|
||


* Instituto Investigación Médica Mercedes y Martín Ferreyra, 5000 Córdoba, Argentina;
Departamento Química Biológica,
Facultad Ciencias Químicas (CIQUIBIC) Universidad Nacional de Córdoba/CONICET, 5000 Córdoba, Argentina; and § Department of Neurology (Neuroscience), Harvard Medical School and Center for Neurological Diseases, Department of
Medicine (Division of Neurology), Brigham and Women's Hospital, Boston, Massachusetts 02115
In the present study, we present evidence
about the cellular functions of KIF2, a kinesin-like superfamily member having a unique structure in that its
motor domain is localized at the center of the molecule
(Noda Y., Y. Sato-Yoshitake, S. Kondo, M. Nangaku,
and N. Hirokawa. 1995. J. Cell Biol. 129:157-167.). Using subcellular fractionation techniques, isopicnic sucrose density centrifugation of microsomal fractions
from developing rat cerebral cortex, and immunoisolation with KIF2 antibodies, we have now identified a
type of nonsynaptic vesicle that associates with KIF2.
This type of organelle lacks synaptic vesicle markers (synapsin, synaptophysin), amyloid precursor protein,
GAP-43, or N-cadherin. On the other hand, it contains
gc, which is a novel variant of the
subunit of the IGF-1
receptor, which is highly enriched in growth cone membranes. Both
gc and KIF2 are upregulated by NGF in
PC12 cells and highly concentrated in growth cones of
developing neurons. We have also analyzed the consequences of KIF2 suppression by antisense oligonucleotide treatment on nerve cell morphogenesis and the
distribution of synaptic and nonsynaptic vesicle markers. KIF2 suppression results in a dramatic accumulation of
gc within the cell body and in its complete disappearance from growth cones; no alterations in the
distribution of synapsin, synaptophysin, GAP-43, or
amyloid percursor protein are detected in KIF2-suppressed neurons. Instead, all of them remained highly enriched at nerve terminals. KIF2 suppression also produces a dramatic inhibition of neurite outgrowth; this
phenomenon occurs after
gc has disappeared from
growth cones. Taken collectively, our results suggest an
important role for KIF2 in neurite extension, a phenomenon that may be related with the anterograde
transport of a type of nonsynaptic vesicle that contains
as one of its components a growth cone membrane receptor for IGF-1, a growth factor implicated in nerve
cell development.
DURING recent years it has become increasingly evident that the assembly of the neuronal cytoskeleton and the transport of membrane precursors to
the active growing tip of neuritic processes are the two basic events underlying process formation in developing neurons (Mitchison and Kirschner, 1988 The microtubule-based anterograde fast axonal transport is one of the mechanisms by which tubulovesicular
structures, synaptic membrane precursors, and nonsynaptic membrane-bound organelles are distributed along axonal processes (Hirokawa, 1996 KIF2 is one kinesin superfamily member having a
unique structure in that its motor domain is localized at
the center of the molecule (Aizawa et al., 1992 With these considerations in mind, in the present study
we examined the cellular functions of KIF2 in mammalian
neurons. To approach this problem, subcellular fractionation techniques and immunoisolation experiments of
membrane organelles with antibodies against KIF2 were
initially used to obtain some insight about the nature of
the cargo that KIF2 may transport. We then analyzed the
pattern of expression, subcellular localization, and consequences of KIF2 suppression by antisense oligonucleotide
treatment on the distribution of several growth cone membrane proteins and neurite outgrowth in PC12 cells. Taken
collectively, the results obtained suggest an important role
for KIF2 in neurite extension, a phenomenon that may be
related with the anterograde transport of a type of nonsynaptic vesicle that contains as one of its components a
growth cone membrane protein designated Cultures
The rat pheochromocytoma cell line (PC12 cells) was obtained from Dr.
Adriana Ferreira (Center Neurological Diseases, Harvard Medical
School, Boston, MA). They were grown on DME supplemented with 10%
horse serum. Cells were plated onto polylysine-treated glass coverslips
(Mascotti et al., 1997) at densities ranging from 5,000-20,000 cells/cm2. 2 d
after plating, the coverslips with the attached cells were transferred to
Petri dishes containing serum-free medium supplemented with the N2
mixture of Bottenstein and Sato (1979) Antisense Oligonucleotides
Antisense phosphorothioate oligonucleotides (S-modified) were used in
the present study. The initial experiments were performed with oligonucleotides The oligonucleotides were purchased from Quality Controlled Biochemicals (Hopkinton, MA); they were purified by reverse chromatography, and taken up in serum-free medium as described previously (Cáceres and Kosik, 1990 The administration of all oligonucleotides was as follows: after PC12
cells have differentiated in the presence of NGF for 3 d, the oligonucleotides were added to the culture medium. The medium was then supplemented with additional oligonucleotide every 12 h until the end of the experiment.
Primary Antibodies
The following primary antibodies were used in this study: an mAb against
all isoforms of Western Blot Analysis
Equal amounts of crude brain homogenates or whole cell extracts from
PC12 cells were fractionated on 7.5% SDS-PAGE and transferred to polivinylidene difluoride (PVDF) membranes in a Tris-glycine buffer, 20%
methanol. The filters were dried, washed several times with TBS (10 mM
Tris, pH 7.5, 150 mM NaCl), and blocked for 1 h in TBS containing 5%
BSA. The filters were incubated for 1 h at 37° C with the primary antibodies in TBS containing 5% BSA. The filters were then washed three times
(10 min each) in TBS containing 0.05% Tween 20, and incubated with a
secondary alkaline phosphatase-conjugated antibody (ProtoBlot Western
Blot Alkaline Phosphatase System; Promega Corp., Madison, WI) for 1 h
at 37°C. After five washes with TBS and 0.05% Tween 20, the blots were developed with bromochloro-iodolylphosphate (15 µl of a 50 mg/ml stock
solution) and nitroblue-tetrazolium (2.5 µl of a 75 mg/ml stock solution)
in 10 ml of alkaline phosphatase detection buffer (100 mM Tris, 100 mM
NaCl, 5 mM MgCl2, pH 9.5). In addition, KIF2 protein levels were measured by quantitative immunoblotting as described by Drubin et al., 1985 Preparation of Microtubules from Cytosolic Fractions
For some experiments, microtubules were prepared from cytosolic fractions obtained from the cerebral cortex of 7-d-old rats by the method of
Vallee (1982) Subcellular Fractionation and Sucrose Density
Gradient Centrifugation
Multiple fractions from 3-d-old rat cerebral cortex were prepared according to standard procedures (see Ueda et al., 1979
Immunoisolation of KIF2-containing Organelles
Immunoisolation of KIF2-containing organelles was performed as described by Okada et al. (1995) Immunofluorescence
Cells were fixed before detergent extraction and processed for immunofluorescence as previously described (DiTella et al., 1996 Morphometric Analysis of Neuronal Shape Parameters
Images were digitized on a video monitor using Metamorph/Metafluor
software (Image Universal Co.). To measure neurite length, fixed, unstained, or antibody-labeled cells were randomly selected and traced from
a video screen using the morphometric menu of the Metamorph as described previously (DiTella et al., 1996 Characterization of the Peptide Antibodies
Against KIF2
The monospecificity of the affinity-purified rabbit polyclonal antibody (BKF2) raised against a peptide corresponding to amino acid residues 526-535 of mouse KIF2 is
shown in Fig. 1 A. This antibody recognizes a single band
of ~97 kD in Western blots of whole cell homogenates
from the cerebral cortex of developing rats (Fig. 1 A, lane
1); an identical staining pattern is observed when equivalent blots are reacted with RKF2, a rabbit polyclonal antibody raised against a peptide corresponding to amino acid residues 114-123 of the KIF2 molecule (Fig. 1 A, lane 3).
The staining generated by these antibodies is completely
abolished by neutralization with the corresponding purified peptides (Fig. 1 A, lanes 2 and 4).
