|
||
© The Rockefeller University Press,
0021-9525/1997//145 $5.00
The Journal of Cell Biology, Volume 139, Number 1,
, 1997 145-156
Article |
Positive and Negative Regulation of Muscle Cell Identity by Members of the hedgehog and TGF-β Gene Families


Institute of Neuroscience, University of Oregon, Eugene, Oregon 97403
We have examined whether the development of embryonic muscle fiber type is regulated by competing influences between Hedgehog and TGF-β signals, as previously shown for development of neuronal cell identity in the neural tube. We found that ectopic expression of Hedgehogs or inhibition of protein kinase A in zebrafish embryos induces slow muscle precursors throughout the somite but muscle pioneer cells only in the middle of the somite. Ectopic expression in the notochord of Dorsalin-1, a member of the TGF-β superfamily, inhibits the formation of muscle pioneer cells, demonstrating that TGF-β signals can antagonize the induction of muscle pioneer cells by Hedgehog. We propose that a Hedgehog signal first induces the formation of slow muscle precursor cells, and subsequent Hedgehog and TGF-β signals exert competing positive and negative influences on the development of muscle pioneer cells.
Abbreviations used in this paper: β-gal, β-galactosidase; bGFP, bright green fluorescence protein; PKA, protein kinase A; twhh, tiggy-winkle hedgehog..
DURING vertebrate embryogenesis, the paraxial mesoderm gives rise to somites, which are paired blocks of mesoderm that lie adjacent to the notochord and neural tube. As somites mature, they become subdivided, with cells in different regions of the somite developing into different cell types, sclerotome, myotome, and dermatome. The differentiation of the somite into specific cell types is under the influence of inductive signals from surrounding tissues, such as notochord, neural tube, and the surface ectoderm (for review, see Hauschka, 1994; Christ and Ordahl, 1995).
A variety of extracellular signaling molecules, including members of hedgehog (Fan and Tessier-Lavigne, 1994; Johnson et al., 1994), Wnt (Munsterberg et al., 1995), and TGF-β (Pourquié et al., 1996) gene families, have been implicated in patterning the somite. Ventral midline tissues express Sonic hedgehog, which plays a critical role in sclerotome and myotome induction (Fan and Tessier-Lavigne, 1994; Johnson et al., 1994). Wnts, which are expressed in the neural tube, act in combination with Hedgehog to induce myogenesis in vitro (Munsterberg et al., 1995). Lateral plate mesoderm in chick embryos expresses BMP4, a TGF-β gene family member that is a candidate for inducing the differentiation of the lateral myogenic precursors in the somite, which give rise to the muscles of the limbs and body wall (Pourquié et al., 1996). This effect of BMP4 is opposed by an unknown diffusible factor expressed in the neural tube (Pourquié et al., 1996).
Vertebrate skeletal muscle contains muscle fibers of several types, which can be broadly classified as slow or fast fibers on the basis of differences in contraction speeds, metabolic activities, and motoneuron innervation. The earliest developing embryonic muscle fibers have intrinsic fiber type properties (Butler et al., 1982; Thornell et al., 1984; Crow and Stockdale, 1986; Harris et al., 1989; Fredette and Landmesser, 1991a,b; Hughes et al., 1993; Devoto et al., 1996b). Transplantation experiments and in vitro clonal analyses have demonstrated that these early myoblasts are committed to form particular fiber types (Miller and Stockdale, 1986a,b; Van Swearingen and Lance-Jones, 1995). However, the factors that regulate the embryonic development of myogenic precursor cell identity are still unknown.
We have examined the potential roles of members of the hedgehog and TGF-β gene families in the development of different muscle fiber types in zebrafish. We provide evidence that slow muscle cells are induced by Hedgehogs, and that this induction is likely due to respecification of fast muscle precursor cells into slow muscle cells. We also show that ectopic expression of Hedgehogs induces supernumerary muscle pioneer cells. This induction of muscle pioneers is repressed by ectopic expression in the notochord of Dorsalin-1, a BMP4-related protein. Our data suggest that members of the hedgehog and TGF-β gene families play opposing roles in patterning the developing somite.
| MATERIALS AND METHODS |
|---|
|
|
|---|
Plasmid Constructions
pCS-twhh-β-gal.
