|
||



* Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02119;
Department of Medicine,
Beth Israel Deaconess Medical Center, Boston, Massachusetts 02215; and § Department of Medicine, Brigham and Women's
Hospital, Boston, Massachusetts 02115
The endothelium is morphologically and
functionally adapted to meet the unique demands of
the underlying tissue. At the present time, little is
known about the molecular basis of endothelial cell diversity. As one approach to this problem, we have chosen to study the mechanisms that govern differential
expression of the endothelial cell-restricted von Willebrand factor (vWF) gene. Transgenic mice were generated with a fragment of the vWF gene containing 2,182 bp of 5
flanking sequence, the first exon and first intron coupled to the LacZ reporter gene. In multiple independent lines of mice,
-galactosidase expression
was detected within endothelial cells in the brain, heart,
and skeletal muscle. In isogeneic transplantation models, LacZ expression in host-derived auricular blood
vessels was specifically induced by the microenvironment of the heart. In in vitro coculture assays, expression of both the transgene and the endogenous vWF
gene in cardiac microvascular endothelial cells
(CMEC) was upregulated in the presence of cardiac myocytes. In contrast, endothelial cell levels of thrombomodulin protein and mRNA were unchanged by the
addition of ventricular myocytes. Moreover, CMEC expression of vWF was not influenced by the addition of
3T3 fibroblasts or mouse hepatocytes. Taken together,
the results suggest that the vWF gene is regulated by vascular bed-specific pathways in response to signals
derived from the local microenvironment.
THE endothelium exhibits a remarkable diversity of
cellular properties that are uniquely adapted to the
needs of the underlying tissue. Heterogeneity within
the endothelium has been described at the level of cell
structure, antigen composition, mRNA expression, and
cell function (Gerritsen, 1987 Beyond a large descriptive catalogue of endothelial cell
phenotypes, surprisingly little is known about the molecular basis of vascular diversity. An important question that
continues to elude us is whether the phenotypic patterns
are genetically inherited from distinct sublineages or
rather governed by signals residing within the microenvironment. In vitro investigations using embryonic stem cell
cultures suggest that endothelial cell differentiation and
early vasculogenesis are genetically predetermined (Wang
et al., 1992 Regardless of the relative roles of clonality and environment in mediating phenotypic differences within the endothelium, the establishment and maintenance of vascular
diversity is ultimately controlled at a transcriptional level.
Regulation of endothelial cell gene expression has been
shown to vary between blood vessel types and vascular
beds (Bahnak et al., 1989 Until recently, little was known about the transcriptional regulation of vWF. In transgenic mice, a segment of
the human vWF gene containing 487 bp of 5 Generation and Analysis of Transgenic Mice
The vWF sequence in vWFlacZ-2 was cloned from a human genomic library (Stratagene, La Jolla, CA). Through sequential cloning steps, the sequence including 2,182 bp of 5 Cardiac and Lung Transplantations
Cardiac transplantation experiments were performed as previously described (Rossi, 1992 In Vitro Coculture Assays
Cardiac muscular endothelial cells (CMEC) were harvested from neonatal and adult mice according to modified protocols (Lodge et al., 1992 O-Nitrophenyl- CMEC were cultured either alone or in the presence of ventricular myocytes, 3T3 fibroblasts, or BNL hepatocytes for a total of 4 d, and then assayed for Ribonuclease Protection Assays
Template DNA containing sequences from the mouse TM cDNA and
from exon 28 of the mouse vWF gene were subcloned into the Bluescript vector (Stratagene). The constructs were linearized by restriction digestion with NotI, and then incubated with T7 in the presence of [32P]UTP to
generate single stranded radiolabeled RNA probe. The probe was then
hybridized with 20 µg of total RNA in hybridization buffer at 42°C overnight and the reaction mixture subsequently treated with RNase and
RNase T1 for 30 min at 37°C. A [32P]UTP-labeled, 250-bp mouse The vWFlacZ-2 Transgene Is Expressed in the
Microvascular Bed of the Heart and Skeletal Muscle
The limited pattern of transgene expression in mice harboring a 733-bp fragment of the human vWF gene suggested that DNA sequences outside this region contained
information for more widespread endothelial cell expression (Aird et al., 1995
Wild-type Heart Grafts Induce Transgene
Expression in Endothelial Cells Derived from
LacZ-negative Blood Vessels
We then wished to determine the relative importance of
environmental cues and genetic factors in programming
expression of the vWFlacZ-2 transgene in different vascular beds. To investigate this issue, we used a syngeneic cardiac transplantation model in which neonatal donor hearts
are grafted into the ear of adult recipient mice (Rossi,
1992
Cardiac Myocytes Induce Expression of Both
Transgene and Endogenous vWF under In Vitro
Coculture Conditions
We next established a coculture system to delineate the interaction between CMEC and ventricular myocytes involved in transgene activation. To this end, neonatal or
adult transgenic CMEC were harvested and grown under
in vitro conditions. After 4 d of culture, pure populations
of CMEC no longer exhibited LacZ activity (data not
shown). However, when overlaid with wild-type ventricular myocytes, CMEC reacquired the X-Gal reaction product. Interestingly, most LacZ-positive endothelial cells occurred within clusters of spontaneously beating ventricular
myocytes (Fig. 6 B). To quantitate the extent of transgene
induction, LacZ activity was assayed in whole plate lysates
with the ONPG substrate. On average,
Finally, we asked whether endothelial cell expression of
the endogenous vWF gene and the vWFlacZ-2 transgene
is controlled in a similar fashion by cardiomyocytes. Primary cultures of CMEC between passages 1-4, exhibited
barely visible vWF antigen as judged by immunohistochemical staining (data not shown). By comparison, strongly positive vWF-containing endothelial cells were
readily discernible within clusters of ventricular myocytes
under coculture conditions (Fig. 6 C). Total cellular vWF
antigenic levels in CMEC (1 ng/105 cells) were increased
by an average of 3.1-fold upon addition of cardiomyocytes
(Fig. 6 A), but were not altered in the presence of mouse
hepatocytes or 3T3 cells (data not shown). To exclude the
possibility that a translational mechanism was responsible for elevating endogenous vWF concentrations, vWF mRNA
levels were determined by ribonuclease protections assays
under coculture conditions. Primary cultures of CMEC exhibited decreased concentrations of transcript as compared to whole heart or freshly harvested CMEC (Fig. 7).
