|
||

* Institut für Mikrobiologie und Molekularbiologie, Justus-Liebig-Universität Giessen, 35392 Giessen, Germany and
School of
Biological Sciences, The University of Manchester, M13 9PT, United Kingdom
Through a screen designed to isolate novel fission yeast genes required for chromosome segregation, we have identified mal3+. The mal3-1 mutation decreased the transmission fidelity of a nonessential minichromosome and altered sensitivity to microtubule-destabilizing drugs. Sequence analysis revealed that the 35-kD Mal3 is a member of an evolutionary conserved protein family. Its human counterpart EB-1 was identified in an interaction screen with the tumour suppressor protein APC. EB-1 was able to substitute for the complete loss of the mal3+ gene product suggesting that the two proteins might have similar functions. Cells containing a mal3 null allele were viable but showed a variety of phenotypes, including impaired control of cell shape. A fusion protein of Mal3 with the Aequorea victoria green fluorescent protein led to in vivo visualization of both cytoplasmic and mitotic microtubule structures indicating association of Mal3 with microtubules. The absence of Mal3 protein led to abnormally short, often faint cytoplasmic microtubules as seen by indirect antitubulin immunofluorescence. While loss of the mal3+ gene product had no gross effect on mitotic spindle morphology, overexpression of mal3+ compromised spindle formation and function and led to severe growth inhibition and abnormal cell morphology. We propose that Mal3 plays a role in regulating the integrity of microtubules possibly by influencing their stability.
PRECISE duplication of the genetic material and its subsequent accurate segregation into two daughter cells
are essential properties of the eucaryotic cell cycle,
that ensure the faithful inheritance of genetic information.
Genomic stability is vital for the survival of an organism
and genetic instability has long been considered an integral characteristic of certain types of cancers (reviewed in
Hartwell, 1992 Entry into mitosis is controlled by the activation of the
protein kinase complex MPF which results in chromosome
condensation and the formation of the mitotic spindle. The
spindle is a dynamic array of microtubules and a large number of microtubule-associated proteins (Hoyt and Geiser,
1996 Mutations in genes required for chromosome transmission fidelity can be identified by scoring for the increased
loss of a genetically marked, nonessential minichromosome. Using such an assay we have identified a number of
new factors required for chromosome segregation (Fleig
et al., 1996 Germline mutations in the APC gene lead to the inherited disease familial adenomatous polyposis (FAP). FAP
shows a dominant mode of inheritance occurring in 1 in
7,000 individuals and results in the development of hundreds to thousands of colorectal tumors in early adult life.
Some of these will give rise to carcinomas (reviewed in
Kinzler and Vogelstein, 1996 Here we show by the ability of EB-1 to substitute for fission yeast Mal3 function that the two proteins appear to
have similar functions, implying that an analysis of fission
yeast Mal3 could provide valuable insight into the function
of the APC-interacting protein EB-1. Our data indicate
that the microtubule-interacting mal3+ gene product plays
an important role in regulating/maintaining the integrity
of microtubule arrays.
Media and Strains
The Schizosaccharomyces pombe strains HM348 (h+, leu1-32, fur1, ade6-M210, tps1, Ch16 [ade6-M216]) (Niwa et al., 1986 Microscopy
Photomicrographs of cells were taken with a Zeiss Axioskop fitted with
differential interference optics. For determination of phenotypes a minimum of 300 cells was scored microscopically. Staining with calcofluor
(Sigma Chem. Co., St. Louis, MO) and processing of cells for immunofluorescence microscopy was carried out as described (Verde et al., 1995 Identification of mal3+ ORF
and Plasmid Constructions
Strain YP30.1 was transformed with an S. pombe genomic bank (Barbet et al.,
1992 30 nucleotides of sequence from the 5
To fuse the yEGFP and mal3+ ORFs, we generated a mal3+ ORF without the TAA stop codon via PCR using pREP3-mal3 and the following oligonucleotides: 5 To demonstrate linkage between the cloned mal3+ gene and the mal3-1
mutant we constructed a mal3 Database Searches and Cloning of Human EB-1
The NCBI's protein database was searched using BLASTP. The Mal3
query showed strongest homologies to human EB-1 (GenBank U24166; P = 3.7 x 10
Disruption of mal3+ Open Reading Frame
To disrupt the mal3+ gene we replaced the 0.8-kb PacI-PstI mal3+ fragment with the 1.9-kb his3+ (Ohi et al. 1996 Isolation of the mal3-1 Mutant and Cloning of mal3+
Through a screen designed to isolate new fission yeast
genes involved in chromosome segregation, we have identified 25 mutant strains which show an increase of loss rate
of a nonessential minichromosome. A decrease in minichromosome transmission fidelity was identified by using
an ade6-based colony color assay and was manifested as an
increase in the number of red sectors in a white colony
(Fleig et al., 1996 The wild-type mal3+ gene was isolated by complementation of the TBZ-sensitive phenotype. 10 µg/ml of TBZ
had little effect on a mal3+ strain at 30°C (Fig. 2 B, a), but
severely inhibited growth of mal3-1 (Fig. 1 B). Transformation of the mal3-1 strain with an S. pombe genomic library identified three plasmids which were able to rescue
the growth defect of the mal3-1 strain on TBZ medium. One of these plasmids contained a 2.9-kb genomic DNA
insert which also complemented the increased loss of the
minichromosome (Fig. 1 A, right).
DNA sequence analysis of either end of this 2.9-kb insert was used for a homology search in the Schizosaccharomyces pombe database (Sanger Center, Hinxton, UK).
A match of 100% identity was found on chromosome I. This region contained the two putative open reading frames
(ORF) SPAC18G6.13c and SPAC18G6.14. The DNA insert contained the entire SPAC18G.13c ORF and 82% of
the SPAC18G6.14 ORF (Fig. 1 C, top diagram). Only SPAC-
18G6.14 rescued the mal3-1 defects (data not shown) and
was thus named mal3+. Linkage was demonstrated between the cloned mal3+ gene and the mal3-1 mutant (see
Materials and Methods).
The DNA sequence of the mal3+ ORF was identical to
that reported for SPAC18G6.14 with the exception of a silent change at position 210 of the ORF where the mal3+
sequence had a C and SPAC18G6.14 a T nucleotide. mal3+
encodes a protein of 308 amino acid residues with a mass
of 35.1 kD and is interrupted by a 60-bp intron (Fig. 1, C
and D). Database searches indicated that no previously
characterized sequence motifs were present in the Mal3
amino acid sequence.
Mal3 Belongs to an Evolutionary Conserved
Protein Family
A search of NCBI's nonredundant protein database identified several proteins with significant homology to Mal3,
in particular the 30-kD human protein EB-1 (28.9% identity and 39.6% similarity) and the 38.3-kD hypothetical S. cerevisiae ORF Yer016p (33.1% identity and 44.1% similarity) (Su et al., 1995 Human EB-1 Rescues the TBZ-Hypersensitivity of the
mal3 Deletion Strain
The functional interchangeability of Mal3 and EB-1 proteins was tested by assessing the ability of EB-1 to suppress the TBZ-hypersensitive phenotype of mal3-1 and
mal3 Deletion of the mal3+ Gene Is Viable but Leads to
Altered Cell Morphology and Phenotypes Similar to
those of the mal3-1 Mutant
A mal3 null allele was constructed by replacing the first
152 amino acids of the mal3+ ORF and promoter region
with the his3+ marker in the diploid strain YP41 (Fig. 3 A,
diagram). Southern analysis identified the resultant mal3
deletion (data not shown). Diploid transformants that carried the mal3+ null allele (named mal3
Further analysis of the haploid mal3 Absence of the mal3+ gene product resulted in alterations in cell form and polarity as branched and curved
cells were seen instead of the cylindrical shape typical of
wild-type cells (Figs. 3 B and 4 A). Bent cells were often
elongated. Altered cell morphology was observed at all
temperatures tested, but was most prominent at 20°C,
where >30% of mal3
The Mal3 Protein Associates with Microtubules In Vivo
To determine the intracellular localization of Mal3 in living cells, a yeast-enhanced version of the green fluorescent
protein named yEGFP (Cormack et al., 1997 We observed green fluorescence when the Mal3-yEGFP
protein was expressed at low or high levels in the cell. Low-level expression of the fusion protein resulted in staining
along microtubule structures and some uniform green fluorescence of the cytoplasm and faint nuclear staining. However, as fluorescence was weak under these conditions, we
looked for intermediate levels of expression of the fusion
protein which had no effect on cell growth and cell morphology but gave better staining. Growing cells on medium containing 0.05 µM thiamine (Javerzat et al., 1996 Loss of Mal3 Function Results in Altered Interphase
Microtubule Arrays
As our data indicated that Mal3 is a microtubule interacting protein we examined the consequences of a loss of
Mal3 protein upon the microtubule cytoskeleton.
