addition
of 0.2 mM unlabeled GDP
plus 2 nM of the exchange
factor RCC1. After 5 min,
Ran-bound 32P-labeled nucleotide was measured in a
filter binding assay. Note, RanBP8 inhibits nucleotide
exchange on RanGTP but not on RanGDP. (C) RanBP7 can form a trimeric RanBP7/RanGTP/RanBP1 complex. z-Tagged RanBP1 was
prebound to IgG Sepharose. A RanBP7 lysate was subjected to binding to either immobilized RanBP1 alone or to an immobilized RanBP1/RanGTP complex. Elution was with SDS, which also releases the z-RanBP1 from the IgG Sepharose. Note, RanBP7 does not
bind to RanBP1 alone, but it is specifically recovered with the RanBP1/RanGTP complex. *, IgG light chain that leaked from the column. (D) The GAP resistance of the RanBP7/RanGTP and the RanBP8/RanGTP complex is relieved by RanBP1. 100 nM RanGTP
was preincubated for 30 min with indicated concentrations of RanBP7 or RanBP8. Buffer or 200 nM RanBP1 were added, followed immediately by 200 nM Rna1p. GTP hydrolysis was allowed for 5 min and measured as in A.
[View Larger Version of this Image (40K GIF file)]
(Görlich et al., 1996b
) in this assay.
, RanBP7 and RanBP8 can each form a
trimeric complex with RanGTP and RanBP1. These complexes are evident by gel filtration (not shown) or by affinity
chromatography. For example, Fig. 6 C shows that RanBP7
can bind via RanGTP to immobilized RanBP1. RanBP1
has a striking effect on both the RanBP7/RanGTP and the
RanBP8/RanGTP complex in that it relieves their GAP
resistance (Fig. 6 D). RanBP1 is thus a cofactor for the disassembly of these complexes. This might well be one in
vivo function of RanBP1. It should be noted that the one
clear difference between importin-
and RanBP7/8 is that
the RanBP1/RanGTP/importin-
complex is still GAP resistant (Görlich et al., 1996b
), and its disassembly requires at least one additional factor (Bischoff, F.R., unpublished
results).
, we translated RanBP7 in vitro in the
presence of [35S]methionine and injected the mixture into
nuclei of Xenopus oocytes. We used two internal controls
for nuclear integrity, the hemoglobin from the reticulocyte
lysate, which is not exported and clearly visible in the injected nuclei (not shown), and 14C-labeled BSA ("injection
control"). After 5 or 90 min, the oocytes were dissected
into nuclear and cytoplasmic fractions, which were analyzed for the presence of the labeled proteins. As seen from Fig. 7 A, RanBP7 is rapidly exported from the nuclei, and
a significant proportion reached the cytoplasm already after 5 min. After 90 min the steady state distribution was
reached in which 90-95% of RanBP7 is cytoplasmic.
Fig. 7.
Characterization of RanBP7 transport between nucleus
and cytoplasm. (A) RanBP7 was translated in the reticulocyte
system in the presence of [35S]methionine and mixed with
[14C]BSA, which served as an injection control. The mixture was
then injected into Xenopus laevis oocyte nuclei either alone or together with 40 µM Rna1p, or with Rna1p and 80 µM RanQ69L.
Proteins were extracted 5 or 90 min after injection. T, C, and N,
indicate proteins extracted from total oocytes or after dissection
from cytoplasmic or nuclear fractions, respectively. Proteins were
analyzed by SDS-PAGE followed by fluorography. (B) Nuclei
of Xenopus oocytes were injected either with buffer (control), or
10 µM Rna1p. Oocytes were dissected 6 h later, and the distribution of endogenous proteins was analyzed by SDS-PAGE followed by Coomassie staining, or by Western blotting with
RanBP7 and importin-
antibodies. In the control, RanBP7 and
importin-
are predominantly cytoplasmic. Nearly 50% of RanBP7
and ~20% of importin-
accumulated in the nucleus, after nuclear Rna1p injection that inhibits re-export of RanBP7 and importin-
. *, Hemoglobin from the injection control. Rna1p stays
nuclear after nuclear injection as judged by Western blotting (not
shown).
[View Larger Versions of these Images (21 + 84K GIF file)]
(Fig. 2, B and C), we can also exclude that RanBP7 is exported by importin-
.
. This is consistent
with data in S. cerevisiae (Koepp et al., 1996
) showing that
SRP1p (yeast importin-
) accumulates in the nucleus if
Prp20p (yeast nucleotide exchange factor for Ran) is defective, which probably also causes a decrease in the nuclear RanGTP concentration. This would suggest that the
export of importin-
and RanBP7 requires a higher nuclear RanGTP concentration than their import.
(as a positive
control) or with z-RanBP7. The binding of the z-tagged
proteins was visualized with fluorescent IgG added to the
import reaction. Fig. 8 shows the fluorescent staining as recorded with a confocal microscope. Strikingly, when z-importin-
or z-RanBP7 were present, the typical NPC staining
pattern was observed.
Fig. 8.
RanBP7 and RanBP8 bind to nuclear pore complexes.
