|
||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© The Rockefeller University Press,
0021-9525/1997//485 $5.00
The Journal of Cell Biology, Volume 139, Number 2,
, 1997 485-495
Article |
Increased Apoptosis Arising from Increased Expression of the Alzheimer's Disease–associated Presenilin-2 Mutation (N141I)
Mutations in the genes for presenilin 1 and 2 (PS-1 and PS-2) have been linked to development of early-onset Alzheimer's disease (AD). As neither the normal function of either presenilin is known nor why mutations cause disease, we examined the properties of wild-type, truncated, and mutant PS-2 upon expression in HeLa cells. Although HeLa cells are strongly predisposed to continued mitosis, expression of PS-2 induced programmed cell death (apoptosis). Direct evidence for apoptosis was obtained by double staining for terminal deoxynucleotide transferase nick end labeling (TUNEL) and PS-2 expression and by following green fluorescent protein–tagged PS-2 over time. Deletion analysis indicates that as little as 166 NH2-terminal residues of PS-2 are sufficient for endoplasmic reticulum (ER) localization and apoptosis. Moreover, the AD- associated PS-2 missense mutation (N141I) more efficiently induced cell death compared to wild-type PS-2 despite lower mutant protein accumulation. Expression of the presenilins in several other cell lines and transgenic mice has been accompanied by rapid protein cleavage without the induction of cell death. In contrast, PS-2 expressed in HeLa cells was not cleaved, and cell death occurred. We hypothesize that full-length but not cleaved PS-2 may be important in the regulation or induction of apoptosis.
Abbreviations used in this paper: aa, amino acid(s); AD, Alzheimer's disease; βAPP, β-amyloid precursor protein gene; CMV, cytomegalovirus; DAPI, 4'6-diamidino-2-phenylindole; GST, glutathione-S-transferase; PS-1 and -2, presenilin 1 and 2; TMD, transmembrane domain.
ALZHEIMER'S disease (AD)1 is a neurodegenerative disorder manifesting with increasing incidence in the aging population. Clinically, it is characterized by memory loss and declining cognitive functions. Familial studies, especially in early-onset cases, indicate molecular heterogeneity and have linked AD to mutations in at least three genes: the β-amyloid precursor protein gene (βAPP) located on chromosome 21 (for review see Mullan and Crawford, 1993) and the presenilin 1 and 2 (PS-1 and PS-2, respectively) genes located on chromosome 14 and 1, respectively (Alzheimer's Disease Collaborative Group, 1995; Campion et al., 1995; Chapman et al., 1995; Cruts et al., 1995; Levy-Lahad et al., 1995a,b; Perez-Tur et al., 1995; Rogaev et al., 1995; Sherrington et al., 1995; Wasco et al., 1995; Boteva et al., 1996). In addition, there is evidence that the acquisition of the apolipoprotein E type 4 (APOE-E4) allele on chromosome 19 predisposes individuals to early onset of AD (Corder et al., 1993; Strittmatter and Roses, 1995).
Mutations in βAPP account for
5% of familial cases (
19 families) with six different single or double missense mutations described so far (for review see Haass et al., 1995; Van Broeckhoven, 1995). The larger proportion of familial AD patients (50–70% of all cases >50 families) have mutations within the PS-1 gene, which has been shown to be a hot spot for missense mutations, as greater than 35 different mutations have been identified so far (for review see Cruts et al., 1996; Haass, 1997). Interestingly, the age of onset of AD correlates somewhat with the location of mutations within the coding regions of PS-1 (for review see Cruts et al., 1996). Fewer AD cases are associated with mutations in PS-2 as only two missense mutations have been described in eight families, mainly of Volga-German descent (Levy-Lahad et al., 1995a,b; Rogaev et al., 1995), and recent evidence indicates at least one of these mutations is variably penetrant (Sherrington et al., 1996).
PS-1 and PS-2 are highly homologous by sequence comparison with the highest degrees of variability occurring in the amino- and carboxyl-terminal regions. Although the function of these proteins is not known, they share homology with two Caenorhabditis elegans proteins. The presenilins are
50% homologous to Sel-12, which is involved in cell signaling by Notch-based receptors, and they exhibit limited homology to SPE-4, which functions in spermatogenesis (Levitan and Greenwald, 1995; Levy-Lahad et al., 1995; Sherrington et al., 1995). Evidence suggesting that these putative C. elegans homologues may indeed be related to mammalian presenilins is the apparent ability of injected human PS-1 and PS-2 cDNAs to functionally rescue a C. elegans Sel-12 mutant defective in vulva development and egg laying (Levitan et al., 1996). Additional evidence indicating PS involvement in development are recent reports showing molecular disruption of the PS-1 gene leads to death shortly after birth with embryos displaying central nervous system defects together with abnormal patterning of the axial skeleton and spinal ganglia (Shen et al., 1997; Wong et al., 1997).
Both presenilin genes are ubiquitously expressed with differential accumulation of two major mRNA transcripts (Li et al., 1995; Rogaev et al., 1995; Sherrington et al., 1995; Lee et al., 1996; Vito et al., 1996a,b). Immunofluorescence staining of epitope-tagged presenilins indicates that the proteins are localized to the ER and Golgi, although subtle differences in localization between PS-1 and PS-2 were noted (Cook et al., 1996; Kovacs et al., 1996; Walter et al., 1996). The presenilins are multipass transmembrane proteins that are believed to topologically weave through ER membranes six to eight times with the NH2- and COOH-terminal domains and the large "loop" spanning the putative sixth and seventh transmembrane domains (TMDs) (according to some models) contained within the cytoplasm (see Fig. 1; Doan et al., 1996; Li and Greenwald, 1996; Lehmann et al., 1997). Recent studies of PS-1 expression in fibroblasts and transgenic mice indicate that PS-1 is proteolytically cleaved since 27–28-kD NH2-terminal and 16– 17-kD COOH-terminal derivatives accumulate in cell lysates (Lee et al., 1996; Thinakaran et al., 1996). Analogous proteolytic cleavage of PS-2 has also been reported (Kim et al., 1997; Tomita et al., 1997). The function of proteolytic cleavage of the presenilins is not known.
