|
||
DxxxLL Motif: A Binding
Site for Adaptor Protein-1 and Adaptor Protein-2 in Vitro
Institute of Medical Microbiology and Immunology, University of Copenhagen, The Panum Institute, DK-2200 Copenhagen, Denmark
Several receptors are downregulated by internalization after ligand binding. Regulation of T cell
receptor (TCR) expression is an important step in T
cell activation, desensitization, and tolerance induction.
One way T cells regulate TCR expression is by phosphorylation/dephosphorylation of the TCR subunit
clusters of differentiation (CD)3
. Thus, phosphorylation of CD3
serine 126 (S126) causes a downregulation of the TCR. In this study, we have analyzed the
CD3
internalization motif in three different systems in
parallel: in the context of the complete multimeric TCR; in monomeric CD4/CD3
chimeras; and in vitro
by binding CD3
peptides to clathrin-coated vesicle
adaptor proteins (APs). We find that the CD3
D127xxxLL131/132 sequence represents one united motif
for binding of both AP-1 and AP-2, and that this motif
functions as an active sorting motif in monomeric CD4/
CD3
molecules independently of S126. An acidic amino acid is required at position 127 and a leucine (L)
is required at position 131, whereas the requirements
for position 132 are more relaxed. The spacing between
aspartic acid 127 (D127) and L131 is crucial for the
function of the motif in vivo and for AP binding in
vitro. Furthermore, we provide evidence indicating that
phosphorylation of CD3
S126 in the context of the
complete TCR induces a conformational change that
exposes the DxxxLL sequence for AP binding. Exposure of the DxxxLL motif causes an increase in the
TCR internalization rate and we demonstrate that this
leads to an impairment of TCR signaling. On the basis
of the present results, we propose the existence of at
least three different types of L-based receptor sorting
motifs.
THE establishment and maintenance of self-tolerance
is based on multiple events in the thymus and periphery resulting in either deletion of self-reactive T
cells or induction of nonresponsiveness (for review see reference 22). Transgenic models of peripheral nonresponsiveness have demonstrated that T cell tolerance can be
maintained by downregulation of the T cell receptor (TCR)1
and/or of clusters of differentiation (CD)4 or CD8 (10, 37, 40, 47). In addition, downregulation of the TCR, CD4, and CD8 has also been observed in the process of tolerance induction to Mls-1a in nontransgenic mice (18). Thus, it has
been proposed that peripheral tolerance induction is a
multistep process characterized by the phenotypic appearance of the tolerant T cells. This ranges from a relative
mild form of tolerance without any phenotypic changes to
the most stringent level of anergy with complete downregulation of the TCR (1). In addition to the process of tolerance induction, TCR downregulation has been observed
during T cell activation and it has been proposed that TCR
downregulation might be crucial for T cell activation in allowing serial triggering of many TCRs by few peptide-
major histocompatibility complexes (49, 50). The mechanisms involved in downregulation of the TCR and coreceptors at the T cell surface are still not fully known.
Several receptors associated with tyrosine kinase activity are downregulated by internalization following ligand
binding. Internalization of these receptors takes place via
clathrin-coated vesicles and requires a tyrosine-based
(Y-based) sorting motif in the cytoplasmic tail of the receptors (for reviews see references 27, 48, 53). A direct interaction between clathrin-coated vesicle adaptor proteins
(APs) and Y-based sorting motifs has been shown for
some of these receptors (2, 13, 30, 44, 45). The APs are
a major component of clathrin-coated pits and vesicles. At
least two different forms of AP complexes exist: AP-1,
composed of the ~100-kD In addition to Y-based motifs, other motifs involved in
receptor internalization and sorting have been described.
Leucine-based (L-based) sorting motifs, usually composed
of two successive leucines, have been identified both in receptors internalized from the plasma membrane (4, 6, 9,
23, 43) and in receptors sorted from the TGN to endosomes/lysosomes (19, 23, 39). Whether AP complexes bind
to L-based sorting motifs remains to be determined.
Internalization of some plasma membrane receptors
with L-based sorting motifs is dependent on phosphorylation of a serine located five residues amino terminal to the
motif (6, 42, 43). This raises the possibility that some L-based
internalization motifs may be inaccessible in the nonphosphorylated state and become accessible/activated after receptor phosphorylation, as previously suggested (7). The
TCR and CD4 represent receptors with L-based sorting
motifs that are internalized from the plasma membrane via
clathrin-coated pits after protein kinase C (PKC)-mediated receptor phosphorylation (6, 43). Both the TCR and CD4
are associated with nonreceptor tyrosine kinases that become activated after receptor ligation. This leads to activation of a range of intracellular molecules including PKC.
We have recently provided evidence that PKC-mediated
TCR internalization involves recognition of the TCR subunit CD3 In the present study, we show that AP-1 and AP-2 bind
the CD3 Cells and Antibodies
Jurkat gamma negative (JGN) cells, a TCR cell surface negative variant of
the human T cell line Jurkat that synthesize no CD3 Constructs, Transfection, and TCR Downregulation
All CD3 CD3 Phosphorylation assays were performed as previously described (6, 7).
The phosphorylated CD3 Intracellular calcium, [Ca2+]i, of cells was measured with the intracellular fluorescent indicator fura-2/AM (Sigma Chemical Co.) as previously
described (17).
Metabolic Labeling and
Immunofluorescence Microscopy
Metabolic labeling studies were performed as previously described (8) using [35S]methionine and [35S]cysteine PromixTM (Amersham International,
Little Chalfont, UK). Labeled cells were lysed in 1% NP-40 lysis buffer
(20 mM Tris-HCl, pH 8.0, 1 mM MgCl2, 150 mM NaCl, 1 mM PMSF, 8 mM iodoacetamide, and 1% NP-40), precipitated with rat anti-mouse
CD4 and rabbit anti-rat Ig, and subsequently analyzed by SDS-PAGE on
10% acrylamide gels under nonreducing conditions. Autoradiography of
the dried gels was performed by using Hyperfilm-MP (Amersham International). 14C-proteins from Amersham International were used as mol wt
markers.
For immunofluorescence microscopy, cytospin preparations of the cells
were fixed for 5 min in methanol at In Vitro Binding Studies Using CD3 Peptides corresponding to the membrane-proximal part of the CD3 Requirements to Residue 131 and 132
Only conservative variations of L-based sorting motifs
composed of a leucine followed by another bulky hydrophobic amino acid have been identified (38). We have recently shown that phosphorylation of CD3
Insertion or Deletion of a Single Amino Acid Between
SD and LL Abolishes TCR Internalization
We have previously shown that in addition to phosphorylation of S126 and the presence of L131 and L132, PKC-mediated TCR internalization is dependent on D127 (7).
As S126 phosphorylation is not dependent on D127, this
indicated that D127 may be directly included in the
L-based receptor sorting motif. If the pSDxxxLL sequence
is recognized as one motif by molecules involved in internalization it would be expected that the spacing between
SD and LL is very important. To investigate whether the
spacing of S126D127 relative to L131L132 influenced
TCR internalization, constructs in which one or more
amino acids were inserted or deleted between D127 and
L131 were transfected into JGN cells (Fig. 2 A). TCR-positive clones were isolated and their ability to internalize
the TCR after PKC activation was determined. Insertion
or deletion of a single amino acid completely abolished
TCR internalization (Fig. 2, B and C), although CD3
In Vitro Binding of AP to CD3 To test whether the cytoplasmic tail of CD3
The DxxxLL Sequence Acts as an Active Receptor
Sorting Motif in CD4/CD3 Combining the observations that phosphorylation of
CD3
Whether the CD4/3-WT, CD4/3-SA, and CD4/3-SDAE
molecules were transported directly from the TGN to endosomes/lysosomes for degradation or were transported
via the plasma membrane was studied next. Cells were incubated with PE-conjugated, anti-CD4 mAb for 20, 60, or
90 min at 37°C. Subsequently, the cells were washed and
mAb was stripped of the cell surface by incubating the
cells in low pH buffer. The amount of acid-resistant mAb
representing receptor-mediated, internalized mAb was
subsequently determined by FACS® analysis. Cells expressing CD4/3-WT, CD4/3-SA, or CD4/3-SDAE molecules had a high intake rate of anti-CD4 mAb, whereas
cells expressing CD4/3-SDAA or CD4/3-tS126 molecules
had a low mAb intake rate (Fig. 5 E). This indicated that
at least a fraction of the CD4/3-WT, CD4/3-SA, and CD4/
3-SDAE molecules were transported via the plasma membrane.