In wild-type fission yeast cells cytoplasmic microtubules
are aligned along the long axis of the cell between the cell
tips (Marks et al., 1986
Consistent with the notion that the microtubule cytoskeleton plays a role in nuclear positioning (Toda et al.,
1984 In addition to displacement of the nucleus and post-anaphase-array lack of Mal3 also led to displacement of
the septum from its normal central location. Approximately 23% of mal3 Overexpression of mal3+ Inhibits Colony Formation
and Leads to Aberrant Cell Morphology
Overproducing Mal3 by inducing mal3+ expression from
the nmt1+ promoter in a wild-type strain resulted in severe
inhibition of colony formation (Fig. 6 A, b) and cell elongation, indicative of a possible role of Mal3 in cell cycle
regulation. Cells started to elongate following 18 h of induction and subsequently became highly elongated with
phenotypes similar to those of the mal3
Cells with extra Mal3 protein also displayed mitotic defects and were unable to undergo proper cytokinesis. The
cytokinesis retardation appeared to be coupled with the
appearance of abnormally formed and misplaced septa.
Following 21 h of mal3+ induction 7.2% of cells had a septum and in 25% of these the septa were not in the central
fifth of the cell. Later (e.g., 24 h) more than 80% of cells
with a septum showed highly abnormal, multiple and/or
misplaced septa (Fig. 6 C, d and f). Overexpression of human EB-1 protein led to similar, albeit less severe phenotypes (Figs. 4 B and 6 A, c and B). Overexpression of either Mal3 or EB-1 protein in the mal3 Overexpression of Mal3 Protein Compromises Spindle
Formation and Function
Immunofluorescence staining of a wild-type strain overexpressing mal3+ for 20-22 h at 32°C showed no gross
defects in microtubule integrity in interphase cells. Cytoplasmic microtubule bundles were present in a full complement and extended along the main cell axis to the cell tips.
The bundles in branched cells were slightly more curved
than those of wild-type cells (Fig. 7 e).
Excess Mal3 led to an increase in the proportion of cells
which were in mitosis and strongly affected the formation
and function of the spindle. After 20 h of induction 24% of
cells were in mitosis and 16% had condensed chromosomes. Two predominant defective spindle phenotypes were
observed: (a) elongating spindles with severe defects in
chromosome segregation to the poles (Fig. 7 a), and (b)
the disintegration of the spindle evidenced by spindle fraying (Fig. 7, a and b) and two separated V-shaped tubulin
structures present in one cell (Fig. 7, d and g). 52% of cells
with a spindle exhibited the former phenotype, while 6%
of all cells displayed the latter one. Additionally, 2.5% of
cells in the population were unable to form a spindle and
showed V-shaped tubulin staining patterns typical of mutants with a defective spindle pole body component or mitotic motor protein (Fig. 7, c and f; Hagan and Yanagida,
1995 A time course analysis of Mal3-yEGFP overexpression
revealed that the increase in the number of cells in mitosis
and the appearance of aberrant spindle structures was correlated directly with the duration of overexpression (Fig. 4
B, right) and peaked following induction for 19-20 h. At
this time ~32% of cells showed green fluorescing mitotic
spindles with >40% of these being aberrant.
Decreasing Microtubule Stability Partially
Rescues the Mal3 Overexpression Phenotype of
Severe Growth Inhibition
The abnormally short cytoplasmic microtubule arrays in
the mal3 By a screen designed to isolate new components of the
chromosome transmission machinery in fission yeast we have
identified and characterized the mal3+ gene. The mal3-1
mutant strain shows a ~400-fold increase in the rate of
loss of a nonessential minichromosome at 24°C but otherwise grows normally. However, as an increase in chromosome loss rate less than three orders of magnitude might
not severely affect colony formation, we cannot rule out
an effect of mal3-1 on the transmission of regular chromosomes. Fission yeast Mal3 and the human APC-interacting
protein EB-1 belong to the same protein family. Mutations
in the APC gene result in the cancer predisposition syndrome FAP and are believed to be an early event in the
development of the majority of sporadic colorectal tumors (reviewed in Kinzler and Vogelstein, 1996 Mal3 Is a Microtubule-associated Protein that
Influences Microtubule Integrity
In vivo localization of the Mal3 fusion protein showed, in
addition to faint cytoplasmic and nuclear staining, strong
fluorescence associated with both cytoplasmic and mitotic
microtubules (Fig. 3 D). As is the case with antitubulin immunofluorescence mitotic spindles were brighter than cytoplasmic microtubules, consistent with more microtubules
in spindles as opposed to the cytoplasmic microtubule
bundles (Ding et al., 1993 Indirect antitubulin immunofluorescence of mal3 The effect on spindle morphology was less marked in
mal3 Overproduction of the Mal3 protein severely compromised the formation and function of the mitotic spindle.
Microtubules can be altered by the association of microtubule associating proteins (MAP) and interaction with microtubule severing proteins and motors (reviewed in Hirokawa, 1994 An alternative explanation for the effect of excess Mal3
on the mitotic spindle could be that the excess protein is
coating the mitotic microtubules, thus blocking/hindering
binding of proteins required for proper spindle function.
Absence or Overexpression of Mal3 Protein Results in
Displacement of Nucleus and Septum
The interphase nucleus of mal3 Excess Mal3 protein also had a profound effect on the
morphology and position of the division septum, resulting
in abnormal and/or misplaced septa (Fig. 6 C, d and f)
reminiscent of loss of function mutations in the fission
yeast dmf1/mid1 gene, which is required for the correct
positioning of the division septum (Chang et al., 1996 Deletion or Overexpression of mal3+ Leads to Aberrant
Cell Morphology
A large number of abnormal curved or branched cells
were observed in the mal3 Excess Mal3 also resulted in morphological abnormalities in the presence of seemingly normal interphase microtubule arrays. This resembles the effect of overexpression
of the microtubule-interacting protein Dis1 (Nabeshima
et al., 1995 Function of the Human APC-interacting Protein EB-1?
The tumor suppressor protein APC has been implicated in
a number of cellular processes including cell migration
(Kinzler and Vogelstein, 1996 The carboxyl terminus of APC is required for the association with both microtubules and EB-1 (Munemitsu et al.,
1994 The control of directed cell growth is vital for cell function and cellular differentiation. The cylindrical form of the
wild-type fission yeast cell and the highly polarized manner of growth of this organism facilitate the identification of
components required for these processes. Our results raise
the exciting possibility that some of the components required for directed cell growth in fission yeast and directed
cell movement in higher eucaryotes have been conserved.
).
; reviewed in Hyman and Karsenti, 1996
; Walczak and
Mitchison, 1996
). Alignment of chromosomes to the middle of the spindle in metaphase and the subsequent separation of the sister chromatids to opposite poles in anaphase (reviewed in Yanagida, 1995
) requires interactions
between kinetochores and spindle microtubules. Although
substantial progress has been made in recent years in identifying components required for spindle function, such as
mitotic motor proteins (Hoyt and Geiser, 1996
), the complexity of the system suggests that a large number of molecules involved in ensuring the accurate segregation of the
chromosomes await identification.
). Here we report the characterization of a further component mal3+. Cloning of the wild-type mal3+
gene revealed that the 35-kD predicted product of the
mal3+ gene, Mal3, belongs to an evolutionary conserved
protein family. A human homologue of Mal3 is EB-1,
which was identified on the basis of its ability to interact
with the carboxyl terminus of the tumour-suppressor protein adenomatous polyposis coli (APC)1 (Su et al., 1995
).