Fig. 1 B shows that in the cerebral cortex the expression
of the BKF2 immunoreactive protein species is higher at
early postnatal days, declining gradually but considerably
until adulthood, where the lowest levels are detected. In
addition, Western blot analysis of subcellular fractions obtained from the cortex of 3-d-old rats revealed that the 97-kD protein is relatively concentrated in the microsomal
fraction compared with the cytosol or the mitochondrial fraction (Fig. 1 C). This means that a considerable amount
of the protein recognized by the BKF2 antibody is associated with small membranous organelles, but only barely
associated with larger ones such as mitochondria (Fig. 1
C). In addition, microtubule binding experiments show
that in the absence of ATP, the 97-kD protein cosediments
with taxol-stabilized microtubules obtained from the cerebral cortex (Fig. 1 D). This binding occurs in the presence
(Fig. 1 D) or absence (not shown) of AMP-PNP; on the other hand, the 97-kD protein is released from microtubules incubated with 10 mM ATP plus 100 mM NaCl, but
not in the presence of ATP alone (Fig. 1 D).
Since all the properties described above are identical to
those previously reported for KIF2 (see Noda et al., 1995 Subcellular Distribution of KIF2
To begin analyzing the type of cargo that KIF2 may transport, microsomal fractions from rat cerebral cortex were
fractionated by isopicnic sucrose density gradient centrifugation and analyzed by immunoblotting with antibodies
against KIF2, KHC, and several membrane proteins, including synaptic and nonsynaptic vesicle constituents. This type
of approach has already proven useful to identify the type
of membrane-bound organelle transported by KIF1A, another member of the kinesin superfamily (Okada et al., 1995 Approximately 70-80% of KIF2 and KHC were recovered in the P3 (high speed pellet) fraction, while <30%
were present in the P2 (medium speed fraction) and S3
(high speed supernatant) fractions. In the P3 microsome
fraction, KHC was recovered in a fraction that extends
from 0.3 to 0.6 M sucrose (Fig. 2). By contrast, KIF2 was
recovered in a different fraction extending from 0.4 to 0.9 M
sucrose, with a peak at 0.6-0.8 M sucrose (Fig. 2). The distribution of KIF2 across the sucrose density gradient was
then compared with that of synaptophysin and synapsin I,
two well-characterized synaptic vesicle (SV) membrane
proteins (Fletcher et al., 1991
Next we compared the distribution of KIF2 with that of
three well-characterized growth cone membrane components. One of them, designated Taken collectively, these observations confirm previous
studies suggesting the existence of at least two classes of
organelles that contain SV membrane proteins: one contains synapsin I, and the other synaptophysin (Okada et
al., 1995
These results clearly and directly demonstrate that KIF2
is associated with a class of nonsynaptic, membranous organelle that contains The Expression and Subcellular Localization of KIF2 in
NGF-treated PC12 Cells
PC12 cells have proven to be an excellent model system
for studying growth cone formation, neurite outgrowth,
and the expression of structural and membrane proteins
involved in nerve cell morphogenesis (Drubin et al., 1985 Fig. 4 shows that NGF induces the expression of KIF2 in
PC12 cells (Fig. 4, lanes 1 and 2). Thus, only one band of
about 100 kDa Mr is detected when whole cell extracts
from PC12 cells, cultured for 72 h in the presence of NGF,
are resolved in SDS-PAGE, blotted and immunostained
with the anti-KIF2 antibodies (Fig. 4, lane 2). At equivalent, or even two to threefold higher protein loadings, KIF2 is barely detectable in cell extracts from PC12 cells
cultured without NGF (Fig. 4, lane 1). In addition, if NGF-differentiated (4 d) PC12 cells are deprived of the neurotrophin for 6-12 h, neurite length decreases significantly
(see Mascotti et al., 1997), as do KIF2 protein levels (Fig.
4, lane 3). These results showed that, in PC12 cells KIF2
expression (as in the case of
In the next series of experiments the spatial distribution
of KIF2 was studied by double immunolabeling with the
BKF2 antibody and an mAb that recognizes tyrosinated
Antisense Oligonucleotides Affect KIF2 Expression
Three phosphorothioate (S-modified) antisense oligonucleotides were tested for their ability to inhibit KIF2 expression. PC12 treated with NGF for 3 d and incubated for
24 h with each of the antisense oligonucleotides (5 µM
dose) described in Materials and Methods show markedly
reduced reactivity to the RKF2 antibody, as assessed by
Western blotting of whole cell extracts (Fig. 6 A; Table I).
In contrast, cells treated with sense oligonucleotides are
comparable in their immunoreactivity to untreated control cells (Fig. 6 A). Exposure to the antisense oligonucleotides
did not affect tubulin (Fig. 6 A), KHC (Fig. 6 B), dynein
(not shown),
Table I.
Effect of KIF2 Antisense Oligonucleotides on KIF2
and Tubulin Protein Levels in NGF-treated PC12 Cells
; Tanaka and Sabry,
1995
). Because axons and their growth cones lack protein
synthetic machinery, highly specialized intracellular transport mechanisms must exist to deliver appropriate cargoes
to their final destinations and/or to sites of membrane addition.
). Kinesin, the first discovered and characterized anterograde microtubule-based motor (Brady, 1985
; Scholey et al., 1985
; Vale et al.,
1985
a), has been involved in the transport of tubulovesicular organelles such as the endoplasmic reticulum (Feiguin
et al., 1994
), endosomes and lysosomes (Hollenbeck and
Swanson, 1990
; Feiguin et al., 1994
; Nakata and Hirokawa,
1995
), as well as of certain groups of vesicles containing
GAP-43, synapsin I, and amyloid precursor protein (Ferreira et al., 1992
, 1993
). However, recent studies have provided evidence indicating that kinesin is not the only anterograde microtubule-based motor involved in organelle
transport within axons. Thus, molecular genetic approaches
have identified a series of gene-encoding proteins sharing
a domain of 350 amino acids, which contains a putative ATP-binding site and a microtubule-binding domain homologous to that of kinesin heavy chain (for reviews see
Endow, 1991
; Goldstein, 1991
; Hirokawa, 1993
, 1996
). In
the particular case of murine brain tissue, a systematic
search for novel putative motors led to the initial discovery of 11 members of the kinesin superfamily (Aizawa et
al., 1992
; Kondon et al., 1994; Okada et al., 1995
; Noda et
al., 1995
; Yamazaki et al., 1995; Hirokawa, 1996
). More importantly, the function of at least some of these proteins
has already been established. For example, KIF1A, the
murine homologue of unc104 kinesin (Hall and Hedgecock, 1991
), is a monomeric motor involved in the anterograde transport of synaptic vesicle precursors (Okada et
al., 1995
), while mitochondria are conveyed anterogradely by KIF1B (Nangaku et al., 1994
).
; Noda et
al., 1995
). There is considerable interest in defining KIF2
function since this molecule may have an important role in
the transport of membranous organelles to the active
growing tip of axonal processes. Thus, KIF2 is predominantly expressed in developing brain tissue, where it is
highly enriched in growth cones and appears to be specialized for the transport of membranous organelles different
from those carried by kinesin heavy chain (KHC),1 KIF1A
(Okada et al., 1995
), KIF1B (Nangaku et al., 1994
), or KIF3A/B (Noda et al., 1995
).
gc, which is a
novel variant of the
subunit of the IGF-1 receptor
(Quiroga et al., 1995
; Mascotti et al., 1997).
Materials and Methods
. To induce the differentiation of
PC12 cells, NGF (Boehringer Mannheim Chemicals, Indianapolis, IN)
was added to the culture medium at a concentration of 50 ng/ml.
11/+14 of the sequence of mouse KIF2 (Aizawa et al., 1992
;
Noda et al., 1995
). However, because, PC12 cells are of rat origin, these
experiments were subsequently repeated using oligonucleotides corresponding to the rat KIF2 sequence. The rat sequence in the region of the
KIF2 motor domain was obtained by using nondegenerate, 18-mer mouse
primers, and performing PCR on reverse-transcribed rat brain mRNA.
An amplified band of the expected size was obtained and the DNA was
cloned and sequenced. Analysis of the obtained sequence revealed >96%
homology with the reported sequence of mouse KIF2 (Noda et al., 1995
).