To link the tiggy-winkle hedgehog (twhh)1 promoter to the gene encoding nuclear β-galactosidase (nβ-gal), plasmid pGEM-7Z-twhh5.5 containing a 5.5-kb genomic fragment of the twhh gene (Ekker et al., 1995b) was digested with SacI and BamHI and then deleted at the 3' end of the promoter to position –49 with respect to the ATG translation start codon by EXO-III nuclease using an Erase-a-Base kit (Promega Corp., Madison, WI). The resulting plasmid, pGEM-7Z- twhh5.2, containing the 5.2-kb twhh promoter, was partially digested with BstXI and EcoRI to release the DNA insert. The EcoRI site at the 5' end of the insert was then blunted by Klenow DNA polymerase and subcloned into the pBluescript-SK BstXI site that had been partially blunted by T4 DNA polymerase. The resulting plasmid, pBluescript-SK-twhh5.2, was digested with SacI and then blunted by T4 DNA polymerase. This linearized plasmid, pBluescript-SK-twhh5.2, was subsequently digested with SalI. The DNA insert containing the 5.2-kb twhh promoter sequence was purified and cloned into plasmid pCS-nβ-gal (a gift from D. Turner, R. Rupp, J. Lee, and H. Weintraub, Fred Hutchinson Cancer Research Center, Seattle, WA) at the SalI and HindIII sites, the latter site having been blunted by Klenow DNA polymerase. The resulting plasmid, pCS-twhh-β-gal, contains the 5.2-kb twhh promoter and the nuclear β-gal reporter gene.
pCS-twhh-β-gal-vec.
To make the twhh promoter into a convenient expression vector for expressing heterologous cDNAs, the BamHI site upstream of the twhh promoter in the plasmid pCS-twhh-β-gal was deleted. The resulting plasmid, which retains the BamHI site between the promoter and the β-gal, was isolated and designated pCS-twhh-β-gal-vec. Genes of interest can be cloned into the BamHI and XhoI sites of this vector by replacing the β-gal sequence.
pCS-twhh-bGFP.
The reporter gene, "bright" green fluorescent protein (bGFP) with a serine 65 to threonine mutation (Heim et al., 1995), was cloned into vector pCS-twhh-β-gal-vec BamHI/XhoI sites by blunt end ligation. The resulting plasmid was named pCS-twhh-bGFP.
pCS-twhh-dsl-1myc.
dorsalin-1 cDNA was amplified from 9-d chick embryos by reverse transcriptase PCR using primers based on the published chick dsl-1 DNA sequence (Basler et al., 1993). The sequences for the 5' and 3' PCR primers were 5' CTCTGTCTGTAAAGATTCAAC 3' and 5' GTACAGTTTCACAGACAGCAG 3', respectively. The PCR product was subcloned into the pCR-II vector (Invitrogen, San Diego, CA). The c-myc–tagged derivative (dsl-1myc) was constructed as previously described (Basler et al., 1993), with all subcloning steps carried out in the pCR-II vector. To place dsl-1myc after the twhh promoter, the DNA insert of dsl-1myc was first subcloned into the EcoRI site of expression vector pCS2+ (a gift from D. Turner, R. Rupp, J. Lee, and H. Weintraub), which has a cytomegalovirus promoter and a polyadenylation site. The resulting plasmids were named pCS2+-dsl-1myc. To link dsl-1myc to the twhh promoter, the dsl-1myc insert was released from pCS2+-dsl-1myc by BamHI and XhoI digestion and then subcloned into pCS-twhh-β-gal-vec BamHI and XhoI sites by replacing the β-gal sequence. The final construct, pCS-twhh-dsl-1myc, contains the 5.2-kb twhh promoter and dsl-1myc.
pT7TSshh, pT7TStwhh, pT7TS-X-shhfs, pCS2+dnPKA-GFP, and pSP64T-PKA*.
Plasmid pT7TSshh and pT7TStwhh contain the zebrafish shh and twhh cDNAs, respectively (Ekker et al., 1995b); plasmid pT7TS-X-shhfs contains the Xenopus shh with a single base pair insertion, resulting in a frame shift in amino acid position No. 39 (Ekker et al., 1995a). Plasmid pCS2+dnPKA-GFP contains the dominant negative form of PKA regulatory subunit (Ungar and Moon, 1996). Plasmid pSP64T-PKA* contains the constitutively active PKA catalytic subunit (Hammerschmidt et al., 1996a).
In Vitro mRNA Synthesis
shh and twhh RNAs were transcribed from DNA plasmid T7TSshh or T7TStwhh as described (Ekker et al., 1995b). Capped mRNAs were transcribed from linearized DNA template with a T7 RNA polymerase in vitro transcription kit (mMESSAGE mMACHINE T7, Ambion, Inc., Austin, TX) according to the manufacturer's instructions.
β-Gal Labeling
β-Gal labeling was carried out with minor modification of published procedures (Westerfield et al., 1992). Embryos were fixed for 30 min at room temperature with rotation, with or without removing the chorion, in 4% paraformaldehyde, 0.2% glutaraldehyde, 4% sucrose, 0.15 mM CaCl2, and 1x PBS. To visualize β-gal activity, embryos were rinsed twice for 15 min with PBS containing 0.1% Triton X-100 and then incubated in reaction solution containing 0.04% x-gal (bromo-4-chloro-indoxyl-β-D-galactoside), 1 mM MgCl2, 3.3 mM K4[Fe3(CN)6], and 3.3 mM K3[Fe2(CN)6] at room temperature for 1–2 h. The reaction was stopped by replacing the substrate solution with PBS.