(A) Permeabilized cells were incubated as indicated with 300 nM
z-tagged importin-
, RanBP7, or RanBP8 and with 300 nM or
~3 µM untagged importin-
. z-Tagged proteins were visualized
with 300 nM fluorescein-labeled human IgG added to the import
assay. Ran and an energy mix were also added. Shown are confocal sections through the equators of the fixed nuclei. Note, z-importin-
, z-RanBP7, and z-RanBP8 give the typical nuclear pore
staining pattern of narrow, punctate rims. NPC binding of RanBP7
and RanBP8 is competed by untagged importin-
, and a fluorescent signal is only observed in the cytoplasmic remnants surrounding the nuclei.
[View Larger Version of this Image (25K GIF file)]
. In the latter case, the RanBP7-NPC
interaction should be importin-
dependent. Permeabilized cells still contain endogenous importin-
, however
only 10-20% of the available importin-
binding sites at
the NPC are occupied by the endogenous protein (Görlich et al., 1995
). If RanBP7 binding to the NPC would be strictly importin-
dependent, it should be stimulated by exogenous importin-
. However, NPC binding of z-RanBP7 was
not increased but even lower if a 1:1 complex with nontagged importin-
was preformed and completely competed by a 10-fold excess of importin-
. Fig. 8 also shows that RanBP8 is NPC binding, and again, this binding is
competed by excess of importin-
.
but directly and to the same sites as importin-
. However, the interpretation of the competition is
somewhat complicated by the fact that at least 3 species have
to be considered, RanBP7, importin-
, and the dimeric
complex of the two. We therefore wanted to know if a
transport receptor with no affinity for RanBP7 would also
compete with RanBP7 for NPC binding.
does not bind to itself or to
transportin but binds strongly to RanBP7 and about four
times less efficiently to RanBP8. Transportin, in turn, has
no detectable affinity for either importin-
or RanBP7. We
therefore chose transportin for the next competition experiment, in which importin-
, transportin, and RanBP7
were each directly fluorescein labeled and subjected at 30 nM
to NPC binding. Importin-
was the positive control in this
experiment. Transportin also showed a clear NPC binding
(it should be noted that transportin accumulates inside the
nuclei if added at a higher concentration, probably because it then saturates its own export out of the nucleus).
Strikingly, the transportin signal at the nuclear envelope
could be competed by unlabeled RanBP7. Fluorescent
RanBP7 gave a very clear nuclear pore staining, which could
be competed by unlabeled RanBP7 itself or by transportin.
Fig. 9.
Interactions between RanBP7, RanBP8, importin-
, and transportin. Importin-
and transportin
were translated in a reticulocyte lysate in the presence of
[35S]methionine. 200 nM
z-tagged importin-
, RanBP7,
RanBP8, or transportin were
added as indicated, and complexes were allowed to form,
which were subsequently recovered with IgG Sepharose.
The control binding was
without a z-tagged protein.
An immobilized M9 domain
(the import substrate of transportin) was the positive control for transportin binding.
[View Larger Version of this Image (20K GIF file)]
mutants or excess of wild-type importin-
inhibit mRNA and U snRNA export, probably by saturating common binding sites at the nuclear
pore complex (Kutay et al., 1997
). Fig. 11 shows that RanBP7
also competes mRNA and U snRNA export, most likely at
the level of NPC binding. As for importin-
, the export of
tRNA is not affected at this concentration.
Fig. 11.
mRNA and U snRNA export are competed by importin-
or RanBP7. Xenopus laevis oocyte nuclei were injected with
buffer or 40 µM of importin-
or RanBP7 (as indicate above the
lanes) together with a mixture of the following radioactively labeled
RNAs: DHFR mRNA, histone H4 mRNA, U1
Sm, U5
Sm,
U6
ss, and human initiator methionyl tRNA. U6
ss does not
leave the nucleus and is an internal control for nuclear integrity.
Synthesis of DHFR, histone H4, U1
Sm, and U5
Sm RNAs was
primed with the m7GpppG cap dinucleotide, whereas synthesis of
U6
ss RNA was primed with
-mGTP. RNA was extracted either 5 or 150 min after injection and detected by electrophoresis,
followed by autoradiography.
[View Larger Version of this Image (72K GIF file)]
Discussion
; Sazer, 1996
). However, with the exception of the importin-dependent transport pathway, no immediate targets of Ran function have
been reported so far. We have now identified a novel class
of RanGTP binding proteins, which includes to date about
20 proteins from various eukaryotes. The members of this
protein superfamily share the following structural features: (a) a common NH2-terminal sequence motif; (b) a
similar large size of 90-130 kD; (c) a similar isoelectric
point ~4.6 (ranging from 4.3-5.4); and (d) predicted secondary structures with extensive helical regions. In addition, at least some of them have a clear internal repeat
structure (Andrade and Bork, 1995
). Whether or not this
applies to all members is currently under investigation.
proteins
superfamily (Fig. 4, and Fornerod et al., 1997
) can be
grouped roughly into families as follows: (a) importin-
-like
proteins including Yrb4p and Pse1p from yeast and RanBP5
from human. (b) A family represented by Los1p and (c)
Crm1p from yeast and human. (d) A family including Msn5p,
Mtr10p, and HRC1004p, and finally (e) Cse1p-like proteins such as CAS, RanBP7, RanBP8, D95009.15p, and Nmd5p. Except for the NH2-terminal sequence motif, there
is not much homology between these groups of proteins.
