|
||
Research Institute, Osaka Medical Center for Maternal and Child Health, Izumi, Osaka 590-02, Japan
Fibronectin (FN) has a complex pattern of
alternative splicing at the mRNA level. One of the alternatively spliced segments, EDA, is prominently expressed during biological processes involving substantial cell migration and proliferation, such as embryonic development, malignant transformation, and wound
healing. To examine the function of the EDA segment,
we overexpressed recombinant FN isoforms with or
without EDA in CHO cells and compared their cell-adhesive activities using purified proteins. EDA+ FN
was significantly more potent than EDA
FN in promoting cell spreading and cell migration, irrespective of
the presence or absence of a second alternatively spliced
segment, EDB. The cell spreading activity of EDA+
FN was not affected by antibodies recognizing the
EDA segment but was abolished by antibodies against
integrin
5 and
1 subunits and by Gly-Arg-Gly-Asp-Ser-Pro peptide, indicating that the EDA segment enhanced the cell-adhesive activity of FN by potentiating the interaction of FN with integrin
5
1. In support of
this conclusion, purified integrin
5
1 bound more avidly to EDA+ FN than to EDA
FN. Augmentation of
integrin binding by the EDA segment was, however,
observed only in the context of the intact FN molecule, since the difference in integrin-binding activity between
EDA+ FN and EDA
FN was abolished after limited
proteolysis with thermolysin. Consistent with this observation, binding of integrin
5
1 to a recombinant
FN fragment, consisting of the central cell-binding domain and the adjacent heparin-binding domain Hep2,
was not affected by insertion of the EDA segment.
Since the insertion of an extra type III module such as
EDA into an array of repeated type III modules is expected to rotate the polypeptide up to 180° at the position of the insertion, the conformation of the FN molecule may be globally altered upon insertion of the EDA
segment, resulting in an increased exposure of the RGD
motif in III10 module and/or local unfolding of the module. Our results suggest that alternative splicing at the
EDA exon is a novel mechanism for up-regulating integrin-binding affinity of FN operating when enhanced
migration and proliferation of cells are required.
FIBRONECTINS (FNs)1 are multifunctional adhesive
glycoproteins present in the extracellular matrix
and various body fluids. They provide excellent
substrates for cell adhesion and spreading, thereby promoting cell migration during embryonic development, wound healing, and tumor progression (for review see
Hynes, 1990 FNs can interact with cells at three distinct regions: the
central cell-binding domain (CCBD), the COOH-terminal
heparin-binding domain (Hep2), and the type III-connecting segment (IIICS) including the CS1 region (Yamada,
1991 FNs purified from different sources appear to be slightly
different with respect to subunit sizes (Yamada and
Kennedy, 1979 Despite accumulated evidence for regulated expression
of EDA- and/or EDB-containing FNs in vivo, the biological functions of these isoforms are only poorly understood.
Many efforts have been made to detect functional differences between plasma FN and FNs purified from conditioned medium of cultured fibroblasts, collectively referred to as "cellular FN," and to elucidate the function of
alternatively spliced coding regions. No clear differences have been reported, however, between plasma and cellular FNs in their abilities to promote cell adhesion and
spreading, except that these two forms differ in their solubilities (for review see ffrench-Constant, 1995 Recently, we constructed an expression vector encoding
full length human plasma FN that lacks both the EDA and
EDB segments but includes IIICS and overexpressed this
recombinant isoform in human tumor cells to restore the
pericellular FN matrix around the tumor cells (Akamatsu
et al., 1996 cDNA Construction
cDNA expression vectors for the full length human FN isoforms differing
in the presence or absence of the EDA and/or EDB segments were constructed by modifying pAIPFN that encodes a full length FN lacking both
extra type III repeats (Akamatsu et al., 1996 For construction of the expression vector encoding the FN isoform containing EDA but not EDB, a BamHI-XbaI fragment of pHCF5 (provided
by Dr. K. Ichihara-Tanaka, Fujita Health University, Toyoake, Japan)
that encodes the EDA segment and its flanking region (Arg1449-Ser2308)
was cloned into the BamHI site of pUC119 in tandem with a XbaI- BamHI fragment of pAIFNC that comprises the sequence encoding Ser2308-Glu2446 and the 3 For construction of the expression vector encoding the FN isoform containing both EDA and EDB segments, a KpnI-SpeI fragment encoding
Val527-Arg1449 without the EDB segment was excised from pHCF93 (provided by Dr. K. Ichihara-Tanaka), filled in with the Klenow fragment of DNA polymerase I, and subcloned into the HincII site of pUC119 from
which the SacI site had been deleted. A 1.6-kbp fragment encoding Val527-
Ser1059 was excised from the pUC119 derivative (designated pHCFN93)
with EcoRI and SacI and ligated into EcoRI-AccI-cleaved pHCFN93 in tandem with the PCR-amplified SacI-AccI fragment that encodes Ser1200-Val1401
including the EDB segment. The resulting plasmid was linearized with SacI
and ligated with the SacI fragment of pHCFN93 encoding Ser1059-Ser1200,
yielding pHCFN93B+. The whole insert of pHCFN93B+ was excised with
SalI and BamHI, and ligated to SalI-BamHI-cleaved pAIFNC. The plasmid was then recut with BamHI and ligated with the BamHI fragment excised from pAIFNAC (encoding Arg1449 through the SV40 polyadenylation signal). The resulting cDNA expression vector for EDA+/EDB+ FN
was designated pAIFNBAC.
Cell Culture
Human HT1080 fibrosarcoma cells, human WI-38 fibroblasts, rat NRK
cells, and hamster CHO-K1 cells were obtained from the Japanese Cancer
Research Resources Bank (Tokyo, Japan). Mouse L cells were provided
by Dr. Masahiro Ishiura (National Institute for Basic Biology, Okazaki,
Japan). The heparan sulfate-deficient CHO cell line 803, which expresses
5-10% of the wild-type level of heparan sulfate (Esko et al., 1988 DNA Transfection and Selection of
Stable Transfectants
cDNA expression vectors were cotransfected into CHO DG44 cells with
pGEMSVdhfr encoding a dehydrofolate reductase minigene (provided by
Dr. Hiroshi Teraoka, Shionogi Research Laboratory, Shionogi and Co.,
Ltd., Osaka, Japan) by the calcium-phosphate precipitation method
(Chen and Okayama, 1987 Purification of FNs
CHO transfectants overexpressing recombinant human FNs were cultured
in Antibodies and Peptides
mAbs against integrin MBP- and GST-Fusion Proteins
Two cDNAs encoding the III11 and III12 modules of human FN with or
without the inserted EDA segment were amplified by reverse transcription PCR from mRNA extracted from WI-38 human fibroblasts using forward and reverse primers tagged with BamHI and SalI sites, respectively.
The primers used were: 5
Recombinant fragments encompassing CCBD-Hep2 interval were prepared as fusion proteins with glutathione-S-transferase (GST). cDNA
fragments encoding the III8-III14 modules with or without the EDA
segment were amplified by PCR from pAIFNBAC and pAIFNC, respectively, using the following primers: 5 Fragmentation of Recombinant FNs
Limited proteolysis of recombinant FNs with thermolysin was performed
as described previously (Sekiguchi et al., 1985 SDS-PAGE and Immunoblot Analysis
SDS-PAGE was performed as described by Laemmli (1970) Cell Spreading Assay
Cell spreading assays were performed using 96-well microtiter plates
(Maxisorp; Nunc, Roskilde, Denmark) coated with various concentrations
of recombinant FNs and blocked with 1% BSA. Amounts of recombinant
FNs immobilized on plates were determined by ELISA using anti-human
FN antiserum or anti-FN mAbs. HT1080 cells were plated at a density of
2-3 × 104 cells/well in DME and incubated at 37°C for 30 min. For inhibition assays with anti-integrin antibodies and peptides, HT1080 cells were
preincubated at 37°C for 15 min in DME containing 0.2% BSA and mAbs
(10 µg/ml), synthetic peptides (1 mg/ml), or MBP fusion proteins (100 µM). The pretreated cells were dispersed by pipetting before plating. For
inhibition assays using anti-FN mAbs, the 96-well plates coated with recombinant FNs were incubated with mAbs (20 µg/ml) containing 0.1%
BSA at 37°C for 30 min before plating of cells. After incubation for specified periods of time at 37°C, nonadherent cells were removed by washing
with DME, and attached cells were fixed with 3.7% formaldehyde and
then stained with Giemsa. Cells adopting a well spread morphology (i.e.,
cells that had become flattened with the long axis more than twice the diameter of the nucleus) were counted per square millimeter.
In some experiments, recombinant FNs were immobilized onto 96-well
plates via the anti-human FN mAb FN8-12 which had been precoated on
the plates. Amounts of the recombinant FNs captured on plates were determined by ELISA using the anti-FN mAb OAL115.
Treatment of Cells with Glycosidases
HT1080 cells were resuspended in DME containing 0.1% BSA at 3 × 105
cells/ml in the presence or absence of 0.1 U/ml of heparitinase I, heparinase, or chondroitinase ABC (Seikagaku Corp.). Cell suspensions were
incubated for 30 min at 37°C before the cell spreading assay.
Flow Cytometry
HT1080 cells were stained with the anti-heparan sulfate mAb HepSS-1
(isotype, IgM), followed by incubation with FITC-conjugated goat anti-
mouse IgM, and then analyzed using a FACScan® flow cytometer (Becton
Dickinson Immunocytometry Systems, San Jose, CA).
Purification of Purification of integrin receptors and reconstitution of purified integrins
into liposomes were carried out according to Pytela et al. (1987) Integrin Liposome Binding Assay
Integrin liposomes in TBS(+) containing 0.2% BSA were added to microtiter wells precoated with recombinant FNs (20 µg/ml) or GST fusion
fragments (20 or 80 µg/ml) and incubated for 6 h at room temperature.
Amounts of recombinant FNs immobilized on wells were verified by
ELISA using polyclonal antibody against CCBD. For inhibition assays,
the integrin liposomes were preincubated with anti-integrin mAbs (10 µg/
ml unless otherwise specified), control IgG (20 µg/ml), or synthetic peptides (1 mg/ml) for 30 min at room temperature before addition to FN- or
fusion fragment-coated wells. The wells were washed with TBS(+), and
bound liposomes were recovered in 1 N NaOH. The radioactivity of
bound liposomes was quantitated using an Aloka LSC-3500 scintillation
counter (Aloka Co., Ltd., Tokyo, Japan). In the binding assays using thermolysin-cleaved FNs as ligands, phosphoramidon (4 µg/ml) was included
in the assay medium to inactivate thermolysin.