|
| Materials and Methods |
|---|
|
|
|---|
1.4-kbp spanning the entire coding sequence of PS-2 was produced. The PCR product was digested with EcoRI since this site was engineered into the 3'-end primer and the resulting
1.4-kbp product was ligated into plasmid pBluescript KS(–) that had been previously digested with EcoRV and EcoRI. The recombinant plasmid was fully sequenced and was found to correspond to human PS-2 without any of the known AD mutations (Levy-Lahad et al., 1995a; Rogaev et al., 1995). To express PS-2 in human cells, full-length PS-2 and four progressively shorter COOH-terminal deletions were cloned into a pGEM expression vector such that the PS-2 cDNA was placed in the appropriate orientation for expression from the strong cytomegalovirus (CMV) promoter (Fig. 1). The pGEM CMV-driven expression plasmid was constructed from pCMV-NF-L (Lee et al., 1993; was kindly provided by Dr. Michael Lee, Johns Hopkins University, Baltimore, MD) by first destroying the most 5' EcoRI site in the vector by standard molecular techniques. The product was then double digested with EagI, which cleaves just 3' of the CMV promoter in NF-L 5' untranslated sequences (see Monteiro et al., 1994), and HindIII, which is located at the 3' end of the NF-L fragment (Lee et al., 1993). Next, through a series of cloning steps an EagI-HindIII fragment from pNF(+La/head) containing lamin 5' sequences, 12 codons of myc sequence, and the entire NF-L 3' region (Monteiro et al., 1994) was introduced into the CMV expression vector. This plasmid was then double digested with SacII, which is located 3' of the EagI site in the 5' untranslated sequence of lamin A, together with SalI, which cleaves 5' of the myc sequences. PS-2 fragments digested with SacII and SalI were subsequently ligated into this CMV expression vector.
pPS-2+MYC
To express full-length PS-2 tagged with the myc epitope, the PS-2 cDNA was PCR amplified with primers that introduced a SacII site upstream of the ATG and a SalI site at the 3' end, which eliminated the stop codon and fused the protein to the myc sequence (described in Monteiro et al., 1994). The 5'-end primer, 5'ACGTACGTAACCGCGGGTTCGTGGTGCTTCCAG3', contained a SacII site followed by 17 bases at its 3' end, which were identical in sequence to the coding strand of PS-2 with similarity beginning 10 bp upstream of the ATG start codon. The 3'-end PCR primer, 5'TATCGCTTAAGTCGACGATGTAGAGCTGATGGG3', contained 17 bases complementary to sequences just upstream of the stop codon of PS-2 and was preceded by a SalI restriction site. The
1.4-kbp PCR product was double digested with SacII and SalI and ligated into the pGEM CMV vector (Fig. 1 C).
pPS-2
To express full-length PS-2 (encoding 448 amino acids [aa]; Fig. 1 A) that was not myc tagged, PS-2 cloned in Bluescript and pPS-2+Myc were each double digested with NotI and EcoRI. NotI cuts at codon 111 of PS-2, whereas the EcoRI site was located downstream of the stop codon in both plasmids. The 3'-end fragment of PS-2 that was devoid of myc sequences and derived from the Bluescript vector was used to replace the corresponding myc-tagged fragment in the pPS-2+Myc.
Construction of pPS-2(268aa)+Myc, pPS-2(222aa)+Myc, and pPS-2(166aa)+ Myc Constructs
To create PS-2 constructs with progressively longer COOH-terminal deletions, the previously described 5' primer containing the SacII site was used in conjunction with 3' primers designed to introduce SalI sites into the PS-2 gene, which allowed the truncated proteins to be myc tagged.
pPS-2(268aa)+Myc.
A 3' primer, 5'TATCGCTTAAGTCGACCAGCACAGCCACGAGAT3', containing 17 bases homologous and complementary to sequences upstream of codon 268 was used to generate construct pPS-2(268aa)+Myc using essentially the same procedure previously described for the construction of pPS-2-Myc. This construct is deleted of 180 COOH-terminal residues immediately 3' of the sixth putative TMD, thereby removing the large hydrophilic loop and all COOH-terminal sequences (Fig. 1 D).
pPS-2(222aa)+Myc.
By a similar PCR procedure, 226 residues from the COOH terminus of PS-2 were deleted using a 3' primer, 5'TATCGCTTAAGTCGACCTTCCAGTGGATGCACA3', which contained 17 bases homologous and complementary to sequences upstream of codon 222. The resulting construct pPS-2(222aa)+Myc is therefore deleted of PS-2 sequences beginning three residues downstream of TMD 4 (Fig. 1 E).
pPS-2(166aa)+Myc.
Similarly, the primer 5'TATCGCTTAAGTCGACCTTGATGCAGCGGTACT3', of which the last 17 bases were homologous and complementary to sequences upstream of codon 166 of PS-2, deleted 282 aa beginning six residues downstream of TMD2 (Fig. 1 F).
pPS-2(138aa)+Myc.
Primer 5'ACGTACGTAAGTCGACGGAGTTGAGGAGGCGCT3', of which the last 17 bases were homologous and complementary to sequences upstream of codon 138 of PS-2, was similarly used to delete 310 COOH-terminal residues of PS-2, including TMD2 (Fig. 1 G).
pGFP-PS-2 and pGFP–PS-2(Asn141Ile)
To monitor PS-2 expression in living cells, PS-2 was cloned into the CLONTECH pEGFP-C1 expression vector, thus fusing PS-2 to the COOH-terminal end of Aequorea victoria GFP. To generate this clone, a 5' primer, 5'TCCGGACTCAGATCTCTCACATTCATGGCCTCT3', of which the last 18 bp were identical to sequences starting at codon 2 of PS-2, was used in combination with the 3' primer, 5'TATCGCTTAAGTCGACGATGTAGAGCTGATGGG3' (described above), to PCR amplify PS-2 clone in Bluescript. The
1.4-kbp product was digested with BglII, which was introduced by the 5'-end primer, and HindIII, which cuts PS-2 internally. The
1-kbp fragment was then ligated between the BglII- HindIII sites of pEGFP-C1. The recombinant pGFP–PS-2(
86) missing 86 COOH-terminal residues of PS-2 was then digested with HindIII and EcoRI, the latter cutting 3' of the former. In conjunction, PS-2 in Bluescript was digested with the same enzymes, and the fragment containing the 3' coding sequences of PS-2 was ligated with the pGFP–PS-2(
86) plasmid fragment. The resulting recombinant yielded pGFP–PS-2 corresponding to full-length PS-2 (missing only the start methionine residue) fused in frame COOH-terminal of GFP (Fig. 1 H).