, the conserved NH2-terminal region is essential for RanGTP binding (Görlich et al., 1996b
; Kutay
et al., 1997
). The presence of this motif in the other members of the superfamily would suggest that they interact
with RanGTP as well. This is indeed the case for at least
RanBP7, RanBP8, CAS, Pse1p, Msn5p, Cse1p (Figs. 1, 2
B, 5, and 6), RanBP5 (Deane et al., 1997
), and Yrb4p
(Schlenstedt, G., E. Smirnova, R. Deane, J. Solsbacher, U. Kutay, D. Görlich, H. Ponstingl, and F.R. Bischoff, manuscript submitted for publication). From the tested proteins
in Fig. 5, only Pdr6p (Chen et al., 1991
) appears negative
for Ran interaction. This might indicate a limitation in the
assays employed, or it might mark the border line for the
significance of the profile in Fig. 4 A. On the other hand,
not all Ran-binding proteins of this kind are covered by
the consensus in Fig. 4 A. For example, transportin does
not match the consensus, although it shows otherwise good
overall homology with importin-
, functions similarly as importin-
(Pollard et al., 1996
), and also binds Ran (Bischoff, F.R., S. Nakielny, and G. Dreyfuss, unpublished results).
protein superfamily is distinct from the family of Ran-binding proteins with a RanBP1 homology domain. The
two Ran-binding motifs are unrelated in sequence, their
effects on the GTPase are different, and their binding sites
on Ran are distinct and nonoverlapping (Fig. 6, and Introduction).
superfamily. This has been well established for importin-
and is shown here for RanBP7 and RanBP8. In
addition, binding to the NPC or an NPC-like cellular distribution has been demonstrated for RanBP5 (Deane et
al., 1997
), Yrb4p (Schlenstedt, G., E. Smirnova, R. Deane, J. Solsbacher, U. Kutay, D. Görlich, H. Ponstingl, and F.R.
Bischoff, manuscript submitted for publication), human
Crm1p (Fornerod et al., 1997
), Los1p (Simos et al., 1996
),
and Cse1p (cited in Irniger et al., 1995
). The potential to
interact with both Ran and the NPC would suggest that
transport across the nuclear envelope might be a common
function of this superfamily of proteins. Each of the candidates might represent one distinct transport pathway, and
the task for the future will be to identify their cargoes.
and importin-
fragments cross-compete with other major nucleocytoplasmic transport pathways such as M9-mediated import and the export of NES containing proteins, mRNA,
and U snRNA (Kutay et al., 1997
). This supports the view
that the mediators of these pathways function similarly to
importin-
, probably take a similar path through the NPC,
and share at least some of the intermediate binding sites.
Here we show that RanBP7 cross-competes with mediators of mRNA and U snRNA export as well. Furthermore,
we observed a direct competition for binding to the nuclear pore complex between RanBP7, importin-
, and
transportin. Thus, also by this criterion, RanBP7 behaves like a shuttling transport receptor.
. Although the affinity of
RanBP7 for RanGTP is lower than that of importin-
, it
is still in a physiological range. The KD of the RanBP7/
RanGTP complex is, with ~25 nM, still far below the cellular Ran concentration of several µM. RanBP7 binds specifically, the GTP-bound form of Ran. As free RanGTP should be available only inside the nucleus, the RanBP7/
RanGTP complex should assemble only in this compartment. Once the RanBP7/RanGTP complex is formed, it is
remarkably stable. The offrate is ~2 h, and the low intrinsic GTPase activity of Ran is even further reduced (not
shown). Furthermore, a GTPase activation by RanGAP1 (RNA1p) is prevented, and the bound GTP is protected
against nucleotide exchange (Fig. 6).
), but at which step it functions had been obscure
so far. It is therefore an attractive possibility to assume the
physiological function of RanBP1 in the recycling of transport factors like RanBP7.
; Matunis et al., 1996
; Richards
et al., 1996
; Mahajan et al., 1997
). Assuming that RanBP7
shuttles between nucleus and cytoplasm, one therefore would predict that RanBP7 leaves the nucleus as a complex with RanGTP. In fact, RanBP7 becomes rapidly exported when injected into nuclei of Xenopus oocytes. Already after 5 min, ~20% of RanBP7 has reached the
cytoplasm. Considering the large size of a Xenopus oocyte,
this is exceedingly fast, in fact much faster than the export
of a BSA-NES conjugate and even faster than tRNA export. The export rate is significantly reduced if nuclear
RanGTP is depleted by nuclear injection of Rna1p
(RanGAP1). The block is not complete, but this is understandable considering that only 25 nM RanGTP is required for half-maximal binding to RanBP7, compared to
at least 10 µM present normally in the nucleus. Thus, to
have a significant effect, the nuclear RanGTP concentration probably has to be lowered by three orders of magnitude, counteracting the continuous RanGTP production
by RCC1. RanGTP depletion from the nucleus inhibits
RanBP7 export probably by preventing the RanBP7/
RanGTP complex formation because the export can be restored by prebinding of RanQ69L GTP (a GAP-resistant
Ran mutant) to RanBP7. This further supports the model
that RanBP7 is indeed exported as a complex with
RanGTP.
