|
||
§
§
* Department of Pathology;
Department of Dermatology; and § the Robert H. Lurie Cancer Center, Northwestern University
Medical School, Chicago, Illinois 60611
The desmosome is a highly organized plasma membrane domain that couples intermediate filaments to the plasma membrane at regions of cell-cell adhesion. Desmosomes contain two classes of cadherins, desmogleins, and desmocollins, that bind to the cytoplasmic protein plakoglobin. Desmoplakin is a desmosomal component that plays a critical role in linking intermediate filament networks to the desmosomal plaque, and the amino-terminal domain of desmoplakin targets desmoplakin to the desmosome. However, the desmosomal protein(s) that bind the amino-terminal domain of desmoplakin have not been identified. To determine if the desmosomal cadherins and plakoglobin interact with the amino-terminal domain of desmoplakin, these proteins were co-expressed in L-cell fibroblasts, cells that do not normally express desmosomal components. When expressed in L-cells, the desmosomal cadherins and plakoglobin exhibited a diffuse distribution. However, in the presence of an amino-terminal desmoplakin polypeptide (DP-NTP), the desmosomal cadherins and plakoglobin were observed in punctate clusters that also contained DP-NTP. In addition, plakoglobin and DP-NTP were recruited to cell-cell interfaces in L-cells co-expressing a chimeric cadherin with the E-cadherin extracellular domain and the desmoglein-1 cytoplasmic domain, and these cells formed structures that were ultrastructurally similar to the outer plaque of the desmosome. In transient expression experiments in COS cells, the recruitment of DP-NTP to cell borders by the chimera required co-expression of plakoglobin. Plakoglobin and DP-NTP co-immunoprecipitated when extracted from L-cells, and yeast two hybrid analysis indicated that DP-NTP binds directly to plakoglobin but not Dsg1. These results identify a role for desmoplakin in organizing the desmosomal cadherin-plakoglobin complex and provide new insights into the hierarchy of protein interactions that occur in the desmosomal plaque.
DESMOSOMES are highly organized adhesive intercellular junctions that couple intermediate filaments
to the cell surface at sites of cell-cell adhesion
(Farquhar and Palade, 1963 Molecular genetic analysis has revealed that the desmosomal glycoproteins, the desmogleins and desmocollins,
are members of the cadherin family of cell-cell adhesion
molecules (for review see Buxton et al., 1993 The most abundant desmosomal plaque protein is desmoplakin, which is predicted to be a homodimer containing two globular end domains joined by a central The classical cadherins, such as E-cadherin, bind directly
to both In previous studies, we used L-cell fibroblasts to characterize plakoglobin interactions with the cytoplasmic domains of the desmosomal cadherins and found that the
desmosomal cadherins regulate plakoglobin metabolic stability (Kowalczyk et al., 1994 Cell Culture
L-cells were cultured in Dulbecco's minimal essential medium (DMEM),
10% fetal bovine serum, and penicillin/streptomycin. To establish cell
lines, cells were transfected with various cDNA constructs by calcium
phosphate precipitation as described previously (Kowalczyk et al., 1994 cDNA Constructs
Cadherins and Chimeric Cadherins.
cDNA constructs encoding full length
human desmoglein-1 (Dsg1) and desmocollin-2a (Dsc2a) were generated
as described previously (Kowalczyk et al., 1994
Plakoglobin and Plakoglobin Deletion Mutants.
A full length plakoglobin cDNA was isolated and subcloned into the mammalian expression vector LK-444. A deletion of plakoglobin lacking the amino-terminal domain
(Pg
; Staehelin, 1974
; Schwarz et al.,
1990
; Garrod, 1993
; Collins and Garrod, 1994
; Cowin and
Burke, 1996
; Kowalczyk and Green, 1996
). Desmosomes are prominent in tissues that experience mechanical stress,
such as heart and epidermis, and the disruption of desmosomes or the intermediate filament system in these organs
has devastating effects on tissue integrity (Steinert and
Bale, 1993
; Coulombe and Fuchs, 1994
; Fuchs, 1994
;
McLean and Lane, 1995
; Stanley, 1995
; Bierkamp et al.,
1996
; Ruiz et al., 1996
). Desmosomes are highly insoluble structures that can withstand harsh denaturing conditions
(Skerrow and Matoltsy, 1974
; Gorbsky and Steinberg, 1981
;
Jones et al., 1988
; Schwarz et al., 1990
). This property of
desmosomes facilitated early identification of desmosomal
components but has impaired subsequent biochemical
analysis of the protein complexes that form between desmosomal components. Ultrastructurally, desmosomes contain a core region that includes the plasma membranes of
adjacent cells and a cytoplasmic plaque that anchors intermediate filaments to the plasma membrane. The plaque
can be further divided into an outer dense plaque subjacent to the plasma membrane and an inner dense plaque
through which intermediate filaments appear to loop.
, 1994; Cowin
and Mechanic, 1994
; Kowalczyk et al., 1996
). The classical
cadherins, such as E-cadherin, mediate calcium-dependent,
homophilic cell-cell adhesion (Nagafuchi et al., 1987
). The
mechanism by which the desmosomal cadherins mediate cell-cell adhesion remains elusive (Amagai et al., 1994
; Chidgey et al., 1996
; Kowalczyk et al., 1996
), although heterophilic interactions have recently been detected between
desmogleins and desmocollins (Chitaev and Troyanovsky,
1997
). Both classes of the desmosomal cadherins associate
with the cytoplasmic plaque protein plakoglobin (Kowalczyk et al., 1994
; Mathur et al., 1994
; Roh and Stanley, 1995b
; Troyanovsky et al., 1994
), which is part of a growing family of proteins that share a repeated motif first
identified in the Drosophila protein Armadillo (Peifer and
Wieschaus, 1990
). This multigene family also includes the
desmosomal proteins band 6/plakophilin 1, plakophilin 2a
and 2b, and p0071, which are now considered to comprise
a subclass of the armadillo family of proteins (Hatzfeld et
al., 1994
; Heid et al., 1994
; Schmidt et al., 1994
; Hatzfeld and Nachtsheim, 1996
; Mertens et al., 1996
).