The addition of ventricular myocytes to CMEC resulted in
a threefold induction of vWF expression (Fig. 7). In contrast, TM mRNA levels did not change significantly (Fig. 7).
In the present study, a region of the human vWF gene encompassing 2,182 bp of 5 The existence of cell subtype-specific mechanisms of
gene regulation is not limited to the endothelium. In transgenic mice, the The vWFlacZ-2 transgenic mouse provides a unique
tool with which to study environmental modulation of endothelial gene expression. In cardiac transplantation experiments, endothelial cells derived from LacZ-negative
blood vessels of the ear were shown to express the transgene in the presence of grafted heart tissue. These findings indicate that endothelial cells of vascular beds outside the
heart, skeletal muscle, and brain retain the competence to
express the vWFlacZ-2 transgene in response to appropriate environmental cues. In other words, the information
for cardiac microvascular bed-specific transcriptional activation of the vWF transgene is contained not within the
endothelial cell itself but rather within the surrounding extracellular milieu. The importance of the ventricular
myocyte in mediating the inductive phenomenon was documented in coculture assays. In these experiments, maintenance and reinduction of both vWFlacZ and endogenous vWF gene expression in CMEC was found to be
dependent on cardiomyocyte-derived signals. Taken together, these observations add strong support to the notion that organ-specific endothelial cell gene expression is
ultimately controlled by interactions between local environmental factors and intracellular transcriptional networks. Indeed, the in vitro system should prove useful
in identifying and characterizing signaling pathways involved.
In summary, the above data strongly suggest that cardiac microvascular endothelial cells possess a common
transcriptional mechanism for expressing both endogenous vWF and the vWFlacZ-2 transgene. Based upon
these results, we predict that transcriptional activation of
vWF in LacZ-negative vascular beds is mediated by the interaction of local signaling pathways with cis-acting elements outside of the vWFlacZ-2 promoter region. According to this model of gene regulation, the expression
pattern of vWF and perhaps other endothelial cell genes
within the vascular tree reflect the combined activity of
multiple signaling pathways that vary from one microenvironment to another. This array of local networks would
provide an effective means of establishing functionally distinct endothelial cell populations responsive to the specific needs of the underlying tissues. As a logical extension of
this model, pathophysiological alterations in one or more
of these pathways might underlie the focal nature of vascular diseases.
; Kumar et al., 1987
; Turner et al., 1987
; Tomlinson et al., 1991
; Page et al., 1992
; Gerritsen and Bloor, 1993
). For example, the postcapillary,
high venule endothelial cells in lymphoid organs support
the binding and migration of lymphocytes via the specific
interaction of adhesion molecules with lymphocyte homing receptors (Streeter et al., 1988
; Berg et al., 1989
; Girard and Springer, 1995
). On the other hand, the endothelial cells that line the small blood vessels of the brain possess a unique expression pattern of cell surface receptors, transporters, and intracellular enzymes that serve to
tightly regulate the exchange of solutes between blood and
brain parenchyma (Bradbury, 1993
; Schlosshauer, 1993
).
Distinct endothelial cell phenotypes have also been documented in other organs such as the liver, kidney, and lung
(DeFouw, 1988
; Fleming and Jones, 1989
). In addition, the
endothelium has been shown to vary in its response to
pathophysiological stimuli. Escherichia coli-induced sepsis in baboons results in the selective activation of tissue factor in a subpopulation of endothelial cells within the marginal zone of splenic follicles (Drake et al., 1993
). In mice,
the systemic delivery of lipopolysaccharide results in a
specific upregulation of the pentraxin gene family member, ptx-3, specifically within the vascular beds of the heart
and skeletal muscle (Introna et al., 1996
). These and other
examples of the vascular bed-specific endothelial cell response underscore the potential role of phenotypic heterogeneity in mediating focal vasculopathic disease states.
). Retroviral cell tagging studies in chicken embryos have shown different clonal origins for endocardial
versus coronary artery endothelial cells (Mikawa and Fischman, 1992
). On the other hand, in vivo transplant studies
using avian species have pointed to the critical role of environmental cues in establishing blood vessel patterning
during development (Poole and Coffin, 1989
; Noden,
1990
). Unfortunately, these experimental approaches are difficult to adapt to the mammalian system, owing to poor
accessibility of embryos and the lack of appropriate cell
markers. Nevertheless, there is evidence that regional specialization of the endothelium in mammals may be conditioned by exogenous factors. Perhaps the best examples
are found in studies of the blood-brain barrier, in which
both in vitro culture and in vivo transplant studies have
documented the ability of astrocytes to induce the appropriate phenotype in endothelial cells (Stewart and Wiley,
1981
; Beck et al., 1984
; Janzer and Raff, 1987
; Maxwell et
al., 1987
; Tao-Cheng et al., 1987
; Lobrinus et al., 1992
).
Additional studies have demonstrated a direct influence of
extracellular signals on gene expression in other endothelial cell types. For example, preproendothelin-1 mRNA in
rat cardiac microvascular endothelial cells was found to be
upregulated when these cells were grown in coculture with ventricular myocytes (Nishida et al., 1993
). Shear stress
has been shown to modulate the transcription of a number
of endothelial cell genes through the induction of specific
DNA-protein interactions (Resnick et al., 1993
; Resnick
and Gimbrone, 1995
). At this time, it is not clear what role
these and other examples of modulatable gene expression
play in establishing and/or maintaining the phenotype of a
given endothelial cell in the intact animal.
; Hadley et al., 1994
; Kaipainen et
al., 1995
; Lassalle et al., 1996
; Smith et al., 1996
). For example, the multimeric glycoprotein von Willebrand factor (vWF),1 a cofactor for platelet adhesion and a carrier for
the antihemophiliac factor (for review see Sadler, 1991
;
Ruggeri and Ware, 1993
), is heterogeneously distributed
throughout the vascular tree and is associated with regional variations in mRNA levels (Rand et al., 1987
; Wu et
al., 1987
; Bahnak et al., 1989
; Coffin et al., 1991
; Page et
al., 1992
; Smith et al., 1996
; Aird, W., and R.D. Rosenberg,
unpublished results). vWF is expressed at higher levels on
the venous side of the circulation compared with arteries
and arterioles. By contrast, consistently low levels of vWF
are present within the sinusoidal endothelial cells of the
liver and spleen. In en face preparations of the rat aorta,
expression of vWF appears to vary from one endothelial
cell to another (Senis et al., 1996
). The gene product is
present in clusters of endothelial cells oriented along the
longitudinal axis of blood flow and is particularly concentrated in endothelial cells lining the ostia of the intercostal arteries. The administration of thrombin resulted in an increase of histochemically detected vWF expression, suggesting that previously nonexpressing endothelial cells
may be recruited to produce vWF (Senis et al., 1996
).