). APC gene defects are also
present in the majority of sporadic colorectal tumors and represent an early event in colorectal tumor development
(Groden et al., 1991
; Nishisho et al., 1991
). The APC gene
encodes a 310-kD cytoplasmic protein with no strong homologies to proteins of known function (reviewed in Kinzler and Vogelstein, 1996
). APC has been implicated in a
number of cellular processes including the regulation of
directed cell migration (reviewed in Polakis, 1995
; Näthke et al., 1996
; Wong et al., 1996
). The amino-terminal part of
APC contains an oligomerization domain, while the central third mediates
-catenin binding (reviewed in Kinzler
and Vogelstein, 1996
; Pfeifer, 1996
). Association of APC
with
-catenin links APC to the process of cell adhesion as
well as placing it into the Drosophila Wg/ mouse Wnt signal transduction pathway (reviewed in Kemler, 1993
; Kinzler and Vogelstein, 1996
; Pfeifer, 1996
). The carboxyl-terminal end of APC is required for association with EB-1,
the human homologue of the Drosophila tumor suppressor protein DLG and the microtubule cytoskeleton (Munemitsu et al., 1994
; Smith et al., 1994
; Matsumine et al., 1996
).
Over 95% of APC mutations in FAP and sporadic tumors result in truncations which delete the carboxyl-terminal
third of the protein (reviewed in Polakis, 1995
) suggesting
that interactions in this region of APC play key roles in
regulating the growth-controlling function of APC.
Materials and Methods
), YP10.22 (h
, leu1-32,
ade6-M210, ura4-D6, Ch16 [ade6-M216]) and YP10.22a (h+, ade6-M210,
ura4-D6, Ch16 (ade6-M216)), the isolation of the mal3-1 carrying strain
YP30.1 and the calculation of the minichromosome loss rate have been described (Fleig et al., 1996
). Strains YP246 (h
, his3-D1, leu1-32, ura4-D18, ade6-M210) and YP249 (h+, his3-D1, leu1-32, ura4-D18, ade6-M216)
(Ohi et al., 1996
) were used to generate diploid strain YP41. The mal3 deletion strain YP350 (h+, mal3
::his3+, his3-D1, leu1-32, ura4-D18, ade6-M210) was isolated by tetrad analysis. Strains YP113 (h+, nda2-KM52,
leu1-32) and YP114 (h+, nda3-KM311, leu1-32) have been described (Umesono et al., 1983
; Toda et al., 1984
). Strains were grown in rich (YE5S) or
EMM minimal medium with appropriate supplements (Moreno et al., 1991
).
For low- or high-level expression from the nmt1+ promoter cells were
grown in EMM with 15 µM thiamine or pregrown on EMM plus thiamine
plates for 18 h at 30°C before inoculation into thiamine-less EMM liquid
medium, respectively. Sensitivity to thiabendazole (TBZ) was monitored
at 24 or 30°C on YE5S plates or EMM plates containing 10 µg/ml of TBZ.
;
Hagan and Hyams, 1988
). For tubulin staining we used the primary monoclonal antitubulin antibody TAT1 (Woods et al., 1989
) followed by FITC-conjugated goat anti-mouse antibodies (Hagan and Yanagada, 1997).
Spindle pole bodies were stained using AP9.2 affinity-purified anti-sad1-primary and Cy3-conjugated secondary sheep anti-rabbit antibodies
(Sigma) (Hagan and Yanagida, 1995
). Immunofluorescence images were
processed as described previously (Lange et al., 1995
).
) and Ura+ transformants were selected by incubation for 50 h at
32°C, followed by replica-plating twice onto plates containing 10 µg/ml TBZ. Plasmids were isolated (Moreno et al., 1991
) from the 3 out of 24,000 transformants able to grow following this selection process, amplified in
E. coli XL1-blue (Stratagene Inc., La Jolla, CA) and retransformed into
YP30.1 to ascertain plasmid borne rescue. These plasmids were tested for
the ability to suppress the increased minichromosome loss of the mal3-1
mutant by visual screening for the suppression of colony sectoring. Only
one of the genomic DNA inserts, present in pUR3-1, was able to rescue all
defects of strain YP30.1.
(5
TCGCTTATCTGTCCCTTGAACCTACGACAA 3
) as well as the 3
(5
GATCAGGTGGTAACTCAAAACCATCCTCAG 3
) end of the 2.9-kb genomic DNA insert
of pUR3-1 were used for an homology search in the S. pombe database,
identifying a region of identity on chromosome I that contained two putative ORFs SPAC18G6.13c and SPAC18G6.14. To determine which ORF
rescued the mal3-1 mutant strain, pUR3-1 was cut with PacI/SmaI and re-ligated thus rendering pUR3-1a which contains only the SPAC-18G6.13c
ORF. The 1.6 kb PvuI/BamHI fragment containing SPAC-18G6.14 was
cloned blunt-ended into SmaI cut pUR18 (Barbet et al., 1992
) resulting in
plasmid pUR3-1b. Only pUR3-1b was able to rescue the defects of the
mal3-1 mutant. SPAC18G6.14 was thus named mal3+. To obtain full-length mal3+, genomic DNA prepared from strain YP10.22 (Moreno et
al., 1991
) was used as a PCR template with oligonucleotides a (5
TACCAGTCGACATGTCTGAATCTCGGCAAGA 3
) and b (5
CTTAGCCCGGGTTAAAACGTGATATTCTCATC 3
). Oligonucleotides a and b
are homologous to the 5
and 3
ends of the mal3+ ORF (sequences in italics) and contain a SalI and SmaI site, respectively (see Fig. 1 C). These restrictions sites were used to clone the 980-bp mal3+ PCR fragment into
SalI/SmaI cut pREP3 (Maundrell, 1993
) generating pREP3-mal3. The sequence of three independently PCR-derived mal3+ DNAs was determined.
Fig. 1.
Phenotypic characterization of the mal3-1 strain, isolation of mal3+ gene and Mal3 amino acid sequence. (A) Sectoring
phenotypes of mal3+, mal3-1, and mal3-1 transformed with plasmid pUR3-1 strains grown at 24°C are shown. *Minichromosome
loss rate; n. d., not determined. (B) While the mal3-1 strain or
mal3-1 plus vector (pUR18) are unable to grow on TBZ containing EMM medium at 30°C, this defect is rescued by plasmid
pUR3-1. (C) Diagrammatic representation of genomic DNA insert of pUR3-1 (top) and full length mal3+ gene obtained by PCR
(bottom). PCR primers have been marked by arrows, ORF by
grey boxes and a putative intron in SPAC18G6.14/mal3+ by a
striped box. P, PvuI; Pa, PacI; Ps, PstI; B, BamHI; Sm, SmaI; Sa,
SalI. (D) Amino acid sequence comparison of fission yeast Mal3,
budding yeast Yer016p (GenBank accession number P40013) and
human EB-1 (GenBank accession number U24166). Identical and similar amino acids are indicated by black and grey boxes, respectively. The arrow head indicates the end of the Mal3 truncated protein in pUR3-1. The mal3+ sequence data are available
from EMBL/GenBank/DDBJ under accession number Y09518.
[View Larger Versions of these Images (43 + 58K GIF file)]
TACCAGTCGACTATGTCTGAATCTCGCAAGA 3
and 5
AGTACCTCGAGAAACGTGATATTCTCATCGT 3
and cloned
it into SalI/XhoI pBluescript (Stratagene). The mal3+ DNA fragment was
excised with BamHI/XhoI and cloned into BamHI/SalI cut pUG23
(Güldener, U., and J.H. Hegemann, unpublished observations), thereby
fusing the mal3+ and yEGFP (Cormack et al., 1997
) ORFs. This fusion
was subsequently cloned into SalI cut pREP3 behind the nmt1+ promoter.
/mal3-1 diploid strain. Both mal3 alleles
show increased sensitivity to TBZ. Random spore analysis of this diploid
strain revealed that the 400 spores tested showed increased sensitivity to
TBZ indicating that mal3
and mal3-1 were linked and thus that the complementing DNA fragment was the mal3+ gene.