-helical
coiled-coil rod domain (O'Keefe et al., 1989
; Green et al.,
1990
; Virata et al., 1992
). Previous studies have demonstrated that the carboxyl-terminal domain of desmoplakin
interacts with intermediate filaments (Stappenbeck and
Green, 1992
; Stappenbeck et al., 1993
; Kouklis et al., 1994
; Meng et al., 1997
), and the amino-terminal domain of desmoplakin is required for desmoplakin localization to the
desmosomal plaque (Stappenbeck et al., 1993
). Direct evidence supporting a role for desmoplakin in intermediate
filament attachment to desmosomes was provided recently
when expression of an amino-terminal polypeptide of desmoplakin was found to displace endogenous desmoplakin
from cell borders and disrupt intermediate filament attachment to the cell surface in A431 epithelial cell lines
(Bornslaeger et al., 1996
).
-catenin and plakoglobin (Aberle et al., 1994
;
Jou et al., 1995
; for review see Cowin and Burke, 1996
).
-Catenin is also an armadillo family member (McCrea et al.,
1991
; Peifer et al., 1992
), and both plakoglobin and
-catenin bind directly to
-catenin (Aberle et al., 1994
, 1996
; Jou
et al., 1995
; Sacco et al., 1995
; Obama and Ozawa, 1997
).
-Catenin is a vinculin homologue (Nagafuchi et al., 1991
)
and associates with both
-actinin and actin (Knudson et al.,
1995
; Rimm et al., 1995
; Nieset et al., 1997
). Through interactions with
- and
-catenin, E-cadherin is coupled indirectly to the actin cytoskeleton, and this linkage is required
for the adhesive activity of E-cadherin (Ozawa et al., 1990
;
Shimoyama et al., 1992
). In addition, E-cadherin association with plakoglobin appears to be required for assembly
of desmosomes (Lewis et al., 1997
), underscoring the importance of E-cadherin in the overall program of intercellular junction assembly. However, the hierarchy of molecular interactions that couple the desmosomal cadherins to
the intermediate filament cytoskeleton is largely unknown,
although the desmocollin cytoplasmic domain appears to play an important role in recruiting components of the
desmosomal plaque (Troyanovsky et al., 1993
, 1994
).
Since desmosomal cadherins form complexes with plakoglobin and because the amino-terminal domain of desmoplakin is required for desmoplakin localization at desmosomes, we hypothesized that the amino-terminal domain of desmoplakin interacts with the desmosomal cadherin-
plakoglobin complex.
) but do not mediate homophilic adhesion (Kowalczyk et al., 1996
). To test the ability
of the desmoplakin amino-terminal domain to interact with
the desmosomal cadherin-plakoglobin complex, we established a series of L-cell lines expressing the desmosomal
cadherins in the presence or absence of a desmoplakin
amino-terminal polypeptide (DP-NTP).1 The results indicate that one important function of the desmoplakin amino-terminal domain is to cluster desmosomal cadherin-plakoglobin complexes. In addition, DP-NTP and plakoglobin
were found to form complexes that could be co-immunoprecipitated from L-cell lysates. Using the yeast two hybrid system, DP-NTP was found to bind directly to plakoglobin but not Dsg1. These data suggest that plakoglobin couples the amino-terminal domain of desmoplakin to the
desmosomal cadherins and that desmoplakin plays an important role in organizing the desmosomal cadherin-plakoglobin complex into discrete plasma membrane domains.
Materials and Methods
,
1996
). The cDNA construct encoding plakoglobin also included a neomycin resistance gene. The antibiotic G418 (GIBCO BRL, Grand Island,
NY) was used at 400 µg/ml (active concentration) to select transfected
cells. For cells that were not cotransfected with plakoglobin, a plasmid
(pSV2neo) that encoded the neomycin resistance gene, was used as the selection marker. Colonies resistant to G418 were isolated and protein expression was assessed by immunoblot and immunofluorescence. In each
case, at least three independently isolated clones expressing the proteins
of interest were used for futher characterization. For transient transfections, COS cells were cultured in DMEM, 10% fetal bovine serum, and
penicillin/streptomycin and transfected using the calcium phosphate precipitation method as described previously (Stappenbeck and Green, 1992
;
Kowalczyk et al., 1995
). Cells were assayed by immunofluorescence 48 h
after transfection. All media and serum were obtained from GIBCO BRL, and tissue culture plasticware was purchased from Becton Dickinson (Lincoln Park, NJ).