Microinjection
For DNA microinjection, linearized DNA was dissolved in distilled H2O to a final concentration of 50 µg/ml. For mRNA injection, mRNA was dissolved in distilled H2O to a final concentration of 100 µg/ml. A final concentration of 0.1% phenol red was added to the DNA or RNA solution to facilitate visualization during microinjection. Approximately 2 nl of DNA or RNA solution was microinjected into the cytoplasm of zebrafish embryos at the one- or two-cell stage.
Antibody Labeling
For antibody labeling, embryos were fixed in 4% paraformaldehyde in 1x PBS for 2 h at room temperature. Embryos were washed twice for 5 min in 1x PBS and once for 5 min in water. Embryos were then soaked in cold acetone for 10 min at –20°C. Embryos were washed once with water for 5 min, and twice with 1x PBS for 5 min each, and once with BDP (0.1% bovine serum albumin, 1% dimethylsulfoxide, 1x PBS) for 5 min. For labeling using monoclonal antibodies, the embryos were incubated with avidin-blocking reagent (Vector Laboratories, Burlingame, CA) and 10% goat serum in BDP for 30 min at room temperature. The embryos were then rinsed twice for 5 min in BDP and subsequently incubated with 1:5 diluted antiengrailed monoclonal antibody 4D9 (Patel et al., 1989) and/or 1:500 diluted anti–c-myc monoclonal antibody (Oncogene Science, Cambridge, MA) together with biotin-blocking reagent (Vector Laboratories) overnight at 4°C with shaking. The embryos were then washed three times for 30 min with BDP, followed by incubation with 1:500 diluted biotin-labeled secondary antibody (Vector Laboratories) in BDP for 1 h at 37°C. Embryos were then washed three times for 30 min with BDP and incubated with 1:1 diluted ABC solution (avidin biotin complex) for 30 min at room temperature. Embryos were washed three times for 30 min in BDP and then presoaked in DAB solution (0.05% diaminobezidine, 1% DMSO, 1x PBS) for 10 min at room temperature. The DAB soaking solution was then replaced by DAB staining solution containing 0.003% of H2O2 in DAB soaking solution. The staining was monitored and stopped by washing twice for 10 min with BDP. Embryos were photographed in PBS.
Immunofluorescent labeling of sections with the F59 and 4D9 monoclonal antibodies was done as previously described (Crow and Stockdale, 1986; Devoto et al., 1996b).
| RESULTS |
|---|
|
|
|---|
|
|
|
Competition between BMP4 expressed in the dorsal neural tube and Sonic hedgehog expressed in the ventral neural tube has been shown to play an important role in dorsoventral patterning of the spinal cord (Basler et al., 1993; Liem et al., 1995). Somite patterning may also be regulated by competing positive and negative signals, including BMP4 (Fan and Tessier-Lavigne, 1994; Pourquié et al., 1996). To learn whether a BMP4-like protein can affect the development of muscle cell identity in zebrafish, we tested whether ectopic expression of Dorsalin-1, a BMP4-like factor, would inhibit the formation of muscle pioneer cells in surrounding somites. We used the chick Dorsalin-1 in this study for several reasons. First, the dorsal neural tube (Basler et al., 1993), a tissue known to play a role in somite patterning (Lassar and Munsterberg, 1996; Pourquié, et al., 1996), expresses Dorsalin-1. Second, Dorsalin-1 can antagonize Hedgehog signaling in the dorsoventral patterning of the neural tube (Basler et al., 1993; Liem et al., 1995). Third, at the time we initiated this study, no gene encoding BMP or a BMP-like protein expressed in the neural tube had been isolated from zebrafish. More recently, a BMP-like gene named radar was reported in zebrafish; however, this clone contains only the partial coding region (Rissi et al., 1995).
In initial experiments, we found that injection of Dorsalin-1 mRNA had a severe ventralizing effect during gastrulation, similar to that caused by injection of BMP4 mRNA (Hammerschmidt, et al., 1996b). Thus, to assess potential later effects on somite patterning, we expressed Dorsalin-1 in the notochord after gastrulation. Additionally, expression of Dorsalin-1 in the notochord localized the protein to the region of the somites, where we anticipated the lowest activity of the putative inhibitor of Hedgehog signaling. To express a potential inhibitor specifically in this region of the somites, we put dorsalin-1 under the control of a promoter from the tiggy-winkle hedgehog gene. The floor plate normally expresses Tiggy-winkle hedgehog. Paradoxically, we found that 5.2 kb of the 5'-flanking sequence from the tiggy-winkle hedgehog gene leads to expression of heterologous proteins, including β-galactosidase, specifically in the notochord (Fig. 4 A; a further characterization of this promoter is in progress). Thus, we used this promoter fragment to express Dorsalin-1 in the notochord.