An additional GFP–PS-2 fusion construct was made to express the PS-2(Asn141Ile) AD-associated mutation (Levy-Lahad et al., 1995a; Rogaev et al., 1995). The asparagine codon at position 141 in PS-2 was converted to an isoleucine by a two-step PCR amplification protocol. In the first step, the 5' portion of PS-2 was amplified using the 5' BglII-containing primer described above in conjunction with a 3' primer, 5'CGTAACGCGAATTCAGGAGGCGCTGGCCCACC3'. The remaining PS-2 3' segment was amplified with a 5' primer, 5'TCAAGCTTGAATTCCGTGCTGATCACCCTCATCATGATCA3', and the PS-2 3'-end primer described initially. Both PCR products were cut with EcoRI, which was introduced by the new primers, and the segments linked in frame with GFP to yield pGFP–PS-2(N141I) (Fig. 1 I). This and the other clones that were generated by PCR were sequenced and were found to encode the expected changes.
pPS-2–(N141I)
To express full-length PS-2 containing the AD-associated mutation, PS-2(N141I), which was neither tagged with GFP nor myc sequences (Fig. 1 B), the XmaI-HindIII fragment from pPS-2 spanning the Asn codon at 141 of wild-type PS-2 was replaced with the corresponding fragment containing the mutation from pGFP–PS-2(N141I) to yield pPS-2(N141I) (Fig. 1 B).
pKv1.4+Myc
A human fetal brain cDNA library (CLONTECH Laboratories, Inc.) was screened by DNA hybridization with a 1.5-kbp EcoRV-EcoRI subfragment of human heart potassium channel Kv1.4 cDNA (kindly provided by Dr. M. Tamkun, Vanderbilt University, Nashville, TN). One positive clone, containing a 3,023-bp cDNA, was fully sequenced and had an open reading frame of 653 amino acids that was homologous to potassium channel Kv1.4 (Tamkun et al., 1991). Through a series of cloning steps, the cDNA was inserted into the modified CMV expression construct, described above, such that the cDNA was fused in-frame at codon 653 of its open reading frame with the myc tag for expression. Transfection of this construct into HeLa cells and electrophysiological recordings using the whole cell patch clamp technique revealed classical voltage-gated activation and inactivation kinetics of an A-type potassium channel.
Expression of Glutathione-S-Transferase (GST)–PS-2 Fusion Proteins in Bacteria
Three different portions of PS-2, the NH2-terminal, the loop spanning TMD 6 and 7, and the COOH-terminal regions (see Fig. 1), were expressed as GST fusion proteins in bacteria. To express the PS-2 NH2-terminal sequences, the segment encoding the first 86 residues of PS-2 were PCR amplified with a 5' primer, CGTACGTCGAATTCCCAATGCTCACATTCATGGC, which introduced an EcoRI site and a proline codon one amino acid upstream of the PS-2 start codon, and a 33 bp 3' primer, GCTGAGTACGCTCGAGCTTCGCTCCGTATTTGA, which introduced a XhoI site after residue 86. Similarly, the segment encoding 120 amino acids of the loop sequence, from residue 270 to residue 389, were PCR amplified with a 5' primer, CGCTTCTGGAATTCCCCAAAGGGCCTCTGAG, which introduced an EcoRI site before residue 270, and a 3' primer, GCTGAGTACGCTCGAGCAGCGTGGTATTCCAGT, which introduced an XhoI site after residue 389.
The COOH-terminal segment encoding the last 39 PS-2 residues was amplified with a 28-bp 5' primer, CGGTACGTGAATTCAAGAAGGCGCTGCC, which introduced an EcoRI site before residue 410 and the previously described 3' primer used to introduce a SalI site into the end of full-length PS2 to myc tag it.
The
260-bp NH2-terminal and 360-bp loop PCR products and the Pharmacia pGST/His T1 vector (Pharmacia Biotech, Inc., Piscataway, NJ) were all digested with EcoRI and XhoI. The
120-bp COOH-terminal PCR fragment was cut with EcoRI and SalI. The fragments were all ligated into pGST/His T1 with the COOH-terminal insertion destroying the XhoI site. These ligations resulted in the fusion of PS-2 sequences COOH-terminal and in-frame with GST. The resulting recombinant plasmids were transformed into CAG456 bacteria (Mercy et al., 1992) and grown overnight at 30°C in 30 ml of standard Luria Broth containing 50 µg ampicillin per ml. The cultures were then diluted into 500 ml of fresh medium and grown for a further 2 h. IPTG was then added to 0.1 mM, and the cultures grown for 3–4 h. The bacteria were collected by centrifugation for 30 min at 3,000 g and resuspended in 1/10 vol chilled 50 mM Tris, pH 7.5, 10% sucrose solution. The following steps were all done on ice: Lysozyme was added to 0.2 mg/ml and left for 20 min with occasional mixing followed by EDTA to 5 mM, NP-40 to 0.1%, and sarkosyl to 0.25%. After a 10-min incubation on ice, the lysed bacteria were sonicated and spun at 4°C for 30 min at 30,000 g. The pellet was removed and the soluble bacterial proteins were incubated for 17 h on a rocker with swollen and equilibrated glutathione agarose beads (Sigma Chemical Co., St. Louis, MO). The slurry was centrifuged at 3,000 g for 5 min, the supernatant was removed, and the agarose pellet was washed in chilled PBS five or six times. GST fusion proteins were eluted in batch with four consecutive bed volume elutions of 10 mM reduced glutathione in 50 mM Tris, pH 8. The eluted fractions were dialyzed in 50 mM Tris, pH 7.5, 10% sucrose, and 5 mM EDTA. The purified proteins and soluble fractions, together with soluble fractions of IPTG- induced bacteria, were boiled in Laemmli buffer and separated by SDS-PAGE. The purified protein fractions were also used in antibody blocking experiments.