, 1996
). A chimeric cadherin comprising the extracellular domain of Dsg1 and the intracellular
domain of mouse E-cadherin (Dsg1Ecad) was constructed as described
previously (Kowalczyk et al., 1994
; see Fig. 1 for structure). A second chimera consisting of the extracellular domain of E-cadherin and the cytoplasmic domain of Dsg1 was also generated (EcadDsg1). This chimera
comprised the cDNA sequences encoding the extracellular domain of
mouse E-cadherin (nucleotides 68-2,190; Nagafuchi et al., 1987
) and the
cytoplasmic domain of human Dsg1 (nucleotides 1,585-3,072; Nilles et al.,
1991
). The fusion between E-cadherin and Dsg1 sequences occurs within
the transmembrane spanning domain and an 11-amino acid epitope tag
from c-myc was added to the carboxyl terminus of the chimera. The E-cadherin portion of the chimera was generated by PCR using the 5
E-cadherin primer LN37 (5
-TGATTTAAAGTCGACTCCACCATGGGAGCCCGGTGC-3
to generate a SalI site at the 5
end of the E-cadherin
cDNA and the 3
E-cadherin primer LN45 (5
-TATAGGTACCGCCAATCCTGCTGCCAC-3
), which generates a 3
KpnI site within sequences
encoding the central region of the membrane spanning domain. The Dsg1
cytoplasmic domain was also generated using PCR. The 5
Dsg1 primer
(LN46: 5
-ATGCGGTACCTCTCATCATGGGATTC-3
) was used to
generate a 5
Kpn I site within the sequences encoding the Dsg1 transmembrane spanning domain in frame with the Kpn I site from the 3
E-cadherin primer (LN45). A 3
Dsg1 primer (LN36 GCCAAGCTTCTACAAGTCCTCTTCAGAAATGAGCTTTTGCTCCACCTTGC T A T A T- TGCAC) was used to produce a 3
HindIII restriction site and the carboxyl-terminal c-myc epitope tag. The PCR products were subcloned into
pBluescript (Strategene, La Jolla, CA) and PCR-generated regions were
replaced with cloned DNA or sequenced to verify that errors were not introduced into the coding sequence. The KpnI sites were used to ligate the
cDNA encoding the extracellular domain of E-cadherin to the cytoplasmic domain of Dsg1. cDNAs encoding Dsg1, Dsc2a, and the Dsg1Ecad
chimeras were each subcloned into the RC4B expression vector (Evans
and Scarpulla, 1988
) for transfection into eukaryotic cells. The EcadDsg1
chimera was subcloned into the mammalian expression vector LK-444,
which uses the
-actin promoter as described previously (Kowalczyk et
al., 1994
).
Fig. 1.
Schematic representation of cDNA constructs. (A) Full
length cDNAs encoding human Dsg1 (Nilles et al., 1991
) or Dsc2a
(Parker et al., 1991
; Kowalczyk et al., 1994
) were expressed. Nomenclature for domain structure of the cadherins is adopted from
Koch et al. (1990)
. (B) Two chimeric cadherins were also constructed. The first chimera encodes the extracellular domain of
Dsg1 and the cytoplasmic domain of mouse E-cadherin (Dsg1Ecad). The inverse chimera comprises the mouse E-cadherin extracellular domain and the Dsg1 cytoplasmic domain (EcadDsg1).
(C) Plakoglobin cDNAs encoding full length human plakoglobin
or deletion mutants lacking the amino- or carboxyl-terminal domains were constructed. The hatched boxes represent the central
repeated unit domains homologous to the armadillo repeats (Peifer et al., 1994
). (D) A cDNA encoding the first 584 amino acids
of the desmoplakin amino-terminal domain (DP-NTP) was constructed as previously described (Bornslaeger et al., 1996
).
[View Larger Version of this Image (26K GIF file)]
N) was generated by PCR using primers LN123 (5
-ACGCGTCGACCCACGATGCTCAAGTCGGCCATTG-3
) and LN52 (5
-CTGCAGACCACATGCTGGCCGTGGAGCAAAAGCTCATTTCTGAAGAGG- ACTTGTAGAAGCTTGGCC-3
). The resuling PCR product of Pg
N
(nucleotides 486-2,354; Franke et al., 1989
) contains a SalI restriction site and Kozak consensus sequence at the 5
end and an 11-amino acid c-myc
epitope tag and a HindIII restriction site at the 3
end. Using the engineered restriction sites, the Pg
N PCR product was inserted into the SalI/
HindIII site in pBluescript and subcloned into the SalI/HindIII sites of the
mammalian expression vector LK-444.
C) was generated by PCR using primers LN51 (5
-ACGTGTCGACCCACGATGGAGGTGATGAACCTGA-3
) and LN120 (5
-TGTTCCGCATCTCCGAGGTGGAGCAAAAGCTCATTTCTGAAGAGGACTTGTAGAAGCTTGCGCA-3
). The
resulting PCR product of Pg
C (nucleotides 120-2,081) contains a SalI restriction site and Kozak consensus sequence at the 5
end and an 11-amino
acid c-myc epitope tag and a HindIII restriction site at the 3
end. Using
the engineered restriction sites, c-myc-tagged Pg
C was subcloned into
the SalI/HindIII site in pBluescript and then into the mammalian expression vector LK-444. For each of the plakoglobin deletion constructs, PCR-generated regions were replaced with original cDNA sequences and sequenced to verify that no errors were introduced.
Desmoplakin Amino-terminal Construct.
A cDNA construct encoding a
portion of the desmoplakin amino-terminal domain, termed DP-NTP, was
constructed and subcloned into a mammalian expression vector using the
CMV promoter (Bornslaeger et al., 1996
). As previously reported (Bornslaeger et al., 1996
), the protein product of the 2.1-kb cDNA is a 70-kD
polypeptide, ~24 kD smaller than predicted from the cDNA. DNA sequence analysis indicated the presence of a mutation that arose spontaneously in a precursor plasmid during bacterial replication, which terminates translation at amino acid number 584. Translation read through allows the
accumulation of trace amounts of a larger polypeptide (~94 kD), which is
present at levels too low to be detected by the NW161 antibody
(Bornslaeger et al., 1996
).