One of the oligonucleotides designated ASKF2a corresponds to the sequence ACACTGCATGGCTCCGAGATG, and is the inverse complement of nucleotides +830/851 of the sequence of the motor domain of rat
KIF2; antisense oligonucleotide ASKF2b, consisting of the sequence
CACTGCATGGCTCCG, is the inverse complement of the rat nucleotides +831/845. Both of the regions selected from the sequence of the rat
KIF2 motor domain are identical to the corresponding regions in the
mouse KIF2 sequence.
; DiTella et al., 1996
). For all the experiments the antisense oligonucleotides were preincubated with 2 µl of lipofectin reagent
(1 mg/ml; GIBCO BRL, Gaithersburg, MD) diluted in 100 µl of serum-free medium. The resulting oligonucleotide suspension was then added to
the NGF-treated PC12 cells at concentrations ranging from 1-5 µM. Control cultures were treated with the same concentration of the corresponding sense-strand oligonucleotides. For some experiments, PC12 cells were
treated for 1 d with a nonmodified KHC antisense oligonucleotide designated
11/+14 hkin (Ferreira et al., 1992
, 1993
; Feiguin et al., 1994
) in order to suppress KHC expression; this antisense oligonucleotide was used
at a concentration of 50 µM.
-tubulin (clone DM1B, mouse IgG; Sigma Chemical Co.,
St. Louis, MO) diluted 1:100; an mAb against tyrosinated
-tubulin (clone
TUB-1A2, mouse IgG; Sigma Chemical Co.) diluted 1:2,000; an mAb
against KHC (clone SUK4; Ingold et al., 1988
) diluted 1:10; an mAb
against synaptophysin (clone SY38, mouse IgG; Boehringer Mannheim
Biochemicals) diluted 1:100; an mAb against GAP-43 (clone 9-1E12; Goslin and Banker, 1990
) diluted 1:1,000; an mAb against the amyloid precursor protein (Boehringer Mannheim Biochemicals) diluted 1:50; an mAb
against N-cadherin (clone GC4; Sigma Chemical Co.) diluted 1:100; an affinity-purified rabbit polyclonal antibody against synapsin I (a generous
gift of Dr. A. Ferreira) diluted 1:50; and an affinity-purified rabbit polyclonal antibody against
gc (Quiroga et al., 1995
; Mascotti et al., 1997) diluted 1:100. In addition, we generated two peptide antibodies against KIF2.
One peptide corresponds to amino acid residues 526-535 of mouse KIF2,
while the other corresponds to amino acids 114-123 of the same KIF2 molecule. The peptides were coupled to keyhole limpet hemacyanin (KLH;
Sigma Chemical Co) using glutaraldehyde as cross-linker. After emulsification with Freund's adjuvant (GIBCO BRL, Gaithersburg, MD), the resultant compounds were injected into rabbits at doses of 0.5 mg. On the third day after the third booster, the rabbits were bled from the ear, the
serum was then affinity purified using a protein A column.
(see also DiTella et al., 1996
). For such a purpose, immunoblots were
probed with the corresponding primary antibody, followed by incubation
with 125I-protein A. Autoradiography was performed on Kodak X-omat
AR film (Eastman Kodak Co., Rochester, NY) using intensifying screens. Autoradiographs were aligned with immunoblots and KIF2 protein levels
were quantitated by scintillation counting of nitrocellulose blot slices.
in the presence or absence of AMP-PNP. The association of
KIF2 with microtubules was then evaluated by Western blotting of the microtubule pellet using the anti-KIF2 antibodies. In an additional set of experiments, microtubule pellets were incubated with 10 mM ATP and 100 mM NaCl to release KIF2 from the microtubules. The presence of KIF2 in
the supernatant was also assessed by Western blotting.
; Kondo et al., 1994
).
Briefly, rat cerebral cortex was gently homogenized with 10× vol of ice-cold
0.32 M sucrose, 10 mM Hepes, pH 7.4. The homogenate was centrifuged
at low speed (3,000 g) for 10 min at 4° C. The supernatant was centrifuged
at medium speed (9,200 g) for 15 min. The medium speed supernatant was
again centrifuged at high speed (100,000 g) for 60 min to yield a cytosolic
fraction (Fig. 1, S3) and a microsomal one (Fig. 1, P3). All the obtained fractions (supernatants and pellets) were then subjected to electrophoresis, transferred to PVDF membranes, and probed with the antibodies against KIF2. For some experiments, the microsomal fraction was further
applied to a 0.3-1.6 M sucrose density gradient at 48,000 rpm for 2 h in a
Sorvall STS 60.4 rotor (Sorvall Instruments, Newtown, CT). 0.3-ml fractions were collected from 4-ml tubes; they were then centrifuged at
100,000 g, and the resulting pellets resuspended in Laemmli buffer. The
same volume from each fraction was applied to SDS-PAGE and transferred to PVDF membrane. Fractions were then analyzed by immunoblotting with antibodies against KIF2, KHC, synaptic vesicle markers, and
growth cone membrane components.
Fig. 1.
(A) Specificity of the affinity-purified peptide antibodies against KIF2 as revealed by Western blot analysis of whole
tissue extracts from the cerebral cortex of 3-d-old rats reacted
with the BKF2 (diluted 1:100; lane 1), or RKF2 (diluted 1:100;
lane 3). Both antibodies stain a single immunoreactive protein
species with an apparent molecular weight of 97 kD. The staining
generated by these antibodies is completely abolished by neutralization with the corresponding purified peptides (lanes 2 and 4).
20 µg of total protein was loaded in each lane. (B) The expression
of KIF2 in the developing rat cerebral cortex as revealed by
immunoblot analysis of whole tissue extracts. P1-P14, Post-natal
d 1-14; Ad, adult. KIF2 is highly expressed in the developing cerebral cortex. The blot was reacted with RKF2 (dilution 1:100);
40 µg of total protein were loaded in each lane. (C) Western blot
analysis of subcellular fractions obtained from the cerebral cortex
of 3-d-old rats showing that KIF2 is highly enriched in the microsomal fraction (P3). CE, crude extract; S1, low speed supernatant; P1, pellet 1; S2, medium speed supernatant; P2, pellet 2; S3,
high speed supernatant; P3, pellet 3 or microsomal fraction. The
blot was reacted with RKF2 (dilution 1:100); 20 µg of protein was
loaded in each lane. (D) KIF2 precipitates with microtubules prepared from cytosolic fractions of developing rat cerebral cortex
by the method of Vallee (1982; see Materials and Methods). The
presence of KIF2 or KHC in the microtubule pellet was then assessed by Western blotting with the BKF2 (dilution 1:25) or SUK
4 (dilution 1:100) antibodies. CE, crude extract; CS, cytosolic
fraction; S, supernatant after microtubule pelleting in the presence of AMP-PNP; P, microtubule pellet obtained in the presence of AMP-PNP; S, supernatant fraction after microtubule
pelleting in the presence of ATP (10 mM); P, microtubule pellet
in the presence of ATP (10 mM); S, supernatant fraction after microtubule pelleting in the presence of ATP (10 mM) plus NaCl
(100 mM); P, microtubule pellet in the presence of ATP (10 mM)
plus NaCl (100 mM). Note that KIF2, as opposed to KHC, is only
slightly released from microtubules in the presence of ATP.
[View Larger Version of this Image (65K GIF file)]
. Thus, for this experiment anti-KIF2 antibodies were covalently attached to protein A-Sepharose beads via dimethylpimelumidate. Microsomal fractions were incubated with these beads at
4°C for 6 h, and the beads were recovered by centrifugation (5,000 rpm for
120 s), and washed with 20 mM Hepes, 100 mM K-aspartate, 40 mM KCl,
5 mM EGTA, 5 mM MgCl2, 2 mM Mg-ATP, 1 mM DTT, pH 7.2, supplemented with several protease inhibitors. The supernatant was spun down
(75,000 rpm for 30 min) to collect the remaining organelles. Immunoblotting was then performed as previously described with antibodies against
gc, KHC, synaptophysin, synapsin I, and amyloid precursor protein
(APP).