53) and budding yeast protein Yer016p (GenBank P40013;
P = 4.3 x 10
53). Sequence alignments were performed using CLUSTAL
W (Thompson et al., 1994
). The dbEST database was searched using
BLAST. The EST clone (NCBI 184415, GenBank R13836) with the highest homology to Mal3 (P = 1.8 x 10
19) was ordered from Research Genetics Inc. (Huntsville, AL) (clone ID 26991) and sequenced revealing
100% identity to EB-1 (Su et al., 1995
) albeit without the first 127 bp of
the EB-1 ORF. To obtain full-length EB-1 the missing 5
end of the
cDNA was constructed via PCR using the cDNA as template and overlapping oligonucleotides (see Fig. 2 A). Oligonucleotide 1 (5
GCTGGAGCAACAAGGGAA G 3
) was used in combination with oligonucleotides
2 (5
AATCTGACAAAGATCGAACAGTTGTGCTCAGGGGCTGCGTATTGTCAGTTTATGGAC 3
), 3 (5
TGACATGCTGGCCTGGATCAATGAGTCTCTGCAGTTGAATCTGACAAAGATCGAACAG 3
),
4 (5
TCAACGTCAGTGACCAGTGATAACCTAAGTCGACATGACATGCTGGCCTGGATC 3
), and 5 (5
TTCTGCTCTAGACTCGAGATGGCAGTGAACGTATACTCAACGTCAGTGACCAGTG 3
) in
such a way that, for example, the PCR product resulting from the use of
oligonucleotides 1 and 2 was used as a template for the next PCR (see Fig.
2 A). After sequence analysis of the 452-bp DNA product obtained from
the last PCR reaction, the fragment was cloned as a PstI/XbaI fragment
into pBluescript generating plasmid pJB17. To obtain the entire EB-1
ORF the 2-kb long PstI/NotI fragment from the original cDNA clone was
cloned into pJB17 resulting in plasmid pJB23. The 1,367-bp AvaI/StuI
fragment from pJB23 containing the entire EB-1 was cloned into XhoI/
SmaI cut pREP3.
Fig. 2.
Suppression of the TBZ sensitivity of the mal3-1 and
mal3
strains by mal3+ and EB-1. (A) Diagrammatic representation of cloning of EB-1 cDNA. The positions of the five oligonucleotides used to construct the 5
end (lightly shaded box) of EB-1
not present in the original cDNA (dark shaded box) are indicated. X, XbaI; A, AvaI; P, PstI; S, StuI; N, NotI. (B) The mal3+
strain transformed with vector (a), the mal3-1 strain transformed with vector (b) or with plasmids expressing mal3+(c) or EB-1 (d)
and the mal3
strain transformed with vector (e), or with plasmids expressing mal3+ (f) or EB-1 (g) were all grown for 18 h at
30°C in thiamine-less EMM medium, diluted in water and serial
dilutions (1:10) starting with 104 cells were spotted on selective
EMM medium with 10 µg/ml TBZ and incubated for 3 d at 30°C.
[View Larger Versions of these Images (9 + 84K GIF file)]
) marker in diploid strain YP41.
Correct integration was verified by Southern-hybridization and PCR analysis. PCR primers used were: a (5
GAGCCTCTTTGCGAAGGAGCATTG 3
) and b (5
TAAAACGTGATATTCTCATCGTCA 3
) homologous to the his3+ 3
end and the last 24 base pairs of the mal3+ ORF,
respectively. Transformants with a correctly disrupted mal3+ ORF were
sporulated and asci dissected by tetrad analysis.
Results
). Strain YP30.1, which showed a 380-fold increase in minichromosome loss at 24°C (Fig. 1 A, middle) and was hypersensitive to the microtubule-destabilizing drug thiabendazole (TBZ) (Fig. 1 B), was chosen for
further analysis. Crossing this mutant strain to a wild-type
strain and pulling tetrads indicated that a single locus was
responsible for both the increased loss of the minichromosome and the TBZ-sensitivity. We called this allele mal3-1.
; Dietrich et al., 1997
). Blocks of homology were distributed over the entire length of the protein with the exception of the COOH-terminal end (Fig. 1 D). Searches of the dbEST database (Boguski et al.,
1993
) identified 16 ESTs of human and mouse origin with
significant homology to Mal3, indicating that it is a member of a conserved multiprotein family. Therefore we sought
to determine whether members of this family were functionally homologous. The EST cDNA clone with the highest homology to the Mal3 sequence was sequenced revealing 100% identity to the published sequence of human
EB-1 (Su et al., 1995
). The first 127 bp of the EB-1 ORF
not present in the cDNA fragment were generated via PCR
using appropriate overlapping oligonucleotides (Fig. 2 A).
(mal3+ null allele, see next section). Both strains
were transformed with plasmids expressing either mal3+
or EB-1 under the control of the thiamine-repressible
nmt1+ promoter. The presence of 15 µM thiamine leads to
low-level expression from this promoter, while the absence of thiamine leads to high-level expression after 12-
14 h (Fleig and Nurse, 1991
; Maundrell, 1993
). Transformants were pregrown in medium lacking thiamine for 18 h
at 30°C and then tested for the ability to grow on TBZ-containing plates. As shown in Fig. 2 B the wild-type
mal3+ strain transformed with vector only grows well on
plates containing 10 µg/ml TBZ (Fig. 2 B, a), while the
mal3
strain grows poorly (e) and mal3-1 is unable to
grow (b). Plasmid-borne expression of Mal3 suppresses
the growth defect on TBZ plates of both the mal3-1 and
mal3
mutants (Fig. 2 B, c and f). Human EB-1 partially rescued the increased TBZ-sensitivity of mal3-1 (Fig. 2 B,
d) and fully suppressed the TBZ sensitivity of mal3
(Fig.
2 B, g) suggesting that, while the human EB-1 protein is
only partially able to compete with the mutant form of the
Mal3 protein in the mal3-1 strain, EB-1 can substitute for
the complete loss of the mal3+ gene product. Low-level
expression of Mal3 and EB-1 partially rescued the TBZ-sensitivity of the mal3
strain (data not shown).
) were sporulated
and subjected to tetrad analysis. While all four spores in
each tetrad were viable at 32°C histidine prototrophy segregated 2:2, indicating that mal3+ is not essential for cell
proliferation. PCR analysis of the histidine prototrophic
spores confirmed the correct integration of the mal3+ disruption cassette (Fig. 3 A).
Fig. 3.
Phenotypic characterization of mal3
strain and in vivo
localization of Mal3 protein. (A) Diagrammatic representation
and PCR analysis of the mal3+ disruption. Diploid strain YP41
was transformed with a linear 3.2-kb DNA fragment where 800 bp of the mal3+ gene had been replaced by the 1.9-kb his3+ gene.
Spores were grown and their DNA analysed by PCR for the presence of the mal3+ disruption. The positions of the PCR primers a
and b are shown in the bottom diagram. The 900-bp DNA fragment generated by PCR can be obtained only if the linear mal3+
disruption fragment has integrated correctly, as the DNA sequence homologous to primer b is not present on the 3.2-kb
DNA fragment used for replacement. a and b show the PCR
product of his
and his+ spore DNA, respectively. M, DNA molecular mass markers (0.94 and 0.83 kb). (B) Photomicrographs
of mal3
cells. A wild-type strain (a) and the mal3
strain (b-e)
were grown logarithmically at 24°C. (C) Serial dilution patch test
for cold-sensitivity of mal3+and mal3
strains. Dilutions shown
were tenfold. Strains were incubated at 30°C and 20°C for 3 and 5 d,
respectively. (D) In vivo localization of Mal3 protein. A wild-type S. pombe strain expressing Mal3-yEGFP under the control
of the nmt1+ promoter was pregrown on solid EMM thiamine
medium, resuspended in liquid EMM medium with 0.05 µM thiamine, grown for 16 h at 30°C and photographed directly. Bars:
(B) 20 µm; (D) 5 µm.
[View Larger Versions of these Images (25 + 71 + 80K GIF file)]
strain revealed
phenotypes similar to those of the mal3-1 mutant strain
i.e., increased sensitivity to TBZ (Fig. 2 B, e) and a decreased transmission fidelity of the minichromosome (data
not shown). In addition while no difference in growth between a wild-type and a mal3
strain was observed at 30 or
24°C (Fig. 3 C, left; data not shown), deletion of the mal3+
gene conferred cold sensitivity (Fig. 3 C, bottom right).
cells had abnormal shapes (Fig. 4 A).