Immunofluorescence and Electron Microscopy
The distribution of desmosomal proteins in L-cell lines and transiently
transfected COS cells was analyzed by immunofluorescence. For most experiments, cells were rinsed in PBS and fixed in
20°C methanol. In some
experiments, cells were washed in PBS containing calcium and magnesium
(PBS+), incubated in 0.01% saponin for 5 min, rinsed gently in PBS+,
and then fixed in
20°C methanol. The following antibodies were used to
detect each protein: DP-NTP was detected using polyclonal antibody
NW161 directed against an amino-terminal desmoplakin polypeptide
(Bornslaeger et al., 1996
); Dsg1 was monitored using a human pemphigus
foliaceus antibody # 982 (Kowalczyk et al., 1995
); Dsc2a was detected using monoclonal antibody 7G6 (Kowalczyk et al., 1994
); plakoglobin was
monitored using monoclonal antibody 11E4 or a polyclonal antibody (a
gift from Dr. J. Papkoff, Megabios Corp. [Burlingame, CA]) directed against a carboxyl-terminal plakoglobin peptide (Hinck et al., 1994
; Kowalczyk et al., 1994
). The E-cadherin extracellular domain of the EcadDsg1
chimera was detected using rat monoclonal antibodies directed against the
E-cadherin extracellular domain (anti-uvomorulin antibody DECMA-1
from Sigma Chemical Co. [St. Louis, MO]) or mAb ECCD-2, a gift from
Dr. M. Takeichi, Kyoto University [Kyoto, Japan]). For electron microscopy, cells were grown to confluence on tissue culture grade plasticware
or on glass coverslips and processed for conventional electron microscopy
as described previously (Green et al., 1991
).
Immunoprecipitation and Immunoblot Analysis
Immunoprecipitation was carried out as described (Kowalczyk et al.,
1994
) with the following changes. L-cells were scraped into Tris-buffered
saline containing 0.5% Triton X-100, vortexed, and subjected to centrifugation at 14,000 g. Antibodies directed against Dsg1 (pemphigus serum
# 982), the desmoplakin amino terminus (NW161), or preimmune serum
from antibody NW161 were incubated with the cell lysate for 2 h at 4°C.
Gamma bind plus sepharose beads (Pharmacia Fine Chemicals, Piscataway, NJ) were then added for 2 h at 4°C, immune complexes were captured by centrifugation, and the beads were washed 5 times in Tris-buffered saline containing 0.5% Triton X-100 for 10 min under gentle rotation
at 4°C. Immune complexes were released by incubation in reducing SDS-PAGE sample buffer and analyzed by immunoblot using Enhanced
Chemiluminescence (Amersham Intl, Arlington Heights, IL). Plakoglobin
was detected using mAb 11E4, which is directed against the amino-terminal
domain of plakoglobin, or a rabbit polyclonal antibody directed against the carboxyl-terminal domain (Hinck et al., 1994
; Kowalczyk et al., 1994
).
Yeast Two Hybrid Constructs and Assays
Yeast two hybrid vectors encoding the GAL4 DNA binding (pAS-CYH2;
Harper et al., 1993
) or transcription activation domain (pACTII; Bai and
Elledge, 1995
) were generously provided by Dr. Stephen Elledge (Baylor
College of Medicine, Houston, TX). The amino-terminal deletion construct of human plakogobin (Pg
N) described above was subcloned from
pBluescript into the activation domain construct pACTII. The cDNA in
pBluescript was restriction digested with SalI and treated with Klenow
fragment of DNA polymerase I to create a blunt 5
end. The DNA was subsequently digested with EcoRI to remove the Pg
N insert and subcloned
into the SmaI and EcoRI sites of pACTII to generate a Pg
N cDNA,
which was inserted in frame with upstream sequences encoding the GAL4
transcription activation domain (p515). A construct comprising the cDNA
sequences encoding the entire cytoplasmic tail of human Dsg1 in the
pAS1-CYH2 DNA binding domain vector was a generous gift from Dr.
Michael Klymkowsky (University of Colorado, Boulder, CO). The cDNA
sequences encoding Dsg1 were removed from pAS1-CYH2 by digestion
with EcoRI and BamHI and subcloned into the same sites of the Path 1 vector (p47), which contains a SalI restriction site 3
of the BAM HI site.
The Dsg1 sequences were then removed with EcoRI and SalI and subcloned into the EcoRI and XhoI sites of pACTII to generate a construct
encoding nucleotides 1,633-3,072 of human Dsg1 in frame with upstream
sequences encoding the GAL4 activation domain (p504). The cDNA encoding DP-NTP in pBluescript (p552) was restriction digested with BamHI
and SalI and subcloned into the BamHI and XhoI sites of pACTII (p597).
This construct was subsequently digested with NcoI and SmaI to subclone
the DP-NTP sequences into the same restriction sites of the pAS1-CYH2
vector (p601). The first 584 amino acids of human desmoplakin are encoded in both the pACTII and pAS1-CYH2 constructs, similar to the DP-NTP expression vectors described above.