Taken together, the available evidence suggests that the
transcriptional control of vWF varies from one endothelial cell to another and that cell-to-cell variation may be programmed by the extracellular environment. Indeed, an understanding of how these transcriptional networks operate
selectively in subsets of endothelial cells should provide an
initial framework with which to unravel the molecular
mechanisms of differential gene expression and endothelial cell heterogeneity.
flanking sequence, as well as the first exon (+1 - +246) was found to
direct expression to a subpopulation of endothelial cells in
the adult brain (Aird et al., 1995
). These observations suggested that the transgene is under vascular bed-specific transcriptional control and implied that more widespread
expression of the vWF gene might be dependent on promoter sequences either proximal to or distal to the 733-bp
fragment. To test this hypothesis, a larger segment of the
vWF gene containing 2,182 bp of 5
flanking sequence, the
first exon, and the first intron was coupled to the LacZ reporter gene, and the resulting construct (vWFlacZ-2) was
used to generate additional lines of transgenic mice. As we report below, transgene expression in these mice was detected not only within blood vessels of the brain but also
within the microvasculature of the heart and skeletal muscle. These findings indicate that vWF expression is indeed
regulated by distinct organ-specific transcriptional pathways. We also show by transplantation and coculture techniques that cardiac vascular bed-specific control of the
vWF transgene and the endogenous gene is modulated by
interactions between microvascular endothelial cells and
cardiomyocytes. The results support the existence of
novel, tissue-specific pathways that regulate the function
of endothelial cells in response to signals derived from
their local microenvironment.
Materials and Methods
flanking sequence, the first exon, the first
intron, and the translational start site of the human vWF gene was coupled to the SDK sequence, LacZ cDNA and simian virus polyadenylation
signal of pSDKlacZpA (generous gift from J. Rossant, Mount Sinai Hospital, Toronto, Canada). The generation and identification of transgenic
mice as well as the analysis of tissue sections and whole mounts for LacZ
activity and vWF immunohistochemistry were carried out as previously
described (Aird et al., 1995
). For reverse transcriptase (RT)-PCR, total RNA isolation was isolated from vWFlacZ-2 mouse organs using a guanidinium thiocyanate phenol-chloroform single-step extraction (Stratagene). Approximately 10 µg of total RNA from each organ was treated
with DNase and then incubated with reverse transcriptase in the presence
of [32P]dCTP. First strand cDNA was then used as template for PCR with primer sets specific for E. coli LacZ (5
-GCATCGAGCTGGGTAATAA GCGTTGGCAAT-3
, 5
-GACACCAGACCAACTGGTAATGGTAG-CGAC-3
), mouse vWF (5
-ATGATGGAGAGGTTACACATC-3
, 5
GGCAGTTGCAGACCCTCCTTG-3
) and mouse thrombomodulin (5
ACTGATCGGACGCTGCAGAAGTTCTGA 3
, 5
-GGCCCAGTATGTCTCAAGATAGCAATG-3
). The PCR parameters were 95°C for 3 min, 95°C for 45 s and 72°C for 3.5 min, for a total of 40 cycles, followed by
7 min of elongation at 72°C. PCR products were resolved on a 1.2% agarose gel and visualized with ethidium bromide.
). Briefly, adult vWFlacZ-2 recipient mice were anesthetized with intraperitoneal avertin, one or both ears were cleaned with
70% ethanol and a subdermal incision 2-5 mm in length was made with a
scalpel along the transverse axis of the ear. A pair of microdissection scissors was then used to dissect away intradermal tissue towards the apex of
the ear, creating a subdermal ear pouch. The donor heart was removed
from the wild-type neonates (12-24-h old) and inserted into the ear
pouch. Gentle pressure with delicate curved forceps was then used to express free air from the pocket and to close the incision. Transplanted mice
were returned to their cages and cared for according to standard protocols. Neonatal wild-type lung tissue was transplanted into the pinna of the
ear of isogeneic adult recipients according to a similar protocol. In mock
transplant experiments, a subdermal ear pouch was created and then
closed as described above without insertion of donor tissue.
;
Nishida et al., 1993
). Adult hearts were excised from anesthetized mice
and retrogradely perfused with Hanks' balanced salt solution buffer
through the ascending aorta to remove blood cells. The left ventricle was
separated from remaining heart tissue, stripped of its epicardium and
minced in HBSS containing 40 mg/ml collagenase. The resulting cell suspension was incubated at 37°C in a shaking water bath for 20 min, supplemented with trypsin (final concentration 25 mg/ml), incubated for an additional 15 min at 37°C and then centrifuged at 100 g for 5 min. The
endothelial cell-rich supernatant was resuspended and plated in DME/
20% FCS. To harvest CMEC from neonatal FVB mice, hearts were removed aseptically from a total of 8-15 mice between 2 and 5 d of age,
placed in ADS buffer (116 mM NaCl, 20 mM Hepes, 1.0 mM NaH2PO4,
5 mM KCl, 0.8 mM Mg2SO4, 5.5 mM glucose), and minced with a straight-edge razor blade. The tissue was then digested for 45 min at 37°C in DME
supplemented with 5% FCS, 0.2% (wt/vol) collagenase and 0.0005% (wt/
vol) DNase. The cell-rich supernatant was centrifuged at 200 g for 10 min
and the resulting pellet was resuspended in 2 ml 40% percoll, overlaid
with 2 ml 25% percoll, followed by 2 ml PBS. The gradient was centrifuged at 400 g for 15 min and cells in the 40-25% interface were collected,
pelleted at 200 g for 2 min, and then resuspended in DME/10% FCS. Cells
were initially plated at a density of 2 × 105 cells ml and after a 1-h incubation, the adherent fraction was fed fresh media and subsequently grown at
37°C. After reaching confluence at 7 d, the adult and neonatal CMEC cultures exhibited uniform uptake of Dil-Ac-low density lipoprotein (LDL),
uniformly bound both FITC-conjugated Griffonia simplicifolia lectin and were positive for the endothelial cell marker platelet endothelial cell adhesion molecule-1 (PECAM) (data not shown). In fluorescence-activated cell sorting studies, >95% of the cells in the CMEC cultures were positive
for diI-acLDL (data not shown). For endothelial cell-myocyte coculture
assays, ventricular myocytes were harvested from embryonic hearts
(Woodley et al., 1991
; Okazaki et al., 1994
) and overlaid on established
cultures of CMEC at a ratio of 1:1. To assay for endothelial cell proliferation, CMEC were cultured alone or cocultured with ventricular myocytes
as described above. After 3 d in culture, the cells were incubated with diI-acLDL. 12 h later, the diI-acLDL-positive endothelial cells were quantitated and the results were used to calculate the proliferative index. The
proliferative index for CMEC and CMEC in coculture was 3.0 ± 0.3 and
2.1 ± 0.2, respectively (data not shown). For coculture assays with nonmyocyte cell types, the murine 3T3 fibroblast cell line (CRL 1658), and the
murine BNL CL.2 embryonic hepatocyte cell line (TIB 73) were obtained from the American Type Culture Collection (Rockville, MD), cultured in
DME/10% FCS and coplated with monolayers of CMEC at a ratio of 1:1.