Tissue Culture and DNA Transfection
HeLa cells were grown in DME supplemented with 10% FBS (Monteiro and Mical, 1996). Exponentially growing cells were transfected with 10–20 µg of plasmid DNAs as calcium phosphate precipitates (Graham and van der Eb, 1973).
Staining of Cells and Analysis by Immunofluorescence Light Microscopy
For immunofluorescence microscopy, cells were transfected directly on glass coverslips. At various times after transfection, the coverslips were fixed in 1% paraformaldehyde on ice for 15 min and then immersed in –20°C 70% ethanol for 20 min or overnight. The cells on the coverslips were rehydrated in PBS, blocked in 0.8% BSA, stained with primary and secondary antibodies, and finally stained with 1 µg/ml 4'6-diamidino- 2-phenylindole (DAPI) as previously described (Monteiro et al., 1994). The primary antibodies used were the mouse monoclonal anti–myc 9E10 antibody (Monteiro et al., 1994), a goat polyclonal anti–PS-2 antibody generated using a 20-aa peptide corresponding to NH2-terminal sequences for PS-2 (Santa Cruz Biotechnology, Inc., Santa Cruz, CA), a rabbit polyclonal anti-GFP antibody (CLONTECH Laboratories, Inc.), a rabbit polyclonal anticalreticulin (StressGen, Victoria, Canada), and a rabbit polyclonal antilamin antibody generated against purified bacterially expressed human lamin C. For antibody–ligand competition experiments, the goat anti–PS-2 antibody diluted 1:150 was incubated overnight with equal molar amounts (
250 µg) of either bacterially purified GST protein or the GST–NH2-terminal PS-2 fusion protein before application to the transfected coverslips. Secondary antibodies used were affinity purified fluorescein- or rhodamine-conjugated rabbit anti–mouse, rabbit anti– goat, donkey anti–rabbit, donkey anti–goat, goat anti–mouse, and goat anti–rabbit antibodies (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA). Fluorescence staining and phase contrast images of cells were visualized on an inverted Zeiss Axiovert 135 microscope (Thornwood, NY). Images were captured either on 35-mm TMAX 400 professional film (Eastman Kodak Corp., Rochester, NY), or using an Image Explorer II system incorporating a Dage MTI CCD72 camera and frame grabber together with IPLab Spectrum software (Signal Analytics Corp., Vienna, VA) on a Power Macintosh (Apple Computer Co., Cupertino, CA).
Analysis of GFP Fluorescence and Visual Monitoring of Cell Death
HeLa cells plated on gridded coverslips (Eppendorf, Milwaukee, WI) were transfected with GFP-expressing constructs, and at various times after transfection, the coverslips were washed with sterile PBS, and GFP fluorescence was visualized using the FITC filter 10 set (Carl Zeiss, Inc.). The fluorescence and phase contrast images of transfected cells in the same gridded areas were captured 17, 41, and 65 h after transfection using the Image explorer II camera. After image analysis, the PBS was replaced with fresh DMEM medium, and the coverslips were quickly returned to the CO2 incubator.
In an alternative procedure, cell death was quantitated by counting the number of floating cells that accumulated 20 and 44 h after transfection. For this analysis, 1–1.5 x 105 HeLa cells grown in 100-mm dishes were transfected with either 15 or 20 µg DNA of the various PS-2 expression constructs. 20 h after transfection, the medium was collected from each dish and fresh medium was added to the dishes. The number of floating cells in medium obtained 20 and 44 h after transfection were counted using a hemacytometer. The number of floating apoptotic cells (of which 50– 60% failed to exclude trypan blue—not untypical of apoptotic cells since loss of membrane integrity occurs very late during apoptosis) and not including mitotic cells (distinguished by the presence of metaphase plates) in the PS-2 transfected dishes were normalized to the number found in mock-transfected dishes.
Protein Preparation, SDS Gel Electrophoresis, and Immunoblotting
Cells were lysed in 0.5% SDS lysis buffer containing protease inhibitors (Monteiro and Mical, 1996) and the unboiled lysates were analyzed on 8.5 and 10% SDS-PAGE gels (Laemmli, 1970). The gels were calibrated by electrophoresing known molecular mass standards; rabbit muscle myosin (205 kD), Escherichia coli β-galactosidase (116 kD), rabbit muscle phosphorylase B (97.4 kD), bovine albumin (66 kD), egg albumin (45 kD), and carbonic anhydrase (29 kD) (Sigma Chemical Co.). The fractionated proteins were transferred onto 0.1-µm nitrocellulose membranes (Schleicher & Schuell, Keene, NH) by electroblotting, and immunoblots were processed as described previously (Xiao and Monteiro, 1994).
Double Labeling of PS-2–transfected HeLa Cells with the myc Monoclonal Antibody and Terminal Transferase Fluorescence In Situ Apoptosis Detection
Transfected cells were analyzed for apoptosis using the in situ Apop Tag detection kit (Oncor, Inc., Gaithersburg, MD) essentially as described by the manufacturer. HeLa cells transfected on coverslips were fixed in 1% paraformaldehyde on ice for 15 min, transferred to 0.5% Triton in PBS for 3 min, and placed in –20°C 70% ethanol for 20 min. The cells on coverslips were rehydrated by two incubations with PBS for 5 min each and then transferred to a humidified chamber and covered with Equilibration buffer (Oncor S7110 kit) for 5 min, after which the buffer was replaced with the working strength terminal deoxynucleotide transferase enzyme. The chamber containing the coverslips was placed in a 37°C incubator, and after 3.5 h, the coverslips were submerged in the working strength stop/wash buffer for 0.5 h and rinsed in three changes of PBS for 3 min each. Working strength antidigoxigenin-fluorescein was applied for 0.5 h, and the cells were washed again first in 1% Triton in PBS for 3 min and twice more in PBS for 5 min each. The coverslips were then counterstained with the myc monoclonal antibody followed by rhodamine-conjugated goat anti–mouse antibody as described above.