). The antibody
staining protocol entailed labeling with the first primary antibody, washing with PBS, staining with labeled secondary antibody (fluorescein- or
rhodamine-conjugated) and washing similarly; the same procedure was repeated for the second primary antibody. Incubations with primary antibodies were for 1 or 3 h at room temperature, while incubations with secondary antibodies were performed during 1 h at 37°C. The cells were
observed with an inverted microscope (Axiovert 35M; Carl Zeiss, Inc.,
Thornwood, NY) equipped with epifluorescence and differential interference contrast (DIC) optics and photographed using either a ×40, a ×63 or
×100 objective (Carl Zeiss, Inc.) with Tri X-Pan or T-MAX 400 ASA film
(Eastman Kodak Co.). Exposures times ranged from 45 to 60 s.
). All measurements were performed using DIC optics at a final magnification of ×768. Differences
among groups were analyzed by the use of ANOVA and Student-Newman Keuls test.
Results
),
we conclude that our antibodies effectively recognize
KIF2 and not a different protein having a similar molecular weight.
).
). The results obtained
showed that synaptophysin was recovered in lighter fractions (0.3-0.6 M) than those enriched in KIF2, while synapsin I was recovered in fractions extending from 0.6 to 1.0 M
sucrose (Fig. 2). The staining for synapsin I overlapped
with that of KIF2, but the peak fractions were different.
Fig. 2.
The binding of KIF2 to membrane vesicles. Microsome
fraction from developing rat cerebral cortex was fractionated by
sucrose gradient centrifugation, and the same volume from each
fraction was applied to SDS-PAGE, transferred to PVDF membranes, and analyzed by immunoblotting with antibodies against
KHC, KIF2, synaptophysin (p38), synapsin I (Sin I),
gc, APP,
GAP-43, and N-cadherin (N-Cad). Note that the peak fractions
of KIF2 and
gc are highly coincident.
[View Larger Version of this Image (76K GIF file)]
gc (a novel variant of the
-subunit of the IGF-1 receptor, which is highly enriched
in growth cone membranes; Quiroga et al., 1995
; Mascotti
et al., 1997), displayed a striking codistribution with KIF2,
being highly enriched in the 0.6-0.8 M sucrose fractions (Fig. 2). On the other hand, GAP-43 (Goslin et al., 1989)
and APP (Ferreira et al., 1993
; Yamazaki et al., 1995b
) distributed across the sucrose gradient with a pattern clearly
different from that of KIF2 (Fig. 2). Thus, GAP-43 was recovered in all fractions of the sucrose gradient (0.3-1.6 M),
while APP was enriched in either lighter (0.3-0.6 M) or
heavier (1.0-1.6 M) fractions than those containing KIF2.
The pattern of distribution of N-cadherin, a cell-adhesion
molecule, was also compared with that of KIF2; this protein displayed a uniform distribution across the sucrose gradient, showing no enrichment in the fractions containing KIF2 or
gc (Fig. 2).
). The former appears to be transported by KHC
(Ferreira et al., 1992
), while the latter by KIF1A (Okada
et al., 1995
). Our observations also suggest the existence of
another type of organelle that appears to contain a nonsynaptic growth cone membrane component, namely
gc,
and KIF2. However, because other KIFs (KHC, KIF1A,
and KIF3; Kondo et al., 1994
; Okada et al., 1995
) are also
present in these fractions, definite conclusions cannot be
drawn on the motor for the
gc-containing organelles. Besides, the relationship between synaptophysin- and synapsin I-containing organelles with the ones enriched in
KIF2 is also unclear, given that some degree of overlap exists among the fractions containing these proteins. Therefore, to clarify some of these points and directly determine
the relationship between KIF2 and
gc, immunoisolation
of organelles from the microsomal fraction was performed
with antibodies against KIF2. The remaining organelles
were recovered by pelleting from the supernatant fraction. Fig. 3 shows that with this method, the KIF2-containing
organelles were quantitatively collected. In this immunoisolated organelle fraction
gc was quantitatively recovered (Fig. 3 A). In contrast, KHC (Fig. 3 B), synaptophysin
(Fig. 3 C), or synapsin (not shown) were not, or were only
slightly detectable in this fraction. These proteins were
quantitatively recovered in the remaining organelle fraction. They were not detected in the supernatant fraction
after pelleting the remaining organelles, effectively ruling
out the possibility that the lack of these proteins in the
KIF2 organelle-containing fraction was due to dissociation during the immunoisolation procedure.
Fig. 3.
Immunoisolation
of
gc-containing organelles
with the BKF2 antibody (dilution 1:20). Lane 1, microsome fraction before immunoprecipitation. Lanes 2 and 3, microsome fraction incubated with BKF2 preimmune serum
pellet (lane 2)
and remanent organelles
(lane 3). Lanes 4 and 5, microsome fraction incubated
with BKF2
pellet (lane 4) and remanent organelles (lane 5). Each of these fractions was applied to SDS-PAGE, transferred to PVDF membranes, and analyzed by immunoblotting with antibodies against
gc, KHC, or
synaptophysin. Note that
gc, but not KHC or synaptophysin
(p38) is quantitatively recovered in the immunoisolated fraction
(lane 4); only a faint band is detected in the remanent organelle
fraction (lane 5).
[View Larger Version of this Image (77K GIF file)]
gc as one of its components. However, they do not provide evidence about the in vivo relationship between KIF2 expression and the transport of
gc-containing organelles, and/or the functional role of
KIF2 during neuronal morphogenesis. Therefore, to obtain evidence about these aspects we decided to examine
the pattern of expression and subcellular distribution of
KIF2, as well as the consequences of KIF2 suppression on
the distribution of
gc in PC12 cells. In this cell system,
gc
expression is upregulated by NGF and highly correlated
with neurite outgrowth. Even more importantly, in NGF-treated PC12 cells,
gc is selectively concentrated in the
proximal growth cone region in vesicle-like structures, clearly different from those containing synaptophysin or
synapsin I (Mascotti et al., 1997), a phenomenon that also
suggests that
gc may be transported to the growth cone
area by a motor different from KHC or KIF1A.
;
Greene et al., 1987
; Bearer, 1992
; Ezmaeli-Azad et al.,
1994; Mascotti et al., 1997). In the absence of NGF, PC12 cells have a round morphology with no neurites or growth
cone-like structures. Upon stimulation with NGF, they extend several neurites tipped by well-defined growth cones,
which are highly enriched with several SV and non-SV
membrane markers, such as synaptophysin and
gc (Mascotti et al., 1997).
gc; Mascotti et al., 1997) is
tightly controlled by NGF as well as differentiation.
Fig. 4.
KIF2 expression in
PC12 cells. Immunoblot analysis of whole cell extracts from
nontreated (lane 1) or NGF-treated (lane 2) PC12 cells reacted with the BKF2 antibody
(dilution 1:50). NGF induces
the expression of a single KIF2
immunoreactive protein species with an apparent molecular mass of 97 kD. Note that
KIF2 is barely detected in undifferentiated PC12 cells.
When NGF-differentiated PC12
cells were deprived of the neurotrophin for 6 h, KIF2 becomes considerably less abundant (lane 3) than in control
ones (lane 2). 40 µg of protein
were loaded in each lane and
the immunoblots were revealed using a rabbit ProtoBlot (Promega) staining kit. PC12 cells were treated with
NGF (50 ng/m) for 3 d.
[View Larger Version of this Image (49K GIF file)]
-tubulin (clone TUA 1.2). PC12 cells cultured in the absence of NGF have a round or polygonal morphology (Fig.
5 A, tubulin antibody), and exhibit very weak immunofluorescence when incubated with the KIF2 antibody (Fig. 5
B). As expected, a significant increase in KIF2 immunofluorescence becomes evident when PC12 are cultured in the
presence of NGF. This phenomenon is detected ~48 h after the addition of NGF, when PC12 cells begin to acquire
a neuron-like morphology. At this stage, the cells have
several short neurites tipped with small growth cones.
KIF2 immunofluorescence is preferentially localized to
the perinuclear region and to the growth cones (Fig. 5 D;
compare with tubulin staining in Fig. 5 C). An exception is
the occasional short neurites that contain a continuous
band of granular staining between the perinuclear region
and the growth cones. After 72 h in the presence of NGF,
PC12 cells have extended several long neurites that ended
in prominent growth cones. At this stage KIF2 immunostaining has become very intense within the growth cone area, but has disappeared completely from neuritic shafts;
a similar pattern is detected in PC12 cells cultured with
NGF for longer periods of time (3-7 d). Observation of
the growth cones at high magnification demonstrates that
KIF2 staining labels a punctate organelle pattern (Fig. 5, E
and F).