Cell Migration Assay
Thin plastic discs ( Construction of Expression Vectors
Encoding FN Isoforms Differing in the Inclusion
of EDA and/or EDB Segments
Three human FN isoforms used in this study are illustrated
in Fig. 1. These isoforms are identical except for the presence or absence of the EDA and/or EDB segments. All
three include the complete IIICS sequence of 120 amino
acids. FN isoforms were expressed as chimeric proteins
with the signal sequence of human protein C inhibitor as
described previously (Ichihara-Tanaka et al., 1990 Expression and Purification of Recombinant FNs
Expression vectors were cotransfected into CHO DG44
cells with a dihydrofolate reductase minigene, and the resulting stable transfectants were treated with increasing
concentrations of methotrexate to amplify the introduced
recombinant genes. Recombinant FN isoforms were purified from the conditioned media of methotrexate-resistant transfectants by gelatin affinity chromatography. Typical
yields of recombinant FNs were 4-6 mg/liter of conditioned medium. Since the concentration of hamster FN in
the conditioned medium of untransfected CHO cells was
0.1-0.15 mg/liter, the fraction of contaminating hamster
FN in the purified recombinant FNs should not exceed 4% of total protein.
Purified FNs gave single bands with apparent molecular
masses of 220-250 kD upon SDS-PAGE under reducing
conditions (Fig. 2 A). The relative molecular masses of the
recombinant FNs were in the order of rFN(BAC) > rFN(AC) > rFN(C), consistent size differences expected
due to the presence or absence of the EDA and/or EDB segments. The recombinant FNs gave sharper bands in
SDS-PAGE compared to native FNs purified from plasma
(plasma FN) and from conditioned medium of cultured fibroblasts (cellular FN), confirming the homogeneity of the
recombinant FNs. SDS-PAGE under nonreducing conditions showed that almost all of the recombinant FNs exist
as dimers, as observed for plasma and cellular FNs (Fig. 2
A). Presence or absence of the EDA and EDB segments
were confirmed by immunoblot analysis (Fig. 2 B).
Cell Adhesive Activity of Recombinant FNs
EDA+ FN isoforms have been shown to be expressed
prominently in tissues where cells actively proliferate and
migrate, such as those in embryos, tumors, and healing
wounds. To explore the physiological functions of the
EDA segment, we first compared the cell-adhesive activity
of recombinant FNs with or without EDA. When HT1080
cells were incubated on substrates coated with recombinant FNs or with plasma or cellular FN, significant differences were seen in the numbers of cells attached to different forms of FNs (Fig. 3 A). HT1080 cells attached in
greater numbers to substrates coated with rFN(AC) or
rFN(BAC) than to the substrate coated with rFN(C). A
similar but less pronounced difference was observed between the substrates coated with plasma or cellular FNs.
In addition to promoting more cell attachment, rFN(AC)
and rFN(BAC) were more potent in inducing cell spreading than rFN(C) (Fig. 3 B). Similarly, cellular FN was
more active than plasma FN in inducing cell spreading, although the difference between cellular and plasma FNs
was less evident than between rFN(AC) and rFN(C). No
significant difference was found, however, between rFN(AC)
and rFN(BAC), indicating that the insertion of the EDB segment did not affect the cell spreading activity of EDA+
FN isoforms. Enhanced cell spreading onto EDA+ FN-coated substrates was also observed with other cell lines including rat NRK cells, mouse L cells, and hamster CHO-K1 cells (data not shown).
The greater cell-adhesive activity of the EDA-containing isoforms was not an artifact because of variation in
quantities of FNs adsorbed onto the substrata, since equal
adsorption of FNs onto plastic surfaces was confirmed by:
(a) ELISA using different mAbs directed to conserved FN
epitopes, and (b) extraction of the substrate-bound FNs
with heated SDS-PAGE sample treatment buffer containing 5% 2-mercaptoethanol and subsequent SDS-PAGE (data not shown). Furthermore, essentially identical results were obtained when FNs were indirectly immobilized
on the substratum via several different anti-FN mAbs,
each recognizing different epitopes present in all FN isoforms tested (data not shown).
Fig. 4 shows the dose dependence of the spreading of
HT1080 cells on different FN isoforms. The number of
spread cells reached a plateau at >10 µg/ml of recombinant FNs irrespective of the presence or absence of the alternatively spliced segments. rFN(AC) and rFN(BAC)
were more potent than rFN(C) in promoting cell spreading throughout the range of FN concentrations examined.
A maximal difference between EDA+ and EDA
EDA Segment Does Not Contain an Additional Site
that Promotes Cell Spreading
One possibility to explain enhanced cell speading on the
EDA+ FN isoforms is that the EDA segment may contain
an additional cell-interactive site that cooperates additively or synergistically with the RGD motif in CCBD. To
explore this possibility, two types of EDA antagonists, i.e.,
mAbs directed against the EDA segment and recombinant peptide containing the EDA segment, were tested for
their abilities to inhibit rFN(AC)-mediated cell spreading. Pretreatment with two distinct anti-EDA mAbs (IST-9
and HHS01) did not inhibit cell spreading on rFN(AC) or
rFN(C), whereas the function-blocking mAbs directed
against CCBD inhibited cell spreading almost completely
on both types of FN isoforms (Fig. 5 A). Furthermore, recombinant peptide MBP11-A-12 containing the EDA segment failed to inhibit cell spreading onto the rFN(AC)-
coated substrates, as was the case with the control MBP
fusion protein lacking the EDA segment (Fig. 5 B). The
inability of the EDA segment to directly interact with
HT1080 cells was also supported by the observation that
neither MBP11-A-12 nor MBP11-12 could mediate adhesion of HT1080 cells (data not shown). These results,
taken together, indicate that the EDA segment is unlikely
to be directly involved in enhanced cell adhesion onto the
EDA+ FN-coated substrates as an independent cell-interactive site.
In support of this conclusion, function-blocking mAbs
directed against the integrin
Enhanced Cell Adhesive Activity of EDA+ FN Is
Independent of Cell Surface Heparan Sulfate
Interaction of the heparin-binding domain of FN with cell
surface heparan sulfate has been shown to promote integrin
Increased Affinity of Integrin The results described above left us with the possibility that
the binding affinity of integrin
Binding of integrin
EDA-mediated Enhancement of Integrin Binding Is
Not Observed with FN Fragments
The EDA segment may alter the conformation of CCBD
by two possible mechanisms. In one model, the EDA segment inserted between the III11 and III12 modules may induce steric distortion of its neighboring modules, i.e., III11
and III12, by readjusting the intermodular interfaces, which
in turn affects the conformation of adjacent modules including RGD-containing III10. Alternatively, insertion of the
EDA segment may alter the global conformation of the
FN molecule by twisting the NH2-terminal two-thirds of the molecule. Adjacent type III modules have been shown
to be interconnected with rotations along the long axis, often in a pseudotwofold relationship (Huber et al., 1994
To explore the second possibility further, we expressed
in bacteria recombinant FN fragments containing CCBD
and the Hep2 domain with or without the inserted EDA
segment and examined their binding to purified integrin
EDA+ FN Is More Active than EDA FN is known to promote cell migration via interaction with
integrin
Though expression of the alternatively spliced EDA and
EDB segments of FN show spacial and temporal regulation during development, wound healing, and tumorigenesis, little is known about the function of these variable domains. In the present study, we produced three different
forms of recombinant FNs differing with respect to presence or absence of the EDA and/or EDB segments and
compared their adhesive functions using homogeneous
proteins. Our results showed that recombinant FNs containing the EDA segment were approximately twice as potent as those lacking EDA in their abilities to promote cell
adhesion and migration, irrespective of the presence or absence of another variable domain, EDB. The binding affinity of EDA+ FN to its integrin receptor, Functions of alternatively spliced EDA and EDB segments have been extensively studied by comparing the biological activities of the two forms of naturally occurring
FNs, i.e., plasma and cellular FNs, only the latter of which
contains substantial quantities of the EDA and/or EDB
segments. Although plasma and cellular FNs differ in certain molecular properties such as posttranslational modification (Fukuda et al., 1982 Previously, Guan et al. (1990) Several lines of evidence indicate that the EDA segment
enhances the cell-adhesive activity of FNs by increasing
binding affinity to integrin Previously, Xia and Culp (1994 Recently, Hino et al. (1996) There are several possible mechanisms that may explain
enhanced integrin-binding affinity of EDA+ FNs. First,
the EDA segment might directly interact with integrins
Accumulating evidence indicates that the strands of the
FN molecule are folded into a compact shape under physiological buffer conditions and undergo conformational
transitions from a compact to an extended form in solutions of high ionic strength or high pH (Williams et al.,
1982 The proposed EDA-induced change in the global conformation of FN is further supported by the following distinctions between the EDA+ and EDA In vivo expression patterns of different FN isoforms suggest a role for EDA+ FN in cell growth as well as in cell
migration. The EDA segment is included in FN species expressed in embryonic tissues but is spliced out of the molecule in most tissues as embryonic development progresses
(Vartio et al., 1987 Despite the importance of the EDA segment in regulating
the cell-adhesive properties of FN, the function of the EDB
segment remains to be defined. Since expression of EDB+
FN isoforms in vivo is more restricted than that of EDA+
isoforms (ffrench-Constant and Hynes, 1989
). FNs are disulfide-bonded dimers of two
closely related subunits, each consisting of three types of
homologous repeating modules termed types I, II, and III
(Petersen et al., 1983
). These repeats are organized into a
series of functional domains that bind to integrins, collagens, heparin and heparan sulfate, fibrin, and FNs themselves.
). CCBD is the major cell-adhesive domain of FN and
contains the Arg-Gly-Asp (RGD) motif that is recognized
by members of the integrin family of cell adhesion receptors, including
5
1,
v
1,
v
3,
v
5,
v
6,
IIb
3, and
8
1 (Ruoslahti and Pierschbacher, 1987
; Hynes, 1992
;
Müller et al., 1995
; Chen et al., 1996
).