To assay interactions between proteins, yeast (strain HF7c) were transformed with the plasmids of interest and grown on synthetic defined media
lacking either tryptophan (SD
trp) for the pAS1-CYH2 vector or leucine
(SD
leu) for the pACTII vector to select for transformed clones. Transformations and
-galactosidase assays were performed according to methods published in the MatchmakerTM Two Hybrid product protocol (Clontech Laboratories Inc., Palo Alto, CA). Briefly, isolated colonies were transformed with 5 to 10 µg plasmid DNA using a standard lithium acetate/
polyethylene glycol method. Interactions between proteins were tested by
streaking transformed colonies onto Whatman filter membranes and
assaying
-galactosidase activity using the substrate X-Gal (5-Bromo-
4-chloro-3-indolyl
-D-galactopyranoside; Sigma Chemical Co.). As a second reporter for interactions, colonies were also tested for growth on
SD-leu-trp-his in the presence of 20 mM 3-aminotriazole (Sigma Chemical
Co.). Materials for base media and agar were obtained from DIFCO Laboratories (Detroit, MI), and materials for synthetic defined media were purchased from Clontech Laboratories Inc.
The Desmoplakin Amino-terminal Domain Clusters Desmosomal Cadherin-Plakoglobin Complexes
The amino-terminal domain of desmoplakin was previously demonstrated to target desmoplakin to the desmosomal plaque (Stappenbeck et al., 1993
; Bornslaeger et al.,
1996
). We hypothesized that the amino-terminal region of
desmoplakin may interact with the desmosomal cadherin-
plakoglobin complex, thereby coupling the desmosomal
cadherins to the intermediate filament cytoskeleton. To
address this question, a series of stable L-cell fibroblast cell lines expressing various desmosomal molecules was
established to reconstitute complexes of specific desmosomal components. A schematic diagram depicting the constructs used in this study is shown in Fig. 1. L-cell lines expressing Dsg1 and plakoglobin in the presence or absence
of DP-NTP were generated, and the expression of each
protein was monitored by immunoblot (Fig. 2). An immunoblot for vimentin is also shown to demonstrate that similar levels of protein were loaded in each lane. Parental
L-cells (not shown) and neomycin-resistant L-cells do not
express detectable levels of desmosomal components (Fig.
2), with the exception of plakoglobin, which is expressed
at extremely low levels (Kowalczyk et al., 1994
, 1996
).
The distribution of exogenously expressed desmosomal
proteins in the L-cell lines was monitored by dual label indirect immunofluorescence (Fig. 3). In L-cells expressing
Dsg1 and plakoglobin, the proteins colocalized and staining was largely uniform along the plasma membrane (Fig.
3, A and B; see also Kowalczyk et al., 1994
). No endogenous desmoplakin staining was detected in these cells (Fig. 3 D). In contrast, in L-cell lines co-expressing DP-NTP,
both Dsg1 (Fig. 3 E) and plakoglobin (Fig. 3 F) were
present in punctate clusters. In addition, DP-NTP (Fig. 3
G) colocalized with plakoglobin (Fig. 3 H), suggesting that
all three components were present in a single complex. It
is important to note that the clustering of desmosomal
cadherins and plakoglobin was observed only in the presence of DP-NTP. Out of a total of 84 L-cell lines expressing Dsg1 and plakoglobin that were generated, clustering
was not observed in any of these cell lines (see also Kowalczyk et al., 1996
). In contrast, 16 independent clones of
L-cell lines expressing the desmoplakin polypeptide were
generated, and clustering was observed in all 16 clones.
Furthermore, in the representative Dsg1/Pg/DP-NTP cell
line shown here, punctate Dsg1 staining was observed in
71 out of 111 cells. This is in comparison to 0 out of 133 cells for the Dsg1/Pg line, indicating that the clustering was
due to the co-expression of the desmoplakin polypeptide.
Laser scanning confocal microscopy was used to further
characterize the distribution of the punctate clusters in cell
lines co-expressing Dsg1, plakoglobin, and DP-NTP. In
many instances, punctate clusters of Dsg1 were visualized
along the ventral cell surface, as shown in Fig. 4 A, where
the focal plane was set at the cell-substrate interface. These
clusters colocalized with plakoglobin (not shown), consistent with the results shown in Fig. 3. Vertical sections of
the cell in Fig. 4 A reveals the presence of clusters on both
the ventral and dorsal cell surfaces (Fig. 4 B). This distribution was observed consistently, as demonstrated by the
additional vertical sections shown in Fig. 4, C and D. In addition, treatment of cell lines expressing Dsg1, plakoglobin, and DP-NTP with trypsin demonstrated that the Dsg1
was sensitive to trypsin degradation (Fig. 4 E). The antibody used to detect Dsg1 (Ab NW1) is directed against
the Dsg1 cytoplasmic domain (Kowalczyk, A.P., unpublished observations), indicating that the generation of a
Dsg1 fragment of ~100 kD in cells treated with trypsin is
due to degradation of a portion of the Dsg1 extracellular domain. Together with the observations that the punctate
clusters of Dsg1 were observed along the plasma membrane by confocal microscopy, the trypsinization results
indicate that the vast majority of Dsg1 was present on the
cell surface. This is consistent with a previous report demonstrating that both Dsg1 and Dsc2a are present on the
cell surface when expressed in L-cells (Kowalczyk et al., 1995
).
z scans) were taken of the cells at the top of
each panel. Arrows identify punctate Dsg1 staining at the apical
membrane, and arrowheads identify staining along the membrane at the cell-substrate interface. To further verify that the
Dsg1 was present on the cell surface, L-cells expressing Dsg1, plakoglobin, and DP-NTP were incubated in the presence or absence of 0.01% trypsin for 10 min at 37°C in PBS containing 1 mM
EDTA. The cells were rinsed in serum to inactivate the trypsin,
lysed in SDS-PAGE sample buffer, and immunoblot analysis performed. Note that trypsin treatment resulted in the appearance of
a 100-kD fragment of Dsg1 that is recognized by the Dsg1 antibody (NW1) which is directed against the cytoplasmic domain.