|
Notochord Expression of Dorsalin-1 Fails to Block the Development of Non–muscle Pioneer Slow Muscle Cells
Muscle pioneers are derived from a subset of slow muscle precursor cells, whereas most of the precursor cells develop into non–muscle pioneer slow muscle cells (Devoto et al., 1996b). To learn whether ectopic expression of Dorsalin-1 in the notochord inhibits the development of muscle pioneer cells specifically or whether non–muscle pioneer slow muscle cells are also affected, we injected embryos with twhh-dsl-1myc DNA and labeled with the F59 antibody, which recognizes all of the slow muscle cells (Fig. 1; Devoto et al., 1996b). As shown by the bracket in Fig. 5 A, there was a gap in F59 labeling in the middle of some of the somites in embryos injected with twhh-dsl-1myc. Transverse sections through unaffected regions (Fig. 5 B) and affected regions (Fig. 5 C) demonstrated that this gap in labeling is a result of the absence of the muscle pioneer population of slow muscle cells, which are normally located adjacent to the notochord (Fig. 5 B, arrows). In contrast, the dorsal and ventral populations of slow muscle cells (the non–muscle pioneer slow muscle cells; Fig. 5, B and C, arrowheads) are apparently unaffected by Dorsalin-1. These data demonstrate that notochord expression of Dorsalin-1 specifically interferes with the development of muscle pioneer cell identity and does not affect the development of the non–muscle pioneer slow muscle cells from adaxial cells.
|
|
|
| DISCUSSION |
|---|
|
|
|---|
Induction of Slow Muscle by Hedgehogs
We have shown that ectopic expression of members of the hedgehog gene family during early zebrafish development induces extra slow muscle cells, suggesting that Hedgehog signaling participates in the establishment of slow muscle cell identity. This is further supported by our observation that inhibition of PKA, likely to occur during Hedgehog signaling, mimics the activity of Hedgehog in slow muscle induction and that constitutive activation of PKA blocks the development of slow muscle cells. Several observations support the hypothesis that one or more Hedgehogs are the endogenous factors that induce the formation of slow muscle precursors during normal development. First, slow muscle precursors develop adjacent to the notochord, becoming apparent after notochord precursor cells begin to express hedgehog genes (Krauss et al., 1993; Roelink et al., 1994; Currie and Ingham, 1996; Devoto et al., 1996b). Second, all slow muscle precursors strongly express the patched gene, which is induced by Hedgehog signaling (Concordet et al., 1996), suggesting that they receive and respond to Hedgehog. Third, there is a loss of slow muscle cells in mutants in which Hedgehog signaling is reduced (Talbot et al., 1995; Devoto et al., 1996a; Weinberg et al., 1996). Together with the results reported here, these observations provide compelling evidence that Hedgehogs induce slow muscle cells.
Muscle Pioneer Induction
We found that ectopic expression of either Sonic hedgehog or Tiggy-winkle hedgehog induced ectopic muscle pioneer cells. Our data differ from a previous report that ectopic expression of Sonic hedgehog was unable to induce muscle pioneers, unless another member of the Hedgehog family, Echidna hedgehog, was coexpressed (Currie and Ingham, 1996). The reason for this discrepancy is unclear, although the two studies used different plasmids that generate RNAs with different untranslated regions. It is possible that these differences affected the stability or translation of the RNA. Our results are consistent with those reported by Hammerschmidt et al. (1996a), who found that ectopic expression of either mouse Sonic hedgehog or Indian hedgehog induced extra muscle pioneer cells in zebrafish embryos.
We propose that early signaling by Hedgehogs is sufficient to trigger the development of slow muscle identity, but that muscle pioneer development requires additional later exposure to Hedgehogs (Fig. 8 A). This hypothesis is supported by the following observations. First, slow muscle precursors are distinct from the other presomitic cells before muscle pioneers become distinct from the other slow muscle precursors. Second, injection of Hedgehog RNA was consistently more effective at inducing non– muscle pioneer slow muscle cells than muscle pioneer cells. Third, hedgehog RNA injection induces muscle pioneers more effectively in anterior somites than in posterior somites of the embryo (data not shown). If the injected hedgehog RNA is degraded over time, then there would consistently be more ectopic hedgehog early in development (in anterior somites) than there would be later in development (in posterior somites). Finally, in several mutants (no tail, floating head), Hedgehog expression becomes progressively reduced, relative to wild-type embryos, as development proceeds. In these mutants, muscle pioneers are missing, whereas other slow muscle cells develop relatively normally, especially in the earlier developing anterior somites (Devoto et al., 1996a).
|
We have shown that when it is expressed in the notochord, Dorsalin-1 has a specific effect on muscle pioneer identity and does not affect the differentiation of non– muscle pioneer slow muscle fibers. Several studies have suggested that BMPs have a limited range of diffusion, raising the question of whether non–muscle pioneer cells are also exposed to Dorsalin-1 protein when it is expressed in the notochord. We think that the specificity of Dorsalin-1 action on muscle pioneer cells but not on the non–muscle pioneer cells due to a difference in the exposure to Dorsalin-1 is unlikely for several reasons. First, Dorsalin-1 was expressed in the notochord just before the migration of adaxial cells away from the notochord, and thus all slow muscle precursors would be exposed to Dorsalin-1 (data not shown). Second, in the case of dominant negative PKA and Dorsalin-1 coinjection, non–muscle pioneer slow muscle cells were induced in the region adjacent to the notochord cells expressing Dorsalin-1, whereas muscle pioneer cells were inhibited in this region (compare Fig. 7, C with F), suggesting that the lack of effect on non–muscle pioneer cells is unlikely the result of a limited range of Dorsalin-1 action.