5
1 is the primary
FN receptor in many cell types and differs from the
v-
and
IIb-containing integrins in that it requires not only
the III10 module containing the RGD motif, but also the
III9 module for binding to FN (Aota et al., 1991
). Recently, a short sequence Pro-His-Ser-Arg-Asn (PHSRN)
has been identified as a synergistic motif in FN for binding to integrins
5
1 (Aota et al., 1994
) and
IIb
3 (Bowditch
et al., 1994
). Interaction of
5
1 with CCBD has been
shown to transduce signals that regulate cell proliferation,
differentiation, and apoptosis (Giancotti and Ruoslahti,
1990
; Meredith et al., 1993
), although the molecular basis
for integrin-mediated signaling is not well understood. The
importance of the FN-integrin
5
1 interaction has been
demonstrated in mice by the embryonic lethality of deficiencies in either FN or
5
1 expression (George et al.,
1993
; Yang et al., 1993
).
). The heterogeneity of FN subunits arises
mainly from alternative splicing of a primary transcript at
three distinct regions termed EDA, EDB, and IIICS
(Schwarzbauer et al., 1983
, 1987
; Kornblihtt et al., 1984
;
Zardi et al., 1987
). The EDA and EDB segments are each
encoded by a single exon and can each comprise an intact type III repeat (Schwarzbauer et al., 1987
). The IIICS segment, on the other hand, consists of five distinct variants
due to exon subdivision (Kornblihtt et al., 1985
; Sekiguchi
et al., 1986
). Up to 20 different FN subunits may result
from alternative splicing involving these three segments.
Many lines of evidence indicate that alternative splicing at
these regions is regulated in a tissue-specific and oncodevelopmental manner. For example, plasma FN produced by adult hepatocytes contains neither EDA nor EDB segments in both subunits and lacks the entire IIICS in one of
the subunits, although cultured fibroblasts typically produce some FNs containing the EDA and/or EDB segments (Kornblihtt et al., 1984
; Sekiguchi et al., 1986
; Zardi
et al., 1987
). FNs expressed in fetal and tumor tissues contain a greater percentage of EDA and EDB segments than
those expressed in normal adult tissues (Oyama et al.,
1989a
,b; 1993; Carnemolla et al., 1989
; ffrench-Constant
and Hynes, 1989
). Increased expression of FNs containing
the EDA and/or EDB segments has also been observed
during wound healing (ffrench-Constant et al., 1989
).
). Since cellular FN is a mixture of heterodimers of several different
subunits differing with respect to the presence or absence
of the EDA and/or EDB segments, failure to detect functional differences could be due to heterogeneity of cellular
FN. To overcome this problem, Guan et al. (1990)
expressed, in mouse lymphoid cells, various recombinant isoforms of rat FNs, each containing a different combination
of the three alternatively spliced regions, and compared
the biological activities of the homogeneous recombinant
proteins. No clear differences were, however, observed
among the abilities of FN isoforms to promote cell adhesion, spreading, and migration, except for minor differences in the ability to assemble into the preexisting extracellular matrix.
). In the present study, we constructed two additional expression vectors encoding human FNs containing
either both the EDA and EDB segments or the EDA segment alone and overexpressed these FN isoforms in CHO
cells to compare the biological activities of three distinct
forms of recombinant FNs (i.e., EDA
/EDB
, EDA+/
EDB
, and EDA+/EDB+ FNs) using purified homodimeric
proteins. Our results showed that the EDA+ isoform was
more than twice as effective as the EDA
isoform in promoting cell spreading and cell migration, irrespective of
the presence or absence of the EDB segment. Increased
cell adhesion and migration on the EDA+ FN substrate was
apparently due to an increase in the binding affinity of integrin
5
1. We discuss molecular mechanisms and implications of the EDA-dependent enhanced integrin binding
on the basis of conformational modulation of the FN molecule by insertion of the EDA segment.
MATERIALS AND METHODS
). pAIPFN was first modified
to delete the BamHI site located 5
to the ATG initiation codon as follows: pAIPFN was cleaved with BamHI and EcoRV and the resulting
2411-bp cDNA fragment encoding the signal sequence of human protein
C inhibitor and NH2-terminal FN sequence was filled in using the Klenow
fragment of DNA polymerase I and subcloned into the EcoRV site of
pBluescript II (Stratagene, La Jolla, CA). The insert was excised as 1703-bp
HindIII-SalI fragment and ligated into HindIII-SalI-cleaved pAIPFN,
yielding the expression vector (pAIFNC) for the FN isoform lacking both the EDA and EDB segments. pAIFNC is identical to pAIPFN except for
the absence of the 5
BamHI site.
untranslated sequence including a polyadenylation signal. Amino acids are numbered from the NH2-terminal pyroglutamic acid in the mature protein (Petersen et al., 1989
). The whole insert was then excised with BamHI and inserted into BamHI-cleaved pAIFNC. The resulting cDNA expression vector for the EDA+/EDB
FN was designated pAIFNAC.
) was
provided by Dr. Shigeki Higashiyama (Osaka University Medical School,
Osaka, Japan). The dihydrofolate reductase-deficient CHO cell line,
CHO DG44, was provided by Dr. Lawrence Chasin (Columbia University, New York) and used for the production of recombinant FNs.
HT1080, WI-38, NRK, and L cells were grown in DME supplemented
with 10% FBS. CHO cell lines were maintained in
-minimal essential
medium containing ribonucleosides and deoxyribonucleosides (GIBCO
BRL, Gaithersburg, MD) plus 10% FBS.
). Selection of stable transfectants and subsequent amplification of the introduced cDNA were carried out as described
(Kaufman, 1989
). Levels of recombinant FN expression were routinely
monitored by dot immunoassay of the culture supernatants with the anti-
human FN mAb FN8-12 (Matsuyama et al., 1994
). Levels of recombinant
FN expression in clones thus selected were >40 times higher than that of
endogenous FN expression in untransfected CHO DG44 cells.
-minimal essential medium with 1% FN-depleted FBS. FN-depleted FBS
was prepared by passing through a gelatin-affinity column twice. The culture supernatants were subjected to affinity chromatography using gelatin-Sepharose (Pharmacia Biotech, Uppsala, Sweden). Plasma and cellular FNs were purified as described previously (Sekiguchi et al., 1985
).
Typical yields of recombinant FNs were 4-6 mg/liter of conditioned media. In some experiments, gelatin affinity-purified FNs were further purified by ion exchange chromatography on a HiTrap-Q column (Pharmacia
Biotech).
5 and
1 subunits, 8F1 and 4G2, were established
in our laboratory by fusion of SP2/0 myeloma cells with the spleen cells of
BALB/c mice immunized with integrin
5
1 purified from human placenta. 8F1 and 4G2 inhibit binding of integrin
5
1 to FN as well as attachment and spreading of HT1080 cells on FN-coated substrata. mAbs
against human FN, 15E, and 17C were also established in our laboratory
using human plasma FN as immunogen. 15E and 17C recognize epitopes
on CCBD and the Hep2 domain, respectively. mAbs against the human
integrin
4 subunit (SG/73; Miyake et al., 1992
) and heparan sulfate
(HepSS-1) were obtained from Seikagaku Corp. (Tokyo, Japan); mAb
against human integrin
v
3 (LM609) was from Chemicon International,
Inc. (Temecula, CA); mAbs against human FN (FN8-12 and FN30-8)
were from Takara Shuzo (Kyoto, Japan); HRP-conjugated mAb against
human FN (OAL115) from Hisanobu Hirano (Otsuka Pharmaceutical
Co., Ltd., Tokushima, Japan); mAbs against EDA (IST-9; Borsi et al.,
1987
) and against FN containing the EDB segment (BC-1) from Dr. Luciano Zardi (Instituto Nazionale per la Ricerca sul Cancro, Genova, Italy);
another mAb against EDA (HHS01; Hirano et al., 1992
) from Eiji Sakashita
(Otsuka Pharmaceutical Factory, Inc., Tokushima, Japan). Polyclonal antibody against human FN was raised in rabbits by repeated immunization
with purified human plasma FN emulsified in complete Freund's adjuvant.
The polyclonal antibody was purified on a Sepharose affinity column conjugated with a recombinant CCBD fragment (Chen et al., 1996
). Control
IgG, goat anti-mouse IgG, HRP-conjugated goat anti-rabbit IgG, and
FITC-conjugated goat anti-mouse IgM were from Cappel Worthington
Biochemicals (Malvern, PA). The synthetic peptides Gly-Arg-Gly-Asp-Ser-Pro (GRGDSP) and Gly-Arg-Gly-Glu-Ser-Pro (GRGESP) were obtained from Iwaki Glass Co. (Chiba, Japan).
-AAAGTCGGATCCGAAATTGACAAACCATCC-3
(forward) and 5
-AAAGTCGACCTACTCCAGAGTGGTGACAAC-3
(reverse), where restriction sites and the stop codon are indicated with bold and italic characters, respectively. PCR-amplified
fragments were cloned between the BamHI and SalI sites of pMAL-cRI
(New England Biolabs, Beverly, MA) to engineer expression in Escherichia coli as fusion proteins with maltose-binding protein (MBP). The resulting fusion proteins, designated MBP11-12 and MBP11-A-12 (see Fig.
1), were purified from the bacterial lysate using amylose resin columns.
Fig. 1.
The structure of recombinant FNs and bacterially expressed fusion fragments. Modular structures of recombinant
FNs are shown schematically on the basis of internally homologous modules termed types I, II, and III. The EDA and EDB segments are shown with filled rectangles, while the IIICS segment is
shown by a hatched oval. All recombinant FNs contain the complete IIICS sequence of 120 amino acids. Functional domains that
interact with heparin (Hep1, Hep2), fibrin (Fib1, Fib2), bacteria,
collagen, and cell surface integrins (CCBD) are indicated above
the schemes. Recombinant FN fragments encompassing different
intervals of type III modules were produced as fusion proteins
with either GST or MBP.