, however, we would expect the RanGTP- RanBP7 interaction to regulate substrate binding. This
would ensure that the substrate is transported in one direction only, even though RanBP7 shuttles.
form an abundant, cytoplasmic heterodimer. A weaker interaction was found also between RanBP8 and importin-
but so far not between other members of the protein superfamily. A complex between importin-
and an unidentified 120-kD protein has been reported before (Chi et al.,
1995
), which was probably identical with RanBP7 or
RanBP8. The RanBP7/importin-
heterodimer appears
not to be involved in the import of proteins with a classical
NLS. It might be a way to regulate either RanBP7 or importin-
function, to lower the concentration of free importin-
if there is only a little substrate in the cytoplasm
and therefore no need for import. Alternatively, the
RanBP7/importin-
complex might constitute an import
receptor with a substrate specificity different from that of
the importin-
/
complex. Both possibilities are currently
being tested.
superfamily have been implicated in a variety of cellular functions. For example, mtr10 was identified in a screen for defects in RNA export from the yeast nucleus (Kadowaki et al.,
1994
). Crm1p is an essential protein in yeast and has been
implicated in the maintenance of chromosome structure
(Toda et al., 1992
; Funabiki et al., 1993
). Human CAS appears to be required for cell proliferation, but lowering its
cellular levels by the moderate expression of anti-sense
RNA renders cultured cells resistant to TNF-triggered apoptosis (Brinkmann et al., 1995
). One of the most interesting proteins is, however, S. cerevisiae Cse1p. It is encoded
by an essential gene and was originally found in a screen
for mutants defective in chromosome segregation (Xiao
et al., 1993
). Subsequently, it was shown that Cse1p is essential for the destruction of the B-type cyclin CLB2 and
thus required for progression through mitosis (Irniger et al.,
1995
). In yeast, the nuclear envelope does not break down during mitosis and cyclin CLB2 degradation takes place in
the nucleus. Our data suggest that Cse1p might be a Ran-binding transport factor that could define a novel nuclear
transport pathway. In this model, Cse1p would function in
the timely nuclear transport of a regulator or a mediator of
cyclin CLB2 degradation. At high copy number, SRP1 (yeast
importin-
) can partially suppress the phenotype of the
cold-sensitive cse1-1 allele (Xiao et al., 1993
), suggesting
that some of the Cse1p function can be taken over by the
"standard" import pathway. Interestingly, the srp1-31 mutant allele also has a cell cycle phenotype, arresting at nonpermissive temperature in G2/M (Loeb et al., 1995
). CLB2
is stabilized also in this strain compared to wild-type cells.
Fig. 10.
Transportin and
RanBP7 compete with each
other for NPC binding. Importin-
, transportin, and
RanBP7 were labeled directly with fluorescein and incubated at a concentration of
50 nM with permeabilized
cells in the presence of Ran
and an energy-regenerating system. Where indicated, the
NPC binding was competed
with 2 µM of unlabeled
RanBP7 or transportin. For
analysis, the samples were
fixed, and nuclei were spun
onto coverslips and examined by confocal fluorescence microscopy.
[View Larger Version of this Image (81K GIF file)]
.
1. Abbreviations used in this paper: GAP, GTPase activating protein; IBB, importin
binding; NLS, nuclear localization signal; NPC, nuclear pore
complex.
We wish to thank Susanne Kostka and Regine Kraft for protein sequencing, Petra Schwarzmaier for technical help, Drs. Róisín Deane, Iain W. Mattaj, and Tom A. Rapoport for critical reading of the manuscript. We
are grateful to Drs. E. Darzynkiewicz and J. Stepinski for the gift of the
7-methyl GpppG and
-methyl GTP cap analogues, and Dr. D. Schümperli for the mouse Histone H4 clone.
This work was supported by the Deutsche Forschungsgemeinschaft, the Swiss National Science Foundation (grant 3100-046841), and the State of Geneva. M. Dabrowski is a recipient of a postdoctoral fellowship from the Max-Delbrück-Zentrum für Molekulare Medizin.
| 1. | Adam, S.A., and L. Gerace. 1991. Cytosolic proteins that specifically bind nuclear location signals are receptors for nuclear import. Cell. 66: 837-847 [Medline]. |
| 2. |
Aitchison, J.D.,
G. Blobel, and
M.P. Rout.
1996.
Kap104: a karyopherin involved in the nuclear transport of messenger RNA binding proteins.
Science
(Wash. DC).
274:
624-627
|
| 3. | Altschul, S.F., M.S. Boguski, W. Gish, and J.C. Wootton. 1994. Issues in searching molecular sequence databases. Nat. Genet. 6: 119-129 [Medline]. |
| 4. | Andrade, M.A., and P. Bork. 1995. HEAT repeats in the Huntington's disease protein. Nat. Genet. 11: 115-116 [Medline]. |
| 5. |
Becker, J.,
F. Melchior,
V. Gerke,
F.R. Bischoff,
H. Ponstingl, and
A. Wittinghofer.
1995.