Fig. 5.
KIF2 becomes localized to growth cones in
differentiated PC12 cells.
Double immunofluorescence
micrographs showing the distribution of tyrosinated
-tubulin (A, C, and E) and KIF2
(B, D, and F) in PC12 cells.
PC12 cells, cultured in the
absence of NGF, display low
positive immunofluorescence
for the RKF2 antibody (A
and B). A dramatic increase
in KIF2 immunofluorescence
is detected in PC12 cells
treated with NGF for 2 d. In
these cells, KIF2 is localized to the perinuclear region and
highly enriched in growth
cones (arrowheads). High
power micrographs of neuritic tips reveal a granular
(vesicle-like) appearance of
the KIF2 immunostaining (F). Bars: 10 µm.
[View Larger Version of this Image (66K GIF file)]
gc (Fig. 6 C), or synaptophysin (Fig. 6 D) immunoreactivity by the same assay. The presence of normal
levels of these proteins in the KIF2-suppressed cells suggests that the effect of the antisense treatment is specific
and that the regulation of the expression of other motor
proteins (e.g., KHC or dynein) is independent of KIF2.
Fig. 6.
Effect of the KIF2 antisense oligonucleotide ASKF2a
(5 µM) on KIF2 (A), tyrosinated
-tubulin (A), KHC (B),
gc
(C), and synaptophysin (D) protein levels as revealed by Western
blot analysis of whole cell homogenates obtained from PC12
cells. For this experiment PC12 cells cultured in the presence of
NGF were treated for 24 h with the ASKF2a oligonucleotide.
Antisense treatment was initiated 3 d after the addition of NGF
(50 ng/ml). Control cultures were treated with equivalent doses
of sense oligonucleotides. (A) Blot reacted with antibodies
against KIF2 (RKF2 diluted 1:50) and tyrosinated
-tubulin
(mAb TUB-1A2), or with mAb SUK 4 (B), or with an affinity-purified polyclonal antibody against
gc (C), or with mAb SY38
(D). 30 µg of total cellular protein were loaded in each lane.
Blots were revealed using the ProtoBlot staining kit (Promega).
[View Larger Version of this Image (75K GIF file)]
Distribution of
gc in Antisense-treated Neurons
Next we examined the distribution of
gc, synaptophysin, synapsin I, GAP-43, and APP in control and KIF2 antisense oligonucleotide-treated PC12 cells. As expected,
KIF2 immunofluorescence is significantly reduced in differentiated PC12 cells treated with the ASKF2a or ASKF2b
antisense oligonucleotides (not shown). A dramatic alteration in the distribution of
gc is also detected (Fig. 7).
Thus, while in nontreated or sense-treated differentiated
control PC12 cells
gc is selectively and highly enriched at
growth cones (Fig. 7, A and B), in the KIF2 antisense-treated cells, all of the labeling is present within the cell
body, being completely absent from neuritic shafts including their tips (Fig. 7, C-F). By contrast, the distribution of
synaptophysin, synapsin I, APP, and GAP-43 is unaltered
in the KIF2 antisense-treated cells when compared with
that observed in the control cells (nontreated or sense-treated); thus, all of these proteins are highly concentrated
within the perinuclear region, presumably the Golgi complex, and the growth cones (Figs. 8, A-H, and 9, A and B).
gc
in NGF-differentiated PC12
cells. (A and B) Double
immunofluorescence micrographs showing tubulin (A)
and
gc (B) staining in PC12
cells from a culture treated
with a KIF2 sense oligonucleotide (5 µM). Note that
gc immunofluorescence is
preferentially localized at
neuritic tips (arrowheads). (C
and D) Double immunofluorescence micrographs showing tubulin (A) and
gc (B)
staining in PC12 cells from a culture treated with ASKF2a
oligonucleotide (5 µM). Note
the complete disappearance
of
gc from neuritic tips (arrowheads). For these experiments, cells were cultured in
serum-free medium in the
presence of NGF (50 ng/ml).
On day 3, after the addition
of NGF, the cells were
treated with KIF2 antisense
or sense oligonucleotides for a 24-h period; they were then
fixed and processed for immunofluorescence as described in Materials and
Methods. Bar, 10 µm.
gc, but not of synaptophysin, GAP-43, or synapsin I in NGF-treated PC12 cells. (A-D) Double immunofluorescence micrographs showing the distribution of
gc (A and C), synaptophysin (B), and GAP-43 (D) in
NGF-differentiated PC12 cells treated with a KIF2 antisense oligonucleotide (ASKF2a, 5 µM). Note that while
gc completely disappears from growth cones (arrows), synaptophysin and GAP-43 remain highly concentrated at neuritic tips. (E and F) Double immunofluorescence micrographs showing the distribution of tyrosinated
-tubulin (E) and synapsin I (F) in NGF-differentiated PC12 cells
treated with ASKF2a (5 µM). Note that synapsin I is highly concentrated at neuritic tips. For these experiments, cells were treated with
oligonucleotides as described in Fig. 7. Bar, 10 µm.
To determine if other motors may participate in
gc
transport, cells were treated with KHC antisense oligonucleotides. As shown in Fig. 9, KHC suppression does not
alter the distribution of
gc (Fig. 9, C and D); however, and
as previously described (see Ferreira et al., 1993
; Yamazaki
et al., 1995b
) this treatment produces a dramatic reduction
of APP immunolabeling at the growth cone and a concomitant accumulation within the cell body (Fig. 9, C and D).
gc (A) and APP (B)
in NGF-differentiated PC12 cells treated with the KIF2
antisense oligonucleotide
ASKF2b (5 µM). Note that
while
gc completely disappears from growth cones (arrowheads) APP remains
highly concentrated at neuritic tips. (C and D) Double
immunofluorescence micrographs showing the distribution of
gc (C) and APP (D)
in NGF-differentiated PC12
cells treated with the KHC
antisense oligonucleotide -11/
14 hkin (50 µM). Note that
while this treatment does
not affect the growth cone localization of
gc, it dramatically decreases APP immunofluorescence at neuritic tips.
For these experiments, cells
were treated with antisense oligonucleotides as described
in Fig. 7. Bar, 10 µm.
Effect of KIF2 Antisense Oligonucleotides on Neurite Extension
During the course of these experiments it became evident that one additional effect of KIF2 suppression was a reduction in the length of PC12 neurites. Therefore, to precisely examine this effect, neurite extension was measured in NGF-treated PC12 cells after either a 24- or a 36-h exposure to the KIF2 antisense oligonucleotides. When PC12-treated with NGF for 3 d are exposed to the ASKF2a antisense oligonucleotide (5 µM) and fixed 24 h later there is a slight decrease in neurite length. In the antisense-treated cultures, the mean total neurite length per cell is 225 ± 5 µm, a value lower than that observed in control (260 ± 8 µm) or sense-treated (265 ± 8 µm) cells. Neurite length in neurons exposed to KIF2 antisense oligonucleotides (5 µM) for 36 h is quantitated in Table II. These cells exhibit a 60-70% decrease in neurite length. Our observations also show that the KIF2 antisense oligonucleotides affected neurite outgrowth in a dose-dependent manner; thus, at 2.5 µM the total neurite length was reduced 35% and at 1 µM it was only reduced 15% (Table II). While suppressing KIF2 expression, the KIF2 antisense oligonucleotides did not irreversibly damage the neurons. When, after 36 h in the presence of the antisense oligonucleotides, the cells are released from antisense inhibition by changing the medium, neurite extension resumed at a rate that paralleled that observed under control conditions (see below).
|
Table II. Effect of KIF2 Antisense Oligonucleotides on Neurite Length in NGF-treated PC12 Cells |
In the final set of experiments, we used quantitative fluorescence and the morphometry of fixed cells to analyze
expression of KIF2 and compare it with both the time
course of
gc disappearance from the growth cone area,
and the reduction of neurite length in PC12 cells treated
with the ASKF2a antisense oligonucleotide for different
periods of time. The results obtained show that the decrease in KIF2 immunofluorescence precedes the disappearance of
gc from the growth cone area, a phenomenon
which in turn precedes the decrease in neurite length by
several hours (Fig. 10, A and B). Similarly, when the cells
are released from the antisense treatment the reexpression
of KIF2 precedes the redistribution of
gc to the growth
cone, a phenomenon which is then followed by an increase
in neurite length (Fig. 10, A and B).