[View Larger Version of this Image (33K GIF file)]
-ACACCCGGGTGCTGTTCCTCCTCCCACTGAC-3
(forward) and 5
-ACGCGTCGACCTAATAGTCTACATCTTCCCTGGGAATGTGACCAATTTGGATTTCCTCTGTC - TTTTTCCTCCCAATC-3
(reverse), where the bold and italic characters indicate the restriction sites (SmaI and SalI) and stop codon, respectively,
and the underline denotes a tag sequence derived from the
2 region of
human FN (Sekiguchi and Titani, 1989
). cDNA fragments were cleaved
with SmaI and SalI and cloned into pGEX4T-1 (Pharmacia Biotech). The
plasmids were expressed in the E. coli strain BL21, and the resulting GST
fusion proteins (designated GST-CAH and GST-CH; see Fig. 1) were purified on glutathione Sepharose columns (Pharmacia Biotech) as suggested by the manufacturer, followed by ion exchange chromatography
using a HiTrapQ column. The GST fusion protein containing only CCBD,
designated GST-C, was prepared in the same manner except that the
cDNA fragment encoding CCBD was amplified by PCR using 5
-TTTCCCGGGTCATGTTCGGTAATTAATGGAAATTG-3
as the reverse
primer.
). Briefly, recombinant FNs
(100 µg/ml) were digested with thermolysin (2.5 µg/ml) in 20 mM Tris-HCl, pH 7.6, containing 1.9 mM CAPS, 50 mM NaCl, 0.5 mM EDTA, and
2.5 mM CaCl2 at 22°C for 10 min. The digestion was terminated by addition of phosphoramidon (Peptide Institute, Minoh, Japan) to a final concentration of 4 µg/ml. Under these conditions, the central region of recombinant FNs consisting of III2-III14 modules remained mostly intact
and was obtained as 150-120-kD fragments from rFN(C) and as 160-130-kD fragments from rFN(AC) (Sekiguchi et al., 1985
). Contiguity of
CCBD and the adjacent Hep2 domain was confirmed by immunoblotting
analysis of the digests with mAbs directed to CCBD (15E) and the Hep2
domain (17C).
. Purified FNs
were separated on 6% polyacrylamide gels and transferred to nitrocellulose membranes. The membranes were stained with mAbs against human
FN using ECL reagents (Amersham Corp., Arlington Heights, IL).
5
1 and
v
3 Integrins
. Briefly,
fresh human placental tissue was extracted with TBS(+) (25 mM Tris-HCl, pH 7.5, 0.13 M NaCl, 1 mM CaCl2, and 1 mM MgCl2) containing 100 mM octylglucoside and 1 mM PMSF. The extract was applied on a series
of Sepharose affinity columns conjugated with either GRGDSPK peptide
(for purification of
v
3) or the 155-kD/145-kD thermolysin fragments of
human plasma FN (for purification of
5
1). Integrins bound to these affinity columns were eluted with TBS(+) containing GRGDSP peptide
(250 µg/ml). Eluted integrins were further purified on a column of wheat
germ lectin Sepharose (Pharmacia Biotech). Purified integrins (50 µg)
were mixed with egg yolk phosphatidylcholine (50 µg) containing [3H]dipalmitoyl phosphatidylcholine (New England Nuclear, Boston, MA) in
TBS(+) containing 50 mM octylglucoside and then dialyzed against
>4,000 vol of TBS(+) at 4°C overnight. The reconstituted integrin liposomes were size fractionated on a Sepharose CL-4B column (Pharmacia
Biotech) and used in the integrin liposome binding assay.
6 mm) were cut in half and coated with 0.01% poly-
L-lysine (Sigma Chemical Co., St. Louis, MO) followed by blocking with
1% BSA. Plastic discs were placed in wells of 96-well microtiter plates
that had been precoated with 5 µg/ml of recombinant FNs or 0.01% poly-
L-lysine and then blocked with 1% BSA. HT1080 cells suspended in DME
were seeded onto the plates at a density of 1 × 104 cells/well. After incubation at 37°C for 1.5 h, plastic discs were removed carefully, and the wells
were gently washed with DME and photographed. Cells attached to the
96-well plates were further incubated for 12 h in DME to allow them to
migrate into the open space left after removal of the discs. The cells were then fixed with 3.7% formaldehyde and stained with Giemsa. Cell motility
was assessed by the distance of the outward migration, i.e., the distance
between the positions of the cell front before and after cell migration. The
assay was also performed in the presence of the anti-integrin
5 mAb 8F1
(20 µg/ml) or control IgG (20 µg/ml).
RESULTS
). The
expression vectors for these isoforms were constructed by modifying the human FN expression vector pAIPFN (Akamatsu et al., 1996
) as described in Materials and Methods.
The resulting FN isoforms are designated as follows:
rFN(C), the isoform lacking both EDA and EDB segments; rFN(AC), the isoform containing EDA but lacking
EDB; and rFN(BAC), the isoform containing both EDA and EDB segments.
Fig. 2.
SDS-PAGE and immunoblot analyses of recombinant
FNs. (A) Recombinant FNs as well as plasma and cellular FNs
(abbreviated pFN and cFN, respectively), both purified by gelatin-affinity chromatography and subsequent ion exchange chromatography on a HiTrap Q column (see Materials and Methods),
were subjected to SDS-PAGE under reducing (top gel) or nonreducing (bottom gel) conditions and visualized by Coomassie
staining. 2 µg of protein was applied to each lane. Positions of the
dimeric and monomeric forms of FNs are indicated in the right
margin. Shown in the left are the positions of molecular size
markers. (B) Purified FNs (0.6 µg/lane) were subjected to SDS-PAGE under reducing conditions followed by immunoblotting
with the following anti-FN mAbs: FN8-12 recognizing Fib2 domain (top panel); IST-9 recognizing the EDA segment (middle panel); BC-1 recognizing the EDB+ FNs (bottom panel).
[View Larger Version of this Image (37K GIF file)]
Fig. 3.
Attachment and
spreading of HT1080 cells on
FN-coated substratum. (A)
HT1080 cells (2 × 104) were
seeded on 96-well microtiter
plates coated with 5 µg/ml of
different FN isoforms and incubated for 30 min at 37°C.
The cells were rinsed, fixed,
and stained with Giemsa.
Bar, 100 µm. (B) Spreading
of HT1080 cells was quantified as described in Materials and Methods. The standard
deviations of multiple determinations (n = 3) are indicated at the top of bars.
[View Larger Versions of these Images (97 + 13K GIF file)]
isoforms was observed at 5 µg/ml recombinant protein.
Fig. 4.
Dose dependence of the spreading of HT1080 cells on
recombinant FNs. HT1080 cells were seeded on plates coated
with various concentrations of rFN(C) (open circles), rFN(AC)
(closed circles), or rFN(BAC) (closed squares) and incubated for
30 min at 37°C. Spreading of HT1080 cells was quantified as described in Materials and Methods and expressed as the number of
cells adopting a well spread morphology per square millimeter.
Each bar represents the mean ± SD (n = 3).
[View Larger Version of this Image (18K GIF file)]
Fig. 5.
Effects of anti-EDA mAbs and recombinant EDA
fragments on cell spreading mediated by recombinant FNs. (A)
Microtiter plates precoated with 5 µg/ml of rFN(C) (open bars)
or rFN(AC) (closed bars) were treated with the following mAbs
(20 µg/ml) at 37°C for 30 min before the addition of HT1080 cells:
None, no addition of mAbs; IST-9 and HHS-01, two different
anti-EDA mAbs; FN12-8+FN30-8, a mixture of two function-blocking mAbs directed to CCBD. The cells were incubated at
37°C for 30 min and the number of cells adopting a well spread
morphology was determined. (B) In separate experiments,
HT1080 cells were seeded onto microtiter plates precoated with 5 µg/ml of rFN(C) (open bars) or rFN(AC) (closed bars) and incubated for 30 min at 37°C in the presence or absence of MBP fusion fragments with (MBP11-A-12) and without (MBP-11-12) the EDA segment. Each bar represents the mean ± SD (n = 6).
[View Larger Versions of these Images (16 + 14K GIF file)]
5 or
1 subunits inhibited
spreading of HT1080 cells onto the rFN(AC)-coated substrates almost completely, whereas the mAbs directed
against other types of FN-binding integrins, i.e., anti-
4
and anti-
v
3 mAbs, were barely inhibitory (Fig. 6).
These results indicated that spreading of HT1080 cells
onto rFN(AC)-coated substrates was predominantly mediated by interaction of integrin
5
1 with CCBD, as was
the case with spreading onto plasma FN-coated substrates
(Aota et al., 1991
). This conclusion was further supported
by the observation that GRGDSP peptide, but not GRGESP,
inhibited almost completely rFN(AC)-mediated spreading of HT1080 cells (Fig. 6). These results, together with the
failure of EDA antagonists to inhibit rFN(AC)-mediated
cell spreading, indicated that the EDA segment augments
the cell-adhesive activity of FNs by promoting the interaction of integrin
5
1 with the RGD-containing CCBD and
not by providing an additional cell-interactive site.
Fig. 6.
Inhibition by anti-integrin mAbs and synthetic peptides
of cell spreading mediated by recombinant FNs. HT1080 cells
were seeded on microtiter plates precoated with 5 µg/ml of
rFN(C) (open bars) or rFN(AC) (closed bars) in the presence or
absence of 10 µg/ml of the following anti-integrin mAbs or 1 mg/
ml of synthetic peptides (GRGDSP and GRGESP), and incubated for 30 min at 37°C: None, no mAb added; 8F1, anti-
5
mAb; 4G2, anti-
1 mAb; ST/73, anti-
4 mAb; LM609, anti-
v
3
mAb. The cell spreading was quantified as described in Materials
and Methods. Each bar represents the mean ± SD (n = 6).
[View Larger Version of this Image (15K GIF file)]
5
1-mediated cell spreading on FN-coated substrates (Woods et al., 1986
). To examine the possible involvement of surface heparan sulfate in enhanced cell
spreading onto EDA+ FN-coated substrates, HT1080 cells
were treated with heparitinase I before incubation on FN-coated substrates. FACS® analysis using the anti-heparan
sulfate mAb HepSS-1 showed that >95% of heparan sulfate on the cell surface was removed by heparitinase treatment (data not shown). The removal of surface heparan
sulfate, however, did not significantly affect the spreading
of HT1080 cells on substrates coated with either rFN(AC)
or rFN(C) (Fig. 7). A similar result was obtained when
CHO803 cells that are deficient in surface heparan sulfate
(Esko et al., 1988
) were used for the cell spreading assay
(data not shown), confirming that cell surface heparan sulfate is apparently not involved in enhanced cell spreading seen on rFN(AC)-coated substrates.