This demonstrates that the trypsin degraded the Dsg1 extracellular domain but did not gain access to the cytoplasmic compartment of the cells. In addition, no degradation of plakoglobin was
observed (not shown), futher confirming that the trypsinization
was limited to the exterior of the cells.
DP-NTP Also Clusters Dsc2a-Plakoglobin Complexes
In contrast to adherens junctions, desmosomes contain two
distinct subclasses of cadherins, desmogleins and desmocollins. Therefore, the ability of DP-NTP to cause clustering of Dsc2a-plakoglobin complexes was also analyzed
(Fig. 5). When expressed alone, Dsc2a (Fig. 5 A) and plakoglobin (Fig. 5 B) were distributed in a diffuse, largely
uniform staining pattern along the membrane of the
L-cells. However, in the presence of DP-NTP, both Dsc2a
(Fig. 5 C) and plakoglobin (Fig. 5 D) were colocalized in
distinct punctate clusters. In addition, DP-NTP (Fig. 5 E)
and plakoglobin (Fig. 5 F) colocalized in these clusters, indicating that DP-NTP causes clustering of both classes of
desmosomal cadherins.
A Chimeric Cadherin with the E-cadherin Extracellular Domain and the Dsg1 Cytoplasmic Domain (EcadDsg1) Recruits Plakoglobin and DP-NTP to Cell-Cell Borders
A number of previous studies have demonstrated that the
desmosomal cadherins do not mediate homophilic adhesion when expressed in L-cells (Amagai et al., 1994
; Chidgey et al., 1996
; Kowalczyk et al., 1996
). A previous study
demonstrated that a chimeric cadherin with the E-cadherin extracellular domain and the Dsg3 cytoplasmic domain mediates homophilic adhesion in L-cells (Roh and
Stanley, 1995a
). Therefore, a chimera containing the E-cadherin extracellular domain and Dsg1 cytoplasmic domain
(EcadDsg1) was co-expressed with plakoglobin and DP-NTP to determine if the chimera could recruit plakoglobin
and DP-NTP to regions of cell-cell contact. In the absence
of DP-NTP, the EcadDsg1 chimera (Fig. 6 A) and plakoglobin (Fig. 6 B) were largely diffuse on the plasma membrane, although some areas of cell-cell border staining
were observed. However, when this chimera was co-
expressed with plakoglobin and DP-NTP, the EcadDsg1
chimera (Fig. 6 C) and plakoglobin (Fig. 6 D) were codistributed in a punctate pattern. In addition, the EcadDsg1
chimera and plakoglobin were often localized at regions of
cell-cell contact. Furthermore, DP-NTP (Fig. 6 E) was recruited to cell-cell contacts and colocalized with plakoglobin (Fig. 6 F). The punctate distribution of DP-NTP at
cell-cell interfaces was observed only in L-cells expressing
the EcadDsg1 chimera. The observation that the EcadDsg1
chimera, plakoglobin, and DP-NTP were all present at cell-
cell borders suggests that all three proteins were present in
the same complex and that these complexes were recruited to areas of intercellular contact by the homophilic interactions of the E-cadherin extracellular domain.
Cell lines expressing the EcadDsg1 chimera and plakoglobin in the presence or absence of DP-NTP were also examined by electron microscopy. In L-cell lines co-expressing
DP-NTP, electron-dense regions subjacent to the plasma
membrane were observed at regions of cell-cell contact
(Fig. 7 B). Interestingly, these structures are similar to the
junctions lacking association with intermediate filaments
that were previously reported in A431 cell lines expressing DP-NTP (Fig. 7 C; Bornslaeger et al., 1996
). Although the
EcadDsg1 chimera and plakoglobin did colocalize at cell-
cell borders in the absence of DP-NTP, the extensive electron-dense plaque-like structures such as those present in
cells co-expressing DP-NTP (Fig. 7 B) were never observed in the absence of DP-NTP (Fig. 7 A). These data
suggest that clustering of the cadherin-plakoglobin complex by DP-NTP leads to the formation of a submembrane
plaque that can be identified ultrastructurally and which
closely resembles the outer dense plaque of the desmosome.
Plakoglobin Bound to the Desmoglein Cytoplasmic
Domain Does Not Associate with
-Catenin
In contrast to the desmosomal cadherins, E-cadherin is
coupled to the actin cytoskeleton through interactions with
-catenin, which is able to bind directly to both
-catenin
and plakoglobin. The ability of plakoglobin to bind to
-catenin and to associate with both desmosomal cadherins and
classical cadherins raises the question as to how these two
classes of cadherins are coupled to distinct cytoskeletal filament networks. Therefore, we used the EcadDsg1 chimera along with a Dsg1Ecad chimeric cadherin to determine if
-catenin could associate with plakoglobin that is bound to the Dsg1 cytoplasmic domain. The chimeric cadherins were immunoprecipitated from cell lysates using
antibodies directed against the extracellular domain of either
chimera. Immunoblot analysis of the immunoprecipitated
proteins revealed that
-catenin co-immunoprecipitated only
with the Dsg1Ecad chimera and did not co-immunoprecipitate with the EcadDsg1 chimera (Fig. 8 A). However, plakoglobin co-immunoprecipitated with both the Dsg1Ecad
and the EcadDsg1 chimeras (Fig. 8 B). These data indicate
that plakoglobin that is associated with the Dsg1 cytoplasmic domain does not bind to
-catenin.