-D-galactopyranoside Assays and
vWF, TM ELISA
-galactosidase activity, vWF, and TM.
-galactosidase activity
was measured using the O-Nitrophenyl-
-D-galactopyranoside (ONPG)
assay. Cells were washed with PBS, and then incubated with TEN (40 mM
TrisHCl, pH 7.5, 10 mM EDTA, 150 mM NaCl) at room temperature for
10 min. Cells were collected with a cell scraper and centrifuged in an Eppendorf tube at 200 g for 5 min. The pellet was resuspended in 50 µl lysis
buffer (250 mM TrisHCl, pH 7.8, 10 mM EDTA), freeze-thawed three
times, and then incubated for 1-12 h at 37°C with 150 µl of buffer Z (60 mM dibasic NaHPO4.2H2O, 60 mM monobasic NaHPO4.2H2O, 10 mM
KCl, 1 mM MgSO4, and 50 mM
-mercaptoethanol), and 50 µl ONPG 4 µg/ml in 100 mM NaPO3 buffer, pH 7.0. The A420, A550, and A600 of each
sample was measured by spectrophotometry and
-galactosidase activity
was calculated as previously described (Miller, 1972
). For TM ELISA,
cells were fixed with ice-cold acetone for 2 min, air-dried, washed with
PBS, and then blocked for 1 h with 1% BSA and 0.05% saponin in PBS.
The cells were then washed with PBS and incubated with either anti-
mouse CD31 monoclonal antibody (PharMingen, San Diego, CA) or anti-
human TM (a gift from S. Kennel, University of Tennessee, Oak Ridge, TN)
at a dilution of 1:1,000 for 45 min at room temperature. After five washes
in PBS, the cells were incubated with anti-rat-HRP antibody at a dilution
of 1:500 for 1 h at room temperature. Cells were washed five times with PBS,
and then incubated with 100 µl of solution containing 8 mg orthophenylenediamine (OPD) substrate (Dako Corp., Carpinteria, CA) in 12 ml
0.1 M citric acid-phosphate, pH 5.0, and 0.0125% H2O2 at room temperature for 3 min. The reaction was stopped with equal volume 1 M sulfuric
acid and the A490 was measured by spectrophotometry. For vWF ELISA,
the cells were fixed with 4% paraformaldeyhde in PBS for 15 min on ice,
washed three times with PBS, and incubated with 1% BSA and 0.05% saponin in PBS at room temperature for 1 h. After a wash in PBS, the cells
were incubated with vWF-HRP antibody (Dako Corp.) at a dilution of 1:200 for 1 h at room temperature. Cells were washed five times with PBS,
and then incubated with 100 µl of solution containing 8 mg OPD substrate
(Dako Corp.) in 12 ml 0.1 M citric acid phosphate, pH 5.0, and 0.0125%
H2O2 at room temperature for 3 min. The reaction was stopped with equal
volume 1 M sulfuric acid, and the A490 was measured by spectrophotometry.
-actin
probe was included in each reaction mixture to control for amounts of
RNA. The protected fragments were separated on a 5% nondenaturing
polyacrylamide gel. The gel was then dried and exposed to x-ray film
overnight. The relative intensity of the bands were quantitated with Betascope 603 Blot Analyzer (Betagen, Waltham, MA).
Results
). To confirm this speculation, we
generated transgenic mice with a larger segment of the
vWF gene containing 2,182 bp of 5
flanking sequence, the first exon, and first intron was coupled to the LacZ reporter gene (vWFlacZ-2) (Fig. 1). In seven independent
founder lines, the X-Gal reaction product was detected
not only within blood vessels of the brain but also in a subset of microvessels within the heart and skeletal muscle
(Figs. 2, A-C, and 3). In cardiac sections stained with
X-Gal and then processed for immunoperoxidase detection of endogenous vWF, the transgene and endogenous
gene products colocalized in the endothelial lining of capillary vessels (Fig. 3 B). In contrast, the endothelial cells of
the coronary arteries, coronary veins, penetrating arteries,
and endocardium of the heart exhibited no detectable
-galactosidase activity but possessed immunoreactive
vWF (Fig. 3A, arrowhead, absence of LacZ staining in epicardial coronary artery). Transgene expression was similarly absent in the vascular bed of other organs, including the liver, spleen, lung, and kidney, as well as in the aorta
and megakaryocyte lineage (Fig. 2, D-F). In each of the
seven lines of mice, ectopic reporter gene activity was detected within a subpopulation of neurons within the hypothalamus and cerebellum (data not shown). In RT-PCR
analyses, LacZ mRNA was detected only in brain, heart,
and skeletal muscle (Fig. 4). In contrast, mRNA from the
endogenous vWF gene and from the endothelial cell-
restricted TM gene was present in all tissues examined.
vWF mRNA levels varied from one organ to another (Fig.
4) and correlated with transcript levels detected by ribonuclease protection assays (data not shown). Thus, the above
vascular bed-specific expression pattern of vWFLacZ-2 provides further evidence that the vWF transgene is regulated through the interaction of regional transcriptional
networks with distinct promoter elements.