Fig. 4.
Phenotypes of the mal3
strain and Mal3 and EB-1
overproducing strains. (A) mal3
cells were grown at 20 or 32°C
in liquid YE5S medium and the percentage of cells with abnormal cell morphology, a displaced nucleus and misplaced septum
was determined. The mal3+ control strain was grown at 20°C.
*Percentage of all interphase cells with a displaced nucleus;
percentage of septated cells with a misplaced septum. (B) Wild-type strains overproducing Mal3, EB-1 or Mal3-yEGFP were grown
for 0-21 h at 30°C in expression inducing medium and the percentage of cells with altered cell shape (
), a displaced nucleus
(
), a mitotic spindle (
) and aberrant spindles out of the total
number of spindles (+) was determined.
[View Larger Version of this Image (41K GIF file)]
) was fused to
the COOH-terminal end of the mal3+ coding region and
the fusion protein was expressed under the control of the
nmt1+ promoter (see Materials and Methods). The Mal3-yEGFP fusion protein rescued the TBZ-sensitivity of mal3
when expressed at a high level from the nmt1+ promoter,
albeit less efficient than Mal3, indicating that the fusion
protein was functional (data not shown).
;
data not shown) resulted in fluorescence that was clearly
highlighting filamentous structures reminiscent of microtubules. The Mal3-yEGFP fusion protein associated with
both cytoplasmic (Fig. 3 D, a-d) and mitotic spindle microtubules (Fig. 3 D, e-h). Fluorescence was distributed
uniformly along the elongating spindle, with early mitotic
spindles staining most intensely. Interestingly in anaphase
the Mal3-yEGFP fusion protein also localized to a ring
present at the cell equator (Fig. 3 D, a and g, arrows). Expression of yEGFP alone from the nmt1+ promoter led to
uniform green staining of the entire yeast cell (data not
shown; Fleig et al., 1996
).
; Hagan and Hyams, 1988
; Fig. 5, h
and i). In contrast morphologically wild-type mal3
cells
grown at 20°C had microtubules that were largely short
(approximately one-fifth of wild-type length) and present
only around the nucleus (Fig. 5, a and b). In addition, the
staining in branched cells was often absent or very weak
possibly indicating that less than the wild-type complement of microtubules were present in each cytoplasmic
bundle (data not shown). To determine that these findings
were not artefacts of fixation, a simple test was performed.
At the nonpermissive temperature cdc25-22 cells arrest
cell cycle progression at the G2/M boundary but continue
to grow thus becoming highly elongated with cytoplasmic
microtubules (Hagan and Hyams, 1988
). By mixing arrested cdc25-22 cells with shorter mal3
cells before processing them for immunofluorescence, one can determine
whether the microtubules in both strains are unable to
reach the cell tips (i.e., fixation artefact) or whether the
defect is present only in mal3
. Consistent with the latter
interpretation the images in Fig. 5 k show normal microtubules in the cdc25-22 cell and short microtubules in mal3
cells. In contrast to the severe alteration of cytoplasmic
microtubules no gross spindle abnormalities were observed in mal3
cells although again spindle staining was
reduced. (Fig. 5 k, arrowhead). However we observed a
fourfold increase in the number of cells showing condensed chromosomes in comparison to an isogenic wild-type strain indicating defects in some aspects of mitosis.
Fig. 5.
Antitubulin immunofluorescence images of
mal3
cells cultured at 20°C.
a, b, d, f, h, i, and k show antitubulin staining while c, e, g,
j, and l show DAPI and
phase contrast images. a and
b represent two different focal planes of three mal3
cells showing several short
microtubules around the location of the nucleus shown
in c. (d) Strong post-anaphase-array staining in
the upper, bent cell. (f) Displaced post-anaphase-array.
h-i show antitubulin immunofluorescence images of two
mal3+ cells grown at 20°C at
different focal planes, while j
shows DAPI staining. k and l
show a mixed culture of
mal3
and elongated cdc25-22 cells. k shows antitubulin
while l shows DAPI staining. cdc25-22 cells were grown at
25°C in YE5S to early log
phase, shifted to the restrictive temperature for 210 min,
returned to 20°C in 30 s by
immersion in an ice bath and
mixed at a ratio of 1:4 with
the mal3
culture grown at
20°C inYE5S. k shows four mal3
cells and an elongated
cdc25-22 cell. The abnormally faint spindle in the
mal3
cell is indicated by an
arrow head in k. The small
arrow in l indicates a mal3
cell with a misplaced nucleus. Bars, 5 µm.
[View Larger Version of this Image (142K GIF file)]
; Hagan and Yanagida, 1997
) mal3
cells frequently
show displaced nuclei (Fig. 5 l, small arrow). At 20°C 18%
of mal3
cells had off center premitotic nuclei (Fig. 4 A).
Interestingly we also observed displaced post-anaphase-arrays (Fig. 5 f). Intriguingly the post-anaphase-arrays were the most strongly staining structures in mal3
cells
observed by antitubulin immunofluorescence possibly indicating that these microtubules have a different composition
or properties to other cytoplasmic microtubules (Fig. 5 d).
cells had a septum not positioned in
the central fifth of a cell at 20°C (Fig. 4 A).
strain, i.e., aberrant cell morphologies and displaced interphase nuclei
(Figs. 4 B and 6 B). The proportion of cells with altered cell shapes correlated directly with the duration of mal3+
overexpression; the most drastic phenotypes were observed
after 21 h or more (Figs. 4 B and 6 C, b).
Fig. 6.
Phenotypic characterization of overexpression of Mal3
and EB-1 proteins. (A) Serial dilution patch test for inhibition of colony formation by overproduction of Mal3 and EB-1. Dilutions shown were tenfold. A mal3+ strain was transformed with either
the insert-less vector (a) or plasmids expressing mal3+ (b) or EB-1
(c) from the nmt1+ promoter. Strains were grown for 18 h at 30°C
in thiamineless medium and then plated on EMM medium with
(+) or without thiamine (
).The growth inhibition phenotype of
Mal3 overexpression was suppressed by 10 µg/ml TBZ (d) or the
presence of the
- and
-tubulin mutants, nda2-KM52 and nda3-KM311, respectively (e and f). Colonies were photographed after
incubation for 3 d at 30 or 29°C (mutant tubulin strains). (B) Photomicrographs of colonies of wild-type cells transformed with
vector control (v), or plasmids expressing mal3+ or EB-1. Strains
were pregrown as in A before streaking cells on thiamineless
plates and incubating them for 1.5 d at 30°C. (C) mal3+ was overexpressed in a wild-type strain for 0 (a, c, and e), 19 (f), 21 (b), or
24 (d) h at 30°C. c and d show staining of septa by calcofluor.
Septa in e and f are indicated by arrowheads. Bar, 5 µm.
[View Larger Version of this Image (87K GIF file)]
strain led to
moderate or no inhibition of colony formation, respectively (data not shown).
Fig. 7.
Overexpression of mal3+ results in defects in form and function of the
mitotic spindle. Wild-type cells overexpressing mal3+ were grown at 32°C for 21 h
in inducing conditions. Each panel shows
three different images of the same cells: in
the first, containing the lettering, the relative location of the chromatin and the cell
outline is shown by combining DAPI fluorescence and phase contrast images; in the
second the microtubules (red) and the
SPBs (green) are shown; the third panel
shows the position of the SPBs (red) relative to the chromatin (green). a shows
three strongly staining spindles of roughly
equal length. The chromosomes are highly
condensed and randomly positioned along
the spindle axis. In each case bars of tubulin staining emanate from the SPB away
from the main body of the spindle. b, d,
and g show examples of cells where the
two half spindles appear to be losing their interdigitation presumably leading to the
complete loss of interdigitation seen in g.
In b the smaller chromosome III has wandered from the spindle axis, indicating
that the microtubules are not contacting the kinetochores. e shows a bent interphase cell which has not separated from its
partner during the previous cytokinesis. c and f show examples of defects during the
early stages of spindle formation. Bar, 5 µm.