Insertion or Deletion of a Single Amino Acid in the
DxxxLL Motif Reduces the Internalization and
Degradation Rate of Chimeric Molecules
If the DxxxLL sequence was recognized as one motif for
AP binding in the chimeric CD4/CD3
Exposure of the DxxxLL Motif in the TCR Results in
an Impairment of TCR Signaling
To test whether TCR downregulation caused by the exposure of the DxxxLL motif had any influence on mAb-
induced TCR activation, JGN-WT and JGN-L131F cells
were incubated with different concentrations of PDB for
30 min and subsequently divided in two parts. One part was analyzed for TCR expression by FACS® and the other
part was analyzed for intracellular calcium [Ca2+]i mobilization after stimulation with suboptimal doses of the anti-TCR mAb F101.01 (12). TCR downregulation correlated
with an impairment to mobilize [Ca2+]i in JGN-WT cells
(Fig. 7). In contrast, incubation of JGN-L131F cells with
PDB did not induce TCR downregulation and had only a
minor inhibitory effects on F101.01-induced [Ca2+]i mobilization (Fig. 7).
Downregulation of receptors after receptor activation is a
general phenomenon observed for a broad range of receptors (26). Recently, L-based motifs have been found to
play an important role in internalization and sorting of
several receptors of the immune system. Thus, the TCR
(CD3 In contrast to nutritive receptors that generally are constitutively internalized, rapid and efficient internalization
via clathrin-coated pits and vesicles of signaling receptors
(e.g., the TCR and EGFR) generally occurs only after
ligand binding and receptor activation. One of the hallmarks of clathrin-coated vesicles is their selectivity. Certain membrane receptors are very efficiently concentrated
in clathrin-coated vesicles, and in most cases this property
has been correlated with the presence of a Y-based internalization signal in the cytoplasmic tail of the receptor (for
reviews see references 48, 53). The mechanism by which
activated receptors with Y-based internalization motifs
are concentrated in clathrin-coated vesicles is not fully understood, although binding of AP-2 to the Y-based motifs
may be involved (2, 13, 30, 44, 45). Phosphorylation of
the tyrosine can probably be excluded as part of the mechanism, as phenylalanine sometimes can substitute for tyrosine (53). In contrast, some L-based motifs (e.g., CD3 The molecular mechanisms involved in the sorting of receptors with L-based sorting motifs are still not fully
known but seem to be highly specific. Only conservative
variations (leucine plus another bulky hydrophobic amino
acid) of L-based sorting motifs have been identified (38).
For CD3 Table I.
CD3 Leucine-based Motifs from Different Species
- and
1-adaptin, and the
smaller ~47-kD µ1 and ~20-kD
1 subunits, is found in
association with clathrin at the TGN; and AP-2, composed
of the ~100-kD
- and
2-adaptin and the smaller ~50-kD
µ2 and ~17-kD
2 subunits, is found in association with
clathrin at the plasma membrane (for review see references 33, 36).
as a substrate for PKC with subsequent phosphorylation of CD3
serine 126 (S126). In this process, basic amino acids surrounding S126 are important (7).
Whether the phosphorylated S126 is directly included in a
motif recognized by receptor sorting molecules, or phosphorylation of S126 causes a conformational change that
exposes the L-based motif remained to be determined.
L-based motif. Furthermore, we demonstrate
that this motif includes the acidic amino acid, aspartic acid
127 (D127), and we provide evidence indicating that phosphorylation of CD3
S126 in the context of the complete
TCR induces a conformational change that exposes the
DxxxLL sequence as one united motif for AP binding. The
phosphorylated S126 is not directly included in the internalization motif. Thus, the DxxxLL sequence is an active
internalization motif in monomeric CD4/CD3
chimeras
independently of S126 and S126 is dispensable for binding
of AP to CD3
peptides in vitro. Insertion or deletion of a
single amino acid between D127 and L131 in the DxxxLL sequence completely abolished internalization of both the
TCR and the CD4/CD3
chimeras, and inhibited binding of AP-1 and AP-2 to CD3
peptides, strongly indicating
that the DxxxLL sequence is recognized as one united motif by AP. Glutamic acid could substitute for aspartic acid
at position 127, whereas only leucine was accepted at position 131. At position 132, bulky hydrophobic amino acids
other than leucine were accepted, i.e., leucine = isoleucine > methionine > phenylalanine.
Materials and Methods
(11) were cultured in
RPMI 1640 medium supplemented with penicillin 2 × 105 U/liter (Leo
Pharmaceutical Products, Ballerup, Denmark), streptomycin 50 µg/liter
(Merck, Darmstadt, Germany), and 10% (vol/vol) FCS (Life Technologies, Paisley, UK) at 37°C in 5% CO2. UCHT1 mouse mAb directed
against human CD3
was obtained purified, and phycoerythrin (PE) conjugated from DAKOPATTS A/S (Glostrup, Denmark). Anti-
- (100/2),
- (100/1), and
-adaptin (100/3) mAb were from Sigma Chemical Co. (St.
Louis, MO). The rat anti-mouse CD4 mAb L3T4 was obtained purified
and PE conjugated from PharMingen (San Diego, CA). The anti-TCR
mAb F101.01 was produced in our own laboratory (12). Rabbit anti-rat Ig
was obtained from DAKOPATTS A/S, and FITC-conjugated F(ab)2 fragments of donkey anti-rat Ig was obtained from Jackson Immunoresearch
Laboratories, Inc. (West Grove, PA). The phorbol ester phorbol 12,13-dibutyrate (PDB) was from Sigma Chemical Co.