| Results |
|---|
|
|
|---|
50–54 kD when probed with a polyclonal antibody specific for NH2-terminal PS-2 sequences (Fig. 2 C, lanes 2 and 4, respectively) that were not detectable in mock-transfected lysates (Fig. 2 C, lanes 1 and 3). The PS-2 antibody recognized GST fusion proteins containing NH2-terminal but not loop or COOH-terminal PS-2 sequences (Fig. 2, A and B). PS-2 deletions in which the COOH-terminal 180, 226, and 282 residues were removed (see Fig. 1 and Materials and Methods) migrated as doublet bands in SDS-PAGE gels (evident in shorter exposures of autoradiographs, data not shown) with apparent molecular sizes of
35–37, 33–35, and 31–33 kD, respectively (Fig. 2 C, lanes 4–7). Apart from these bands, larger immunoreactive complexes were routinely seen in PS-2–transfected cells but not in mock-transfected cells and appeared to represent dimers, trimers, and higher molecular mass complexes of PS-2 proteins (Fig. 2 C, lanes 4–7, small arrowheads). We did not observe any significant proteolytic cleavage of the PS-2–expressed products as has been previously reported (Kim et al., 1997; Tomita et al., 1997). In fact, immunoblot analyses of a parallel gel probed with the myc antibody, which recognized the COOH terminus of PS-2, contained bands identical in size to those recognized by the anti–NH2-terminal PS-2 antibody, indicating full-length accumulation of the various PS-2 polypeptides with the presence of both NH2- and COOH-terminal epitopes (compare Fig. 2 C, lanes 3–7, with Fig. 2 D, lanes 1–5). The myc-reactive PS-2 bands were clearly distinguished from the
35 and 65 kD endogenous bands present in all HeLa cell lysates (Fig. 2 D, small arrowhead).
|
|
|
70% 20 h after transfection, but by 44 h it had accelerated and approached that of the other constructs (Fig. 5 A).
|
Fig. 6, A–D, shows a typical example of PS-2(166aa)+ Myc–transfected cells in which TUNEL-positive labeling (Fig. 6 B) correlated with PS-2 expression (Fig. 6 A). Interestingly, only the highly condensed nuclei of the rounded-up shrunken cells that appear about to detach from the coverslip (seen by the phase contrast image; Fig. 6 D, arrowheads) were prominently labeled. Even the PS-2–positive cell with the multiple compacted DNA aggregates, seen by DAPI staining (Fig. 6 C), was not TUNEL labeled, suggesting that it is an earlier stage of apoptosis during which few free DNA 3' ends have been generated or are accessible for labeling. In addition to DNA cleavage, another feature of cells undergoing apoptosis is the collapse of the nuclear envelope and cleavage of lamin proteins (Kaufmann, 1989; Ucker et al., 1992; Oberhammer et al., 1994; Lazebnik et al., 1995; Rao et al., 1996). We therefore examined the integrity of the nuclear lamina in pPS-2 (166aa+Myc– transfected cells using an antibody specific for lamins A/C (Fig. 6, E–H). In PS-2–expressing cells, the nuclear lamina had indeed collapsed but was round and apparently normal in PS-2–negative cells. In some PS-expressing cells, the nuclear lamina was diffuse, suggesting cleavage of the nuclear lamins during apoptosis.
|
80-kD polypeptides (Fig. 2 E), consistent with fusion of 27 kD of GFP sequences with 50–55 kD of PS-2. There was no evidence for any proteolytic cleavage of the fusion proteins. Furthermore, both GFP–PS-2 fusion proteins displayed classical ER and nuclear envelope localization when examined by direct fluorescence microscopy (Fig. 7, A and B), indicating that fusion of GFP with PS-2 did not noticeably alter the normal ER localization pattern of PS-2.
|
155% after 41 h and to 158% at 65 h. The initial increase at 41 h probably resulted from either cell division of the transfected cells (the HeLa cell cycle is
23 h; Monteiro and Mical, 1996) and/or an increase in GFP expression in cells previously scored as nonexpressors. The smaller increase at 65 h is probably due to loss of transient GFP expression during prolonged growth. In sharp contrast, cell viability dramatically decreased in cells expressing GFP–PS-2 fusion proteins. 41 h after transfection, cell viability decreased to
76% in cells expressing wild-type PS-2 fusion proteins and decreased further to 33% by 65 h. A similar dramatic decrease in cell viability was seen in cells expressing the PS-2(N141I) mutation with viability decreasing to 74% at 41 h and 38% after 65 h. In both cases, decrease in cell viability correlated with the appearance of numerous rounded-up shrunken cells at the later time points, consistent with cell death by apoptosis. However, a careful comparison of cell viability in six sets of independent experiments and analysis of greater than 2,000 cells indicated no significant difference in the rate of cell survival between wild-type and mutant PS-2 GFP fusion proteins in HeLa cells (Fig. 5 B). The time-dependent loss of GFP fluorescence could have resulted from the loss of transient expression or the loss of cells from the coverslips due to death. To test these and other possibilities, we followed individual GFP-expressing cells over a period of time. A typical example of this analysis is shown in Fig. 8, where at least three of a group of cells attached on the No. 2 grid mark of the coverslip are clearly seen to express the GFP–PS-2 fusion protein by fluorescence at 22 h. After 50 h, these same cells, which had retained some residual fluorescence, had rounded-up and had shrunken cytoplasms typical of dying cells.
|
25% that of wild-type protein levels (Fig. 1 F). | Discussion |
|---|
|
|
|---|
The mechanisms by which PS-2 overexpression leads to cell death by apoptosis are not revealed by our studies. Although the presenilins are ubiquitously expressed, PS-2 is expressed at considerably lower levels than PS-1 (Rogaev et al., 1995; Sherrington et al., 1995; Li et al., 1995; Lee et al., 1996). Perhaps in normal cells, expression of one or both of the presenilins is modulated by other factors that regulate the commitment to the cell death pathway. Presumably, in the transient transfections increases in expression of PS-2 leads to the perturbation of this regulation in favor of the apoptotic pathway.