Fig. 1.
Schematic representation of the vWFlacZ-2 transgene.
Arrow, transcriptional start site; SV40 poly(A), SV40 polyadenylation signal; RI, EcoRI; H, HindIII; S, SphI.
[View Larger Version of this Image (4K GIF file)]
Fig. 2.
The vWFlacZ-2 transgene directs vascular bed-specific expression in vivo. LacZ staining of 10-µm sections from vWFlacZ-2
mouse tissues showing reporter gene activity within the endothelial cell lining of a blood vessel in the white matter of the brain (A), and
microvessels of the heart (B) and skeletal muscle (C). In contrast,
-galactosidase activity is not detectable in the lung (D), kidney (E),
and spleen (F). The X-Gal reaction product was similarly absent in other organs, including the liver and aorta as well as the megakaryocyte/platelet lineage (data not shown). Bars: (A) 23 µm; (B-F) 63 µm.
[View Larger Version of this Image (68K GIF file)]
Fig. 3.
The vWFlacZ-2 transgene colocalizes with endogenous
vWF within the microvessels of the heart. (A) Whole mounts of
the vWFlacZ-2 adult heart incubated with the X-Gal substrate reveals diffuse LacZ staining in both ventricles and atria with distinct sparing of the epicardial coronary arteries (arrowhead). (B)
10-µm section through the left ventricular wall of the vWFlacZ-2
adult heart processed for
-galactosidase activity (blue) and immunoperoxidase detection of vWF (black) reveals co-localization
(arrowheads) within the endothelial lining of the microvessels.
Bar, 26 µm.
[View Larger Version of this Image (99K GIF file)]
Fig. 4.
-galactosidase activity correlates with LacZ
mRNA levels. RT-PCR analysis of LacZ, vWF, and TM
in vWFlacZ-2 mouse tissues reveals the presence of detectable
-galactosidase transcripts exclusively within the
brain, heart, and skeletal
muscle of adult transgenic
mice. This limited expression pattern contrasts with the more widespread, albeit heterogeneous, distribution of endogenous vWF and TM mRNA in adult
mouse tissues. Each lane represents an RT-PCR analysis from
identical cDNA template. Two independent experiments in two
independent vWFlacZ-2 transgenic lines produced similar results.
[View Larger Version of this Image (62K GIF file)]
). In these experiments, wild-type neonatal were harvested within 24 h of birth, and immediately implanted under the subdermal layer of the ear pinna of adult vWFlacZ-2
transgenic mice. The blood vessels of the host ear rapidly vascularize the graft (Fig. 5 A), and endothelial cells from
this nonexpressing bed are newly exposed to a myocardial
environment. The grafts were analyzed between 3-6 wk
after transplantation when the functional viability of the
implanted organ was confirmed both by visible pulsations
and electrocardiographic activity (Fig. 5 B). In six independent transplants, LacZ activity was detected in numerous blood vessels surrounding ventricular myocytes (Fig. 5, C and D). The X-Gal reaction product was not observed
in the vascular bed of the ear proper, nor within the blood
vessels of mock-transplanted transgenic littermates (data
not shown). LacZ staining was also absent in neonatal
lung tissue transplanted into the pinna of six vWFlacZ-2
transgenic mice (Fig. 5 F). As a control for neovascularization, wild-type lungs were also grafted into a transgenic
mouse that contains
-galactosidase activity in endothelial
cells of every vascular bed including the ear (Aird, W.C.,
and R.D. Rosenberg, unpublished observations). In these mice, an abundance of LacZ-positive blood vessels within
the substance of the graft indicate that the transplanted
lung is revascularized by host-derived endothelium (Fig. 5
E). Taken together, these results suggest that certain vascular beds outside the heart, skeletal muscle, and brain retain the competence to express the vWFlacZ-2 transgene
in response to the microenvironment of the heart. In other
words, the critical information required for cardiac microvascular-specific transcriptional activation of the vWF
transgene is not contained within the endothelial cell, but
rather within the surrounding myocytes or the extracellular milieu. These in vivo observations support the view
that organ-specific endothelial cell gene expression is ultimately controlled by the interplay between local environmental factors and intracellular transcriptional networks.
Fig. 5.
Environmental induction of transgene expression in cardiac transplantation
model. (A) Whole mount photomicrograph
of a 3-wk-old neonatal, wild-type cardiac
graft in the ear of an adult vWFlacZ-2 mouse showing the complex network of
anastomosing host auricular blood vessels.
(B) Two-lead electrocardiogram of a transplanted heart revealing electrocardiographic activity. The heart rate of the graft
was 150 beats per min, compared with the
native heart rate of 320 beats per min under
anesthesia (C) X-Gal staining of a thick
100-µm section from the cardiac graft reveals the presence of
-galactosidase activity in a linear pattern. (D) X-Gal staining of
an 8-µm section from the cardiac graft reveals the presence of LacZ-containing endothelial cells next to wild-type ventricular myocytes. (E) X-Gal staining of a 12-µm
section through a wild-type lung graft transplanted into the ear of a transgenic mouse
that expresses LacZ in all vascular beds.
The presence of LacZ-positive blood vessels indicates that the lung graft is revascularized by host-derived endothelium. (F)
X-Gal staining of a 12-µm section through
a wild-type lung graft in the ear of a vWFlacZ-2 mouse ear revealing absence of detectable LacZ activity. Bars: (C,E,F) 60 µm;
(D) 12 µm.
[View Larger Version of this Image (97K GIF file)]
-galactosidase activity in primary cultures of CMEC (120 U/105 cells) was
2.6-fold higher in cocultures of CMEC and myocytes as
compared to CMEC alone (Fig. 6 A). Of importance, the
total numbers of endothelial cells, as monitored by cell-specific markers, failed to increase upon the addition of
ventricular myocytes which argues against a proliferative
effect of the coculture conditions (data not shown). Moreover, the antigenic levels of the endothelial cell marker
TM were not elevated, suggesting that the inductive process is specific for
-galactosidase (Fig. 6 A). Furthermore, cocultures of CMEC with BNL hepatocytes or 3T3 fibroblasts failed to induce LacZ expression (data not shown).
Thus, the above data suggest that maintenance and reinduction of the vWFlacZ-2 transgene in CMEC are specifically mediated by cardiac myocytes.
Fig. 6.