mutations were constructed as previously described (6, 8) by
the PCR using Vent DNA polymerase containing 3
to 5
proofreading exonuclease activity (New England Biolabs Inc., Beverly, MA) and the plasmid pJ6T3
-2 (20) as template. Chimeric CD4/CD3
(CD4/3-tS126), composed of the extracellular and transmembrane domains of mouse CD4
and a truncated cytoplasmic domain of human CD3
, was produced using
the plasmid pCD-L3T4.25 (25) as template, and the primer set CD4-up:
5
-CTCAAGTCTAGAACCATGTGCCGAGCCATCTCT; and CD4/3-t126: 5
-CTTGTCGAATTCTCAAGCTCGAGACTGGCGAACTCCATCCTGGACACAGCAGAGGATGCA by PCR. The PCR product was
digested with XbaI and EcoRI, and subcloned into the expression vector
pMH-Neo (14) to generate plasmid pMH-Neo-CD4/3-tS126. CD4/3-WT,
CD4/3-SA, CD4/3-SDAA, CD4/3-SDAE, CD4/3-1A, and CD4/3-dT130
were produced using the plasmid pMH-Neo-CD4/3-tS126 as template,
and the 5
-primer CD4-up and the 3
-primers: 5
-GTCCTTGAATTCTCACAACGAGTCTGCTTGTCTGAAGCGCGAGACTGGAGAA-CTCCATC, 5
-GTCCTTGAATTCTCACAACAGAGTCTGCTTGTCAGCAGCGCGAGACTGGCGAACTCCATC, 5
-GTCCTTGAATTCTCACAACAGAGTCTGCTTAGCTGCAGCGCGAGACTGGCGAA
CTCCATC, 5
-GTCCTTGAATTCTCACAACAGAGTCTGCTTTTCAGCAGCGCGAGACTGGAGAACTCCATC, 5
-GTCCTTGAATTCTCACAACAGAGTCTGAGCCTTGTCTGCAGCGCGAGACTGGCGAACTCCATC, and 5
-GTCCTTGAATTCACAACAGCTGCTTGTCTGCAGCGCGAGACTGGCGAACTCCATC, respectively. Mutations
were confirmed by DNA sequencing. Transfections were performed using
a Gene Pulser (Bio Rad Laboratories, Hercules, CA) at a setting of 270 V
and 960 microfarad with 40 µg of plasmid per 2 × 107 cells. After 3-4 wk
of selection, G418 resistant clones were expanded and maintained in medium without G418. For TCR downregulation, cells were adjusted to 105
cells/ml medium (RPMI 1640/10% FCS) and incubated at 37°C with various concentrations of phorbol ester. At the indicated time cells were
transferred to ice-cold PBS containing 2% FCS and 0.1% NaN3 and
washed twice. The cells were stained directly with PE-conjugated UCHT1
and analyzed in a FACScan® flow cytometer (Becton and Dickinson, Co.,
Mountain View, CA). Mean fluorescence intensity (MFI) was recorded
and used in the calculation of percent anti-CD3 binding: MFI of phorbol
ester-treated cells, divided by MFI of untreated cells. For each construct, at least three different clones were analyzed.
Phosphorylation, Internalization of Chimeric
CD4/CD3
Receptors, and Intracellular Calcium
chain with a mol wt of 26-30 kD was coprecipitated with CD3
(20 kD) using the anti-CD3
mAb UCHT1. For each
construct, at least two different clones were analyzed. To determine internalization of chimeric CD4/CD3
receptors, cells were incubated in RPMI
1640 + 10% FCS at a cell density of 2 × 105 cells per ml at 37° or 4°C with
PE-conjugated anti-CD4 mAb. At the time indicated, aliquots of cell suspension were washed in ice-cold RPMI 1640 + 10% FCS and immediately
treated with 300 µl 0.5 M NaCl, 0.5 M acetic acid, pH 2.2 for 10 s. The
acid-resistant fluorescence of the cells (representing internalized anti-CD4) was measured in the FACScan®. The percentage of internalized
anti-CD4 to cell surface-bound anti-CD4 was subsequently calculated using the equation: HAR
CAR/CT. In this equation, HAR is the MFI of
acid-treated cells incubated at 37°C; CAR is the MFI of acid-treated cells
incubated at 4°C, and CT is the MFI of untreated cells incubated at 4°C. For each construct at least three different clones were analyzed.
20°C and then for 30 s in acetone at
20°C. The preparations were air-dried at room temperature for 20 h, and
subsequently washed by immersion in PBS for 5 min. After incubation
with donkey serum diluted 1:20 in PBS for 20 min, the preparations were
incubated with rat anti-mouse CD4 (PharMingen) for 30 min, washed in
PBS, incubated with FITC-conjugated F(ab)2 fragments of donkey anti-
rat IgG (Jackson Immunoresearch Laboratories) for 30 min, washed in
PBS, and subsequently inspected in a Leitz Dialux 20 microscope (Leica,
Wetzlar, Germany).
Peptides
cytoplasmic tail from Q117 to L132, with a Q117 to cysteine mutation were obtained from Schafer-N (Copenhagen, Denmark) bound to vinyl-activated
Sepharose 4B beads at a density of ~1-2 µmol/ml gel. The coupling procedure via the amino-terminal cysteine resulted in immobilization of monomeric peptides with freely exposed carboxy termini. To prepare T cell
cytosol 4 × 108 Jurkat cells were washed three times in cytosol buffer (25 mM Hepes, pH 7.0, 125 mM CH3COOK, 2.5 mM (CH3COO)2Mg, 1.0 mM
DTT, 1 mg/ml glucose), and the resulting cell pellet was resuspended in an
equal volume of cytosol buffer with inhibitors added (0.75 µM aprotinin,
10 µM leupeptin, 3 µM pepstatin A, 1 mM PMSF, 0.4 mM EDTA). The
cell suspension was frozen in liquid nitrogen, thawed on ice, and drawn
five times through a 21-gauge syringe. After centrifugation for 30 min at
20,000 g, 4°C, the cytosol was transferred to new tubes and then kept at
80°C until use. The protein concentration in the cytosol preparations
was 15-20 mg/ml. Beads were incubated with T cell cytosol for 2 h at 37°C,
washed three or six times in PBS at 4°C, and bound material was eluted by
boiling the beads in Laemmli sample buffer with 5% 2-ME. After SDS-PAGE, the eluted material was transferred to nitrocellulose-membranes,
and immunoblottings were performed using anti-
-, anti-
-, or anti-
-adaptin antibodies followed by peroxidase-conjugated, rabbit anti-mouse
antibodies (DAKOPATTS A/S). Bound antibodies were visualized using
enhanced chemiluminescence (ECL; Amersham).
Results
S126 is required for PKC-mediated downregulation of the TCR (6).
In addition to phosphorylation of S126, two leucines (L131
and L132), are required for TCR downregulation after
PKC activation (6). These leucines are not CD3
determinants for PKC as carboxyterminal truncations of the
CD3
cytoplasmic tail up to T130 do not affect PKC-mediated phosphorylation of CD3
(6). To analyze which
amino acid functioned in TCR internalization at position
131 and 132 in the cytoplasmic tail of CD3
, constructs were made in which isoleucine, phenylalanine, or methionine substituted for L131 or L132 (Fig. 1 A). These
constructs were separately transfected into the CD3
negative T cell line JGN which upon transfection with CD3
becomes TCR positive (11). TCR positive clones were isolated, and their ability to internalize the TCR after PKC
activation was determined. The requirements to position 131 were very strict. Of the analyzed amino acids, only leucine was accepted at position 131 (Fig. 1, B and C). In contrast, TCR internalization seemed to be less restricted in
its requirements to the amino acid at position 132. Thus,
isoleucine functioned as well as leucine at this position.
Methionine and phenylalanine also functioned at this position but with decreasing efficiency (Fig. 1, B and C).
Fig. 1.
Requirements to residue 131 and 132. (A) Schematic
representation of the amino acid sequences in the cytoplasmic
tails of the CD3
chains expressed in the indicated cell lines and a
summation of the results from the TCR downregulation analyses.
TCR downregulation was scored according to the percent anti-CD3 binding after incubation with PDB (110 nM) for 1 h: +++,
0-40% anti-CD3 binding; ++, 40-60% anti-CD3 binding; +, 60-
80% anti-CD3 binding; (+), 80-95% anti-CD3 binding;
, >95%
anti-CD3 binding. (B) Cells were incubated with different concentrations of PDB for 1 h and TCR downregulation was determined by staining with anti-CD3 mAb and flow cytometry comparing MFI of PDB-treated cells with MFI of untreated cells. (C)
FACS® histograms of untreated cells (white, dotted line) and
cells treated with 110 nM PDB (black) for 1 h. The cell line and the percent anti-CD3 binding after PDB treatment are given in
the upper left corner of each histogram. The ordinate indicates
the relative cell number. The abscissa indicates the fluorescence intensity in a logarithmic scale in arbitrary units. MFI of the cell
lines stained with irrelevant mAb varied between two and five arbitrary units (data not shown).
[View Larger Version of this Image (46K GIF file)]
phosphorylation was intact (Fig. 2 D). Taken together,
these results strongly indicated that either S126 plus D127,
or D127 alone, is directly included in the L-based sorting
motif of CD3
.