gc (diamonds) immunofluorescence in NGF-differentiated PC12
cells. After 3 d in the presence of NGF (50 ng/ml), the cells were
treated with ASKF2a (5 µM; solid arrow) for 36 h; at this time
point (open arrow), the medium was changed and the cells maintained in antisense-free medium in the presence of NGF. Control
cultures (open symbols) were treated with equivalent doses of the
corresponding sense oligonucleotide. KIF2 immunofluorescence
was measured in the cell body and growth cones. Only the values
obtained from cell body measurements are presented; identical
results were obtained from measurements performed within the
growth cone area.
gc immunofluorescence was quantitated in
the growth cone area. At least 100 cells were measured for each
time point and experimental condition. Each value represents the
mean ± SEM. (B) Graph showing changes in neurite length
(mean total neuritic length per cell) in control (sense treated) and
KIF2 antisense (ASKF2a, 5 µM) oligonucleotide-treated PC12
cells. Each value represents the mean ± SEM. A total of 50 cells
were measured for each time point and experimental condition. Note that in the antisense-treated cultures the drop in KIF2 and
gc immunofluorescence precedes the reduction of neurite length, and that when cells are released from the antisense treatment the
appearance of KIF2 immunofluorescence precedes that of
gc within the growth cone, a phenomenon which is then followed by an increase in neurite length.
KIF2 and the Subcellular Distribution of
gc
The present results confirm and extend previous observations by Noda et al. (1995)
suggesting that KIF2 is an anterograde microtubule-based motor involved in the transport of a class of nonsynaptic membrane organelles
abundant in developing neurons. The new information
presented here suggests that at least one of the components transported by KIF2 is
gc, a growth cone nonsynaptic membrane protein (Quiroga et al., 1995
; Mascotti et al.,
1997). Thus, one striking finding in KIF2-suppressed PC12
cells is the altered distribution of
gc. In untreated cells, or
cells treated with sense oligonucleotides,
gc is found selectively concentrated within growth cones. In antisense-treated cells, on the other hand,
gc is confined to the cell
body.
Several observations suggest that this effect is the result
of a specific and selective blockade of KIF2 expression by
the antisense treatment. First, sequence analysis of the regions of the KIF2 mRNAs selected for designing the antisense oligonucleotides reveals no significant homology with
any other reported sequence, including other members of
the kinesin superfamily. In addition, none of the S-modified antisense oligonucleotides used in this study contains
four contiguous guanosine residues, which are believed to
increase oligomer affinity to proteins, and hence generate nonspecific antisense inhibitory effects (Wagner, 1995
).
Secondly, the antisense oligonucleotide treatment dramatically reduces KIF2 protein levels without altering the levels of several other proteins including tubulin, KHC, dynein, synaptophysin, GAP-43, and
gc; this is important
since some of these proteins have been directly implicated
in neurite formation (Yankner et al., 1990
; Ferreira et al.,
1992
). Third, the effects of the antisense oligonucleotides are dose dependent and not observed when the cells are
treated with equivalent doses of the corresponding sense
oligonucleotides. In addition the effects are also observed
when the antisense oligonucleotides are used at very low
concentrations (2.5 µM), a phenomenon which also contributes to rule out the possibility of nonspecific binding of
the oligonucleotides to proteins (Wagner, 1995
). Fourth,
the antisense treatment does not cause irreversible damage to the cells; PC12 cells recover the normal distribution
of
gc following a change to medium free of the antisense
oligonucleotide. Fifth, KIF2 suppression selectively alters
gc distribution without affecting the subcellular localization of several other growth cone components, including
synaptophysin, synapsin I, APP, and GAP-43, which are transported to the neurite terminus by other microtubule-based anterograde motors, such as KIF1A and KHC (Ferreira et al., 1992
, 1993
; Okada et al., 1995
). Conversely, the
distribution of
gc is not modified by KHC antisense oligonucleotides, a treatment that significantly disrupts the
growth cone localization of APP (Ferreira et al., 1993
;
Yamazaki et al., 1995b
; this study) or GAP-43 (Ferreira et
al., 1992
).
Several additional lines of evidence also support the
idea that KIF2 may serve as the plus-end motor involved
in the anterograde transport of
gc-containing vesicles.
First, analysis of subcellular fractions obtained by SDG
centrifugation of microsomal fractions revealed a striking
colocalization of KIF2 with
gc. Second, and even more
important, immunoisolation experiments allow us to isolate the KIF2 cargo from other organelles and determine
that the KIF2 cargo contained
gc, but lacked synaptophysin, synapsin I, and KHC. Third, both KIF2 and
gc are
predominantly expressed in developing brain tissue, upregulated by NGF, and highly enriched in growth cone
membrane preparations obtained from fetal brain tissue
(Noda et al., 1995
; Quiroga et al., 1995
). Finally, immunofluorescence studies show that within growth cones
gc associates with a type of vesicle-like structure different from
those containing synaptophysin and synapsin I (Mascotti
et al., 1997).
The present observations also support the notion that in
developing neurons KIF2 function is significantly different
from the one performed by other members of the central
motor domain subfamily in nonneuronal cells. Thus, all
other KIF2-related proteins have been implicated in mitosis and spindle elongation (Wordeman and Mitchison,
1995
; Walczak et al., 1996
). While this seems to be an unexpected finding, it is worth noting that divergence in function among filogenetically related kinesin superfamily
members may not be an unusual phenomenon. In fact, a
similar situation exists in the case of KIFC2 that, unlike
other COOH-terminal kinesin related proteins of the
KAR3 family involved in mitosis and meiosis, appears to
participate in the retrograde transport of a subpopulation of membrane bound organelles present in neuronal cells
(Hanton et al., 1997
; Saito et al., 1997
). It will now be of
considerable interest to begin analyzing the nature of this
functional divergence.
KIF2 Participation in Neurite Extension
Analysis of the in situ distribution of KIF2 revealed that it
is expressed in postmitotic neurons and concentrated in
axonal processes of developing neurons (Noda et al.,
1995
). The present study extends these observations by
showing that KIF2 expression is upregulated by environmental factors such as NGF and that its induction profile
closely parallels neurite extension in PC12 cells. Furthermore, NGF withdrawal not only causes neurite retraction, but also a precipitous drop in KIF2 protein levels. It follows that KIF2 expression is strictly regulated by NGF and
thus, is a differentiation product of PC12 cells; in contrast
to KHC, which is expressed in proliferative and non-proliferative cells (Feiguin et al., 1994
). The upregulation of
KIF2 expression in NGF-treated PC12 cells puts this molecule in a similar category to MAP1b and tau
two structural MAPs whose expression is induced by NGF (Drubin et al., 1985
; Aletta et al., 1988
), and that have been directly implicated in neurite extension in PC12 cells (Brugg et al.,
1993
; Esmaeli-Azad et al., 1994
). The analysis of the phenotype of KIF2-suppressed PC12 cells provides direct evidence about its participation in neurite extension; thus, a
24- or 36- h exposure to KIF2 antisense, but not sense, oligonucleotides results in a significant reduction in neurite
length. Interestingly, neurite growth is also impaired in
KHC-suppressed neurons, a phenomenon which has been
related with the blockade of the anterograde transport of
the growth cone regulatory protein, GAP-43 (Ferreira et
al., 1992
).
While the mechanism(s) by which KIF2 participates in
neurite extension are currently unknown, one obvious
possibility, as in the case of KHC, relates with the nature
and final destination of the cargo that it transports. For example, the KIF2 cargo may contain regulatory proteins
that when appropriately delivered to the growth cone will
actively participate in neurite outgrowth. Such cargo types
may include receptor proteins for certain types of neuritogenic factors, as it might be the case for the
gc-containing IGF-1 receptors. In this regard, one question that arises
concerns the possible relationship between the altered distribution of
gc and the inhibition of neurite outgrowth observed in KIF2-suppressed PC12 cells.