[View Larger Version of this Image (49K GIF file)]
). We interpret the significant number of cells which
showed two separate V-shaped structures in one cell as being those in which the two halves of the mitotic spindle no
longer interdigitate and yet the microtubules are stable
and do not depolymerize.
strain suggested that Mal3 might somehow influence microtubule stability. As excess Mal3 led to defective spindles and mitotic microtubules have shorter half-lives than their interphase counterparts (Salmon et al.,
1984
; Saxton et al., 1984
) these data also support a possible
role for Mal3 in stabilizing microtubules. If Mal3 does indeed play a role in stabilizing microtubules then destabilizing microtubules by some means would be expected to alleviate the severity of the phenotypes observed upon Mal3
overexpression. We tested this idea by destabilizing microtubules in two ways and assaying colony forming potential:
first, wild-type cells overexpressing Mal3 were grown in the
presence of TBZ and secondly by overproducing Mal3 in
strains carrying the cold-sensitive mutant
1- and
-tubulin alleles, nda2-KM52 and nda3-KM-311, respectively (Umesono et al., 1983
). The inhibition of colony formation
of wild-type cells expressing Mal3 at high levels was partially suppressed by growth on medium containing 10 µg/ml
TBZ (Fig. 6 A, d) and was also rescued by the presence of
either mutant tubulin allele (Fig. 6 A, e-f). The experiment
was carried out at 29°C, which while being permissive for
both mutant tubulin strains does result in 10-20% of cells
having abnormal bent cell shapes (Umesono et al., 1983
),
indicating that the tubulin alleles do not impart a fully wild-type function. We tested three different transformants expressing extra Mal3 per strain and consistently found that
while the presence of the nda3-KM311 allele almost totally suppressed the inhibition of colony formation conferred by mal3+ overexpression, the nda2-KM52 allele was
only partially able to do so.
Discussion
). Recently it has
been demonstrated that the genetic instability that forms
an integral part of colorectal tumors can be caused by severe defects in chromosome segregation (Lengauer et al.,
1997
). In this context it is intriguing that we have identified
the mal3+ gene product, whose loss can be rescued by human EB-1, in a screen for components influencing chromosome transmission fidelity in fission yeast.
). These data strongly indicate that Mal3 interacts with microtubules although we do not
yet know if the interaction is a direct one.
cells
showed altered microtubule structures. Instead of the typical wild-type cytoplasmic microtubule network that extends between the cell tips (Hagan and Hyams, 1988
; Fig.
5, h and i) the interphase microtubules of the mal3
strain
were extremely short, never reached the cell tips and were
closely associated with the nucleus (Fig. 5, a and b). Regrowth of microtubules after depolymerization by incubation at low temperatures shows microtubule regrowth occurs predominantly around the nucleus (cited in Verde et al.,
1995
; Hagan, I.M., unpublished observations). The often
fainter staining of microtubules in the mal3+ deletion strain
indicates either poor fixation or fewer microtubules as opposed to the bundles of three microtubules observed in
wild-type S. pombe cells (Streiblova and Girbardt, 1980
;
Tanaka and Kanbe, 1986
).
cells with the only visible defect being weaker staining intensity (Fig. 5, k). However a mal3
cell population
showed a significantly increased chromosome condensation index indicating a delay during mitosis suggesting that
the weaker staining reflects a compromised function. This
finding is complemented by the observation that deletion
of the mal3+ homologue in S. cerevisiae leads to an accumulation of cells with a 2C DNA content (Fleig, U., S. Heck,
and J.H. Hegemann, unpublished observation).
; Desai and Mitchison, 1995
; Hyman and
Karsenti, 1996
). Mitotic microtubules have shorter half-lives than interphase microtubules and microtubule turnover plays an important part in the assembly of the mitotic
spindle (reviewed in Hyman and Karsenti, 1996
). In addition proteins that increase the catastrophe rate of microtubules are required for correct mitotic spindle assembly
(Belmont and Mitchison, 1996
; Walczak et al., 1996
). We
speculate that overexpression of Mal3 might hyperstabilize microtubules and thus upset the fine-tuned balance of
microtubule dynamics required for mitosis. In this context it is interesting that the mal3+ overexpression phenotype
of severe growth inhibition was rescued partially by growth
on TBZ-containing medium or in the presence of mutant
tubulin alleles (Fig. 6 A, d-f). Rescue of a number of phenotypes caused by the absence of the microtubule-destabilizing mitotic motor protein Kar3p has also been observed
in the presence of microtubule-destabilizing drugs or a reduction in tubulin gene dosage (Saunders et al., 1997
).
cells was often displaced
from the center of the cells (Fig. 4 A), thus reinforcing the
role played by the microtubule cytoskeleton and associated motor proteins in the positioning of the nucleus (for
example Oakley and Morris, 1980
; Jacobs et al., 1988
; Hagan
and Yanagida, 1997
). In S. pombe, mutations in tubulin
genes or the presence of microtubule-destabilizing chemicals can lead to a displacement of the nucleus (Walker, 1982
; Umesono et al., 1983
; Hiraoka et al., 1984
; Verde et al., 1995
).
; Sohrmann et al., 1996
). A possible connection between the actin and microtubule cytoskeleton has been demonstrated in S. pombe by the existence of the benomyl-resistant ben4
mutant, which displays an altered actin cytoskeleton and is
rendered lethal by the presence of an extra actin gene in
the genome (Fantes, 1989
). In this context the existence of
an equatorial tubulin ring present in anaphase after the
formation of the actin contractile ring is particularly interesting and led to the suggestion that this microtubule ring
also plays a role in the determination of the division plane
(Pichova et al., 1995
). Similarly rings have also been observed with the in vivo localization of the S. pombe microtubule-associating protein Dis1 (Nabeshima et al., 1995
) and our Mal3-yEGFP.
strain and in cells overexpressing mal3+ indicating a possible role for Mal3 in the
control of directed cell growth. The altered cell shape is
most likely a consequence of the defective microtubule
cytoskeleton of the mal3
strain as disruption or alteration of the microtubule cytoskeleton by mutation of the
tubulin genes or by treatment with microtubule-destabilizing chemicals also leads to misshaped cells (Walker, 1982
;
Umesono et al., 1983
; Hiraoka et al., 1984
; Verde et al.,
1995
). The molecular basis for the importance of the microtubular cytoskeleton in the spatial organization of fission yeast has begun to emerge with the characterization
of the tea1+ gene product, whose localization at the cell
poles is dependent upon an intact cytoplasmic microtubule
cytoskeleton and which is required to maintain antipodal
growth (Mata and Nurse, 1997
).
; Nakaseko et al., 1996
). The most likely explanation for these phenotypes is that the overproduction of a
MAP occupies so many binding sites on the microtubule
surface that it either directly competes out or sterically blocks
the binding of other MAPs and motors. Thus the microtubules appear normal but are nonfunctional.
; reviewed in Pfeifer, 1996
).
Although mutations in APC lead to an accumulation of
enterocytes close to the crypt-villus transition in the intestine (reviewed in Polakis, 1995
), overexpression of wild-type APC protein results in disordered cell migration in
the intestinal epithelium of chimeric mice (Wong et al.,
1996
). In the presence of an intact microtubule cytoskeleton, endogenous APC protein in epithelial cells is concentrated in puncta near the end of microtubules that protrude into actively migrating membrane structures (Näthke
et al., 1996
). As the APC protein can promote assembly
and bundling of microtubules in vitro (Munemitsu et al.,
1994
), one of its functions might be the recruitment of microtubules to protruding membrane structures thereby stabilizing/determining the direction of cell migration (Näthke
et al., 1996
). The important role of microtubule dynamics
in guiding directed movement of, for example, the motile
portion of the axon terminal, the growth cone, has been
well documented (Sabry et al., 1991
; Tanaka and Kirschner, 1995
).
; Smith et al., 1994
; Su et al., 1995
). As human EB-1
and fission yeast Mal3 appear to have similar functions
and our data indicate that Mal3 is a microtubule-interacting protein involved in microtubule integrity, we suggest
that APC might exert the recruitment of microtubules to
actively migrating membranes via EB-1 protein. Whether
EB-1 is normally distributed all over microtubules (as is
the case for Mal3) and APC only interacts with a sub-population, or whether EB-1 is always complexed with APC
and microtubule ends awaits further analysis. Indeed interaction with APC might be only one of multiple functions executed by EB-1.
Received for publication 30 June 1997 and in revised form 27 August 1997.