Fig. 2.
Insertion and deletion of amino acids between
D127 and L131. (A) Schematic representation of the
amino acid sequences in the cytoplasmic tails of the CD3
chains expressed in the indicated cell lines and a summation of the results from the
TCR downregulation and
CD3
phosphorylation analyses. TCR downregulation
were scored as described in
the legend to Fig. 1. (B) Cells
were incubated with different concentrations of PDB
for 1 h, and TCR downregulation was determined by
staining with anti-CD3 mAb
and flow cytometry comparing MFI of PDB treated cells
with MFI of untreated cells. (C) FACS® histograms of
untreated cells (white, dotted
line) and cells treated with
110 nM PDB (black) for 1 h.
The cell line and the percent
anti-CD3 binding following
PDB treatment are given in the upper left corner of each
histogram. The ordinate indicates the relative cell number. The abscissa indicates
the fluorescence intensity in
a logarithmic scale in arbitrary units. MFI of the cell
lines stained with irrelevant
mAb varied between two and five arbitrary units (data not shown). (D) Phosphorylation analyses of CD3
from JGN-WT (lane 1),
JGN-1A (lane 2), JGN-2A (lane 3), JGN-4A (lane 4), JGN-dT130 (lane 5), and JGN-dQT (lane 6) cells.
[View Larger Versions of these Images (41 + 14 + 52K GIF file)]
Peptides
represented
a binding motif for AP complexes, peptides corresponding
to the membrane-proximal part of the CD3
cytoplasmic
tail from glutamine 117 (Q117) to L132, with a Q117 to
cysteine mutation, were synthesized and immobilized on
Sepharose beads. The coupling procedure resulted in immobilization of monomeric peptides with freely exposed
carboxy termini. Thus, the orientation of the immobilized
peptides mimicked that of the CD3
cytoplasmic tail in
vivo. Beads were incubated with T cell cytosol, washed
three times in PBS, and bound material was eluted. After
SDS-PAGE, the eluted material was transferred to nitrocellulose membranes, and immunoblottings were performed
using anti-
-, anti-
-, or anti-
-adaptin antibodies. Peptides representing the wild-type sequence of CD3
(GAM-WT) precipitated
-,
-, and
-adaptin, whereas
peptides in which alanines substituted for the leucines corresponding to L131 and L132 (GAM-LLAA) did not precipitate
- and
-adaptin, and only weakly precipitated
-adaptin (Fig. 3 A). Increasing the number of washes of
the beads from three to six reduced the amount of
-adaptin precipitated with the GAM-LLAA beads, whereas the
amount of
-adaptin precipitated with GAM-WT was not
significantly reduced (Fig. 3 B). Titration of beads and cytosol demonstrated that GAM-WT beads precipitated
-,
-, and
-adaptin in parallel (Fig. 3, C-E, and data not
shown). The observation that GAM-WT bound APs although the peptide was not phosphorylated, indicated either that the peptide became phosphorylated during the
incubation with cytosol or that phosphorylation of serine corresponding to CD3
S126 was not required for in vitro
binding. To analyze the role of serine in AP binding, peptides in which alanine substituted for serine (GAM-S126A) were produced. These peptides bound AP as efficiently as GAM-WT, suggesting that S126 is not required
for AP binding (Fig. 4 A). In contrast, peptides in which
alanine substituted for aspartic acid corresponding to CD3
D127 bound AP less efficiently, suggesting that
D127 is required for optimal AP binding (Fig. 4 A). Likewise, peptides in which one amino acid was inserted
(GAM-INS) or deleted (GAM-DEL) between the aspartic acid and leucine corresponding to CD3
D127 and
L131, respectively, bound AP less efficiently than the
GAM-WT and GAM-S126A peptides (Fig. 4 B).
Fig. 3.
In vitro binding of AP to CD3
peptides. (A) Western
blots of material from T cell cytosol bound by beads coated with
GAM-WT (lanes 1, 3, and 5) and GAM-LLAA (lanes 2, 4, and 6)
peptides, and blotted with anti-
-adaptin (lanes 1 and 2), anti-
-adaptin (lanes 3 and 4), and anti-
-adaptin (lanes 5 and 6) antibodies. The amino acid sequences of the GAM-WT and GAM-LLAA peptides are given below Fig. 3 B. (B) Western blot of
material from T cell cytosol bound by beads coated with GAM-WT (lanes 1 and 3) and GAM-LLAA (lanes 2 and 4) peptides
with unprocessed T cell cytosol in lane 5 blotted with a mixture of
anti-
-adaptin and anti-
-adaptin antibodies. The beads were either washed three times (lanes 1 and 2) or six times (lanes 3 and
4) before the bound material was eluted. (C) Western blot of material from T cell cytosol bound by beads coated with GAM-WT
(lanes 1-3) and GAM-LLAA (lanes 4-6) peptides blotted with
anti-
-adaptin antibody. The amount of beads used represented
200 (lanes 1 and 4), 100 (lanes 2 and 5), and 50 (lanes 3 and 6)
nmol bound CD3
peptide. A plot of the bands quantitated by
densitometry is given below. The bands are normalized to the
band obtained with 200 nmol GAM-WT peptide. (D) Western blot of material from T cell cytosol bound by beads coated with GAM-WT peptides and blotted with the anti-
-adaptin antibody. Increasing amounts (125 [lane 1], 250 [lane 2], 500 [lane 3], and 1,000 [lane 4] µg) of T cell cytosol were used. The amount of
beads was constant and represented 200 nmol bound CD3
peptide. A plot of the bands quantitated by densitometry is given below. The bands are normalized to the band obtained with 1,000 µg T cell cytosol. (E) Western blot of material from T cell cytosol bound by beads coated with GAM-WT peptides and blotted with
the anti-
-adaptin antibody. Increasing amounts (125 [lane 1],
250 [lane 2], 500 [lane 3], and 1,000 [lane 4] µg) of T cell cytosol were used. The amount of beads was constant and represented
200 nmol bound CD3
peptide. A plot of the bands quantitated
by densitometry is given below. The bands are normalized to the
band obtained with 500 µg T cell cytosol.
[View Larger Version of this Image (34K GIF file)]
Fig. 4.
Binding of AP to
mutated CD3
peptides. (A)
Western blot of material
from T cell cytosol bound by
beads coated with GAM-S126A (lanes 1-3) and
GAM-D127A (lanes 4-6)
peptides blotted with the anti-
-adaptin antibody. The
amount of beads used represented 200 (lanes 1 and 4),
100 (lanes 2 and 5), and 50 (lanes 3 and 6) nmol bound
CD3
peptide. A plot of the
bands quantitated by densitometry is given below. The
bands are normalized to the
band obtained with 200 nmol
GAM-WT peptide. (B)
Western blot of material from T cell cytosol bound by
beads coated with GAM-WT
(lanes 1 and 2), GAM-INS
(lanes 3 and 4), and GAM-DEL (lanes 5 and 6) peptides blotted with the anti-
-adaptin antibody. The amount of
beads used represented 200 (lanes 1, 3, and 5) and 100 (lanes 2, 4, and 6) nmol
bound CD3
peptide.