Although PS-1 is highly homologous to PS-2, no increased apoptosis has been documented in cell lines and transgenic mice overexpressing PS-1 (Duff et al., 1996; Kovacs et al., 1996; Thinakaran et al., 1996). While the simplest explanation is that PS-1 may function differently from PS-2, another possibility is that transgenic lines overexpressing PS-1 may induce compensatory changes in the expression of antiapoptotic genes. Another likely possibility is that proteolytic cleavage of PS proteins alter their properties significantly. Most prior reports have shown overexpression of PS proteins in cell lines and transgenic mice to yield primarily proteolytic products. However, in our experiments we failed to observe significant cleavage (<5–10%) of the expressed PS-2 proteins, including those containing full-length PS-2 sequences. Based on these observations, we propose that proteolytic cleavage of the presenilins diminishes the apoptotic effects of the full-length proteins. That PS truncations are less toxic than full-length proteins is supported by higher levels of truncated proteins that accumulated with increasing length of COOH-terminal truncations (see Fig. 2, C and D).
The AD-associated PS-2 mutation converting arginine to isoleucine at codon 141 caused an increase in apoptosis in cells overexpressing the mutant protein. Despite accumulating to lower protein levels than the wild-type protein, the mutant is more toxic. The deletion studies presented here have indicated that retention of NH2-terminal PS-2 sequences are necessary for apoptosis. Not surprisingly, fusion of GFP to the NH2 terminus of PS-2 masks these differences.
Clearly, if the differential killing effect of full-length wild-type and mutant PS-2 is relevant to disease, then it must manifest in neurons that are at risk in AD. Suggestive evidence that apoptosis may be involved in AD is supported by increased accumulation of the death-promoting protein, Bax, as well as increased evidence for nuclear DNA fragmentation, in AD cases but not in controls (Su et al., 1997). Additionally, recent reports suggest that AD mutations in βAPP may also induce apoptosis when expressed in neuronal cells and that death is mediated by heterotrimeric guanosine triphosphate–binding proteins (G proteins; Yamatsuji et al., 1996). Interestingly, FAD patients with mutations in presenilin genes and transgenic mice expressing mutant human PS genes have elevated levels of Aβ42-43 peptides (Duff et al., 1996; Scheuner et al., 1996; Borchelt et al., 1996; Tomita et al., 1997), which have been documented to induce apoptosis (LaFerla et al., 1995). The obvious implications of all of this is that missense mutations in presenilins produce subtle effects that increase apoptosis over the course of the neuronal life span.
| Acknowledgments |
|---|
86aa) constructs, respectively. We thank Dr. Ann Pluta and a benevolent reviewer for The Journal of Cell Biology for insightful comments on the manuscript. This work was supported in part by a grant from the National Institute on Aging to M.J. Monteiro.
Submitted: 28 April 1997
Revised: 19 August 1997
Address all correspondence to Mervyn J. Monteiro, Ph.D., University of Maryland Biotechnology Institute, Room N352, 725 West Lombard Street, Baltimore, MD 21201. Tel.: (410) 706-8132. Fax: (410) 706-1732.
| References |
|---|
|
|
|---|
Alzheimer's Disease Collaborative Group. The structure of the presenilin 1 (S182) gene and identification of six novel mutations in early onset AD families, Nat Genet, 1995, 11, 219–222.[Medline]
Borchelt DR, Thinakaran G, Eckman CB, Lee MK, Davenport F, Ratovitsky T, Prada C-M, Kim G, Seekins S, Yager D et al.. Familial Alzheimer's disease-linked presenilin 1 variants elevate Aβ1-42/1-40 ratio in vitro and in vivo, Neuron, 1996, 17, 1005–1013.[Medline]
Boteva K, Vitek M, Mitsudade H, Silva H, Xu P-T, Small G & Gilbert JR. Mutation analysis of presenilin 1 gene in Alzheimer's disease, Lancet, 1996, 347, 130–131.[Medline]
Campion D, Flaman JM, Brice A, Hannequin D, Dubois B, Martin C, Moreau V, Charbonnier F, Didierjean O, Tardieu S et al.. Mutations in the presenilin 1 gene in families with early-onset Alzheimer's disease, Hum Mol Genet, 1995, 4, 2373–2377.
Chapman J, Asherova A, Wang N, Treves TA, Korczyn AD & Goldfarb LG. Familial Alzheimer's disease associated with S182 codon 286 mutation, Lancet, 1995, 346, 1040, .[Medline]
Cook DB, Sung JC, Golde TE, Felsenstein KM, Wojczyk BS, Tanzi RE, Trojanowski JQ, Lee VMY & Doms RM. Expression and analysis of presenilin-1 in a human neuronal system: localization in cell bodies and dendrites, Proc Natl Acad Sci USA, 1996, 93, 9223–9228.
Corder EH, Saunders AM, Strittmatter WJ, Schmechel DE, Gaskell PC, Small GW, Roses AD, Haines JL & Pericak-Vance MA. Gene dose apolipoprotein E type 4 allele and the risk of Alzheimer's disease in late onset families, Science (Wash DC), 1993, 261, 921–923.
Cruts M, Backhovens H, Wang SY, Vangassen G, Theurns J, Dejonghe C, Wehnert A, Devoecht J, deWinter G, Cras P et al.. Molecular genetic analysis of familial early-onset Alzheimer's disease linked to chromosome 14Q24.3, Hum Mol Genet, 1995, 4, 2363–2371.