Please address all correspondence to Dr. Ursula Fleig, Institut für Mikrobiologie und Molekularbiologie, Frankfurterstrasse 107, 35392 Giessen, Germany. Tel.: +49 641 99 35544. Fax: +49 641 99 35549. E-mail: ursula. fleig{at}bio.uni-giessen.deWe thank K. Gould for the his3-D1 strains and pAF1; O. Niwa and M. Yanagida for strain HM438; K. Gull for the TAT1 antibody; A. Carr for the genomic DNA library; G. Schlauderer, M. Sen-Gupta, and T. Fiedler for help with the sequence analysis; B. McCormack for yEGFP; A. Fischer-Heuschkel for Mal3-yEGFP; and C. Reitz for photographic artwork. U. Fleig and J.H. Hegemann are grateful to E. Fleig for his continuous support.
This work was supported by the Cancer Research Campaign (CRC) and the Wellcome Trust equipment grant (to Manchester University, School of Biological Sciences) to I.M. Hagan, and the Deutsche Forschungsgemeinschaft (SFB 272, TP A1) and the European Union Programme BIOTECH II to J.H. Hegemann.
APC, adenomatous polyposis coli; FAP, familial adenomatous polyposis; GFP, green fluorescent protein; ORF, open reading frame; MAP, microtubule-associating protein; TBZ, thiabendazole.
| 1. | Barbet, N., W.J. Muriel, and A.M. Carr. 1992. Versatile shuttle vectors and genomic libraries for use with Schizosaccharomyces pombe. Gene (Amst.). 114: 59-66 [Medline]. |
| 2. | Boguski, M.S., T.M.J. Lowe, and C.M. Tolstoshev. 1993. dbEST-database for "Expressed Sequence Tags." Nat. Genet. 4: 332-333 [Medline]. |
| 3. | Belmont, L.D., and T.J. Mitchison. 1996. Identification of a protein that interacts with tubulin dimers and increases the catastrophe rate of microtubules. Cell. 84: 623-631 [Medline]. |
| 4. | Chang, F., A. Wollard, and P. Nurse. 1996. Isolation and characterization of fission yeast mutants defective in the assembly and placement of the contractile ring. J. Cell. Sci. 109: 132-142 . |
| 5. |
Cormack, B.P.,
G. Bertram,
M. Egerton,
N.A. Gow,
S. Falkow, and
A.J. Brown.
1997.
Yeast-enhanced green fluorescent protein (yEGFP) a reporter of gene
expression in Candida albicans.
Microbiology.
143:
303-311
|
| 6. |
Desai, A., and
T.J. Mitchison.
1995.
A new role for motor proteins as couplers
to depolymerizing microtubules.
J. Cell Biol.
128:
1-4
|
| 7. | Dietrich, F.S., J. Mulligan, K. Hennessy, M.A. Yelton, E. Allen, R. Araujo, E. Aviles, A. Berno, T. Brennan, J. Carpenter et al. 1997. The nucleotide sequence of Saccharomyces cerevisiae chromosome V. Nature (Lond.). 387(suppl):78-81. |
| 8. |
Ding, R.,
K.L. McDonald, and
J.R. McIntosh.
1993.
Three-dimensional reconstruction and analysis of mitotic spindles from the yeast, Schizosaccharomyces pombe.
J. Cell Biol.
120:
141-151
|
| 9. | Fantes, P.A. 1989. Molecular biology of the fission yeast. Academic Press, San Diego. 127-182. |
| 10. | Fleig, U.N., and P. Nurse. 1991. Expression of a dominant negative allele of cdc2 prevents activation of the endogenous p34cdc2 kinase. Mol. Gen. Genet. 226: 432-440 [Medline]. |
| 11. | Fleig, U., M. Sen-Gupta, and J.H. Hegemann. 1996. Fission yeast mal2+ is required for chromosome segregation. Mol. Cell Biol. 16: 6169-6177 [Abstract]. |
| 12. | Groden, J., A. Thliveris, W. Samowitz, M. Carlson, L. Gelbert, H. Albertsen, G. Joslyn, J. Stevens, L. Spirio, M. Robertson, et al . 1991. Identification and characterization of the familial adenomatous polyposis coli gene. Cell. 66: 589-600 [Medline]. |
| 13. |
Hagan, I.M., and
J.S. Hyams.
1988.
The use of cell division cycle mutants to investigate the control of microtubule distribution in the fission yeast Schizosaccharomyces pombe.
J. Cell Sci.
89:
343-357
|
| 14. |
Hagan, I., and
M. Yanagida.
1995.
The product of the spindle formation gene
sad1+ associates with the fission yeast spindle pole body and is essential for
viability.
J. Cell Biol.
129:
1033-1047
|
| 15. | Hagan, I., and M. Yanagida. 1997. Evidence for cell cycle-specific, spindle pole body mediated nuclear positioning in the fission yeast Schizosaccharomyces pombe. J. Cell Sci. 110: 1851-1866 [Abstract]. |
| 16. | Hartwell, L.. 1992. Defects in a cell cycle checkpoint may be responsible for the genomic instability of cancer cells. Cell. 71: 543-546 [Medline]. |
| 17. |
Hiraoka, Y.,
T. Toda, and
M. Yanagida.
1984.
The nda3 gene of fission yeast
encodes -tubulin: a cold sensitive nda3 mutation reversibly blocks spindle
formation and chromosome movement in mitosis.
Cell.
39:
349-358
[Medline].
|
| 18. | Hirokawa, N.. 1994. Mikrotubule organization and dynamics dependent on microtubule-associated proteins. Curr. Opin. Cell Biol. 6: 74-81 [Medline]. |
| 19. | Hoyt, M.A., and J.R. Geiser. 1996. Genetic analysis of the mitotic spindle. Annu. Rev. Genet. 30: 7-33 [Medline]. |
| 20. | Hyman, A.A., and E. Karsenti. 1996. Morphogenetic properties of microtubules and mitotic spindle assembly. Cell. 84: 401-410 [Medline]. |
| 21. |
Jacobs, C.W.,
A.E.M. Adams,
P.J. Szaniszlo, and
J.R. Pringle.
1988.
Functions
of microtubles in the Saccharomyces cerevisiae cell cycle.
J. Cell Biol.
107:
1409-1426
|
| 22. | Javerzat, J.-P., G. Cranston, and R.C. Allshire. 1996. Fission yeast genes which disrupt mitotic chromosome segregation when overexpressed. Nucleic Acids Res. 24: 4674-4683 . |
| 23. | Kemler, R.. 1993. From cadherins to catenins: cytoplasmic protein interactions and regulation of the cell adhesion. Trends Genet. 9: 317-321 [Medline]. |
| 24. | Kinzler, K.W., and B. Vogelstein. 1996. Lessons from hereditary colorectal cancer. Cell. 87: 159-170 [Medline]. |
| 25. | Lange, B.H., T. Sherwin, I.M. Hagan, and K. Gull. 1995. The basics of immunofluorescence video-microscopy for mammalian cells and microbial systems. Trends in Cell Biol. 5: 328-332 . [Medline] |
| 26. | Lengauer, C., K.W. Kinzler, and B. Vogelstein. 1997. Genetic instability in colorectal cancers. Nature (Lond.). 386: 623-627 [Medline]. |
| 27. | Marks, J., I.M. Hagan, and J.S. Hyams. 1986. Growth polarity and cytokinesis in fission yeast: the role of the cytoskeleton. J. Cell. Sci.(Suppl.). 5: 229-241 [Medline]. |
| 28. | Mata, J., and P. Nurse. 1997. tea1 and the microtubular cytoskeleton are important for generating global spatial order within the fission yeast cell. Cell. 89: 939-949 [Medline]. |
| 29. | Matsumine, A., A. Ogai, T. Senda, N. Okumura, K. Satho, G.-H. Baeg, T. Kawahara, S. Kobayashi, M. Okada, K. Toyoshima, and T. Akiyama. 1996. Binding of APC to the human homolog of the drosophila discs large tumor suppressor protein. Science (Wash. DC). 272: 1020-1023 [Abstract]. |
| 30. | Maundrell, K.G.. 1993. Thiamine repressible expression vectors pREP and pRIP for fission yeast. Gene (Amst.). 123: 127-130 [Medline]. |
| 31. | Moreno, S., A. Klar, and P. Nurse. 1991. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194: 795-823 [Medline]. |
| 32. |
Munemitsu, S.,
B. Souza,
O. Müller,
I. Albert,
B. Rubinfeld, and
P. Polakis.
1994.