[View Larger Version of this Image (23K GIF file)]
Chimeras Independently
of S126
S126 was required for TCR internalization and that
S126 was dispensable for AP binding in vitro, suggested
that the role of S126 phosphorylation in T cells was to induce a conformational change that exposed the DxxxLL
motif for adaptor binding. As the TCR is a multimeric receptor composed of at least eight chains (all possessing cytoplasmic tails), it is possible that the DxxxLL motif of
CD3
in the context of the complete TCR is not accessible
in the nonphosphorylated state for molecules involved in
internalization. This hypothesis implies that the DxxxLL
receptor sorting motif may be active in monomeric receptors independently of serine. Accordingly, constructs coding for the extracellular and transmembrane parts of CD4,
and the membrane-proximal part of the CD3
cytoplasmic
tail from Q117 to L132 (with various mutations) were
transfected into JGN cells (Fig. 5 A). As an L-based motif
negative control, the CD4/3-tS126 construct (coding for
the extracellular and transmembrane part of CD4, and the
membrane-proximal part of CD3
from Q117 to A125) was transfected into JGN cells (Fig. 5 A). If the DxxxLL
motifs in the CD4/3-WT and CD4/3-SA chimeras and the
ExxxLL motif in the CD4/3-SDAE chimera were active
independently of the presence and/or phosphorylation of
S126, then it would be expected that only small amounts of
the chimeras were expressed at the cell surface, and that
these molecules were quickly internalized. Likewise, if the
aspartic acid was required in an active sorting motif, the
CD4/3-SDAA chimeric molecules would be expected to
be highly expressed at the cell surface and to have a low
turnover rate like the CD4/3-tS126 chimeras. G418-resistant clones were isolated and analyzed for cell surface expression of the chimeric molecules by FACS® analysis using an anti-CD4 mAb. Clones transfected with CD4/3-WT, CD4/3-SA, and CD4/3-SDAE only weakly expressed
the chimeric molecules at the cell surface. In contrast,
clones transfected with CD4/3-tS126 and CD4/3-SDAA
highly expressed the chimeric molecules at the cell surface
(Fig. 5 B, upper row). Pulse-chase metabolic labeling demonstrated that the amounts of chimeric molecules produced in the transfectants were comparable, and that the
CD4/3-WT, CD4/3-SA, and CD4/3-SDAE molecules were
quickly degraded with almost no labeled molecules left after a 4-h pulse, whereas the CD4/3-tS126 and CD4/3-SDAA molecules were far more stable (Fig. 5 B, middle row). Furthermore, immunofluorescence microscopy of
fixed and permeabilized cells showed a predominant intracellular localization of CD4/3-WT, CD4/3-SA, and CD4/3-SDAE molecules clustered in few large vesicles. In contrast, CD4/3-tS126 and CD4/3-SDAA molecules were
found both at the plasma membrane and intracellularly
(Fig. 5 B, lower row). Several lines of evidence pointed to
endosomes/lysosomes as the likely site of degradation of
the CD4/3-WT, CD4/3-SA, and CD4/3-SDAE molecules.
First, when protein transport through the Golgi apparatus
was inhibited by monensin, degradation was blocked (Fig.
5 C). Second, the degradation destroyed fully processed molecules, pointing to a site of degradation beyond the
Golgi apparatus (Fig. 5 B, middle row). Finally, ammonium chloride, known to inhibit lysosomal degradation, inhibited degradation (Fig. 5 D).
Fig. 5.
The DxxxLL sequence is an active sorting
motif in CD4/CD3
chimeras. (A) Schematic representation of the amino acid sequences in the cytoplasmic
tails of the CD4/CD3
chimeras expressed in the indicated cell lines and a summation of the results obtained from FACS® analysis, immunofluorescence microscopy,
pulse-chase metabolic labeling, and internalization experiments. IC, intracellular; PM, plasma membrane. (B)
The FACS® profile (first
row), the results from pulse-
chase metabolic labeling
studies (second row), and the
results from immunofluorescence microscopy analyses
(third row) are shown for
each cell line. The name of
the relevant cell line is given
at the top of each column.
The FACS® profiles show
the relevant cell line in black
and the JGN cell line in
white. For pulse-chase metabolic labeling, cells were pulsed for 30 min (lane 1)
and chased for 1 (lane 2), 2 (lane 3), and 4 (lane 4) h. (C)
Pulse-chase metabolic labeling of JGN-CD4/3-SA cells
as in B, in the presence or absence of monensin or (D)
ammonium chloride. (E) Internalization of anti-CD4 antibodies by chimeric receptors. The percentage of
internalized anti-CD4 to cell
surface bound anti-CD4 was
calculated as described in
Materials and Methods.
[View Larger Version of this Image (77K GIF file)]
molecules, as suggested by the TCR and peptide experiments, it would be
expected that insertion or deletion of amino acids between
D127 and L131 would reduce the internalization rate and
degradation of the chimeras. To test this, chimeric CD4/
CD3
constructs in which one amino acid was inserted or
deleted between D127 and L131 were transfected into JGN cells (Fig. 6 A). G418-resistant clones were isolated
and examined for cell surface expression of the chimeras
by FACS® analysis using an anti-CD4 mAb. Both CD4/3-1A and CD4/3-dT130 molecules were highly expressed at
the cell surface of the transfectants (Fig. 6 B). Pulse-chase
metabolic labeling showed that, in contrast to CD4/3-SA
molecules, CD4/3-1A and CD4/3-dT130 were stable for at
least 4 h (Fig. 6 C). Incubation with PE-conjugated anti-CD4 mAb at 37°C demonstrated that cells expressing
CD4/3-1A or CD4/3-dT130 molecules had a lower intake
rate of mAb as compared to cells expressing CD4/3-SA
(Fig. 6, D and E). Furthermore, immunofluorescence microscopy showed that the CD4/3-1A and CD4/3-dT130
molecules were localized both at the plasma membrane
and intracellularly (data not shown).
Fig. 6.
Internalization and
degradation is reduced by insertion or deletion of amino
acids in the DxxxLL motif.
(A) Schematic representation of the amino acid sequences in the cytoplasmic
tails of the CD4/CD3
chimeras expressed in the indicated cell lines, and a summation of the results obtained
from FACS® analysis, immunofluorescence microscopy,
pulse-chase metabolic labeling, and internalization experiments. IC, intracellular; PM, plasma membrane. (B)
The FACS® profiles show
the indicated cell line in
black and the JGN cell line in
white. (C) Pulse-chase metabolic labeling. JGN-CD4/3-SA, JGN-CD4/3-1A, and JGN-CD4/3-dT130 cells were pulsed for 30 min (lane 1) and chased for 1 (lane 2),
2 (lane 3), and 4 (lane 4) h. (D) Internalization of anti-CD4 antibodies by chimeric receptors. The percentage of internalized anti-CD4
to cell surface bound anti-CD4 was calculated as described in Materials and Methods.
[View Larger Version of this Image (33K GIF file)]
Fig. 7.
Exposure of the DxxxLL motif in the TCR results in an
impairment of TCR signaling. (A) FACS® profiles of JGN-WT
and JGN-L131F cells incubated without PDB (grey), with 12 nM
PDB (bold line), or with 110 nM PDB (dotted line) for 30 min.
The ordinate indicates the relative cell number. The abscissa indicates the fluorescence intensity in a logarithmic scale in arbitrary
units. The cell line and the percent anti-CD3 binding after treatment without PDB and with 12 and 110 nM PDB are given in the
upper left corner of each histogram (B) [Ca2+]i measurements.
After incubation of JGN-WT and JGN-L131F cells without PDB
(regular line), with 12 nM PDB (thin line), or with 110 nM PDB
(thick line) for 30 min, the cells were treated with the anti-TCR
antibody F101.01 at 120 s, and subsequently with ionophore-Ca2+
salt at 480 s. The ratio of fura-2/AM fluorescence at 340 nm to
that at 380 nm was recorded and is indicated by the ordinate in
arbitrary units. The abscissa indicates the time in seconds. The
cell line is given in the upper left corner of each histogram.