RNA1 encodes a GTPase-activating protein specific for Gsp1p,
the Ran/TC4 homologue of Saccharomyces cerevisiae.
J. Biol. Chem.
270:
11860-11865
|
| 6. |
Beddow, A.L.,
S.A. Richards,
N.R. Orem, and
I.G. Macara.
1995.
The Ran/TC4
GTPase-binding domain: identification by expression by expression cloning
and characterizaiton of a conserved sequence motif.
Proc. Natl. Acad. Sci.
USA.
92:
3328-3332
|
| 7. |
Belhumeur, P.,
A. Lee,
R. Tam,
T. DiPaolo,
N. Fortin, and
M.W. Clark.
1993.
GSP1 and GSP2, genetic suppressors of the prp20-1 mutant in Saccharomyces cerevisiae: GTP-binding proteins involved in the maintenance of nuclear
organization.
Mol. Cell. Biol.
13:
2152-2161
|
| 8. |
Birney, E.,
J.D. Thompson, and
T.J. Gibson.
1996.
PairWise and SearchWise:
finding the optimal alignment in a simultaneous comparison of a protein
profile against all DNA translation frames.
Nucleic Acids Res.
24:
2730-2739
|
| 9. | Bischoff, F.R., and H. Ponstingl. 1991a. Catalysis of guanine nucleotide exchange on Ran by the mitotic regulator RCC1. Nature (Lond.). 354: 80-82 [Medline]. |
| 10. |
Bischoff, F.R., and
H. Ponstingl.
1991b.
Mitotic regulator protein RCC1 is complexed with a nuclear ras-related polypeptide.
Proc. Natl. Acad. Sci. USA.
88:
10830-10834
|
| 11. |
Bischoff, F.R.,
C. Klebe,
J. Kretschmer,
A. Wittinghofer, and
H. Ponstingl.
1994.
RanGAP1 induces GTPase activity of nuclear ras-related Ran.
Proc.
Natl. Acad. Sci. USA.
91:
2587-2591
|
| 12. |
Bischoff, F.R.,
H. Krebber,
T. Kempf,
I. Hermes, and
H. Ponstingl.
1995a.
Human RanGTPase activating protein RanGAP1 is a homolog of yeast RNA1p
involved in messenger RNA processing and transport.
Proc. Natl. Acad. Sci.
USA.
92:
1749-1753
|
| 13. | Bischoff, F.R., H. Krebber, E. Smirnova, W.H. Dong, and H. Ponstingl. 1995b. Coactivation of RanGTPase and inhibition of GTP dissociation by Ran GTP binding protein RanBP1. EMBO J. 14: 705-715 [Medline]. |
| 14. | Bork, P., and T. Gibson. 1996. Applying motif and profile searches. Methods Enzymol. 266: 162-184 [Medline]. |
| 15. |
Brinkmann, U.,
E. Brinkmann,
M. Gallo, and
I. Pastan.
1995.
Cloning and characterization of a cellular apoptosis susceptibility gene, the human homologue to the yeast chromosome segregation gene CSE1.
Proc. Natl. Acad.
Sci. USA.
92:
10427-10431
|
| 16. | Chen, W.N., E. Balzi, E. Capieaux, M. Choder, and A. Goffeau. 1991. The DNA sequencing of the 17 kb HindIII fragment spanning the LEU1 and ATE1 loci on chromosome VII from Saccharomyces cerevisiae reveals the PDR6 gene, a new member of the genetic network controlling pleiotropic drug resistance. Yeast. 7: 287-299 [Medline]. |
| 17. |
Chi, N.C.,
E.J.H. Adam, and
S.A. Adam.
1995.
Sequence and characterization
of cytoplasmic nuclear import factor p97.
J. Cell Biol.
130:
265-274
|
| 18. |
Chi, N.C.,
E.J.H. Adam,
G.D. Visser, and
S.A. Adam.
1996.
RanBP1 stabilizes
the interaction of Ran with p97 in nuclear protein import.
J. Cell Biol.
135:
559-569
|
| 19. |
Chow, T.,
J. Ash,
D. Dignard, and
D. Thomas.
1992.
Screening and identification of a gene, PSE-1, that affects protein secretion in Saccharomyces cerevisiae.
J. Cell. Sci.
101:
709-719
|
| 20. | Coutavas, E., M. Ren, J.D. Oppenheim, P. D'Eustachio, and M.G. Rush. 1993. Characterization of proteins that interact with the cell-cycle regulatory protein Ran/TC4. Nature (Lond.). 366: 585-587 [Medline]. |
| 21. | Dasso, M.. 1993. RCC1 in the cell cycle: the regulator of chromosome condensation takes on new roles. Trends Biochem. Sci. 18: 96-101 [Medline]. |
| 22. | Deane, R., W. Schäfer, H.-P. Zimmerman, L. Mueller, D. Görlich, S. Prehn, H. Ponstingl, and F.R. Bischoff. 1997. Ran-binding protein 5 (RanBP5) is related to the nuclear transport factor importin- but interacts differently with
RanBP1. Mol. Cell. Biol. In press.
|
| 23. |
Dingwall, C., and
R.A. Laskey.