Cruts M, Hendriks L & Van Broeckhoven C. The presenilin genes: a new gene family involved in Alzheimer's disease pathology, Hum Mol Genet, 1996, 5, 1449–1455.[Abstract]
Deng G, Pike CJ & Cotman CW. Alzheimer-associated presenilin-2 confers increased sensitivity to apoptosis in PC12 cell, FEBS Lett, 1996, 397, 50–54.[Medline]
Doan A, Thinakaran G, Borchelt DR, Slunt HH, Rativitsky T, Podlisny M, Selkoe DJ, Seeger M, Gandy SE, Price DL & Sisodia SS. Protein topology of presenilin 1, Neuron, 1996, 17, 1023–1030.[Medline]
Duff K, Eckman C, Zehr C, Yu X, Prada C-M, Perez-tur J, Hutton M, Buee L, Harigaya Y, Yager D et al.. Increased amyloid-β42(43) in brains of mice expressing mutant presenilin 1, Nature (Lond), 1996, 383, 710–713.[Medline]
Earnshaw WC. Nuclear changes in apoptosis, Curr Opin Cell Biol, 1995, 7, 337–343.[Medline]
Graham R & van der Eb AJ. A new technique for the assay of infectivity of human adenovirus 5 DNA, Virology, 1973, 52, 456–467.[Medline]
Haass C. Presenilins: genes for life and death, Neuron, 1997, 18, 687–690.[Medline]
Haass C, Hung Y, Citron M, Teplow DB & Selkoe DJ. β-Amyloid, protein processing and Alzheimer's disease, Drug Res, 1995, 45, 398–402.[Medline]
Kaufmann SH. Induction of endonucleolytic DNA cleavage in human acute myelogenous leukemia cells by etoposide, camptothecin, and other cytotoxic anticancer drugs: a cautionary note, Cancer Res, 1989, 49, 5870–5878.
Kim TW, Pettingell WH, Hallmark OG, Moir RD, Wasco W & Tanzi RE. Endoproteolytic cleavage and proteosomal degradation of presenilin 2 transfected cells, J Biol Chem, 1997, 272, 11006–11010.
Kovacs DM, Fausett HJ, Page KJ, Kim T-W, Moir RD, Merriam DE, Hollister RD, Hallmark OG, Mancini R, Felsenstein KM et al.. Alzheimer-associated presenilins 1 and 2: neuronal expression in brain and localization to intracellular membranes in mammalian cells, Nat Med, 1996, 2, 224–229.[Medline]
LaFerla FM, Tinkle BT, Bieberich CJ, Haudenschild C & Jay G. The Alzheimer's Aβ peptide induces neurodegeneration and apoptotic cell death in transgenic mice, Nat Genet, 1995, 9, 21–30.[Medline]
Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature (Lond), 1970, 227, 680–685.[Medline]
Lazebnik YA, Takahashi R, Moir R, Goldman R, Poirier G, Kaufmann S & Earnshaw W. Studies of lamin proteinase reveal multiple parallel pathways during apoptotic execution, Proc Natl Acad Sci USA, 1995, 92, 9042–9046.
Lee MK, Xu Z, Wong PC & Cleveland DW. Neurofilaments are obligate heteropolymers in vivo, J Cell Biol, 1993, 122, 1337–1350.
Lee MK, Slunt HH, Martin LJ, Thinakaran G, Kim G, Gandy SE, Seeger M, Koo E, Price DL & Sisodia SS. Expression of presenilin 1 and 2 (PS1 and PS2) in human and murine tissues, J Neurosci, 1996, 16, 7513–7525.
Lehmann S, Chiesa R & Harris DA. Evidence for a six-transmembrane domain structure of presenilin 1, J Biol Chem, 1997, 272, 12047–12051.
Levitan D & Greenwald I. Facilitation of lin-12-mediated signalling by sel-12, a Caenorhabditis elegansS182 Alzheimer's disease gene, Nature (Lond), 1995, 377, 351–354.[Medline]
Levitan D, Doyle TG, Brousseau D, Lee MK, Thinakaran G, Slunt HH, Sisodia SS & Greenwald I. Assessment of normal and mutant human presenilin function in Caenorhabditis elegans. , Proc Natl Acad Sci USA, 1996, 93, 14940–14944.
Levy-Lahad E, Wasco W, Poorkaj P, Romano DM, Oshima J, Pettingell WH, Yu C, Jondro PD, Schmidt SD, Wang K et al.. Candidate gene for the chromosome 1 familial Alzheimer's disease locus, Science (Wash DC), 1995a, 269, 973–977.
Levy-Lahad E, Wijsman EM, Nemens E, Anderson L, Goddard KAB, Weber JL, Bird TD & Schellenberg GD. A familial Alzheimer's disease locus on chromosome 1, Science (Wash DC), 1995b, 269, 970–973.
Li X & Greenwald I. Membrane topology of the C. elegansSEL-12 presenilin, Neuron, 1996, 17, 1015–1021.[Medline]
Li J, Ma J & Potter H. Identification and expression analysis of a potentially familial Alzheimer disease gene on chromosome 1 related to AD3, Proc Natl Acad Sci USA, 1995, 92, 12180–12184.
Mercy MR, Troncoso JC & Monteiro MJ. A new series of trpE vectors that enable high expression of nonfusion proteins in bacteria, Protein Expr Purif, 1992, 3, 57–64.[Medline]
Monteiro MJ & Mical T. Resolution of kinase activities during the HeLa cell cycle: identification of kinases with cyclic activities, Exp Cell Res, 1996, 223, 443–451.[Medline]
Monteiro MJ, Hicks C, Gu L & Janicki S. Determinants for intracellular sorting of cytoplasmic and nuclear intermediate filaments, J Cell Biol, 1994, 127, 1327–1343.
Mullan M & Crawford F. Genetic and molecular advances in Alzheimer's disease, Trends Neurosci, 1993, 16, 398–403.[Medline]
Oberhammer FA, Hochegger K, Froschl G, Tiefenbacher R & Pavelka M. Chromatin condensation during apoptosis is accompanied by degradation of lamin A+B, without enhanced activation of cdc2 kinase, J Cell Biol, 1994, 126, 827–837.
Opas M, Dziak E, Fliegel L & Michalak M. Regulation of expression and intracellular distribution of calreticulin, a major calcium binding protein of nonmuscle cells, J Cell Physiol, 1991, 149, 160–171.[Medline]
Perez-Tur J, Froelich S, Prihar G, Crook R, Baker M, Duff K, Wragg M, Busfield F, Lendon C, Clark RF et al.. A mutation in Alzheimer's disease destroying a splice acceptor site in the presenilin-1 gene, Neuroreport, 1995, 7, 297–301.[Medline]
Rao L, Perez D & White E. Lamin proteolysis facilitates nuclear events during apoptosis, J Cell Biol, 1996, 135, 1441–1455.