[View Larger Version of this Image (30K GIF file)]
Discussion
and CD3
) (6, 23), CD4 (43), the MHC class II-
associated invariant chain (Ii) (34), gp130 (9), and CD44
(41) all contain L-based sorting motifs. In general, receptor downregulation is probably an important method by
which a cell, after receptor signaling, attenuates its response to ligand stimulation and thereby protects itself
from excessive signaling. Several mitogenic receptors with
tyrosine kinase activity have oncogenic potential and the
importance of tyrosine kinase receptor desensitization has
been shown by analyzing mutated epidermal growth factor
receptors (EGFR). Stimulation with low concentrations of
ligand leads to neoplastic transformation of cells expressing desensitization defective EGFR but not of cells expressing wild-type EGFR (28, 55). The physiological role
of TCR downregulation mediated by the CD3
phosphorylation-dependent, L-based sorting motif is still unknown.
In addition, to protect the T cell from excessive signaling,
it is likely that a strict regulation of this central receptor of
the specific immune system is important both in the initial
steps of T cell activation (49, 50) and in tolerance induction (1). This is supported by the present observation that
TCR downregulation after PKC activation abolished suboptimal stimulation with anti-TCR mAb as measured by
mobilization of [Ca2+]i.
, CD4, and to some extent gp130) are dependent on serine
phosphorylation, whereas others (e.g., Ii and CD44) are
independent. We have previously shown that the L-based
internalization motif in context of the complete TCR is
strictly regulated by S126 phosphorylation (6). Taken together with the present observation that the DxxxLL motif was active in the CD4/CD3
chimeras independently of
serine, this suggested that the DxxxLL motif is most likely
not accessible for the internalization machinery in the context of the complete TCR and that phosphorylation of
S126 serves to induce a conformational change in the TCR
that makes the DxxxLL motif accessible for the internalization machinery.
, we found that at position 131 only leucine was
accepted, whereas the requirements to position 132 were
more relaxed (i.e., leucine = isoleucine > methionine > phenylalanine). This is in agreement with the presence of
either LL, LI, or LM in the CD3
and CD3
L-based motifs from different species (Table I). These results suggest
that L-based motifs found in different receptors follow a
common pattern and are recognized by the same or very
homologous molecules.
It has not been clear whether the L-based sequence per
se constitutes a complete targeting motif or additional residues are included in the motif. Recent studies of the Ii
have indicated that sorting of Ii, in addition to L-based sequences, depends on an acidic amino acid positioned four
or five residues amino terminal to the motif (29, 35). Furthermore, we have shown that CD3
D127 is absolutely
required for PKC-mediated TCR internalization although
it is dispensable for S126 phosphorylation (7). The present
study of the CD4/CD3
chimeras demonstrated that a
glutamic acid versus an alanine substitution for aspartic
acid was accepted at position 127, which supports the suggestion that an acidic amino acid is included in L-based
motifs. Interestingly, a phosphorylated serine could also
substitute for aspartic acid or glutamic acid at position 127 in the CD4/CD3
chimeras (Geisler, C., unpublished data). Furthermore, the results obtained by insertion or
deletion of amino acids between D127 and L131 in the
DxxxLL sequence strongly indicated that the DxxxLL sequence was recognized as one motif. This is also supported
by the conserved D/ExxxLL/I/M sequences found in
CD3
and
from different species (Table I).
Although the D/ExxxLL/M motif found in different
CD3
subunits works as a receptor sorting motif in chimeric receptors (the present study and reference 23), it is
not preceded by a serine and it cannot substitute for the
CD3
motif in the context of the complete TCR (54). One
role of this motif could be in TCR quality control by targeting incompletely assembled TCR complexes to the endosomes/lysosomes for degradation. In line with this, it
has been demonstrated that TCR complexes lacking the
chain are mainly transported to the lysosomes for degradation (46). These observations suggest that
normally
cover the L-based TCR internalization motifs, and this
could explain why only completely assembled TCR are allowed to be normally expressed at the T cell surface.
Binding studies with peptides, representing the cytoplasmic tail of CD3
, suggested that the DxxxLL motif was
recognized by both AP-2 and AP-1. From these results we
could not determine which subunit of the AP complexes
was responsible for binding. Furthermore, the possibility
that AP-DxxxLL binding was mediated by a third unidentified molecule could not be excluded. A recent study using the yeast two-hybrid system demonstrated a direct interaction of Y-based sorting motifs and the µ1 and µ2
chains but failed to detect any interaction between these
chains and the CD3
DKQTLL motif (31). This suggests
that the µ1 and µ2 chains are not involved in binding to
L-based sorting motifs, however, an alternative explanation could be that µ1 and µ2 are involved in binding, but
only when found in the context of the complete AP complex. Although such in vitro experiments should be interpreted with caution, a much stronger binding of AP to GAM-WT compared to GAM-LLAA peptides was observed. The observation that S126 was dispensable for AP
binding supported the results obtained in vivo, demonstrating that S126 was not required for internalization of
the CD4/CD3
chimeras. In addition, GAM-D127A peptides bound AP less efficiently than GAM-WT and GAM-S126A peptides, indicating that an acidic amino acid was
required at this position for optimal AP binding in vitro.
In line with this, in vivo studies of JGN-CD4/3-SDAA
cells showed a reduced internalization rate of the chimeric
molecules compared to JGN-CD4/3-SA cells. The finding
that the DxxxLL motif bound both AP-2 and AP-1 complexes is in good agreement with the observation that L-based receptor sorting motifs are found both in receptors
sorted from the TGN to endosomes/lysosomes (19, 23, 39)
and in receptors internalized from the plasma membrane
(4, 6, 9, 23, 43) and is furthermore supported by a recent
study describing the in vitro binding of both AP-2 and AP-1 to L-based motifs by using surface plasmon resonance
analysis (15).
From these results it may be suggested that receptors
with L-based sorting motifs can be divided in three groups.
The first group includes receptors destined for the endosome/lysosome compartments. These receptors express a
directly accessible L-based motif (e.g., Ii, the cation-
dependent mannose 6-phosphate receptor, lysosomal integral membrane protein II, and the CD4/3-WT, -SA, and
-SDAE chimeras). The accessible motif is recognized by
AP-1 at the TGN and the majority of the receptors are
sorted directly to the endosomes/lysosomes (Fig. 8 A). The
second group includes multimeric plasma membrane receptors like the TCR. Here the L-based motif serves two
functions: quality control; and receptor downregulation. In
incompletely assembled receptors, the L-based motifs are
accessible and recognized by AP-1 at the TGN leading to
degradation of nonfunctional receptors in the lysosomes.
In completely assembled receptors, the L-based motif is
not accessible for AP and the receptors are transported to
the plasma membrane. Only after receptor stimulation
leading to kinase activation and receptor phosphorylation,
the motif becomes accessible for AP-2 and the receptors
are then internalized (Fig. 8 B). The third group includes
monomeric plasma membrane receptors like CD4. In this
group, a serine substitutes for the acidic amino acid in the
L-based motif and the motif only becomes active after phosphorylation of this serine. This implies that receptors
belonging to this group are transported from the Golgi apparatus to the plasma membrane, as the motif is not active
at the TGN. Only after receptor stimulation at the plasma
membrane leading to PKC activation and receptor phosphorylation, the motif becomes active leading to AP-2
binding and receptor internalization (Fig. 8 C).
Received for publication 24 March 1997 and in revised form 22 May 1997.
Please address all correspondence to Carsten Geisler, Institute of Medical Microbiology and Immunology, University of Copenhagen, The Panum Institute, Building 18.3, Blegdamsvej 3C, DK-2200 Copenhagen, Denmark. Tel.: (45) 3532-7880. Fax: (45) 3532-7881. e-mail: cgtcr{at}biobase.dkWe thank Dr. M.J. Crumpton for plasmid pJ6T3
-2 and Dr. D.R. Littman
for plasmid pCD-L3T4.25. The technical help of I.B. Olsen is gratefully
acknowledged.