It is likely that slow muscle identity is established earlier than muscle pioneer cell identity. Slow muscle precursors are morphologically and molecularly distinct at the end of gastrulation (Devoto, et al., 1996b; Weinberg, et al., 1996), whereas muscle pioneers are not identifiably separate from the other slow muscle precursors until the time of somite formation, when they express engrailed genes and develop their distinctive morphology (Felsenfeld et al., 1991; Hatta et al., 1991; Ekker et al., 1992). Expression of dorsalin-1 from the twhh promoter begins before the appearance of muscle pioneer identity and before the migration of the slow muscle precursors away from the notochord (data not shown). Thus, all of the slow muscle cells are likely to be exposed to Dorsalin-1; this suggests that the development of non–muscle pioneer slow muscle precursors is unaffected by exposure to Dorsalin-1 at this time, perhaps because they are already committed to a slow muscle fate. We have not tested whether BMP-like signals acting earlier, during gastrulation, influence the development of non–muscle pioneer slow muscle cells.
twhh Promoter
In this study, we showed that the 5.2-kb twhh promoter could drive expression of heterologous cDNAs specifically in the notochord. This notochord specificity was unexpected considering that the endogenous twhh gene is exclusively expressed in the floor plate. It is possible that the 5.2-kb twhh promoter we isolated and used may lack a repressor sequence present in the twhh gene that inhibits the notochord expression of the twhh gene. Our results highlight the power of using tissue-specific promoters to direct expression of proteins to specific tissue types, at specific times, in the zebrafish embryo. This will be generally useful for analyzing later functions of genes that also have functions during gastrulation (see also Kroll and Amaya, 1996).
Model
Based on our results and studies by other laboratories, we propose that the differentiation of slow muscle cells in zebrafish is regulated by at least two signals, Hedgehogs and BMP-like proteins (Fig. 8). During early stages of development, Hedgehogs secreted from midline cells induce paraxial mesodermal cells to become adaxial cells, the precursors of slow muscle. We propose that this early exposure to Hedgehogs is sufficient to signal the development of non–muscle pioneer slow muscle cells; however, it is insufficient for the development of muscle pioneer cells. Differentiation of muscle pioneers requires prolonged exposure to the inductive Hedgehog signals, and minimal exposure to an inhibitory BMP-like signal. In the dorsal and ventral regions of the somite, an inhibitory BMP4-like signal blocks the response to Hedgehog, whereas in the middle region of the somite, this inhibitory BMP-like activity is absent or very low and consequently restricts the development of muscle pioneer cells to the middle region of the somite. The mechanism for setting up this low BMP-like activity in the middle region of the somite is unknown. One possibility is an uneven distribution of the BMPs and BMP-like protein within the somite. The dorsal and ventral regions are exposed to a high concentration of the BMP-like protein, while the middle region is exposed to a low concentration of BMP-like protein. Evidence supporting this hypothesis comes from studies of mediolateral patterning of the chick somite. In chick embryos, the lateral part of the somite is exposed to a high concentration of BMP4 expressed in the lateral plate mesoderm (Pourquié et al., 1996). BMP4 from this source acts as a diffusible lateralizing signal to specify the hypaxial muscle lineage (Pourquié et al., 1996). In zebrafish, several BMPs and BMP-like proteins have been shown to be expressed in tissues near the somite during segmentation stages. For example, a BMP-like gene, radar, is specifically expressed in the dorsal neural tube and hypochord cells (Rissi et al., 1995), and BMP2 and BMP4 are expressed primarily in the mesenchyme of dorsal and ventral fins (Nikaido et al., 1997). Therefore, it is likely that there is a gradient in the distribution of BMP and BMP-like proteins within the somite, with higher concentrations in the dorsal and ventral regions of the somite and lower concentrations in the middle region of the somite. Alternatively, the BMP inhibitory activity might be reduced in the middle region of the somite (around the notochord) by an opposing signal from the notochord that blocks the BMP-like activity in this region. Chordin (Piccolo et al., 1996), Noggin (Zimmerman et al., 1996), and Follistatin (Hemmati-Brivaniou et al., 1994) can each bind to and inactivate BMPs and other TGF-β family members, and in Xenopus these genes are also expressed in the notochord (Smith and Harland, 1992; Hemmati-Brivanlou et al., 1994; Sasai et al., 1994). Thus, Chordin, Noggin, or Follistatin could repress the BMP-like activity in the notochord region, allowing the development of muscle pioneer cells. Further experiments are required to learn which mechanism is correct, and possibly both mechanisms are used to establish an uneven distribution of BMP-like inhibition of muscle pioneer development. This BMP4-like signal may also stimulate migration of adaxial cells toward the surface of the somite, where they are consequently exposed to a lower concentration of Hedgehogs. Regardless of the mechanism, this model predicts that these opposing signals determine slow muscle cell identities; adaxial cells that remain near the notochord express engrailed and develop into muscle pioneers, whereas the adaxial cells in the dorsal and ventral regions of the somite do not develop into muscle pioneers.