-catenin is not associated with the
EcadDsg1 chimera. The Dsg1Ecad or the EcadDsg1 chimeras
were immunoprecipitated from L-cell lysates under mild detergent
conditions as described in Materials and Methods. L-cells expressing only neomycin (L-neo) resistance were used as a control. The
immunoprecipitates were analyzed by immunoblot for the presence of either plakoglobin (A) or
-catenin (B).
Plakoglobin Is Required for DP-NTP to Associate with the Dsg1 Cytoplasmic Domain
In adherens junctions,
-catenin is thought to link E-cadherin to
-catenin by binding directly to both proteins.
Due to the fact that plakoglobin and
-catenin are closely
related, we reasoned that plakoglobin may couple desmoplakin to the desmosomal cadherin cytoplasmic domains.
To test this hypothesis, the distribution of Dsg1 was monitored in L-cell lines expressing DP-NTP in the presence of
plakoglobin deletion mutants or in the absence of exogenously expressed plakoglobin (Fig. 9). Similar to control cells expressing full length plakoglobin (see Fig. 3), Dsg1
was distributed in punctate clusters in L-cells co-expressing DP-NTP in the presence of plakoglobin deletion mutants lacking either the amino- (Fig. 9 A) or carboxyl-terminal (Fig. 9 B) domains (refer to Fig. 1 for deletion map).
In the absence of exogenously expressed plakoglobin, Dsg1
(Fig. 9, C and E) was distributed in a diffuse pattern in
cells co-expressing Dsg1 and DP-NTP. Very low levels of
endogenous plakoglobin are expressed in L-cells (Fig. 9 D),
and only small amounts of endogenous plakoglobin can be
detected in L-cells expressing Dsg1 (Kowalczyk et al., 1994
). Although DP-NTP was occasionally observed in a punctate staining pattern, DP-NTP was more diffuse (Fig. 9 F)
in the absence of exogenous plakoglobin than in cells co-expressing plakoglobin (see also Figs. 3, 5, and 6).
N/DP-NTP; A) or
carboxyl (L-Dsg1/Pg
C/DP-NTP; B) domain. In both cell lines,
Dsg1 was distributed in a punctate staining pattern. In contrast,
in L-cells expressing Dsg1 and DP-NTP in the absence of exogenously expressed plakoglobin (C-F), Dsg1 was diffusely distributed (C and E). Endogenous mouse plakoglobin is expressed at
very low levels in L-cells (Kowalczyk et al., 1994
To further define the role of plakoglobin in the association of DP-NTP with the desmosomal cadherin cytoplasmic
domains, the EcadDsg1 chimera, plakoglobin, and DP-NTP
were transiently expressed in COS cells (Fig. 10). When
co-expressed in the absence of the chimera, plakoglobin
(Fig. 10 A) was distributed diffusely in the cytoplasm and
DP-NTP (Fig. 10 B) was distributed in perinuclear aggregates. COS cells assemble some desmosomes, and low levels of both plakoglobin and desmoplakin staining at cell
borders could be detected in transiently transfected cells,
presumably reflecting incorporation of the transiently expressed proteins into existing desmosomes (Stappenbeck
et al., 1993
). However, the vast majority of transiently expressed DP-NTP was not recruited to cell borders by the
EcadDsg1 chimera in the absence of plakoglobin (Fig. 10, A and B). In COS cells cotransfected with the EcadDsg1
chimera and DP-NTP, the EcadDsg1 chimera accumulated at cell-cell borders (Fig. 10 C), whereas DP-NTP remained in perinuclear aggregates (Fig. 10 D). In contrast,
in cells transiently expressing plakoglobin, DP-NTP, and
the EcadDsg1 chimera, the EcadDsg1 chimera (Fig. 10 E)
colocalized at borders with both plakoglobin (not shown)
and DP-NTP (Fig. 10 F). These findings are consistent
with the results observed in L-cell lines and demonstrate
that plakoglobin is required for the EcadDsg1 chimera to
recruit DP-NTP to areas of cell-cell contact.
Plakoglobin Forms Complexes with DP-NTP in L-cells and Binds Directly to DP-NTP
Co-immunoprecipitation experiments were conducted to
determine if protein complexes could be identified in L-cells
that exhibited clustered cadherin-plakoglobin complexes.
L-cells co-expressing Dsg1, DP-NTP, and plakoglobin or
deletion mutants of plakoglobin were solubilized in 0.5%
Triton X-100, and immunoprecipitations were carried out
using an antibody directed against either Dsg1 or DP-NTP
(Fig. 11). Plakoglobin or plakoglobin deletion mutants were
then detected using antibodies directed against the amino- (PgNT) or carboxyl-terminal domain (PgCT) of plakoglobin. The results indicate that plakoglobin and the plakoglobin deletion mutants co-immunoprecipitate with both
Dsg1 and DP-NTP. Preimmune sera from antibody NW161
was used as a control to verify that plakoglobin was co-
immunoprecipitated specifically with DP-NTP. These data
demonstrate that plakoglobin is in a complex with DP-NTP in the L-cell lines. In addition, the fact that plakoglobin deletion mutants lacking either the amino- or carboxyl-terminal end domains of plakoglobin also co-immunoprecipitated with DP-NTP suggests that the central armadillo
repeats of plakoglobin are important for association with
both Dsg1 and DP-NTP.