This work was supported by The Danish Cancer Society, The Novo Nordisk Foundation, The Danish Medical Research Council, The Danish Natural Science Research Council, Director Ib Henriksens Foundation, Gerda and Aage Haensch's Foundation, and Director Leo Nielsen and wife Karen Magrethe Nielsen Foundation for Medical Basic Research. J. Kastrup was a recipient of a scholarship from The Danish Cancer Society. J. Dietrich was a recipient of a Ph.D. scholarship from the University of Copenhagen. C. Geisler and N. Ødum are members of The Biotechnology Centre for Cellular Communication.
AP, adaptor protein; CD, clusters of diferentiation; EGFR, epidermal growth factor receptor; Ii, invariant chain; JGN, Jurkat gamma negative; MFI, mean fluorescence intensity; PDB, phorbol 12,13-dibutyrate; PE, phycoerythrin; PKC, protein kinase C; TCR, T cell receptor.
| 1. | Arnold, B., G. Schonrich, and G.J. Hammerling. 1993. Multiple levels of peripheral tolerance. Immunol. Today. 14: 12-14 [Medline]. |
| 2. | Beltzer, J.P., and M. Spiess. 1991. In vitro binding of the asialoglycoprotein receptor to the beta adaptin of plasma membrane coated vesicles. EMBO (Eur. Mol. Biol. Organ.) J. 10: 3735-3742 [Medline]. |
| 3. |
Bernot, A., and
C. Auffray.
1991.
Primary structure and ontogeny of an
avian CD3 transcript.
Proc. Natl. Acad. Sci. USA.
88:
2550-2554
|
| 4. | Bremnes, B., T. Madsen, M. Gedde-Dahl, and O. Bakke. 1994. An LI and ML motif in the cytoplasmic tail of the MHC-associated invariant chain mediate rapid internalization. J. Cell. Sci. 107: 2021-2032 [Abstract]. |
| 5. | Davies, J.D., D. Mueller, D.B. Wilson, and D.P. Gold. 1990. Nucleotide sequence of a cDNA encoding the rat T3 delta chain. Nucleic Acids Res. 18: 4617 . |
| 6. |
Dietrich, J.,
X. Hou,
A.K. Wegener, and
C. Geisler.
1994.
CD3 contains a
phosphoserine-dependent di-leucine motif involved in downregulation of
the T cell receptor.
EMBO (Eur. Mol. Biol. Organ.) J.
13:
2156-2166
[Medline].
|
| 7. |
Dietrich, J.,
X. Hou,
A.K. Wegener,
L.O. Pedersen,
N. Odum, and
C. Geisler.
1996.
Molecular characterization of the di-leucine based internalization motif of the T cell receptor.
J. Biol. Chem.
271:
11441-11448
|
| 8. |
Dietrich, J.,
A. Neisig,
X. Hou,
A.K. Wegener,
M. Gajhede, and
C. Geisler.
1996.
Role of CD3 in T cell receptor assembly.
J. Cell. Biol.
132:
299-310
|
| 9. |
Dittrich, E.,
C.R. Haft,
L. Muys,
P.C. Heinrich, and
L. Graeve.
1996.
A di-leucine motif and an upstream serine in the interleukin-6 (IL-6) signal
transducer gp130 mediate ligand-induced endocytosis and downregulation of the IL-6 receptor.
J. Biol. Chem.
271:
5487-5494
|
| 10. |
Ferber, I.,
G. Schonrich,
J. Schenkel,
A.L. Mellor,
G.J. Hammerling, and
B. Arnold.
1994.
Levels of peripheral T cell tolerance induced by different
doses of tolerogen.
Science (Wash. DC).
263:
674-676
|
| 11. |
Geisler, C..
1992.
Failure to synthesize the CD3- chain: Consequences for
T cell antigen receptor assembly, processing, and expression.
J. Immunol.
148:
2437-2445
[Abstract].
|
| 12. | Geisler, C., T. Plesner, G. Pallesen, K. Skjodt, N. Odum, and J.K. Larsen. 1988. Characterization and expression of the human T cell receptor-T3 complex by monoclonal antibody F101.01. Scand. J. Immunol. 27: 685-696 [Medline]. |
| 13. | Glickman, J.N., E. Conibear, and B.M. Pearse. 1989. Specificity of binding of clathrin adaptors to signals on the mannose-6-phosphate/insulin-like growth factor II receptor. EMBO (Eur. Mol. Biol. Organ.) J. 8: 1041-1047 [Medline]. |
| 14. | Hahn, W.C., E. Menzin, T. Saito, R.N. Germain, and B.E. Bierer. 1993. The complete sequences of plasmids pFNeo and pMH-Neo: convenient expression vectors for high-level expression of eukaryotic genes in hematopoietic cell lines. Gene (Amst.). 127: 267-268 [Medline]. |
| 15. | Heilker, R., U. Manning-Krieg, J.F. Zuber, and M. Spiess. 1996. In vitro binding of clathrin adaptors to sorting signals correlates with endocytosis and basolateral sorting. EMBO (Eur. Mol. Biol. Organ.) J. 15: 2893-2899 [Medline]. |
| 16. |
Hein, W.R., and
A. Tunnacliffe.
1990.
Characterization of the CD3 and invariant subunits of the sheep T cell antigen receptor.
Eur. J. Immunol.
20:
1505-1511
[Medline].
|
| 17. |
Hou, X.,
J. Dietrich,
N. Odum, and
C. Geisler.
1996.
The cytoplasmic tail of
Fc RIIIA is involved in signaling by the low affinity receptor for IgG.
J.
Biol. Chem.
271:
22815-22822
|
| 18. | Huang, L., and I.N. Crispe. 1993. Superantigen-driven peripheral deletion of T cells. Apoptosis occurs in cells that have lost the alpha/beta T cell receptor. J. Immunol. 151: 1844-1851 [Abstract]. |
| 19. |
Johnson, K.F., and
S. Kornfeld.
1992.
The cytoplasmic tail of the mannose
6-phosphate/insulin-like growth factor-II receptor has two signals for lysosomal enzyme sorting in the Golgi.
J. Cell. Biol.
119:
249-257
|
| 20. |
Krissansen, G.W.,
M.J. Owen,
W. Verbi, and
M.J. Crumpton.
1986.
Primary structure of the T3 subunit of the T3/T cell antigen receptor complex deduced from cDNA sequences: evolution of the T3 and subunits.
EMBO (Eur. Mol. Biol. Organ.) J.
5:
1799-1808
[Medline].
|
| 21. |
Krissansen, G.W.,
M.J. Owen,
P.J. Fink, and
M.J. Crumpton.
1987.
Molecular cloning of the cDNA encoding the T3 subunit of the mouse T3/T
cell antigen receptor complex.
J. Immunol.
138:
3513-3518
[Abstract].
|
| 22. | Kruisbeek, A.M., and D. Amsen. 1996. Mechanisms underlying T-cell tolerance. Curr. Opin. Immunol. 8: 233-244 [Medline]. |
| 23. | Letourneur, F., and R.D. Klausner. 1992. A novel di-leucine motif and a tyrosine-based motif independently mediate lysosomal targeting and endocytosis of CD3 chains. Cell. 69: 1143-1157 [Medline]. |
| 24. |
Levins, B., and
C.A.L.S. Colaco.
1992.
The CD3 -chain, transmembrane
signaling or recognition?
Immunogenetics.
35:
140-143
[Medline].
|
| 25. | Littman, D.R., and S.N. Gettner. 1987. Unusual intron in the immunoglobulin domain of the newly isolated murine CD4 (L3T4) gene. Nature (Lond.). 325: 453-455 [Medline]. |
| 26. | Lohse, M.J.. 1993. Molecular mechanisms of membrane receptor desensitization. Biochim. Biophys. Acta. 1179: 171-188 [Medline]. |
| 27. | Marks, M.S., H. Ohno, T. Kirchhausen, and J.S. Bonifacino. 1997. Protein sorting by tyrosine-based signals: adapting to the Ys and wherefores. Trends Cell Biol. 7: 124-128 . [Medline] |
| 28. |
Masui, H.,
A. Wells,
C.S. Lazar,
M.G. Rosenfeld, and
G.N. Gill.