1991.
Nuclear targeting sequences a consensus?
Trends Biochem. Sci.
16:
478-481
[Medline].
|
| 24. |
Drivas, G.T.,
A. Shih,
E. Coutavas,
M.G. Rush, and
P.D'Eustachio.
1990.
Characterization of four novel ras-like genes expressed in a human teratocarcinoma cell line.
Mol. Cell. Biol.
10:
1793-1798
|
| 25. | Edelhoch, H.. 1967. Spectroscopic determination of tryptophan and tyrosine in proteins. Biochemistry. 6: 1948-1954 [Medline]. |
| 26. |
Feldherr, C.M.,
E. Kallenbach, and
N. Schultz.
1984.
Movement of karyophilic
protein through the nuclear pores of oocytes.
J. Cell Biol.
99:
2216-2222
|
| 27. |
Floer, M., and
G. Blobel.
1996.
The nuclear transport factor karyopherin binds stoichiometrically to Ran-GTP and inhibits the Ran GTPase activating
protein.
J. Biol. Chem.
271:
5313-5316
|
| 28. | Fornerod, M., J. van Deursen, S. van Baal, A. Reynolds, D. Davis, K.G. Murti, J. Fransen, and G. Grosveld. 1997. The human homologue of yeast CRM1 is in a dynamic subcomplex with CAN/Nup214 and a novel nuclear pore component Nup88. EMBO (Eur. Mol. Biol. Organ.) J. 16: 807-816 [Medline]. |
| 29. |
Funabiki, H.,
I. Hagan,
S. Uzawa, and
M. Yanagida.
1993.
Cell cycle-dependent
specific positioning and clustering of centromeres and telomeres in fission
yeast.
J. Cell Biol.
121:
961-976
|
| 30. | Goldfarb, D.S., J. Gariepy, G. Schoolnik, and R.D. Kornberg. 1986. Synthetic peptides as nuclear localization signals. Nature (Lond.). 322: 641-644 [Medline]. |
| 31. | Görlich, D., and I.W. Mattaj. 1996. Nucleocytoplasmic transport. Science (Wash. DC). 271: 1513-1518 [Abstract]. |
| 32. | Görlich, D., F. Vogel, A.D. Mills, E. Hartmann, and R.A. Laskey. 1995. Distinct functions for the two importin subunits in nuclear protein import. Nature (Lond.). 377: 246-248 [Medline]. |
| 33. | Görlich, D., P. Henklein, R.A. Laskey, and E. Hartmann. 1996a. A 41 amino acid motif in importin alpha confers binding to importin beta and hence transit into the nucleus. EMBO (Eur. Mol. Biol. Organ.) J. 15: 1810-1817 [Medline]. |
| 34. | Görlich, D., N. Panté, U. Kutay, U. Aebi, and F.R. Bischoff. 1996b. Identification of different roles for RanGDP and RanGTP in nuclear protein import. EMBO (Eur. Mol. Biol. Organ.) J. 15: 5584-5594 [Medline]. |
| 35. |
Hopper, A.K.,
H.M. Traglia, and
R.W. Dunst.
1990.
The yeast RNA1 gene
product necessary for RNA processing is located in the cytosol and apparently excluded from the nucleus.
J. Cell Biol.
111:
309-321
|
| 36. | Imamoto, N., T. Shimamoto, T. Takao, T. Tachibana, S. Kose, M. Matsubae, T. Sekimoto, Y. Shimonishi, and Y. Yoneda. 1995. In vivo evidence for involvement of a 58kDa component of nuclear pore targeting complex in nuclear protein import. EMBO (Eur. Mol. Biol. Organ.) J. 14: 3617-3626 [Medline]. |
| 37. | Irniger, S., S. Piatti, C. Michaelis, and K. Nasmyth. 1995. Genes involved in sister chromatid separation are needed for B-type cyclin proteolysis in budding yeast. Cell. 81: 269-278 [Medline]. |
| 38. |
Jarmolowski, A.,
W.C. Boelens,
E. Izaurralde, and
I.W. Mattaj.
1994.
Nuclear
export of different classes of RNA is mediated by specific factors.
J. Cell
Biol.
124:
627-635
|
| 39. |
Kadowaki, T.,
S.P. Chen,
M. Hitomi,
E. Jacobs,
C. Kumagai,
S. Liang,
R. Schneiter,
D. Singleton,
J. Wisniewska, and
A.M. Tartakoff.
1994.
Isolation
and characterization of Saccharomyces cerevisiae mRNA transport-defective
mtr mutants.
J. Cell Biol.
126:
649-659
|
| 40. |
Kambach, C., and
I.W. Mattaj.
1992.
Intracellular distribution of the U1A protein depends on active transport and nuclear binding to U1 snRNA.
J. Cell
Biol.
118:
11-21
|
| 41. | Klebe, C., F.R. Bischoff, H. Ponstingl, and A. Wittinghofer. 1995. Interaction of the nuclear GTP-binding protein Ran with its regulatory proteins RCC1 and RanGAP1. Biochemistry. 34: 639-647 [Medline]. |
| 42. | Koepp, D.M., and P.A. Silver. 1996. A GTPase controlling nuclear trafficking: running the right way or walking randomly? Cell. 87: 1-4 [Medline]. |
| 43. |
Koepp, D.,
D. Wong,
A. Corbett, and
P.A. Silver.