Protein expression in cardiac microvascular endothelial cell-ventricular myocyte coculture. (A)
-Galactosidase activity in CMEC from
vWFlacZ-2 mice, as measured with the ONPG
substrate, was 2.6-fold higher under coculture conditions (CMEC + myo) compared with either vWFlacZ-2 or wild-type CMEC alone. Antigenic levels of cellular vWF were stimulated 3.1-fold under
similar conditions. In contrast, there was no
change in the antigenic levels of the endothelial
cell marker TM when CMEC was coplated with
ventricular myocardial cells. The results are derived from at least three independent experiments,
each performed in triplicate. Protein levels are calculated relative to values obtained from primary cultures of vWFlacZ-2 and wild-type-derived
CMEC. (B) X-Gal staining of a coculture plate
containing CMEC and cardiomyocytes reveals the
presence of numerous LacZ-positive endothelial
cells integrated within a cluster of myocytes. (C)
vWF immunofluorescence under coculture conditions reveals a similar staining pattern with strongly positive endothelial cells interspersed within a colony of cardiomyocytes. Bar, 100 µm.
[View Larger Versions of these Images (65 + 15K GIF file)]
Fig. 7.
Changes in vWF
antigen correlate with transcript levels. In ribonuclease
protection assays, total RNA
from freshly harvested heart
(heart), CMEC and CMEC
in coculture with ventricular
myocytes (CMEC + myo) was
hybridized to riboprobes specific for mouse vWF, TM,
and
-actin mRNA.
[View Larger Version of this Image (42K GIF file)]
Discussion
flanking sequence, the first exon
and first intron coupled to the coding region of LacZ was
used to generate transgenic mice. In seven independent
lines of mice, reporter gene activity and mRNA were limited to the endothelial lining of blood vessels in the brain,
heart and skeletal muscle, indicating that this particular
promoter fragment contains information sufficient for vascular bed-specific expression of vWF. The limited distribution of the transgene contrasts with the more widespread expression of the endogenous gene and suggests
that alternative mechanisms of transcriptional activation
are operative in LacZ-negative endothelial cells. These
observations add vWF to a growing list of endothelial cell
promoters that have been shown to direct limited, endothelial cell subtype-restricted expression in transgenic
mice (Harats et al., 1995
; Korhonen et al., 1995
; Schlaeger
et al., 1995
). In one report, DNA promoter constructs containing either 1,200 or 600 bp of the murine Tie-2 promoter were shown to direct expression to distinct endothelial cell subpopulations within transgenic embryos
(Schlaeger et al., 1995
). In a similar study, a 735-bp region
of the mouse Tie-1 gene was shown to confer endothelial cell subtype-specific expression during development (Korhonen et al., 1995
). In contrast, activity of the Tie-1 and
Tie-2 transgenes was downregulated in adult mice (Korhonen et al., 1995
; Schlaeger et al., 1995
). Finally, a 5.9-kb
fragment of the murine preproendothelin-1 promoter directed differential expression within the endothelium and
vascular smooth muscle cells of adult transgenic mice
(Harats et al., 1995
). Expression levels in these mice varied
not only between arteries, veins, and capillaries, but also
between vascular beds of different organs (Harats et al.,
1995
). Taken together, these studies provide strong support for the existence of regional differences in the mechanisms of endothelial cell gene regulation.
1(1) collagen gene was shown to possess
different cis elements required for expression in fibroblasts of the skin as compared to fibroblasts within the fascia (Liska et al., 1994
). In another investigation, expression of the CD4 gene in transgenic mice was shown to be
governed by distinct regulatory elements in separate T cell
subsets (Hanna et al., 1994
). In a recent study of the muscle-specific SM22
gene, a 445-bp region of the promoter
directed expression in the vascular smooth cells of arteries
as well as cardiac and skeletal myocytes in a temporospatial pattern similar to that of the endogenous gene. However, in contrast to the endogenous gene, transgene expression was absent in venous and visceral smooth muscle
cells (Li et al., 1996
). The promoter region of yet another muscle-specific gene (MLC-3F) was found to contain distinct DNA regions capable of distinguishing between regulatory programs within the various chambers of the transgenic heart (Kelly et al., 1995
). These reports provide
additional evidence that transcriptional control mechanisms may differ between subpopulations of cells and reinforces the notion that not all cell types within a given lineage are alike.
Received for publication 22 April 1997 and in revised form 27 June 1997.
Please address all correspondence to W.C. Aird, Molecular Medicine, RW-663, Beth Israel Deaconess Medical Center, 330 Brookline Avenue, Boston, MA 02215. Tel.: (617) 667-1031. Fax: (617) 667-2913. e-mail: waird{at}bidmc.harvard.eduWe thank D. Beeler and E. Li for their technical assistance, and M. Krieger and R. Kelly for their critical reading of the manuscript. We are grateful to A. Hautzopolous for providing us with the mouse vWF riboprobe.
This work was supported in part by grant HL41484 from the National Institutes of Health.
CMEC, cardiac microvascular endothelial cells;
LDL, low density lipoprotein;
ONPG, O-Nitrophenyl-
-D-
galactopyranoside;
RT, reverse transcriptase;
TM, thrombomodulin;
vWF, von Willebrand factor.
| 1. |
Aird, W.C.,
N. Jahroudi,
H. Weiler-Guettler,
H.B. Rayburn, and
R.D. Rosenberg.
1995.
Human von Willebrand factor gene sequences target expression
to a subpopulation of endothelial cells in transgenic mice.
Proc. Natl. Acad.
Sci. USA.