Fig. 7.
Effect of glycosidase treatments on spreading of
HT1080 cells on recombinant FNs. HT1080 cells were treated
with 0.1 U/ml of heparitinase I, heparinase, or chondroitinase
ABC for 30 min at 37°C. Glycosidase-treated cells were added to
microtiter plates precoated with 5 µg/ml of rFN(C) (open bars) or
rFN(AC) (closed bars) and incubated for 30 min at 37°C. Cell
spreading was quantified as described in Materials and Methods.
Each bar represents the mean ± SD (n = 6).
[View Larger Version of this Image (18K GIF file)]
5
1 to EDA+ FN
5
1 to CCBD could be enhanced by inclusion of the EDA segment. To explore this
possibility further, integrin
5
1 purified from human placenta and reconstituted into phosphatidylcholine liposomes containing [3H]dipalmitoyl phosphatidylcholine
was tested for its binding avidity to recombinant FNs with
or without the EDA segment. As depicted in Fig. 8, integrin
5
1 liposomes bound to rFN(AC) significantly more
avidly than to rFN(C). Binding of integrin
5
1 liposomes to rFN(AC) was blocked by the anti-integrin
5 mAb 8F1,
as was the case with the binding to rFN(C). No significant
binding was observed with vitronectin, confirming that the
purified
5
1 used in this study was devoid of other integrins capable of binding to both FN and vitronectin (i.e.,
v
3,
v
5,
v
6, and
IIb
3).
Fig. 8.
Binding of integrin
5
1 to recombinant FNs. Integrin
5
1 was purified from human placenta and reconstituted in
phosphatidylcholine liposomes as described in Materials and
Methods. The integrin
5
1-liposomes were added to microtiter
plates precoated either with 20 µg/ml of rFN(C) (open bars) or
rFN(AC) (closed bars), or with 5 µg/ml of vitronectin (hatched
bars) in the presence or absence of the anti-integrin
5 mAb 8F1
(10 µg/ml) and incubated for 6 h at room temperature. Quantities
of bound integrin
5
1 liposomes are expressed as percentage of
the total input radioactivity after subtraction of the radioactivity
bound to plates coated only with BSA. Each bar represents the
mean ± SD (n = 6).
[View Larger Version of this Image (9K GIF file)]
5
1 to FN has been shown to depend on both the RGD motif in the III10 module and the
synergy site in III9 (Aota et al., 1991
). Thus, enhanced
binding of integrin
5
1 to rFN(AC) could conceivably be
due to increased affinity of the integrin to either the RGD
motif or the synergy site. To examine which site was responsible for the enhanced affinity of rFN(AC) towards
5
1, association of integrin
v
3 with rFN(AC) or
rFN(C) was examined. Binding of
v
3 to FN has been
shown to depend on the RGD motif in the III10 module,
but not on the synergy site in the III9 module (Danen et
al., 1995
). Integrin
v
3 purified from placenta and reconstituted in liposomes bound more avidly to rFN(AC) than
to rFN(C), as was the case with
5
1 (Fig. 9). The binding
was reproducibly inhibited by the anti-
v
3 mAb LM609 and by GRGDSP peptide, but not by the anti-
5 mAb 8F1
or the control GRGESP peptide. Residual binding of
v
3-liposomes to rFN(AC) in the presence of LM609
could result from the presence of
v
5, another vitronectin-binding integrin, in the purified
v
3 preparation. These results are consistent with the model that enhanced
binding of integrin
5
1 to EDA+ FN is due to an increase
in the affinity of
5
1 for the RGD motif in CCBD and
that this increased affinity may result from an altered conformation or accessibility of CCBD in the presence of the
EDA segment.
Fig. 9.
Binding of integrin
v
3 to recombinant FNs. Integrin
v
3 liposomes were added to microtiter plates precoated either
with 20 µg/ml of rFN(C) (open bars) or rFN(AC) (closed bars) or
with 5 µg/ml of vitronectin (hatched bars) in the presence or absence of the anti-integrin
v
3 mAb LM609 (50 µg/ml), the anti-integrin
5 subunit mAb 8F1 (10 µg/ml), GRGDSP peptide (1 mg/ml), or control GRGESP peptide (1 mg/ml). The binding assay was carried out as described in Fig. 8. Each bar represents the
mean ± SD (n = 6).
[View Larger Version of this Image (22K GIF file)]
;
Leahy et al., 1996
). To test these two possibilities, we examined binding affinities of recombinant FNs for integrin
5
1 before and after limited proteolysis with thermolysin. Under the conditions employed (Sekiguchi et al.,
1985
), the central region of the FN molecule including CCBD and the adjacent Hep2 domain was released by
thermolysin as 150-120-kD fragments from rFN(C) and as
160-130-kD fragments from rFN(AC) (data not shown).
The integrin-binding activity of rFN(C) was significantly
increased after limited proteolysis, reaching a level comparable to that of rFN(AC) after thermolysin digestion (Fig.
10 A). It was also noted that the integrin-binding activity
of rFN(AC) was slightly decreased after limited proteolysis. These results do not fit with the first possibility based
on the neighboring effects of the inserted EDA segment
on the III10 module but rather support the second model
that insertion of the EDA segment potentiates integrin
binding to CCBD by altering the global conformation of
the FN molecule, thereby either increasing integrin accessibility to CCBD or optimizing the local conformation of the RGD-containing III10 module by perturbing the constraints applied to CCBD.
Fig. 10.
Binding of integrin
5
1 to
FN fragments. (A) Microtiter plates
were coated with 20 µg/ml of rFN(C)
(open bars) or rFN(AC) (closed bars)
that had been digested with thermolysin for 0 min (Undigested) and 10 min
(Digested) as described in Materials
and Methods. The plates were incubated with integrin
5
1 reconstituted in phosphatidylcholine liposomes for 6 h
at room temperature. Quantities of
bound integrin
5
1 liposomes were
expressed as percentages of the total input radioactivity after subtraction of
the radioactivity bound to plates coated
only with BSA. Each bar represents the
mean ± SD (n = 3). (B) Microtiter
plates were coated with 20 µg/ml (open bars) or 80 µg/ml (closed and hatched bars) of GST fusion proteins containing the CCBD alone
(GST-C) or both the CCBD and the Hep2 domain with (GST-CAH) or without (GST-CH) the EDA segment. Integrin
5
1 liposomes
were added to the plates and incubated for 6 h at room temperature in the absence (open and closed bars) or presence (hatched bars) of
the anti-integrin
5 mAb 8F1 (10 µg/ml). Each bar represents the mean ± SD (n = 6).
[View Larger Versions of these Images (13 + 13K GIF file)]
5
1. Integrin
5
1 bound equally well to both recombinant CCBD-Hep2 fragments with and without the EDA
segment (designated GST-CH and GST-CAH; Fig. 10 B).
The integrin binding to these fragments was completely inhibited by the anti-integrin
5 mAb 8F1, confirming the
specificity of this binding assay. The recombinant CCBD-Hep2 fragments with and without the EDA segment were
also equally active in promoting spreading of HT1080 cells
(data not shown). These results provide further support
for the conclusion that the EDA segment upregulates the integrin binding activity of CCBD through alteration of
global conformation of the FN molecule (see Discussion).
It should also be noted that no significant difference was
detected in the integrin-binding activities of recombinant
CCBD fragments with and without the Hep2 domain, indicating that the binding of CCBD to integrin
5
1 is independent of the adjacent Hep2 domain.
FN in
Promoting Cell Migration
5
1 (Yamada et al., 1990
). Increased binding
avidity of integrin
5
1 for EDA+ FN may, therefore,
lead to an enhanced cell motility on substratum coated
with EDA+ FN. To test this possibility, migration of
HT1080 cells on the substrates coated with EDA+ or
EDA
FNs were compared (Fig. 11 A). HT1080 cells were
significantly more migratory on rFN(AC) and rFN(BAC)
than on rFN(C). No significant cell migration was observed on substrates coated with poly-L-lysine (data not
shown). Quantitation of outward cell migration showed that HT1080 cells migrated 1.7-2 times farther on substrates coated with rFN(AC) or rFN(BAC) than on the
substrate coated with rFN(C) (Fig. 11 B). Cell migration
mediated by EDA+ and EDA
FNs was inhibited by anti-integrin
5 mAb 8F1 to a similar extent, suggesting that increased cell motility on the EDA+ FNs was due to the increased integrin recognition of CCBD flanked with the
EDA segment.
Fig. 11.
Migration of HT1080 cells on recombinant FNs. 96-well plates were precoated with 5 µg/ml of rFN(C) (open bars),
rFN(AC) (closed bars), or rFN(BAC) (hatched bars) and then
partially covered with plastic discs (
6 mm) that had been cut in
half and coated with 0.01% poly-L-lysine. HT1080 cells were
seeded onto the plates and incubated for 1.5 h at 37°C to allow
them to spread. The plastic discs were then removed and the cells
were further incubated at 37°C for 12 h to allow them to migrate
into the open space left after removal of the discs. (A) The cells
were photographed before and after migration at 37°C for 12 h.
The positions of the cell front before and after the cell migration
were indicated by open and closed arrowheads, respectively. (B)
Cell motility on different substrates was quantified by measuring
the distance of outward migration, i.e., the distance between the
positions of the cell front before and after cell migration. Cell
motility was assayed in the presence or absence of 20 µg/ml of the
anti-integrin
5 subunit mAb 8F1 or control IgG. Each bar represents the mean ± SD (n = 6).
[View Larger Versions of these Images (22 + 49K GIF file)]
DISCUSSION
5
1, was 2-2.5
times greater than that of EDA
FN, indicating that alternative splicing at the EDA region regulates the binding affinity of FNs to integrin
5
1, thereby contributing to regulation of cell adhesion and migration on FN-containing extracellular matrices.