1996.
Dynamic localization of
the nuclear import receptor and its interactions with transport factors.
J. Cell
Biol.
133:
1163-1176
|
| 44. |
Kutay, U.,
E. Izaurralde,
F.R. Bischoff,
I.W. Mattaj, and
D. Görlich.
1997.
Dominant-negative mutants of importin- block multiple pathways of import and export through the nuclear pore complex.
EMBO (Eur. Mol. Biol.
Organ.) J.
16:
1153-1163
[Medline].
|
| 45. | Lennon, G.G., C. Auffray, M. Polymeropoulos, and M.B. Soares. 1996. The I.M.A.G.E. Consortium: an integrated molecular analysis of genomes and their expression. Genomics. 33: 151-152 [Medline]. |
| 46. |
Loeb, D.J.,
G. Schlenstedt,
D. Pellman,
D. Kornitzer,
P.A. Silver, and
G. Fink.
1995.
The yeast nuclear import receptor is required for mitosis.
Proc. Natl.
Acad. Sci. USA.
92:
7647-7651
|
| 47. |
Lounsbury, K.M, and
I.G. Macara.
1997.
Ran-binding protein 1 (RanBP1)
forms a ternary complex with Ran and karyopherin and reduces Ran GTPase-activating Protein (RanGAP) inhibition by karyopherin .
J. Biol.
Chem.
272:
551-555
|
| 48. |
Lounsbury, K.M.,
A.L. Beddow, and
I.G. Macara.
1994.
A family of proteins
that stabilize the Ran/TC4 GTPase in its GTP-bound conformation.
J. Biol.
Chem.
269:
11285-11290
|
| 49. |
Lounsbury, K.M.,
S.A. Richards,
R.R. Perlungher, and
I.G. Macara.
1996.
Ran
binding domains promote the interaction of ran with p97/ -karyopherin,
linking the docking and translocation steps of nuclear import.
J. Biol. Chem.
271:
2357-2360
|
| 50. | Mahajan, R., C. Delphin, T. Guan, L. Gerace, and F. Melchior. 1997. A small ubiquitin-related polypeptide involved in targeting RanGAP1 to nuclear pore complex protein RanBP2. Cell. 88: 97-107 [Medline]. |
| 51. |
Matunis, M.J.,
E. Coutavas, and
G. Blobel.
1996.
A novel ubiquitin-like modification modulates the partitioning of the Ran-GTPase-activating protein between cytosol and nuclear pore complex.
J. Cell Biol.
135:
1457-1470
|
| 52. |
Melchior, F.,
B. Paschal,
E. Evans, and
L. Gerace.
1993.
Inhibition of nuclear
protein import by nonhydrolyzable analogs of GTP and identification of the
small GTPase Ran/TC4 as an essential transport factor.
J. Cell Biol.
123:
1649-1659
|
| 53. | Michael, W.M., M. Choi, and G. Dreyfuss. 1995. A nuclear export signal in hnRNP A1: a signal-mediated, temperature-dependent nuclear protein export pathway. Cell. 83: 415-422 [Medline]. |
| 54. |
Michaud, N., and
D.S. Goldfarb.
1991.
Multiple pathways in nuclear transport:
the import of U2 snRNP occurs by a novel kinetic pathway.
J. Cell Biol.
112:
215-223
|
| 55. | Moore, M.S., and G. Blobel. 1993. The GTP-binding protein Ran/TC4 is required for protein import into the nucleus. Nature (Lond.). 365: 661-663 [Medline]. |
| 56. |
Moroianu, J.,
M. Hijikata,
G. Blobel, and
A. Radu.
1995.
Mammalian karyopherin a1b and a2b heterodimers: a1 or a2 subunit binds nuclear localization
sequence and b subunit interacts with peptide repeat containing nucleoporins.
Proc. Natl. Acad. Sci. USA.
92:
6532-6536
|
| 57. | Newmeyer, D.D., J.M. Lucocq, T.R. Bürglin, and E.M. De Robertis. 1986. Assembly in vitro of nuclei active in nuclear protein import. EMBO (Eur. Mol. Biol. Organ.) J. 5: 501-510 [Medline]. |
| 58. |
Ohtsubo, M.,
R. Kai,
N. Furuno,
T. Sekiguchi,
M. Sekiguchi,
H. Hayashida,
K.-I. Kuma,
T. Miyata,
S. Fukushige,
T. Murotsu, et al
.
1987.
Isolation and characterization of the active cDNA of the human cell cycle gene RCC1 involved
in the regulation of onset of chromosome condensation.
Genes Dev.
1:
585-593
|
| 59. |
Ohtsubo, M.,
H. Okazaki, and
T. Nishimoto.
1989.
The RCC1 protein, a regulator for the onset of chromosome condensation locates in the nucleus and
binds to DNA.