92:
4567-4571
|
| 2. | Bahnak, B.R., Q. Wu, L. Coulombel, Z. Assouline, D. Kerbiriou-Nabias, G. Pietu, L. Drouet, J.P. Caen, and D. Meyer. 1989. Expression of von Willebrand Factor in porcine vessels: heterogeneity at the level of von Willebrand Factor mRNA. J. Cell. Physiol. 138: 305-310 [Medline]. |
| 3. | Beck, D.W., H.V. Vinters, M.N. Hart, and P.A. Cancilla. 1984. Glial cells influence polarity of the blood-brain barrier. J. Neuropathol. Exp. Neurol. 43: 219-224 [Medline]. |
| 4. | Berg, E.L., L.A. Goldstein, M.A. Jutila, M. Nakache, L.J. Picker, P.R. Streeter, N.W. Wu, D. Zhou, and E.C. Butcher. 1989. Homing receptors and vascular addressins: cell adhesion molecules that direct lymphocytes traffic. Immunol. Rev. 108: 5-18 [Medline]. |
| 5. | Bradbury, M.W.B.. 1993. The blood-brain barrier. Exp. Physiol. 78: 453-472 [Medline]. |
| 6. | Coffin, J.D., J. Harrison, S. Schwartz, and R. Heimark. 1991. Angioblast differentiation and morphogenesis of the vascular endothelium in the mouse embryo. Dev. Biol. 148: 51-62 [Medline]. |
| 7. | DeFouw, D.O.. 1988. Structural heterogeneity within the pulmonary microcirculation of the normal rat. Anat. Rec. 221: 645-654 [Medline]. |
| 8. | Drake, T.A., J. Cheng, A. Chang, and F.B. Taylor Jr.. 1993. Expression of tissue factor, thrombomodulin, and E-selectin in baboons with lethal Escherichia coli sepsis. Am. J. Pathol. 142: 1458-70 [Abstract]. |
| 9. | Fleming, S., and D.B. Jones. 1989. Antigenic heterogeneity of renal endothelium. J. Pathol. 158: 319-323 [Medline]. |
| 10. | Gerritsen, M.E.. 1987. Functional heterogeneity of vascular endothelial cells. Biochem. Pharmacol. 36: 2701-2711 [Medline]. |
| 11. | Gerritsen, M.E., and C.M. Bloor. 1993. Endothelial cell gene expression in response to injury. FASEB (Fed. Am. Soc. Exp. Biol.) J. 7: 523-532 [Abstract]. |
| 12. | Girard, J.P., and T.A. Springer. 1995. High endothelial venules (HEVs): specialized endothelium for lymphocyte migration. Immunol. Today. 16: 449-457 [Medline]. |
| 13. | Hadley, J.T., Z. Lu, K. Wasniowska, A.W. Martin, S.C. Peiper, J. Hesselgesser, and R. Horuk. 1994. Postcapillary venule endothelial cells in kidney express a multispecific chemokine receptor that is structurally and functionally identical to the erythroid isoform, which is the Duffy blood group antigen. J. Clin. Invest. 94: 985-991 . |
| 14. |
Hanna, Z.,
C. Simard,
A. Laperriere, and
P. Jolicoeur.
1994.
Specific expression
of the human CD4 gene in mature CD4+ CD8- and immature CD4+ CD8+
T cells and in macrophages of transgenic mice.
Mol. Cell. Biol.
14:
1084-1094
|
| 15. | Harats, D., H. Kurihara, P. Belloni, H. Oakley, A. Ziober, D. Ackley, G. Cain, Y. Kurihara, R. Lawn, and E. Sigal. 1995. Targeting gene expression to the vascular wall in transgenic mice using the murine preproendothelin-1 promoter. J. Clin. Invest. 95: 1335-1344 . |
| 16. |
Introna, M.,
V.V. Alles,
M. Castellano,
G. Picardi,
L. De Gioia,
B. Bottazzai,
G. Peri,
F. Breviario,
M. Salmona,
L. De Gregorio, et al
.
1996.
Cloning of
mouse ptx3, a new member of the pentraxin gene family expressed at extrahepatic sites.
Blood.
87:
1862-72
|
| 17. | Janzer, R.C., and M.C. Raff. 1987. Astrocytes induce blood-brain barrier properties in endothelial cells. Nature (Lond.). 325: 253-257 [Medline]. |
| 18. |
Kaipainen, A.,
J. Korhonen,
T. Mustonen,
V.W.M. van Hinsbergh,
G. Fang,
D. Dumont,
M. Breitman, and
K. Alitalo.
1995.
Expression of the fms-like tyrosine kinase 4 gene becomes restricted to lymphatic endothelium during development.
Proc. Natl. Acad. Sci. USA.
92:
3566-3570
|
| 19. |
Kelly, R.,
S. Alonso,
S. Tajbakhsh,
G. Cossu, and
M. Buckingham.
1995.
Myosin light chain 3F regulatory sequences confer regionalized cardiac and skeletal muscle expression in transgenic mice.
J. Cell. Biol.
129:
383-396
|
| 20. | Korhonen, J., I. Lahtinen, M. Halmekyto, L. Alhonen, J. Janne, D. Dumont, and K. Alitalo. 1995. Endothelial-specific gene expression directed by the tie gene promoter in vivo. Blood. 86: 1826-1835 . |
| 21. | Kumar, S., D.C. West, and A. Ager. 1987. Heterogeneity in endothelial cells from large vessels and microvessels. Differentiation. 36: 57-70 [Medline]. |
| 22. |
Lassalle, P.,
S. Molet,
A. Janin,
J. Van der Heyden,
J. Tavernier,
W. Fliers,
R. Devos, and
A. Tonnel.
1996.
ESM-1 is a novel human endothelial cell-specific molecule expressed in the lung and regulated by cytokines.
J. Biol.
Chem.
271:
20458-20464
|
| 23. |
Li, L.,
J.M. Miano,
B. Mercer, and
E.N. Olson.
1996.
Expression of the
SM22alpha promoter in transgenic mice provides evidence for distinct transcriptional regulatory programs in vascular and smooth muscle cells.
J. Cell.
Biol.
132:
849-859
|
| 24. |
Liska, D.J.,
M.J. Reed,
E.H. Sage, and
P. Bornstein.
1994.
Cell-specific expression of alpha 1(I) collagen-hGH minigenes in transgenic mice.
J. Cell. Biol.
125:
695-704
|
| 25. | Lobrinus, J.A., L. Juillerat-Jeanneret, P. Darekar, B. Schlosshauer, and R.C. Janzer. 1992. Induction of the blood brain barrier specific HT7 and neurothelin epitopes in endothelial cells of the chick chorioallantoic vessels by a soluble factor derived from astrocytes. Brain Res. Dev. Brain. Res. 70: 207-211 [Medline]. |
| 26. | Lodge, P.A., C.E. Haisch, and F.T. Thomas. 1992. A simple method of vascular endothelial cell isolation. Transplant. Proc. 24: 2816-2817 [Medline]. |
| 27. | Maxwell, K., J.A. Berliner, and P.A. Cancilla. 1987. Induction of gamma-glutamyl transpeptidase in cultured cerebral endothelial cells by a product released by astrocytes. Brain Res. 410: 309-314 [Medline]. |
| 28. |
Mikawa, T., and
D.A. Fischman.