; Paul and Hynes, 1984
) and solubility (Yamada et al., 1977
), no significant differences
have been found in their cell-adhesive activities (Yamada
and Kennedy, 1979
). Failure to detect differences in their
adhesive properties could be due to heterogeneity of cellular FN used in earlier studies. Typically, cellular FN expressed in cultured fibroblasts contains as much as 50% of
EDA
isoforms (Magnuson et al., 1991
), leaving only 25%
of the entire dimer population as EDA+ homodimers provided that dimerization of different forms of FN polypeptides occurs stochastically. In contrast, recombinant FNs used in this study were homogeneous in terms of the presence or absence of the EDA and/or EDB segments, allowing us to demonstrate clearly enhanced cell-adhesive activity of EDA+ FN isoforms.
reported expression and
isolation of various forms of rat recombinant FNs. Comparison of the cell-adhesive activity of these recombinant
FNs, however, showed no difference between EDA+ and
EDA
isoforms. The apparent discrepancy between this
report and our present study could be due to the difference in the molecular structure of the recombinant FNs
used. The EDA+ FN used by Guan et al. (1990)
did not
contain the IIICS segment, whereas isoforms tested in the
present study all included the complete IIICS segment,
which has been shown to be critical for secretion of dimerized nascent FN polypeptides (Schwarzbauer et al., 1989
).
The EDA+ form of rat FN used by Guan et al. (1990)
was
predominantly secreted as monomer, whereas rFN(AC)
used in the present study was secreted as dimer. It is possible that the IIICS region may be required for EDA-dependent potentiation of the cell-adhesive activity of FNs
by ensuring dimer formation or rendering the FN molecule competent for conformational activation upon insertion of the EDA segment (see below).
5
1 and not by providing an
additional cell-adhesive site. Thus, function-blocking mAbs
against CCBD or those against integrin
5
1 inhibited
rFN(AC)-mediated cell spreading almost completely, while
mAbs against the EDA segment showed no inhibition. Consistent with these observations, rFN(AC)-mediated
cell spreading was also completely inhibited by GRGDSP
peptide but not by the EDA-containing recombinant fragment. Enhanced binding affinity of EDA+ FN to integrin
5
1 was demonstrated by a direct binding assay using integrin
5
1 purified and reconstituted into liposomes.
, 1995
) reported that a
recombinant EDA segment alone or in combination with
its neighboring type III modules promoted adhesion of
mouse 3T3 cells. The recombinant EDA segment was also
reported to transform rat lipocytes into myofibroblasts
(Jarnagin et al., 1994
). These observations may suggest the
presence of a specific cell surface receptor for the EDA
segment, although the molecular identity of the receptor
remains elusive. Despite these previous reports, we could
not obtain evidence to support direct interaction of the
EDA segment with cells. Our MBP fusion protein consisting of III11, EDA, and III12 modules did not have an activity to mediate cell attachment or spreading. Although the
reason for this discrepancy remains to be clarified, the putative EDA receptor(s) could be expressed only in limited types of cells (e.g., 3T3 cells). It may also be possible that a
tag of histidine hexamer added to the recombinant EDA
fragment (Xia and Culp, 1994
, 1995
) could potentiate the
interaction of the EDA segment with putative EDA receptor(s).
reported that EDA-enriched
cellular FN was more potent than plasma FN in promoting
adhesion of human synovial cells. Adhesion of synovial
cells to EDA-enriched FN was partially inhibited by anti-Hep2 mAb and also by heparitinase treatment of the cells,
suggesting that insertion of the EDA segment may enhance the cell-adhesive activity of FN by potentiating the interaction of the Hep2 domain with cell surface heparan
sulfate proteoglycans. Despite these observations, our results showed that the interaction of the Hep2 domain with
heparan sulfate proteoglycans was not involved in the enhanced adhesion of HT1080 cells on EDA+ FN-coated
substrates, since (a) heparitinase treatment did not affect
cell spreading onto rFN(AC)-coated substrates; (b) glycosaminoglycan-deficient CHO cells were fully competent
to reproduce the difference in the cell spreading activity
seen between rFN(AC) and rFN(C); (c) none of the mAbs
directed to the Hep2 domain inhibited adhesion of HT1080
cells to rFN(AC)-coated surfaces (Manabe, R., unpublished observation). Although the reason for this discrepancy is not clear, the role of the Hep2 domain in EDA+
FN-mediated cell adhesion may differ among different cell
types, synovial cells being strongly dependent on the interaction of the Hep2 domain with heparan sulfate proteoglycans. Since the inhibition of synovial cell adhesion by anti-Hep2 mAb and by heparitinase treatment was only partial
(Hino et al., 1996
), it is likely that enhanced integrin binding due to the inserted EDA segment was also involved in
increased synovial cell adhesion onto EDA-enriched FN.
5
1 and
v
3, thereby synergizing with the binding of
the RGD motif to these integrins (ffrench-Constant,
1995
). This possibility seems unlikely, however, since binding of integrin
5
1 to the GST-fusion protein consisting
of CCBD and the Hep2 domain was not affected by the
presence or absence of the EDA segment. A second possibility is that insertion of the EDA segment alters the conformation of the neighboring type III modules including III10, thereby enhancing the integrin-binding affinity of
CCBD (ffrench-Constant, 1995
). Analyses of the three-
dimensional structure of a recombinant FN fragment consisting of III7-III10 modules revealed that two adjacent
type III modules are interconnected with tilts and rotations along the long axis (Leahy et al., 1996
). Insertion of
an extra type III module (i.e., the EDA module) could alter the conformation of the neighboring modules (i.e., III11 and III12) by readjusting the intermodular rotations and
tilts, which could in turn alter the conformation of their
neighboring modules including III10 so as to optimize the
conformation of the RGD-containing loop. The third possibility is that insertion of the EDA segment alters the global conformation of the FN molecule by rotating the NH2-terminal portion of the FN polypeptide relative to the
COOH terminus (Fig. 12). Given a pseudo-twofold relationship between adjacent type III modules (Huber et al.,
1994
; Leahy et al., 1996
), the insertion of the EDA segment is expected to rotate the NH2-terminal two-thirds
(the NH2 terminus through III11) up to 180° relative to the
COOH-terminal one-third (III12 through the COOH terminus). Such a change in global conformation may not only increase the accessibility of the RGD motif in CCBD
to the integrins
5
1 and
v
3 but also induce partial unfolding of the III10 module by altering the tension and/or
torsion applied to CCBD. Our results obtained with thermolysin-cleaved recombinant FNs and GST fusion proteins consisting of CCBD and the Hep2 domain clearly
showed that enhanced integrin-binding of EDA+ FN was
only observable in the context of the intact FN molecule, consistent with the third possibility. The significant increase in the integrin-binding affinity of EDA
FN after
limited proteolysis suggests that the integrin binding site
of EDA
FN is either partially cryptic in the intact molecule or folded into a conformation with suboptimal affinity
for integrin
5
1. In support of this notion, the binding of
plasma FN to hamster kidney cells has been reported to
increase up to twofold after tryptic digestion (Hayashi and
Yamada, 1983
; Akiyama et al., 1985
). It should also be
noted that the integrin-binding activity of EDA+ FN was
slightly decreased after limited proteolysis, suggesting that
conformational change induced by the inserted EDA segment not only increases the exposure of the integrin-binding site on the surface of the FN molecule but also perturbs the local conformation of CCBD, particularly the
RGD-containing III10, to optimize the affinity for integrin
5
1. In support of this possibility, the FN type III modules have been proposed to undergo reversible unfolding with a relatively weak force that is comparable to that required to dissociate a noncovalent protein-protein interaction (Erickson, 1994
).
Fig. 12.
A schematic model
for EDA-induced conformational change of FN. The FN
molecule is folded into a
compact conformation due
to intra- and/or inter-chain
interactions. Insertion of the
EDA segment (black) between CCBD (gray) and the
Hep2 domain rotates the
NH2-terminal region encompassing the NH2 terminus
through the III11 module up
to 180°C relative to the region COOH-terminal to the
inserted EDA segment, leading to a change in the global conformation of the FN molecule. Such a conformational change may increase
the accessibility of the RGD motif within CCBD to integrin
5
1 and/or alter the local conformation of the III10 module so as to optimize the binding of integrin
5
1 to the RGD motif. Arrowheads point to the position of the EDA insertion.
[View Larger Version of this Image (22K GIF file)]
; Erickson and Carrell, 1983
). Such conformational transitions have also been observed in monomeric forms
of FN subunits produced by reduction and subsequent carboxyamidomethylation of disulfides or by limited proteolysis (Erickson and Carrell, 1983
; Benecky et al., 1990
), indicating that the FN strands are folded into a compact
structure by an intra-chain interaction (although involvement of an inter-chain interaction can not be rigorously excluded). Although the regions involved in intra- and/or
inter-chain interaction have not been fully elucidated, the
III1 module may play an important role. The III1 module
was reported to bind multiple regions in FN including the
NH2-terminal 70-kD region, the III10 module, and the
COOH-terminal fibrin-binding domain (Aguirre et al.,
1994
; Hocking et al., 1996
; Ingham et al., 1997
). It is tempting to speculate that EDA-mediated rotation of the NH2-terminal two-thirds relative to the COOH terminus redirects intra- and/or inter-chain interactions, resulting in
transition of the global conformation of the FN molecule
from one state to another (Fig. 12).
FN isoforms.
Cellular FN containing EDA and/or EDB segments has been shown to be much less soluble than plasma FN under
physiological buffer conditions (Yamada et al., 1977
). Altered
solubility can be easily explained by changes in global conformation that may increase the exposure of hydrophobic
and/or charged surfaces of the FN molecule. Furthermore,
alteration in global conformation may be compatible with
an increased matrix assembly of the EDA+ FN isoforms.
Guan et al. (1990)
reported that EDA+ isoforms were
more readily incorporated into the extracellular matrix
than an isoform lacking both EDA and EDB segments. We
also found that rFN(AC) is 2-3-fold more efficient than
rFN(C) in assembling into the extracellular matrix (Manabe,
R., unpublished observation). Although the molecular
mechanisms for FN matrix assembly remain to be elucidated, FNs are considered to undergo a conformational change from a compact to an extended conformation upon
binding to integrin receptors on cell surfaces, thereby dissociating intramolecular interactions and exposing sites
for FN-FN interaction (Mosher, 1993
; Sechler et al., 1996
).
The EDA-mediated conformational change may accelerate FN matrix assembly by facilitating the conformational activation of FNs upon binding to RGD-dependent integrins, particularly
5
1.