Our model is similar to that proposed for the dorsoventral patterning of the spinal cord (Liem et al., 1995; Ericson et al., 1996). Sonic hedgehog expressed by the notochord induces ventral cell types, such as floor plate and motorneurons, whereas BMP4 expressed in the dorsal neural tube induces dorsal cell types, such as neural crest, roof plate cells, and dorsal commissural neurons (Liem et al., 1995). The activity of Hedgehog and BMP4 are mutually antagonistic; Hedgehog inhibits the responses to BMP4, and BMP4 in turn inhibits the responses to Hedgehog (Liem et al., 1995). It has been suggested that patterning of the chick somite also involves the opposing actions of signals from surrounding tissues, including the neural tube and notochord (Fan and Tessier-Lavigne, 1994; Pourquié et al., 1996). These signals include Sonic hedgehog and BMP4 (Munsterberg et al., 1995; Pourquié et al., 1996). Our results suggest that in addition to regulating the broad subdivisions of the somite into sclerotome and dermamyotome, the opposing actions of hedgehog and TGF-β gene family members also regulate the development of embryonic muscle fiber-type identity.
| Acknowledgments |
|---|
This work was supported by Public Health Services Grants HD29360, HD22486, and NS21132. R.T. Moon is an investigator of the Howard Hughes Medical Institute.
Submitted: 24 April 1997
Revised: 25 June 1997
Address all correspondence to Randall T. Moon, Howard Hughes Medical Institute, Box 35370, Room K536C HSB, University of Washington, Seattle, WA 98195. Tel.: (206) 543-1722. Fax: (206) 616-4230. e-mail: rtmoon{at}u.washington.edu
| REFERENCES |
|---|
|
|
|---|
Basler, K., T. Edlund, T.M. Jessell, and T. Yamada. 1993. Control of cell pattern in the neural tube: regulation of cell differentiation by dorsalin-1, a novel TGF β family member. Cell. 73:687–702.
Butler J, Cosmos E & Brierley J. Differentiation of muscle fiber types in aneurogenic brachial muscles of the chick embryo, J Exp Zool, 1982, 224, 65–80.[Medline]
Christ B & Ordahl CP. Early stages of chick somite development, Anat Embryol (Berl), 1995, 191, 381–396.[Medline]
Concordet JP, Lewis KE, Moore JW, Goodrich LV, Johnson RL, Scott MP & Ingham PW. Spatial regulation of zebrafish patched homologue reflects the roles of sonic hedgehogand protein kinase A in neural tube and somite patterning, Development (Camb), 1996, 122, 2835–2846.[Abstract]
Crow MT & Stockdale FE. Myosin expression and specialization among the earliest muscle fibers of the developing avian limb, Dev Biol, 1986, 113, 238–254.[Medline]
Currie PD & Ingham PW. Induction of a specific muscle cell type by a Hedgehog-like protein in zebrafish, Nature (Lond), 1996, 382, 452–455.[Medline]
Devoto SH, Melançon E, Amacher SL, Eisen JS & Westerfield M. Influence of axial mesoderm on the development of slow muscle precursors, Dev Biol, 1996a, 175, 386.
Devoto SH, Melançon E, Eisen JS & Westerfield M. Identification of separate slow and fast muscle precursor cells in vivo, prior to somite formation, Development (Camb), 1996b, 122, 3371–3380.[Abstract]
Ekker M, Wegner J, Akimenko MA & Westerfield M. Coordinate embryonic expression of three zebrafish engrailed genes, Development (Camb), 1992, 116, 1001–1010.[Abstract]
Ekker SC, McGrew LL, Lai CJ, Lee JJ, von Kessler DP, Moon RT & Beachy PA. Distinct expression and shared activities of members of the hedgehog gene family of Xenopus laevis. , Development (Camb), 1995a, 121, 2337–2347.[Abstract]
Ekker SC, Ungar AR, Greenstein P, von Kessler DP, Porter JA, Moon RT & Beachy PA. Patterning activities of vertebrate Hedgehog proteins in the developing eye and brain, Curr Biol, 1995b, 5, 944–955.[Medline]
Ericson J, Morton S, Kawakami A, Roelink H & Jessell TM. Two critical periods of sonic hedgehog signaling required for the specification of motor neuron identity, Cell, 1996, 87, 661–673.[Medline]
Fan CM & Tessier-Lavigne M. Patterning of mammalian somites by surface ectoderm and notochord: evidence for sclerotome induction by a hedgehog homolog, Cell, 1994, 79, 1175–1186.[Medline]
Fan CM, Porter JA, Chiang C, Chang DT, Beachy PA & Tessier-Lavigne M. Long-range sclerotome induction by sonic hedgehog: direct role of the amino-terminal cleavage product and modulation by the cyclic AMP signaling pathway, Cell, 1995, 81, 457–465.[Medline]
Felsenfeld AL, Curry M & Kimmel CB. The fub-1 mutation blocks initial myofibril formation in zebrafish muscle pioneer cells, Dev Biol, 1991, 148, 23–30.[Medline]
Fredette BJ & Landmesser LT. A reevaluation of the role of innervation in primary and secondary myogenesis in developing chick muscle, Dev Biol, 1991a, 143, 19–35.[Medline]
Fredette BJ & Landmesser LT. Relationship of primary and secondary myogenesis to fiber type development in embryonic chick muscle, Dev Biol, 1991b, 143, 1–18.[Medline]
Hammerschmidt M, Bitgood MJ & McMahon AP. Protein kinase A is a common negative regulator of hedgehog signaling in the vertebrate embryo, Genes Dev, 1996a, 10, 647–658.