1992.
Retroviral analysis of cardiac morphogenesis: discontinuous formation of coronary vessels.
Proc. Natl. Acad. Sci.
USA.
89:
9504-9508
|
| 29. | Miller, J.H. 1972. Experiments in Molecular Genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 446 pp. |
| 30. | Nishida, M., J.P. Springhorn, R.A. Kelly, and T.W. Smith. 1993. Cell-cell signaling between adult rat ventricular myocytes and cardiac microvascular endothelial cells in heterotypic primary culture. J. Clin. Invest. 91: 1934-1941 . |
| 31. | Noden, D.M.. 1990. Origins and assembly of avian embryonic blood vessels. Ann. N.Y. Acad. Sci. 588: 236-249 [Medline]. |
| 32. |
Okazaki, K.,
T. Ishikawa,
M. Inui,
M. Tada,
K. Goshima,
T. Okamoto, and
H. Hidaka.
1994.
KN-62, a specific Ca++/calmodulin-dependent protein kinase inhibitor, reversibly depresses the rate of beating of cultured fetal
mouse cardiac myocytes.
J. Pharmacol. Exp. Ther.
270:
1319-1324
|
| 33. | Page, C., M. Rose, M. Yacoub, and R. Pigott. 1992. Antigenic heterogeneity of vascular endothelium. Am. J. Pathol. 141: 673-683 [Abstract]. |
| 34. | Poole, T.J., and J.D. Coffin. 1989. Vasculogenesis and angiogenesis: two distinct morphogenetic mechanisms establish embryonic vascular pattern. J. Exp. Zool. 251: 224-231 [Medline]. |
| 35. |
Rand, J.H.,
L. Badimon,
R.E. Gordon,
R.R. Uson, and
V. Fuster.
1987.
Distribution of von Willebrand factor in porcine intima varies with blood vessel
type and location.
Arteriosclerosis.
7:
287-291
|
| 36. | Resnick, N., and M.A. Gimbrone. 1995. Hemodynamic forces are complex regulators of endothelial gene expression. FASEB (Fed. Am. Soc. Exp. Biol.) J. 9: 874-882 [Abstract]. |
| 37. |
Resnick, N.,
T. Collins,
W. Atkinson,
D.T. Bonthron,
C.F. Dewey, and
M.A. Gimbrone.
1993.
Platelet-derived growth factor B chain promoter contains a
cis-acting fluid shear-stress-responsive element.
Proc. Natl. Acad. Sci. USA.
90:
4591-4595
|
| 38. | Rossi, M.A.. 1992. Chronic hemodynamic unloading regulates the morphologic development of newborn mouse hearts transplanted into the ear of isogeneic adult mice. Am. J. Pathol. 141: 183-191 [Abstract]. |
| 39. | Ruggeri, Z.M., and J. Ware. 1993. von Willebrand factor. FASEB (Fed. Am. Soc. Exp. Biol.) J. 7: 308-316 [Abstract]. |
| 40. |
Sadler, J.E..
1991.
von Willebrand factor.
J. Biol. Chem.
266:
22777-22780
|
| 41. | Schlaeger, T.M., Y. Qin, Y. Fujiwara, J. Magram, and T.N. Sato. 1995. Vascular endothelial cell lineage-specific promoter in transgenic mice. Development (Camb.). 121: 1089-1098 [Abstract]. |
| 42. | Schlosshauer, B.. 1993. The blood brain barrier: morphology, molecules and neurothelin. Bioessays. 15: 341-346 [Medline]. |
| 43. | Senis, Y.A., M. Richardson, S. Tinlin, D.H. Maurice, and A.R. Giles. 1996. Changes in the pattern of distribution of von Willebrand factor in rat aortic endothelial cells following thrombin generation in vivo. Br. J. Hematol. 93: 195-203 [Medline]. |
| 44. | Smith, J.M., J.H. Meinkoth, T. Hochstatter, and K.M. Meyers. 1996. Differential distribution of von Willebrand factor in canine vascular endothelium. Am. J. Vet. Res. 57: 750-755 [Medline]. |
| 45. | Stewart, P.A., and M.J. Wiley. 1981. Developing nervous tissue induces formation of blood-brain barrier characteristics in invading endothelial cells: A study using quail-chick transplantation chimeras. Dev. Biol. 84: 183-192 [Medline]. |
| 46. | Streeter, P.R., E.L. Berg, B.T.N. Rouse, R.F. Bargatze, and E.C. Butcher. 1988. A tissue-specific endothelial cell molecule involved in lymphocyte homing. Nature (Lond.). 331: 41-46 [Medline]. |
| 47. | Tao-Cheng, J.H., Z. Nagy, and M.W. Brightman. 1987. Tight junctions of brain endothelium in vitro are enhanced by astroglia. J. Neurosci. 7: 3293-3299 [Abstract]. |
| 48. | Tomlinson, A., H. van Vlijmen, A. Loesch, and G. Burnstock. 1991. An immunohistochemical study of endothelial cell heterogeneity in the rat: observations in "en face" Hautchen preparations. Cell. Tissue Res. 263: 173-181 [Medline]. |
| 49. | Turner, R.R., J.H. Beckstead, R.A. Warnke, and G.S. Wood. 1987. Endothelial cell phenotypic diversity. Am. J. Clin. Pathol. 87: 569-575 [Medline]. |
| 50. | Wang, R., R. Clark, and V.L. Bautch. 1992. Embryonic stem cell-derived cystic embryoid bodies form vascular channels: an in vitro model of blood vessel development. Development (Camb.). 114: 303-316 [Abstract]. |
| 51. |
Woodley, S.L.,
M. McMillan,
J. Shelby,
D.H. Lynch,
L.K. Roberts,
R.D. Ensley, and
W.H. Barry.
1991.
Myocyte injury and contraction abnormalities
produced by cytotoxic T lymphocytes.
Circulation.
83:
1410-1418
|
| 52. | Wu, Q.Y., L. Drouet, J.L. Carrier, C. Rothschild, M. Berard, C. Rouault, J.P. Caen, and D. Meyer. 1987. Differential distribution of von Willebrand factor in endothelial cells. Comparison between normal pigs and pigs with von Willebrand disease. Arteriosclerosis. 7: 47-54 [Abstract]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|