; ffrench-Constant and Hynes, 1989
). In
adults, EDA+ FNs reappear during wound healing and in
tumor tissues (ffrench-Constant et al., 1989
; Oyama et al.,
1989a
). In addition, levels of the EDA+ FN expression are
significantly higher in invasive tumors than in noninvasive
ones (Oyama et al., 1989a
). Since tissues where EDA+
FNs are highly expressed are populated with cells having
high proliferative and migratory potentials, it seems likely
that EDA+ FNs play an important role in promoting cell
proliferation and migration in vivo. In support of this notion, our results show that EDA+ FN is more potent than
EDA
FN in promoting migration of HT1080 cells. Under
circumstances where vast cell proliferation and migration
are required, the splicing pattern at the EDA region is apparently altered to produce more EDA+ FN isoforms and,
in so doing, to strengthen signals from the surrounding FN
matrix. Regulation of extracellular signals at the level of
RNA splicing represents a novel mechanism for the control of proliferation, differentiation, and apoptosis of adherent cells.
), the EDB
segment may have an important function only in highly
specific situations, such as early embryonic development.
By analogy with the EDA segment, the insertion of the
EDB segment is expected to alter the global conformation
of the FN molecule by rotating the NH2-terminal half (i.e.,
NH2 terminus through III7) relative to the COOH terminus. Although the EDB segment did not affect the cell-adhesive activity of EDA+ FNs, it may modulate other
biological functions of FN through conformational perturbation. Further studies on the biological activities of a
panel of recombinant FN isoforms differing with respect
to presence or absence of EDA and EDB segments should provide clues to the function of the EDB segment.
Received for publication 12 March 1997 and in revised form 6 July 1997.
Address all correspondence to Kiyotoshi Sekiguchi, Research Institute, Osaka Medical Center for Maternal and Child Health, 840 Murodo, Izumi, Osaka 590-2, Japan. Tel.: (81) 725-56-1220 (ext. 5401). Fax: (81) 725-57-3021. e-mail: j61639{at}center.osaka-u.ac.jpWe thank Dr. Keiko Ichihara-Tanaka for generous gifts of the plasmid pHCF5 and pHCF93, Dr. Luciano Zardi for the mAbs IST-9 and BC-1, Hisanobu Hirano for the mAb OAL115, Eiji Sakashita for the mAb HHS01, and Dr. Masahiro Nakayama (Department of Pathology, Osaka Medical Center for Maternal and Child Health, Osaka, Japan) for allowing us to use term placenta for purification of integrins. We also thank Dr. Judith Healy for valuable comments on this manuscript.
This work was supported by the Special Coordination Fund from the Science and Technology Agency of Japan, the Grants-in-aid for Scientific Research on Priority Areas from the Ministry of Education, Science, and Culture of Japan, and a grant from Osaka Cancer Foundation.
CCBD, central cell-binding domain; FN, fibronectin; GST, glutathione-S-transferase; MBP, maltose-binding protein; RGD, Arg-Gly-Asp.
| 1. |
Aguirre, K.M.,
R.J. McCormick, and
J.E. Schwarzbauer.
1994.
Fibronectin self-association is mediated by complementary sites within the amino-terminal
one-third of the molecule.
J. Biol. Chem.
269:
27863-27868
|
| 2. |
Akamatsu, H.,
K. Ichihara-Tanaka,
K. Ozono,
W. Kamiike,
H. Matsuda, and
K. Sekiguchi.
1996.
Suppression of transformed phenotypes of human fibrosarcoma cells by overexpression of recombinant fibronectin.
Cancer Res.
56:
4541-4546
|
| 3. |
Akiyama, S.K.,
E. Hasegawa,
T. Hasegawa, and
K.M. Yamada.
1985.
The interaction of fibronectin fragments with fibroblastic cells.
J. Biol. Chem.
260:
13256-13260
|
| 4. |
Aota, S.,
T. Nagai, and
K.M. Yamada.
1991.
Characterization of regions of fibronectin besides the arginine-glycine-aspartic acid sequence required for
adhesive function of the cell-binding domain using site-directed mutagenesis.
J. Biol. Chem.
266:
15938-15943
|
| 5. |
Aota, S.,
M. Nomizu, and
K.M. Yamada.
1994.
The short amino acid sequence
Pro-His-Ser-Arg-Asn in human fibronectin enhances cell-adhesive function.
J. Biol. Chem.
269:
24756-24761
|
| 6. | Benecky, M.J., C.G. Kolvenbach, R.W. Wine, J.P. DiOrio, and M.W. Mosesson. 1990. Human plasma fibronectin structure probed by steady-state fluorescence polarization: evidence for a rigid oblate structure. Biochemistry. 29: 3082-3091 [Medline]. |
| 7. |
Borsi, L.,
B. Carnemolla,
P. Catellani,
C. Rosellini,
D. Vecchio,
G. Allemanni,
S.E. Chang,
J. Taylor-Papadimitriou,
H. Pande, and
L. Zardi.
1987.
Monoclonal antibodies in the analysis of fibronectin isoforms generated by alternative splicing of mRNA precursors in normal and transformed cells.
J. Cell
Biol.
104:
595-600
|
| 8. |
Bowditch, R.D.,
M. Hariharan,
E.F. Tominna,
J.W. Smith,
K.M. Yamada,
E.D. Getzoff, and
M.H. Ginsberg.
1994.
Identification of a novel binding site in fibronectin: differential utilization by 3 integrins.
J. Biol. Chem.
269:
10856-10863
|
| 9. |
Carnemolla, B.,
E. Balza,
A. Siri,
L. Zardi,
M.R. Nicotra,
A. Bigotti, and
P.G. Natali.
1989.
A tumor-associated fibronectin isoform generated by alternative splicing of messenger RNA precursors.
J. Cell Biol.
108:
1139-1148
|
| 10. |
Chen, C., and
H. Okayama.
1987.
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol. Cell. Biol.
7:
2745-2752
|
| 11. |
Chen, J.,
T. Maeda,
K. Sekiguchi, and
D. Sheppard.
1996.
Distinct structural requirements for interaction of the integrins 5 1, v 5, and v 6 with the
central cell binding domain in fibronectin.
Cell Adhes. Commun.
4:
237-250
[Medline].
|
| 12. |
Danen, E.H.J.,
S. Aota,
A.A. van Kraats,
K.M. Yamada,
D.J. Ruiter, and
G.N.P. van Muijen.
1995.
Requirement for the synergy site for cell adhesion
to fibronectin depends on the activation state of integrin 5 1.
J. Biol.
Chem.
270:
21612-21618
|
| 13. |
Erickson, H.P..
1994.
Reversible unfolding of fibronectin type III and immunoglobulin domains provides the structural basis for stretch and elasticity of
titin and fibronectin.
Proc. Natl. Acad. Sci. USA.
91:
10114-10118
|
| 14. |
Erickson, H.P., and
N.A. Carrell.
1983.
Fibronectin in extended and compact
conformations: electron microscopy and sedimentation analysis.
J. Biol.
Chem.
258:
14539-14544
|
| 15. |
Esko, J.D.,
K.S. Rostand, and
J.L. Weinke.
1988.
Tumor formation dependent on
proteoglycan biosynthesis.
Science (Wash. DC).
241:
1092-1096
|
| 16. | ffrench-Constant, C.. 1995. Alternative splicing of fibronectin: many different proteins but few different functions. Exp. Cell Res. 221: 261-271 [Medline]. |
| 17. | ffrench-Constant, C., and R.O. Hynes. 1989. Alternative splicing of fibronectin is temporally and spatially regulated in the chicken embryo. Development. 106: 375-388 [Abstract]. |
| 18. |
ffrench-Constant, C.,
L. Van De Water,
H.F. Dvorak, and
R.O. Hynes.
1989.
Reappearance of an embryonic pattern of fibronectin splicing during wound
healing in the adult rat.
J. Cell Biol.
109:
903-914
|
| 19. |
Fukuda, M.,
S.B. Levery, and
S. Hakomori.
1982.
Carbohydrate structure of
hamster plasma fibronectin: evidence for chemical diversity between cellular
and plasma fibronectins.
J. Biol. Chem.
257:
6856-6860
|
| 20. | George, E.L., E.N. Georges-Labouesse, R.S. Patel-King, H. Rayburn, and R.O. Hynes. 1993. Defects in mesoderm, neural tube and vascular development in mouse embryos lacking fibronectin. Development. 119: 1079-1091 [Abstract]. |
| 21. |
Giancotti, F.G., and
E. Ruoslahti.
1990.
Elevated levels of the 5 1 fibronectin
receptor suppress the transformed phenotype of Chinese hamster ovary
cells.
Cell.
60:
849-859
[Medline].
|
| 22. |
Guan, J.-L.,
J.E. Trevithick, and
R.O. Hynes.
1990.
Retroviral expression of alternatively spliced forms of rat fibronectin.
J. Cell Biol.
110:
833-847
|
| 23. |
Hayashi, M., and
K.M. Yamada.
1983.
Domain structure of the carboxyl-terminal half of human plasma fibronectin.
J. Biol. Chem.
258:
3332-3340
|
| 24. | Hino, K., T. Maeda, K. Sekiguchi, K. Shiozawa, H. Hirano, E. Sakashita, and S. Shiozawa. 1996. Adherence of synovial cells on EDA-containing fibronectin. Arthritis Rheum. 39: 1685-1692 [Medline]. |
| 25. | Hirano, H., T. Tachikawa, K. Hino, E. Sakashita, and K. Sekiguchi. 1992. Development of enzyme-linked immunosorbent assasy (ELISA) for the detection of cellular type fibronectin by EDA-region specific monoclonal antibody. J. Clin. Lab. Inst. Reag. 15: 179-184 . |
| 26. |
Hocking, D.C.,
R.K. Smith, and
P.J. McKeown-Longo.
1996.
A novel role for
the integrin-binding III-10 module in fibronectin matrix assembly.
J. Cell
Biol.
133:
431-444
|
| 27. | Huber, A.H., Y.E. Wang, A.J. Bieber, and P.J. Bjorkman. 1994. Crystal structure of tandem type III fibronectin domains from Drosophila neuroglian at 2.0 Å. Neuron. 12: 717-731 [Medline]. |
| 28. | Hynes, R.O. 1990. Fibronectins. Springer-Verlag, New York. 546 pp. |
| 29. | Hynes, R.O.. 1992. Integrins: versatility, modulation, and signaling in cell adhesion. Cell. 69: 11-25 [Medline]. |
| 30. |
Ichihara-Tanaka, K.,
K. Titani, and
K. Sekiguchi.
1990.