Hammerschmidt M, Serbedzija GN & McMahon AP. Genetic analysis of dorsoventral pattern formation in the zebrafish: requirement of a BMP-like ventralizing activity and its dorsal repressor, Genes Dev, 1996b, 10, 2452–2461.
Harris AJ, Fitzsimons RB & McEwan JC. Neural control of the sequence of expression of myosin heavy chain isoforms in fetal mammalian muscles, Development (Camb), 1989, 107, 751–769.
Hatta K, Bremiller R, Westerfield M & Kimmel CB. Diversity of expression of engrailed-like antigens in zebrafish, Development (Camb), 1991, 112, 821–832.[Abstract]
Hauschka, S.D. 1994. Development, anatomy, and cell biology. In Myology. A. Engel and C. Franzini-Armstrong, editors. McGraw Hill Press, NY. 3–73.
Hemmati-Brivaniou A, Kelly OG & Melton DA. Follistatin, an antagonist of activin, is expressed in the Spemann organizer and displays direct neuralizing activity, Cell, 1994, 77, 283–291.[Medline]
Heim R, Cubitt AB & Tsien RY. Improved green fluorescence [letter], Nature (Lond), 1995, 373, 663–664.[Medline]
Hughes SM, Cho M, Karsch I, Mizrachi, Travis M, Silberstein L, Leinwand LA & Blau HM. Three slow myosin heavy chains sequentially expressed in developing mammalian skeletal muscle, Dev Biol, 1993, 158, 183–199.[Medline]
Jiang J & Struhl G. Protein kinase A and hedgehog signaling in Drosophila limb development, Cell, 1995, 80, 563–572.[Medline]
Johnson RL, Laufer E, Riddle RD & Tabin C. Ectopic expression of Sonic hedgehog alters dorsal-ventral patterning of somites, Cell, 1994, 79, 1165–1173.[Medline]
Kimmel CB, Ballard WW, Kimmel SR, Ullmann B & Schilling TF. Stages of embryonic development of the zebrafish, Dev Dyn, 1995, 203, 253–310.[Medline]
Krauss S, Concordet JP & Ingham PW. A functionally conserved homolog of the Drosophilasegment polarity gene hh is expressed in tissues with polarizing activity in zebrafish embryos, Cell, 1993, 75, 1431–1444.[Medline]
Kroll LK & Amaya E. Transgenic Xenopusembryos from sperm nuclear transplantations reveal FGF signaling requirements during gastrulation, Development (Camb), 1996, 122, 3173–3183.[Abstract]
Lassar AB & Munsterberg AE. The role of positive and negative signals in somite patterning, Curr Opin Neurobiol, 1996, 6, 57–63.[Medline]
Li W, Ohlmeyer JT, Lane ME & Kalderon D. Function of protein kinase A in hedgehog signal transduction and Drosophila imaginal disc development, Cell, 1995, 80, 553–562.[Medline]
Liem KF, Tremml G Jr, Roelink H & Jessell TM. Dorsal differentiation of neural plate cells induced by BMP-mediated signals from epidermal ectoderm, Cell, 1995, 82, 969–979.[Medline]
Miller JB & Stockdale FE. Developmental origins of skeletal muscle fibers: clonal analysis of myogenic cell lineages based on expression of fast and slow myosin heavy chains, Proc Natl Acad Sci USA, 1986a, 83, 3860–3684.
Miller JB & Stockdale FE. Developmental regulation of the multiple myogenic cell lineages of the avian embryo, J Cell Biol, 1986b, 103, 2197–2208.
Miller JB, Teal SB & Stockdale FE. Evolutionarily conserved sequences of striated muscle myosin heavy chain isoforms. Ectopic mapping by cDNA expression, J Biol Chem, 1989, 264, 13122–13130.
Munsterberg AE, Kitajewski J, Bumcrot DA, McMahon AP & Lassar AB. Combinatorial signaling by Sonic hedgehog and Wnt family members induce myogenic bHLH gene expression in the somite, Genes Dev, 1995, 9, 2911–2922.