Rogaev EI, Sherrington R, Rogaeva EA, Levesque G, Ikeda M, Liang Y, Chi H, Lin C, Holman K, Tsuda T et al.. Familial Alzheimer's disease in kindereds with missense mutations in the gene on chromosome 1 related to the Alzheimer's disease type 3 gene, Nature (Lond), 1995, 376, 775–778.[Medline]
Scheuner D, Eckman C, Song X, Citron M, Suzuki N, Bird TD, Hardy J, Hutton M, Kukull W, Larson E et al.. Secreted amyloid β-protein similar to that in the senile plaques of Alzheimer's disease is increased in vivo by the presenilin and 2 and APP mutations linked to familial Alzheimer's disease, Nat Med, 1996, 2, 864–870.[Medline]
Shen J, Bronson RT, Chen DF, Xia W, Selkoe DJ & Tonegawa S. Skeletal and CNS defects in presenilin-1-deficient mice, Cell, 1997, 89, 629–639.[Medline]
Sherrington R, Rogaev EI, Liang Y, Rogaeva EA, Levesque G, Ikeda M, Chi H, Lin C, Li G, Holman K et al.. Cloning of a gene bearing missense mutations in early-onset familial Alzheimer's disease, Nature (Lond), 1995, 375, 754–760.[Medline]
Sherrington R, Froelich S, Sorbi S, Campion D, Chi H, Rogaeva EA, Levesque G, Rogaev EI, Lin C, Liang Y et al.. Alzheimer's disease associated with mutations in presenilin 2 is rare and variably penetrant, Hum Mol Genet, 1996, 5, 985–988.
Strittmatter WJ & Roses AD. Apolipoprotein E and Alzheimer disease, Proc Natl Acad Sci USA, 1995, 92, 4725–4727.
Su JH, Deng G & Cotman CW. Bax protein expression is increased in Alzheimer's brain: correlation with DNA damage, Bcl-2 expression, and brain pathology, J Neuropathol Exp Neurol, 1997, 56, 86–93.[Medline]
Tamkun MM, Knoth KM, Wabridge JA, Kroemer H, Roden DM & Glover KM. Molecular cloning and characterization of two voltage-gated K channel cDNAs from human ventricle, FASEB (Fed Am Soc Exp Biol) J, 1991, 5, 331–337.[Abstract]
Thinakaran G, Borchelt DR, Lee MK, Slunt HH, Spitzer L, Kim G, Ratovitsky T, Davenport F, Nordstedt C, Seeger M et al.. Endoproteolysis of presenilin 1 and accumulation of processed derivatives in vivo, Neuron, 1996, 17, 181–190.[Medline]
Tomita T, Maruyama K, Saido TC, Kume H, Shinozaki K, Tokuhiro S, Capell A, Walter J, Grunberg H, Hass C et al.. The presenilin 2 mutation (N141I) linked to familial Alzheimer disease (Volga German families) increases the secretion of amyloid β protein ending at the 42nd (or 43rd) residue, Proc Natl Acad Sci USA, 1997, 94, 2025–2030.
Ucker DS, Myers J & Obermiller PS. Activation driven cell death: quantitative differences alone distinguish stimuli triggering nontransformed T cell proliferation or death, J Immunol, 1992, 149, 1583–1592.[Abstract]
Van Broeckhoven C. Molecular genetics of Alzheimer's disease: identification of genes and gene mutations, Eur Neurol, 1995, 35, 8–19.[Medline]
Vito P, Lacana E & D'Adamio LD. Interfering with apoptosis: Ca2+-binding protein ALG-2 and Alzheimer's disease gene ALG-3, Science (Wash DC), 1996a, 271, 521–525.[Abstract]
Vito P, Wolozin B, Ganjei JK, Iwasaki K, Lacana E & D'Adamio LD. Requirement of the familial Alzheimer's disease gene PS2 for apoptosis, J Biol Chem, 1996b, 271, 31025–31028.
Yamatsuji T, Matsui T, Okamoto T, Komatsuzaki K, Takeda S, Fukumoto H, Iwatsubo T, Suziki N, Asami-Odaka A, Ireland S et al.. G protein-mediated neuronal DNA fragmentation induced by familial Alzheimer's disease-associated mutants of APP, Science (Wash DC), 1996, 272, 1349–1352.[Abstract]
Walter J, Capell A, Grunberg J, Presold B, Schindzielorz A, Prior R, Podlisny MB, Fraser P, St. George-Hyslop PH, Selkoe DJ & Hass C. The Alzheimer's disease-associated presenilins are differentially phosphorylated proteins located predominantly within the endoplasmic reticulum, Mol Med, 1996, 2, 673–691.[Medline]
Wasco W, Pettingell WP, Jondro PD, Schmidt SD, Gurubhagavatula S, Rodes L, DiBlasi T, Romano DM, Guenette SY, Kovacs DM et al.. Familial Alzheimer's chromosome 14 mutations, Nat Med, 1995, 1, 848, .[Medline]
Wyllie AH. Cell death: significance of apoptosis, Int Rev Cytol, 1980, 68, 251–306.[Medline]
Wolozin B, Iwasaki K, Vito P, Ganjei JK, Lacana E, Sunderland T, Zhao B, Kusiak JW, Wasco W & D'Adamio L. Participation of presenilin 2 in apoptosis: enhanced basal activity conferred by an Alzheimer mutation, Science (Wash DC), 1996, 274, 1710–1713.
Wong PC, Zeng H, Chen H, Becher MW, Sirinathsinghji DJS, Trumbauer ME, Chen HY, Price DL, Van der Ploeg LHT & Sisodia SS. Presenilin 1 is required for Notch1 and Dll1 expression in the paraxial mesoderm, Nature (Lond), 1997, 387, 288–292.[Medline]
Xiao J & Monteiro MJ. Identification and characterization of a novel (115 kDa) neurofilament-associated kinase, J Neurosci, 1994, 14, 1820–1833.[Abstract]
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|