Recombinant carboxyl-terminal fibrin-binding domain of human fibronectin expressed in mouse L
cells.
J. Biol. Chem.
265:
401-407
|
| 31. |
Ingham, K.C.,
S.A. Brew,
S. Huff, and
S.V. Litvinovich.
1997.
Cryptic self-association sites in type III modules of fibronectin.
J. Biol. Chem.
272:
1718-1724
|
| 32. |
Jarnagin, W.R.,
D.C. Rockey,
V.E. Koteliansky,
S. Wang, and
D.M. Bissell.
1994.
Expression of variant fibronectins in wound healing: cellular source
and biological activity of the EIIIA segment in rat hepatic fibrogenesis.
J.
Cell Biol.
127:
2037-2048
|
| 33. | Kaufman, R.J.. 1989. Selection and coamplification. Methods Enzymol. 185: 537-566 . |
| 34. |
Kornblihtt, A.R.,
K. Vibe-Pedersen, and
F.E. Baralle.
1984.
Human fibronectin: cell specific alternative mRNA splicing generates polypeptide chains differing in the number of internal repeats.
Nucleic Acids Res.
12:
5853-5868
|
| 35. | Kornblihtt, A.R., K. Umezawa, K. Vibe-Pedersen, and F.E. Baralle. 1985. Primary structure of human fibronectin: differential splicing may generate at least 10 polypeptides from a single gene. EMBO (Eur. Mol. Biol. Organ.) J. 4: 1755-1759 [Medline]. |
| 36. | Laemmli, U.K.. 1970. Cleavage of structural proteins during the assembly of the head of the bacteriophage T4. Nature (Lond.). 227: 680-685 [Medline]. |
| 37. | Leahy, D.J., I. Aukhil, and H.P. Erickson. 1996. 2.0 Å crystal structure of a four-domain segment of human fibronectin encompassing the RGD loop and synergy region. Cell. 84: 155-164 [Medline]. |
| 38. |
Magnuson, V.L.,
M. Young,
D.G. Schattenberg,
M.A. Mancini,
D. Chen,
B. Steffensen, and
R.J. Klebe.
1991.
The alternative splicing of fibronectin pre-mRNA is altered during aging and in response to growth factors.
J. Biol.
Chem.
266:
14654-14662
|
| 39. |
Matsuyama, S.,
K. Ichihara-Tanaka, and
K. Sekiguchi.
1994.
Targeting of the
immunoglobulin-binding domain of protein A to the extracellular matrix using a minifibronectin expression vector.
J. Biochem.
116:
898-904
|
| 40. | Meredith, J.E. Jr., B. Fazeli, and M.A. Schwartz. 1993. The extracellular matrix as a cell survival factor. Mol. Biol. Cell. 4: 953-961 [Abstract]. |
| 41. |
Miyake, K.,
Y. Hasunuma,
H. Yagita, and
M. Kimoto.
1992.
Requirement for
VLA-4 and VLA-5 integrins in lymphoma cells binding to and migration beneath stromal cells in culture.
J. Cell Biol.
119:
653-662
|
| 42. | Mosher, D.F.. 1993. Assembly of fibronectin into extracellular matrix. Curr. Opin. Struct. Biol. 3: 214-222 . |
| 43. |
Müller, U.,
B. Bossy,
K. Venstrom, and
L.F. Reichardt.
1995.
Integrin 8 1
promotes attachment, cell spreading and neurite outgrowth on fibronectin.
Mol. Biol. Cell.
6:
433-448
[Abstract].
|
| 44. |
Oyama, F.,
S. Hirohashi,
Y. Shimosato,
K. Titani, and
K. Sekiguchi.
1989a.
Deregulation of alternative splicing of fibronectin pre-mRNA in malignant human liver tumors.
J. Biol. Chem.
264:
10331-10334
|
| 45. | Oyama, F., Y. Murata, N. Suganuma, T. Kimura, K. Titani, and K. Sekiguchi. 1989b. Patterns of alternative splicing of fibronectin pre-mRNA in human adult and fetal tissues. Biochemistry. 28: 1428-1434 [Medline]. |
| 46. |
Oyama, F.,
S. Hirohashi,
M. Sakamoto,
K. Titani, and
K. Sekiguchi.
1993.
Coordinate oncodevelopmental modulation of alternative splicing of fibronectin
pre-messenger RNA at ED-A, ED-B, and CS1 regions in human liver tumors.
Cancer Res.
53:
2005-2011
|
| 47. |
Paul, J.I., and
R.O. Hynes.
1984.
Multiple fibronectin subunits and their post-translational modifications.
J. Biol. Chem.
259:
13477-13487
|
| 48. |
Petersen, T.E.,
H.C. Thøgersen,
K. Skorstengaard,
K. Vibe-Pedersen,
P. Sahl,
L. Sottrup-Jenesen, and
S. Magnusson.
1983.
Partial primary structure of bovine plasma fibronectin: three types of internal homology.
Proc. Natl. Acad.
Sci. USA.
80:
137-141
|
| 49. | Petersen, T.F., K. Skorstengaard, and K. Vibe-Pedersen. 1989. Primary structure of fibronectin. In Fibronectin. D.F. Mosher, editor. Academic Press, San Diego, CA. 1-24. |
| 50. | Pytela, R., M.D. Pierschbacher, S. Argraves, S. Suzuki, and E. Ruoslahti. 1987. Arginine-glycine-aspartic acid adhesion receptors. Methods Enzymol. 144: 475-489 [Medline]. |
| 51. |
Ruoslahti, E., and
M.D. Pierschbacher.
1987.
New perspectives in cell adhesion:
RGD and integrins.
Science (Wash. DC).
238:
491-497
|
| 52. | Schwarzbauer, J.E., J.W. Tamkun, I.R. Lemischka, and R.O. Hynes. 1983. Three different fibronectin mRNA arise by alternative splicing within the coding region. Cell. 35: 421-431 [Medline]. |
| 53. | Schwarzbauer, J.E., R.S. Patel, D. Fonda, and R.O. Hynes. 1987. Multiple sites of alternative splicing of the rat fibronectin gene transcript. EMBO (Eur. Mol. Biol. Organ.) J. 6: 2573-2580 [Medline]. |
| 54. |
Schwarzbauer, J.E.,
C.S. Spencer, and
C.L. Wilson.
1989.
Selective secretion of
alternatively spliced fibronectin variants.
J. Cell Biol.
109:
3445-3453
|
| 55. |
Sechler, J.L.,
Y. Takada, and
J.E. Schwarzbauer.
1996.
Altered rate of fibronectin matrix assembly by deletion of the first type III repeats.
J. Cell Biol.
134:
573-583
|
| 56. | Sekiguchi, K., and K. Titani. 1989. Probing molecular polymorphism of fibronectins with antibodies directed to the alternatively spliced peptide segments. Biochemistry. 28: 3293-3298 [Medline]. |
| 57. |
Sekiguchi, K.,
A. Siri,
L. Zardi, and
S. Hakomori.
1985.
Differences in domain
structure between human fibronectins isolated from plasma and from culture supernatants of normal and transformed fibroblasts: studies with domain-specific antibodies.
J. Biol. Chem.
260:
5105-5114
|
| 58. |
Sekiguchi, K.,
A.M. Klos,
K. Kurachi,
S. Yoshitake, and
S. Hakomori.
1986.
Human liver fibronectin complementary DNAs: identification of two different messenger RNAs possibly encoding the and subunits of plasma fibronectin.
Biochemistry.
25:
4936-4941
[Medline].
|
| 59. |
Vartio, T.,
L. Laitinen,
O. Närvänen,
M. Cutolo,
L.-E. Thornell,
L. Zardi, and
I. Virtanen.
1987.
Differential expression of the ED sequence-containing form
of cellular fibronectin in embryonic and adult human tissues.
J. Cell Sci.
88:
419-430
|
| 60. |
Williams, E.C.,
P.A. Janmey,
J.D. Ferry, and
D.F. Mosher.
1982.
Conformational states of fibronectin: effects of pH , ionic strength, and collagen binding.
J. Biol. Chem.
257:
14973-14978
|
| 61. | Woods, A., J.R. Couchman, S. Johansson, and M. Höök. 1986. Adhesion and cytoskeletal organization of fibroblasts in response to fibronectin fragments. EMBO (Eur. Mol. Biol. Organ.) J. 5: 665-670 [Medline]. |
| 62. | Xia, P., and L.A. Culp. 1994. Adhesion activity in fibronectin's alternatively spliced domain EDa. 213:253-265. |
| 63. | Xia, P., and L.A. Culp. 1995. Adhesion activity in fibronectin's alternatively spliced domain EDa (EIIIA): complementarity to plasma fibronectin functions. Exp. Cell Res. 217: 517-527 [Medline]. |
| 64. | Yamada, K.M. 1991. Fibronectin and other cell interactive glycoproteins. In Cell Biology of Extracellular Matrix. E. Hay, editor. Plenum Press, New York. 111-146. |
| 65. |
Yamada, K.M., and
D.W. Kennedy.
1979.
Fibroblast cellular and plasma fibronectins are similar but not identical.
J. Cell Biol.
80:
492-498
|
| 66. | Yamada, K.M., D.H. Schlesinger, D.W. Kennedy, and I. Pastan. 1977. Characterization of a major fibroblast cell surface glycoprotein. Biochemistry. 16: 5552-5559 [Medline]. |
| 67. |
Yamada, K.M.,
D.W. Kennedy,
S.S. Yamada,
H. Gralnick,
W. Chen, and
S.K. Akiyama.
1990.
Monoclonal antibody and synthetic peptide inhibitors of human tumor cell migration.
Cancer Res.
50:
4485-4496
|
| 68. |
Yang, J.T.,
H. Rayburn, and
R.O. Hynes.
1993.
Embryonic mesodermal defects
in 5 integrin-deficient mice.
Development.
119:
1093-1105
[Abstract].
|
| 69. | Zardi, L., B. Carnemolla, A. Siri, T.E. Petersen, G. Paolella, G. Sebastio, and F.E. Baralle. 1987. Transformed human cells produce a new fibronectin isoform by preferential alternative splicing of a previously unobserved exon. EMBO (Eur. Mol. Biol. Organ.) J. 6: 2337-2342 [Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|