Nikaido M, Tada M, Saji T & Ueno N. Conservation of BMP signaling in zebrafish mesoderm patterning, Mech Dev, 1997, 61, 75–88.[Medline]
Orellana SA & Mcknight S. Mutations in the catalytic subunit of cAMP-dependent protein kinase result in unregulated biological activity, Proc Natl Acad Sci USA, 1992, 89, 4726–4730.
Pan D & Rubin GM. cAMP-dependent protein kinase and hedgehog act antagonistically in regulating decapentaplegic transcription in Drosophila imaginal discs, Cell, 1995, 80, 543–552.[Medline]
Patel NH, Martin E, Blanco, Coleman KG, Poole SJ, Ellis MC, Kornberg TB & Goodman CS. Expression of engrailed proteins in arthropods, annelids, and chordates, Cell, 1989, 58, 955–968.[Medline]
Perrimon N. Hedgehog and beyond, Cell, 1995, 80, 517–520.[Medline]
Piccolo S, Sasai Y, Lu B & De Robertis EM. Dorsoventral patterning in Xenopus: inhibition of ventral signals by direct binding of chordin to BMP-4, Cell, 1996, 86, 589–598.[Medline]
Pourquié O, Fan CM, Coltey M, Hirsinger E, Watanabe Y, Bréant C, Francis-West P, Brickell P, Tessier M, Lavigne & Le Douarin NM. Lateral and axial signals involved in avian somite patterning: a role for BMP4, Cell, 1996, 84, 461–471.[Medline]
Rissi M, Wittbrodt J, D'Elot E, Naegeli M & Rosa FM. Zebrafish Radar: a new member of the TGF-β superfamily defines dorsal regions of the neural plate and the embryonic retina, Mech Dev, 1995, 49, 223–234.[Medline]
Roelink H, Augsburger A, Heemskerk J, Korzh V, Norlin S, Ruiz i Altaba A, Tanabe Y, Placzek M, Edlund T, Jessell TM & Dodd J. Floor plate and motor neuron induction by vhh-1, a vertebrate homolog of hedgehog expressed by the notochord, Cell, 1994, 76, 761–775.[Medline]
Sasai Y, Lu B, Steinbeisser H, Geissert D, Gont LK & De Robertis EM. Xenopuschordin: a novel dorsalizing factor activated by organizer-specific homeobox genes, Cell, 1994, 79, 779–790.[Medline]
Smith WC & Harland RM. Expression cloning of noggin, a new dorsalizing factor localized to the Spemann organizer in Xenopus embryos, Cell, 1992, 70, 829–840.[Medline]
Talbot WS, Trevarrow B, Halpern ME, Melby AE, Farr G, Postlethwait JH, Jowett T, Kimmel CB & Kimelman D. A homeobox gene essential for zebrafish notochord development, Nature (Lond), 1995, 378, 150–157.[Medline]
Thornell LE, Billeter R, Butler GS, Browne, Eriksson PO, Ringqvist M & Whalen RG. Development of fiber types in human fetal muscle. An immunocytochemical study, J Neurol Sci, 1984, 66, 107–115.[Medline]
Trevarrow B, Marks DL & Kimmel CB. Organization of hindbrain segments in the zebrafish embryo, Neuron, 1990, 4, 669–679.[Medline]
Ungar AR & Moon RT. Inhibition of protein kinase A phenocopies ectopic expression of hedgehog in the CNS of wild-type and cyclopsmutant embryos, Dev Biol, 1996, 178, 186–191.[Medline]
van Raamsdonk W, van der Stelt A, Diegenbach PC, van de Berg W, de Bruyn H, van Dijk J & Mijzen P. Differentiation of the musculature of the teleost Brachydanio rerio. , Z Anat Entwicklngs gesch, 1974, 145, 321–342.
Van Swearingen J & Lance-Jones C. Slow and fast muscle fibers are preferentially derived from myoblasts migrating into the chick limb bud at different developmental times, Dev Biol, 1995, 170, 321–337.[Medline]
Waterman RE. Development of the lateral musculature in the teleost, Brachydanio rerio: a fine structural study, Am J Anat, 1969, 125, 457–493.[Medline]
Weinberg ES, Allende ML, Kelly CS, Abdelhamid A, Andermann P, Doerre G, Grunwald DJ & Riggleman B. Developmental regulation of zebrafish MyoD in wild-type, no tail, and spadetailembryos, Development (Camb), 1996, 122, 271–280.[Abstract]
Westerfield, M. 1995. Microscopic observation. In The Zebrafish Book. M. Westerfield, editor. University of Oregon Press, Eugene, OR. 4.1–4.5.
Westerfield M, Wegner J, Jegalian BG, DeRobertis EM & Püschel AW. Specific activation of mammalian Hox promoters in mosaic transgenic zebrafish, Genes Dev, 1992, 6, 591–598.
Zimmerman LB, De Jesus-Escobar JM & Harland RM. The Spermann organizer signal noggin binds and inactivates bone morphogenetic protein 4, Cell, 1996, 86, 599–606.[Medline]
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|