IGF-1 appears to function in most cells primarily as a
mitogenic peptide, but in the particular case of the developing nervous system it also functions as a neurotrophic
factor promoting neurite outgrowth (Aizenmann and De
Vellis, 1987
; Caroni and Grandes, 1990
; Beck et al., 1993
;
Ishii et al., 1993
). The receptor for IGF-1 resembles the insulin receptor, and is a disulfide-linked heterotetrameric
(
2
2) transmembrane glycoprotein, with extracellular ligand-binding (
) and intracellular tyrosine kinase (
) domains (Ullrich et al., 1986
). The expression of IGF-1 receptors in the nervous system is high at late embryonic and
early postnatal stages and declines significantly afterwards
(Ullrich et al., 1986
; Werner et al., 1991
), again suggesting
an important role for this ligand-receptor system in brain
development. Interestingly, IGF-1 and its receptor, as well
as KIF2, are expressed permanently in the olfactory bulb where neuronal remodeling and neurite outgrowth continue throughout adult life (Bondy, 1991
; Noda et al.,
1995
); and transgenic mice lacking IGF-1 receptors exhibit
serious deficits in neural development (Liu et al., 1993
).
In developing neurons, the expression of
gc-containing
IGF-1 receptors, but not of other
subunits (
other) of the
insulin or IGF-1 receptors, is correlated with neurite outgrowth, growth cone formation, and (in PC12 cells) is
highly dependent on NGF (Mascotti et al., 1997). Taken
together, these observations raised the idea that the different functions of IGF-1 (mitogenic or neuritogenic actions)
may result from the contrasting regulations and distributions of
gc-containing IGF-1 versus
other-containing insulin/IGF-1 receptors in developing neurons. Thus, an altered distribution of
gc-containing IGF-1 receptors is
compatible with the reduction of neurite length observed
in KIF2-suppressed neurons. In this regard, it is worth noting that the disappearance of
gc from growth cones precedes the reduction in neurite length; the opposite phenomenon was not observed under the present experimental
conditions. However, definite conclusions on this matter
will certainly depend on a more detailed characterization
of the biological role of
gc-containing IGF-1 receptors as
well as of the identification of other components present
in the KIF2-transported cargo. Given that other members
of the central motor domain subfamily are involved in
spindle elongation (Walczak and Mitchison, 1996), it will
also be of interest to explore the possible participation of
KIF2 in the regulation of microtubule organization and/or
dynamics. Studies are in progress to address these and related issues.
Received for publication 6 March 1997 and in revised form 15 May 1997.
This paper is dedicated to NIS and MFM.This work was supported by grants from CONICOR, Fundación Perez-Companc, Fundación Antorchas, and a Fogarty International Collaborative Award (FIRCA). It was also supported by a Howard Hughes Medical Institute grant HMMI 75197-553201 (to A. Cáceres) awarded under the International Research Scholars Program. G. Morfini is a fellow from the National Council of Research from Argentina (CONICET).
APP, amyloid precursor protein; KHC, kinesin heavy chain; PVDF, polyvinylidene difluoride; SV, synaptic vesicle.
| 1. |
Aizawa, H.,
Y. Sekine,
R. Takemura,
Z. Zhang,
M. Nangaku, and
N. Hirokawa.
1992.
Kinesin family in murine central nervous system.
J. Cell. Biol.
119:
1287-1296
|
| 2. | Aizenmann, Y., and J. De Vellis. 1987. Brain neurons develop in a serum glial free environment: effects of insulin, insulin-like growth factor-I and thyroid hormone on neuronal survival, growth and differentiation. Brain Res. 406: 32-42 [Medline]. |
| 3. |
Aletta, J.M.,
S.A. Lewis,
N.J. Cowan, and
L.A. Greene.
1988.
Nerve growth factor regulates both the phosphorylation and steady state levels of microtubule-associated protein 1.2 (MAP1.2).
J. Cell Biol.
106:
1573-1581
|
| 4. | Bearer, E.. 1992. An actin-associated protein present in the microtubule organizing center and the growth cones. J. Neurosci. 12: 750-761 [Abstract]. |
| 5. | Beck, K., B. Knusel, and F. Hefti. 1993. The nature of the trophic action of BDNF, des (1-3) IGF1, and bFGF on mesencephalic dopaminergic neurons developing in culture. Neuroscience. 52: 855-866 [Medline]. |
| 6. |
Binder, L.,
A. Frankfurter,
H. Kim,
A. Cáceres,
M. Payne, and
L. Rebhun.
1984.
Heterogeneity of microtubule-associated protein 2 during rat brain development.
Proc. Natl. Acad. Sci. USA
81:
5613-5617
|
| 7. | Bondy, C.A.. 1991. Transient IGF-1 gene expression during the maturation of functionally related central projection neurons. J. Neurosci. 11: 3442-3455 [Abstract]. |
| 8. |
Bottenstein, J., and
G. Sato.
1979.
Growth of a rat neuroblastoma cell line in a serum-free supplemented medium.
Proc. Natl. Acad. Sci. USA.
76:
514-517
|
| 9. | Brady, S.T.. 1985. A novel brain ATPase with properties expected for the fast axonal transport motor. Nature (Lond.). 317: 73-75 [Medline]. |
| 10. |
Brugg, B.,
D. Reddy, and
A. Matus.
1993.
Attenuation of microbubule-associated protein 1 expression by antisense oligodeoxynucleotides inhibits initiation of neurite outgrowth.
Neuroscience
52:
489-496
[Medline].
|
| 11. | Cáceres, A., and K. Kosik. 1990. Inhibition of neurite polarity by Tau antisense oligonucleotides in primary cerebellar neurons. Nature (Lond.). 343: 461-463 [Medline]. |
| 12. | Caroni, P., and P. Grandes. 1990. Nerve sprouting in innervated adult skeletal muscle induced by exposure to elevated levels of insulin-like growth factors. J. Cell Biol. 110: 267-310 . |
| 13. | DiTella, M., F. Feiguin, N. Carri, K. Kosik, and A. Cáceres. 1996. MAP-1b/Tau functional redundancy during laminin-enhanced axonal growth. J. Cell Sci. 109: 467-477 [Abstract]. |
| 14. |
Drubin, D.,
S. Feinstein,
E. Shooter, and
M. Kirschner.
1985.
Nerve growth factor-induced neurite outgrowth in PC12 cells involves the coordinate induction of microtubule assembly and assembly promoting factors.
J. Cell Biol.
101:
1799-1807
|
| 15. | Endow, S.. 1991. The emerging kinesin family of microtubule motor proteins. Trends Biochem. Sci. 16: 221-225 [Medline]. |
| 16. | Esmaeli-Azad, B., J. McCarty, and S.C. Feinstein. 1994. Sense and antisense transfection analysis of tau function: tau influences net microtubule assembly, neurite outgrowth and neuritic stability. J. Cell Sci. 107: 869-879 [Abstract]. |
| 17. |
Feiguin, F.,
A. Ferreira,
K. Kosik, and
A. Cáceres.
1994.
Kinesin-mediated organelle translocations revealed by specific cellular manipulations.
J. Cell
Biol.
127:
1021-1039
|
| 18. |
Ferreira, A.,
J. Niclas,
R.D. Vale,
G. Banker, and
K. Kosik.
1992.
Suppression
of kinesin expression in cultured hippocampal neurons using antisense oligonucleotides.
J. Cell Biol.
117:
595-606
|
| 19. | Ferreira, A., A. Cáceres, and K. Kosik. 1993. Intraneuronal compartments of the amyloid precursor protein. J. Neurosci. 13: 3122-3133 . |
| 20. | Fletcher, T., P. Cameron, P. DeCamilli, and G. Banker. 1991. The distribution of synapsin I and synaptophysin in hippocampal neurons developing in culture. J. Neurosci. 11: 1617-1626 [Abstract]. |
| 21. | Goldstein, L.S.B.. 1991. The kinesin superfamily: tails of functional redundancy. Trends Cell Biol. 1: 93-98 . [Medline] |
| 22. |
Goslin, K., and
G. Banker.
1990.
Rapid changes in the distribution of GAP43
correlate with the expression of neuronal polarity during development and
under experimental conditions.