J. Cell Biol.
109:
1389-1397
|
| 60. | Panté, N., and U. Aebi. 1996. Towards the molecular dissection of protein import into nuclei. Curr. Opin. Cell Biol. 8: 397-406 [Medline]. |
| 61. |
Palacios, I.,
K. Weis,
C. Klebe, and
C. Dingwall.
1996.
Ran/TC4 mutants identify a common requirement for snRNP and protein import into the nucleus.
J. Cell Biol.
133:
485-494
|
| 62. | Pollard, V.W., W.M. Michael, B. Naldalny, M.C. Slomi, P. Wang, and G. Dreyfuss. 1996. A novel receptor mediated nuclear protein import pathway. Cell. 88: 985-994 . |
| 63. | Rexach, M., and G. Blobel. 1995. Protein import into nuclei: association and dissociation reactions involving transport substrate, transport factors, and nucleoporins. Cell. 83: 683-692 [Medline]. |
| 64. |
Richards, S.A.,
K.M. Lounsbury,
K.L. Carey, and
I.G. Macara.
1996.
A nuclear
export signal is essential for the cytosolic localization of the Ran binding
protein, RanBP1.
J. Cell Biol.
134:
1157-1168
|
| 65. | Sazer, S.. 1996. The search for the primary function of the Ran GTPase continues. Trends Cell Biol. 6: 81-85 . [Medline] |
| 66. | Schlenstedt, G.. 1996. Protein import into the nucleus. FEBS (Fed. Eur. Biochem. Sci.) Lett. 389: 75-79 . |
| 67. |
Schlenstedt, G.,
C. Saavedra,
J.D.J. Loeb,
C.N. Cole, and
P.A. Silver.
1995a.
The GTP-bound form of the yeast Ran/TC4 homologue blocks nuclear protein import and appearance of polyA+ RNA in the cytoplasm.
Proc. Natl.
Acad. Sci. USA.
92:
225-229
|
| 68. | Schlenstedt, G., D.H. Wong, D.M. Koepp, and P.A. Silver. 1995b. Mutants in a yeast Ran binding protein are defective in nuclear transport. EMBO (Eur. Mol. Biol. Organ.) J. 14: 5367-5378 [Medline]. |
| 69. | Schuler, G.D., S.F. Altschul, and D.J. Lipman. 1991. A workbench for multiple alignment construction and analysis. Proteins. 9: 180-190 [Medline]. |
| 70. | Sweet, D.J., and L. Gerace. 1995. Taking from the cytoplasm and giving to the pore: soluble transport factors in nuclear protein import. Trends Cell Biol. 5: 444-447 . |
| 71. | Simos, G., H. Tekotte, H. Grosjean, A. Segref, K. Sharma, D. Tollervey, and E.C. Hurt. 1996. Nuclear pore proteins are involved in the biogenesis of functional tRNA. EMBO (Eur. Mol. Biol. Organ.) J. 15: 2270-2284 [Medline]. |
| 72. |
Thompson, J.D.,
D.G. Higgins, and
T.J. Gibson.
1994.
CLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.
Nucleic Acids Res.
22:
4673-4680
|
| 73. |
Toda, T.,
M. Shimanuki,
Y. Saka,
H. Yamano,
Y. Adachi,
M. Shirakawa,
Y. Kyogoku, and
M. Yanagida.
1992.
Fission yeast pap1-dependent transcription is negatively regulated by an essential nuclear protein, crm1.
Mol. Cell.
Biol.
12:
5474-5484
|
| 74. |
Weis, K.,
I.W. Mattaj, and
A.I. Lamond.
1995.
Identification of hSRP1 as a
functional receptor for nuclear localization sequences.
Science (Wash. DC).
268:
1049-1053
|
| 75. | Weis, K., C. Dingwall, and A.I. Lamond. 1996a. Characterization of the nuclear protein import mechanism using Ran mutants with altered binding specificities. EMBO (Eur. Mol. Biol. Organ.) J. 15: 7120-7128 [Medline]. |
| 76. |
Weis, K.,
U. Ryder, and
A.I. Lamond.
1996b.
The conserved amino terminal
domain of hSRP1 is essential for nuclear protein import.
EMBO (Eur.
Mol. Biol. Organ.) J.
15:
1818-1825
[Medline].
|
| 77. |
Wu, J.,
M.J. Matunis,
D. Kraemer,
G. Blobel, and
E. Coutavas.
1995.
Nup358, a
cytoplasmically exposed nucleoporin with peptide repeats, Ran-GTP binding sites, zinc fingers, a cyclophilin A homologous domain, and a leucine-rich
region.
J. Biol. Chem.
270:
14209-14213
|
| 78. |
Xiao, Z.,
J.T. McGrew,
A.J. Schroeder, and
M. Fitzgerald-Hayes.
1993.
CSE1
and CSE2, two new genes required for accurate mitotic chromosome segregation in Saccharomyces cerevisiae.
Mol. Cell. Biol.
13:
4691-4702
|
| 79. | Yokoyama, N., N. Hayashi, T. Seki, N. Panté, T. Ohba, K. Nishii, K. Kuma, T. Hayashida, T. Miyata, U. Aebi, et al . 1995. A giant nucleopore protein that binds Ran/TC4. Nature (Lond.). 376: 184-188 [Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|