1991.
Enhanced tumorigenesis of NR6 cells which express non-down-regulating
epidermal growth factor receptors.
Cancer Res.
51:
6170-6175
|
| 29. |
Motta, A.,
B. Bremnes,
M.A. Morelli,
R.W. Frank,
G. Saviano, and
O. Bakke.
1995.
Structure-activity relationship of the leucine-based sorting
motifs in the cytosolic tail of the major histocompatibility complex-associated invariant chain.
J. Biol. Chem.
270:
27165-27171
|
| 30. |
Nesterov, A.,
R.C. Kurten, and
G.N. Gill.
1995.
Association of epidermal
growth factor receptors with coated pit adaptins via a tyrosine phosphorylation-regulated mechanism.
J. Biol. Chem.
270:
6320-6327
|
| 31. |
Ohno, H.,
J. Stewart,
M.C. Fournier,
H. Bosshart,
I. Rhee,
S. Miyatake,
T. Saito,
A. Gallusser,
T. Kirchhausen, and
J.S. Bonifacino.
1995.
Interaction of tyrosine-based sorting signals with clathrin-associated proteins.
Science (Wash. DC).
269:
1872-1875
|
| 32. | Pearse, B.M.F.. 1988. Receptors compete for adaptors found in plasma membrane coated pits. EMBO (Eur. Mol. Biol. Organ.) J. 7: 3331-3336 [Medline]. |
| 33. | Pearse, B.M., and M.S. Robinson. 1990. Clathrin, adaptors, and sorting. Annu. Rev. Cell Biol. 6: 151-171 . |
| 34. | Pieters, J., O. Bakke, and B. Dobberstein. 1993. The MHC class II-associated invariant chain contains two endosomal targeting signals within its cytoplasmic tail. J. Cell Sci. 106: 831-846 [Abstract]. |
| 35. |
Pond, L.,
L.A. Kuhn,
L. Teyton,
M. Schutze,
J.A. Tainer,
M.R. Jackson, and
P.A. Peterson.
1995.
A role for acidic residues in di-leucine motif-based targeting to the endocytic pathway.
J. Biol. Chem.
270:
19989-19997
|
| 36. | Robinson, M.S.. 1993. Adaptins. Trends Cell Biol. 2: 293-297 . |
| 37. |
Rocha, B., and
H. von Boehmer.
1991.
Peripheral selection of the T cell
repertoire.
Science (Wash. DC).
251:
1225-1228
|
| 38. | Sandoval, I.V., and O. Bakke. 1994. Targeting of membrane proteins to endosomes and lysosomes. Trend Cell Biol. 4: 292-297 . [Medline] |
| 39. |
Sandoval, I.V.,
J.J. Arredondo,
J. Alcalde,
A.G. Noriega,
J. Vandekerchove,
M.A. Jimenez, and
M. Rico.
1994.
The residue leu(ile)475-ile(leu,
val, ala)476, contained in the extended carboxyl cytoplasmic tail, are critical for targeting of the resident lysosomal membrane protein LIMP II to
lysosomes.
J. Biol. Chem.
269:
6622-6631
|
| 40. | Schonrich, G., U. Kalinke, F. Momburg, M. Malissen, A.M. Schmitt, Verhulst, B. Malissen, G.J. Hammerling, and B. Arnold. 1991. Down-regulation of T cell receptors on self-reactive T cells as a novel mechanism for extrathymic tolerance induction. Cell. 65: 293-304 [Medline]. |
| 41. |
Sheikh, H., and
C.M. Isacke.
1996.
A di-hydrophobic Leu-Val motif regulates the basolateral localization of CD44 in polarized Madin-Darby canine kidney epithelial cells.
J. Biol. Chem.
271:
12185-12190
|
| 42. | Shin, J., C. Doyle, Z. Yang, D. Kappes, and J.L. Strominger. 1990. Structural features of the cytoplasmic region of CD4 required for internalization. EMBO (Eur. Mol. Biol. Organ.) J. 9: 425-434 [Medline]. |
| 43. |
Shin, J.,
R.L. Dunbrack,
S. Lee, and
J.L. Strominger.
1991.
Phosphorylation-dependent down-modulation of CD4 requires a specific structure
within the cytoplasmic domain of CD4.
J. Biol. Chem.
266:
10658-10665
|
| 44. |
Sorkin, A., and
G. Carpenter.
1993.
Interaction of activated EGF receptors
with coated pit adaptins.
Science (Wash. DC).
261:
612-615
|
| 45. |
Sosa, M.A.,
B. Schmidt,
K. von Figura, and
A. Hille-Rehfeld.
1993.
In vitro
binding of plasma membrane-coated vesicle adaptors to the cytoplasmic
domain of lysosomal acid phosphatase.
J. Biol. Chem.
268:
12537-12543
|
| 46. |
Sussman, J.J.,
J.S. Bonifacino,
J. Lippincott-Schwartz,
A.M. Weissman,
T. Saito,
R.D. Klausner, and
J.D. Ashwell.
1988.
Failure to synthesize the T
cell CD3- chain: structure and function of a partial T cell receptor complex.
Cell.
52:
85-95
[Medline].
|
| 47. |
Tafuri, A.,
J. Alferink,
P. Moller,
G.J. Hammerling, and
B. Arnold.
1995.
T
cell awareness of paternal alloantigens during pregnancy.
Science (Wash.
DC).
270:
630-633
|
| 48. | Trowbridge, I.S., J.F. Collawn, and C.R. Hopkins. 1993. Signal-dependent membrane protein trafficking in the endocytic pathway. Annu. Rev. Cell. Biol. 9: 129-161 . |
| 49. | Valitutti, S., S. Muller, M. Cella, E. Padovan, and A. Lanzavecchia. 1995. Serial triggering of many T-cell receptors by a few peptide-MHC complexes. Nature (Lond.). 375: 148-151 [Medline]. |
| 50. |
Valitutti, S.,
S. Muller,
M. Dessing, and
A. Lanzavecchia.
1996.
Different
responses are elicited in cytotoxic T lymphocytes by different levels of T
cell receptor occupancy.
J. Exp. Med.
183:
1917-1921
|
| 51. | Van den Elsen, P., B. Shepley, J. Borst, J.E. Coligan, A.F. Markham, S. Orkin, and C. Terhorst. 1984. Isolation of cDNA clones encoding the 20K T3 glycoprotein of human T-cell receptor complex. Nature (Lond.). 312: 413-418 [Medline]. |
| 52. | Van den Elsen, P., B. Shepley, M. Cho, and C. Terhorst. 1985. Isolation and characterization of a cDNA clone encoding the murine homologue of the human 20K T3/T-cell receptor glycoprotein. Nature (Lond.). 314: 542-544 [Medline]. |
| 53. | Vaux, D.. 1992. The structure of an endocytosis signal. Trends Cell Biol. 2: 189-192 . [Medline] |
| 54. |
Wegener, A.K.,
X. Hou,
J. Dietrich, and
C. Geisler.
1995.
Distinct domains
of the CD3- chain are involved in surface expression and function of the
T cell antigen receptor.
J. Biol. Chem.
270:
4675-4680
|
| 55. |
Wells, A.,
J.B. Welsh,
C.S. Lazar,
H.S. Wiley,
G.N. Gill, and
M.G. Rosenfeld.
1990.
Ligand-induced transformation by a noninternalizing epidermal growth factor receptor.
Science (Wash. DC).
247:
962-964
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|