J. Cell Biol.
110:
1319-1331
|
| 23. |
Greene, L., and
A. Tischler.
1976.
Establishment of a noradrenergic clonal cell
line of rat adrenal pheochromocytoma cells which respond to nerve growth
factor.
Proc. Natl. Acad. Sci. USA.
73:
2424-2428
|
| 24. | Greene, L., J. Aletta, A. Rukenstein, and S. Green. 1987. PC12 pheochromocytoma cells: culture, NGF treatment and experimental exploitation. Methods Enzymol. 147: 207-216 [Medline]. |
| 25. | Hall, D.H., and E.M. Hedgecock. 1991. Kinesin-related gene unc-104 is required for axonal transport of synaptic vesicles in C. elegans. Cell. 65: 837-847 [Medline]. |
| 26. | Hanton, D.W., Z. Yang, and L.S.B. Goldstein. 1997. Characterization of KIFC2, a neuronal kinesin superfamily member in mouse. Neuron. 18: 439-451 [Medline]. |
| 27. | Hirokawa, N.. 1993. Axonal transport and the cytoskeleton. Curr. Op. Neurobiol. 3: 724-731 [Medline]. |
| 28. | Hirokawa, N.. 1996. Organelle transport along microtubules-the role of KIFs. Trends Cell Biol. 6: 135-141 . |
| 29. | Hollenbeck, P., and J. Swanson. 1990. Radial extension of macrophage tubular lysosomes supported by kinesin Nature (Lond.). 346: 864-866 [Medline]. |
| 30. |
Ingold, A.L.,
S.A. Cohn, and
J.M. Scholey.
1988.
Inhibition of kinesin-driven
microtubule motility by monoclonal antibodies to kinesin heavy chain.
J.
Cell Biol.
107:
2657-2667
|
| 31. | Ishii, D.N., G.W. Glazner, and L.R. Whalen. 1993. Regulation of peripheral nerve regeneration by insulin-like growth factors. Ann. N.Y. Acad. Sci. 692: 172-182 [Medline]. |
| 32. |
Kondo, S.,
R. Sato-Yoshitake,
Y. Noda,
H. Aizawa,
Y. Matsuura, and
N. Hirokawa.
1994.
KIF3A is a new microtubule-based anterograde motor in the
nerve axon.
J. Cell Biol.
125:
1095-1115
|
| 33. | Liu, J.P., J. Baker, A.S. Perkins, E.J. Robertson, and A. Efstratiadis. 1993. Mice carrying null mutations of the gene encoding insulin-like growth factor I (IGF-1) and type 1 IGF receptor (IGF1R). Cell. 75: 59-72 [Medline]. |
| 34. |
Mascotti, F.,
A. Cáceres,
K. Pfenninger, and
S. Quiroga.
1996.
Expression and distribution of IGF-1 receptors containing a -subunit variant ( gc) in developing neurons.
J. Neurosci.
15:
1447-1459
.
|
| 35. | Mitchison, T., and M. Kirschner. 1988. Cytoskeletal dynamics and nerve growth. Neuron. 1: 761-772 [Medline]. |
| 36. |
Nakata, T., and
N. Hirokawa.
1995.
Point mutations of adenosine triphosphate-binding motif generate rigor kinesin that selectively blocks anterograde lysosome membrane transport.
J. Cell Biol.
131:
1039-1053
|
| 37. | Nangaku, M., Y. Sato-Yoshitake, Y. Okada, Y. Noda, R. Takemura, H. Yamazaki, and N. Hirokawa. 1994. KIF1B: a novel microtubule plus end- directed monomeric motor protein for mitochondria transport. Cell. 79: 1209-1220 [Medline]. |
| 38. |
Noda, Y.,
Y. Sato-Yoshitake,
S. Kondo,
M. Nangaku, and
N. Hirokawa.
1995.
KIF2 is a new anterograde microtubule based motor which transport membranous organelles distinct from those carried by KHC or KIF3A/B.
J. Cell
Biol.
129:
157-167
|
| 39. | Okada, Y., H. Yamazaki, Y. Sekine-Aizawa, and N. Hirokawa. 1995. The neuron-specific kinesin superfamily protein KIF1A is a unique monomeric motor for anterograde axonal transport of synaptic vesicle precursors. Cell. 81: 769-780 [Medline]. |
| 40. |
Quiroga, S.,
R.S. Garofalo, and
K.H. Pfenninger.
1995.
Insulin-like growth factor I receptors of fetal brain are enriched in nerve growth cones and contain
a -subunit variant.
Proc. Natl. Acad. Sci. USA.
92:
4309-4312
|
| 41. | Saito, N., Y. Okada, Y. Noda, Y. Kinoshita, S. Kondo, and N. Hirokawa. 1997. KIFC2 is a novel neuron-specific C-terminal type kinesin superfamily motor for dendritic transport of multivesicular body-like organelles. Neuron. 18: 425-438 [Medline]. |
| 42. | Scholey, J.M., M.E. Porter, P.M. Grisson, and J.R. McIntosh. 1985. Identification of kinesin in sea urchin eggs and evidence for its localization in the mitotic spindle. Nature (Lond.). 318: 483-486 [Medline]. |
| 43. | Tanaka, E., and J. Sabry. 1995. Making the connection: cytoskeletal rearrangements during growth cone guidance. Cell. 83: 171-176 [Medline]. |
| 44. |
Ueda, T.,
P. Greengard,
K. Berzina,
R. Cohen,
F. Blomberg,
J. Grab, and
P. Siekevitz.
1979.
Subcellular distribution in cerebral cortex of two proteins
phosphorylated by a cAMP-dependent kinase.
J. Cell Biol.
83:
308-319
|
| 45. | Ullrich, A., A. Gray, A.W. Tam, T. Yang-Fen, M. Tsubokawa, C. Collins, W. Henzel, T. LeBon, S. Kathuria, E. Chen, et al . 1986. Insulin-like growth factor receptor primary structure: comparison with insulin receptor suggests structural determinants that define functional specificity. EMBO (Eur. Mol. Biol. Organ.). J. 5: 2503-2512 [Medline]. |
| 46. | Vale, R.D., B.L. Schnapp, T.S. Reese, and M.S. Sheetz. 1985. Organelle, bead, and microtubule translocation promoted by soluble factors from squid giant axons. Cell. 40: 559-569 [Medline]. |
| 47. |
Vallee, R..
1982.
A taxol-dependent procedure for the isolation of microtubules
and microtubule-associated proteins (MAPs).
J. Cell Biol.
92:
435-442
|
| 48. | Walczak, C.E., T. Mitchison, and A. Desai. 1996. XKCM1: a Xenopus kinesin- related protein that regulates microtubule dynamics during mitotic spindle assembly. Cell. 84: 37-47 [Medline]. |
| 49. | Wagner, R.. 1995. The state of the art in antisense research. Nat. Med. 1: 1116-1118 [Medline]. |
| 50. | Werner, H., M. Woloschak, B. Stannard, Z. Shenn-Orr, C.T. Roberts, D. LeRoith. 1991. In Insulin-like Growth Factors: Molecular and Cellular Aspects. D. LeRoith, editor. CRC Press, Boca Raton, FL. 17-47. |
| 51. |
Wordeman, L., and
T. Mitchison.
1995.
Identification and partial characterization of mitotic centromere-associated kinesin, a kinesin-related protein that
associates with centromeres during mitosis.
J. Cell Biol.
128:
95-105
|
| 52. |
Yamazaki, H.,
T. Nakata,
Y. Okada, and
N. Hirokawa.
1995a.
KIF3A/B: a heterodimeric kinesin superfamily protein that works as a microtubule plus
end-directed motor for organelle transport.
J. Cell Biol.
130:
1387-1399
|
| 53. |
Yamazaki, T.,
D.J. Selkoe, and
E.H. Koo.
1995b.
Trafficking of cell surface
-amyloid precursor protein: retrograde and transcytotic transport in cultured neurons.
J. Cell Biol.
129:
431-442
|
| 54. | Yankner, B., L. Benowitz, L. Villa-Komaroff, and R. Neve. 1990. Transfection of PC12 cells with the human GAP-43 gene: effects on neurite outgrowth and regeneration. Mol. Brain Res. 7: 39-44 [Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|