The APC gene product associates with microtubules in vivo and promotes their assembly in vitro.
Cancer Res.
54:
3676-3681
|
| 33. |
Nabeshima, K.,
H. Kurooka,
M. Takeuchi,
K. Kinoshita,
Y. Nakaseko, and
M. Yanagida.
1995.
p93dis1, which is required for sister chromatid separation, is a
novel microtubule and spindle pole body-associating protein phosphorylated
at the Cdc2 target sites.
Genes Dev.
9:
1572-1585
|
| 34. | Nakaseko, Y., K. Nabeshima, K. Kinoshita, and M. Yanagida. 1996. Dissection of fission yeast microtubule associating protein p93Dis1: regions implicated in regulated localization and microtubule interaction. Genes to Cells. 1: 633-644 . [Abstract] |
| 35. |
Näthke, I.S.,
C.L. Adams,
P. Polakis,
J.H. Sellin, and
W.J. Nelson.
1996.
The adenomatous polyposis coli tumour suppressor protein localizes to plasma
membrane sites involved in active cell migration.
J. Cell Biol.
134:
165-197
|
| 36. |
Nishisho, I.,
Y. Nakamura,
Y. Miyoshi,
Y. Miki,
H. Ando,
A. Horii,
K. Koyama,
J. Utsonomiya,
S. Baba, and
P. Hedge.
1991.
Mutation of chromosome
5q21genes in FAP and colorectal cancer patients.
Science (Wash. DC).
253:
665-669
|
| 37. | Niwa, O., T. Matsumoto, and M. Yanagida. 1986. Construction of a mini-chromosome by deletion and its mitotic and meiotic behaviour in fission yeast. Mol. Gen. Genet. 203: 397-405 . |
| 38. |
Oakley, B.R., and
N.R. Morris.
1980.
Nuclear movement is -tubulin dependent in Aspergillus nidulans.
Cell.
19:
255-262
[Medline].
|
| 39. | Ohi, R., A. Feoktistova, and K.L. Gould. 1996. Construction of vectors and a genomic library for use with his3-deficient strains of Schizosaccharomyces pombe. Gene (Amst.). 174: 315-318 [Medline]. |
| 40. | Pfeifer, M.. 1996. Regulating cell proliferation: as easy as APC. Science (Wash. DC). 272: 974-975 [Medline]. |
| 41. | Pichova, A., S.D. Kohlwein, and M. Yamamoto. 1995. New arrays of cytoplasmic microtubules in the fission yeast Schizosaccharomyces pombe. Protoplasma. 188: 252-257 . |
| 42. | Polakis, P.. 1995. Mutations in the APC gene and their implications for protein structure and function. Curr. Opin. Genet. Dev. 5: 66-71 [Medline]. |
| 43. |
Sabry, J.H.,
T.P. O'Connor,
L. Evans,
A. Toroian-Raymond,
M. Kirschner, and
D. Bentley.
1991.
Microtubule behavior during guidance of pioneer neuron
growth cones in sito.
J. Cell Biol.
115:
381-395
|
| 44. |
Salmon, E.D.,
R.J. Leslie,
W.M. Karow,
J.R. McIntosh, and
W.M. Saxton.
1984.
Spindle microtubule dynamics in sea urchin embryos: analysis using fluoresence-labeled tubulin and measurements of fluoresence distribution after
photobleaching.
J. Cell Biol.
99:
2165-2186
|
| 45. |
Saunders, W.,
D. Hornack,
V. Lengyel, and
C. Deng.
1997.
Kar3p acts at preanaphase spindle poles to limit the number and length of cytoplasmic microtubules.
J. Cell Biol.
137:
417-431
|
| 46. |
Saxton, W.M.,
D.L. Stemple,
R.J. Leslie,
E.D. Salmon,
M. Zavortink, and
J.R. McIntosh.
1984.
Tubulin dynamics in cultured mammalian cells.
J. Cell Biol.
99:
2175-2186
|
| 47. |
Sohrmann, M.,
C. Frankhauser,
C. Brodbeck, and
V. Simanis.
1996.
The dmf1/
mid1 gene is essential for correct positioning of the division septum in fission
yeast.
Genes Dev.
10:
2707-2719
|
| 48. | Smith, K.J., D.B. Levy, P. Maupin, T.D. Pollard, B. Vogelstein, and K.W. Kinzler. 1994. Wild-type but not mutant APC associates with the microtubule cytoskeleton. Cancer Res. 54: 3627-3675 . |
| 49. | Streiblova, E., and M. Girbardt. 1980. Microfilaments and microtubules in cell division cycle mutants of Schizosaccharomyces pombe. Can. J. Microbiol. 26: 250-261 [Medline]. |
| 50. |
Su, L.-K.,
M. Burrell,
D.E. Hill,
J. Gyuris,
R. Brent,
R. Wiltshire,
J. Trent,
B. Vogelstein, and
K.W. Kinzler.
1995.
APC binds to the novel protein EB-1.
Cancer Res.
55:
2972-2977
|
| 51. |
Tanaka, E., and
M.W. Kirschner.
1995.
The role of microtubule dynamics in
growth cone motility and axonal growth.
J. Cell Biol.
128:
139-155
|
| 52. | Tanaka, K., and T. Kanbe. 1986. Mitosis in the fission yeast Schizosaccharomyces pombe as revealed by freeze-substitution electron microscopy. J. Cell Sci. 80: 253-268 [Abstract]. |
| 53. |
Thompson, J.D.,
D.G. Higgins, and
T.J. Gibson.
1994.
CLUSTAL W: improving
the sensitivity of progressive multiple sequence alignment through sequence
weighting, position-specific gap penalties and weight matrix choice.
Nucleic
Acids Res.
22:
4673-4680
|
| 54. |
Toda, T.,
Y. Adachi,
Y. Hiraoka, and
M. Yanagida.
1984.
Identification of the
pleiotropic cell division gene NDA2 as one of the two different -tubulin
genes in Schizosaccharomyces pombe.
Cell.
37:
233-242
[Medline].
|
| 55. | Umesono, K., T. Toda, S. Hayashi, and M. Yanagida. 1983. Two cell division cycle genes NDA2 and NDA3 of the fission yeast Schizosaccharomyces pombe control microtubular organization and sensitivity to anti-mitotic benzimidazole compounds. J. Mol. Biol. 168: 271-284 [Medline]. |
| 56. |
Verde, F.,
J. Mata, and
P. Nurse.
1995.
Fission yeast cell morphogenesis: identification of new genes and analysis of their role during the cell cycle.
J. Cell
Biol.
131:
1529-1538
|
| 57. | Walker, G.M.. 1982. Cell cycle specificity of certain anti-microtubular drugs in Schizosaccharomyces pombe. J. Gen. Micro. 128: 61-71 . |
| 58. | Walczak, C.E., T.J. Mitchison, and A. Desai. 1996. XKCM1: a Xenopus kinesin-related protein that regulates microtubule dynamics during mitotic spindle assembly. Cell. 84: 37-47 [Medline]. |
| 59. | Walczak, C.E., and T.J. Mitchison. 1996. Kinesin-related proteins at mitotic spindle poles. Function and regulation. Cell. 85: 943-946 [Medline]. |
| 60. |
Wong, M.H.,
M.L. Hermiston,
A.J. Syder, and
J.I. Gordon.
1996.
Forced expression of the tumour suppressor adenomatosis polyposis protein induces
disordered cell migration in the intestinal epithelium.
Proc. Natl. Acad. Sci.
USA.
93:
9588-9593
|
| 61. |
Woods, A.,
T. Sherwin,
R. Sassa,
T.H. MacRae,
A.J. Baines, and
K. Gull.
1989.
Definition of individual components within the cytoskeleton of Trypanosoma brucei by a library of monoclonal anitbodies.
J. Cell Sci.
93:
491-500
|
| 62. | Yanagida, M.. 1995. Frontier questions about sister chromatid separation in anaphase. Bioessays. 17: 519-526 [Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|