N, and Pg
C
co-immunoprecipitated with Dsg1 and with DP-NTP. Dsg1 was
immunoprecipitated with PF sera #982, and DP-NTP was immunoprecipitated with NW161. Note that no plakoglobin is detected
when the preimmune serum from NW161 was used as the immunoprecipitating antibody.
To determine if plakoglobin and DP-NTP interact directly, these proteins were expressed in the yeast two hybrid system and interactions were analyzed by monitoring
-galactosidase activity (Fig. 12, A-D). Cotransformation
of plasmids containing the interacting domains from p53
and large T antigen (p53DB and LTTA) were used as positive
controls for transcription activation (Fig. 12 A). Control
experiments were also conducted to verify that the DP-NTP (DP-NTPDB) and plakoglobin constructs (PG
NTA) did
not spontaneously activate transcription. No
-galactosidase activity was observed when PG
NTAwas tested for
interaction with p53DB (Fig. 12 B). However,
-galactosidase activity was consistently observed when yeast were
cotransformed with PG
NTA and DP-NTPDB (Fig. 12 C), indicating that these proteins interact directly. Although DP-NTPDB was found to interact with PG
NTA (Fig. 12 C), an
interaction between DP-NTPDB and the Dsg1 cytoplasmic
tail (Dsg1TA) was not detected (Fig. 12 D). Similar to previous studies (Witcher et al., 1996
), the Dsg1 cytoplasmic
tail exhibited strong interactions with a PG
N-DNA- binding domain fusion, indicating that the Dsg1 construct
was functional (not shown). Although DP-NTP did not activate transcription in the DNA-binding domain vector,
PG
N in the DNA-binding domain construct did exhibit
low levels of transcription activation, precluding our ability to test PG
N interaction with DP-NTP in the reverse
orientation. However, these results were confirmed using
growth in the absence of histidine as a second, independent reporter for the activation of transcription. Yeast
cotransformed with DP-NTPDB and PG
NTA exhibited
growth on agar plates lacking histidine in the presence of
20 mM 3-aminotriazole (Fig. 12 G), whereas no growth
was detected in parallel experiments in which the Dsg1 tail
was tested for interactions with DP-NTP (Fig. 12 H).
These data indicate that DP-NTP binds directly to plakoglobin but not Dsg1.
-galactosidase activity (A-D) or the ability to grow in
the absence of histidine (E-H). Positive control vectors encoding
interacting domains of p53 in the DNA-binding domain vector
(DB) and large T antigen in the transcription activation vector
(TA) were cotransformed as controls for transcription activation.
Yeast transformed with these vectors exhibited high levels of
-galactosidase activity (A) and large amounts of growth on histidine drop out medium (E). In contrast, cotransformation with
p53DB and a plakoglobin deletion construct PG
NTA did not exhibit
-galactosidase activity or growth in the absence of histidine.
However, yeast cotransformed with PG
NTA and DP-NTPDB exhibited both
-galactosidase activity (C) and growth on histidine
drop out plates (G), indicating that these two proteins interact directly. In contrast, no activation of transcription was detected
when DP-NTP was tested for interaction with the Dsg1 cytoplasmic domain (D and H).
The molecular interactions that couple the desmosomal
cadherins to the intermediate filament cytoskeleton have
not been well characterized. Previous studies had shown
that the amino-terminal domain of desmoplakin is important
for localizing desmoplakin to the cytoplasmic plaque of the
desmosome (Stappenbeck et al., 1993
; Bornslaeger et al.,
1996
). In the current study, we sought to determine if desmosomal cadherin-plakoglobin complexes interact with the
amino-terminal domain of desmoplakin. The results indicate that the amino-terminal domain of desmoplakin clusters desmosomal cadherin-plakoglobin complexes and binds directly
to plakoglobin, but not desmoglein. These results provide
new insights into the hierarchy of molecular interactions
that occur in the cytoplasmic plaque of the desmosome.
In L-cell lines co-expressing DP-NTP, both Dsg1- (Fig.
3) and Dsc2a-plakoglobin (Fig. 5) complexes are clustered
into punctate regions of staining, which appear to be at the
plasma membrane. It is interesting to note that the desmosomal cadherins are clustered in L-cells co-expressing DP-NTP, even though these cells do not aggregate in suspension (not shown). The fact that the desmosomal cadherins
are clustered but are not engaged in adhesion in L-cells indicates that clustering can occur independent of adhesion.
These observations are consistent with the finding that
desmosomal complexes resembling half desmosomes are
assembled in HaCaT keratinocytes grown in low calcium
medium (Demlehner et al., 1995
). Clustering of desmosomal cadherins and plakoglobin represents only one aspect of desmosome assembly, and it will be interesting to
determine if other desmosomal components such as pinin
(Ouyang and Sugrue, 1992
, 1996
), envoplakin (Ruhrberg
et al., 1996
), and the plakophilins require desmosomal cadherin-mediated adhesion for assembly into the plaque.
Co-immunoprecipitation experiments demonstrated that plakoglobin and DP-NTP are present in complexes that can be extracted from L-cell lysates (Fig. 11). Although we could not detect the desmosomal cadherins in these complexes, it is likely that the complexes that form between DP-NTP and plakoglobin do contain the cadherins. This is supported by the fact that the desmosomal cadherins are clustered by DP-NTP along with plakoglobin. Furthermore, in cell lines expressing the EcadDsg1 chimera, plakoglobin and DP-NTP are both redistributed to cell-cell interfaces and colocalize with the chimera. These observations strongly suggest that the desmosomal cadherins, plakoglobin, and DP-NTP exist in the same complex.
In addition to the observation that plakoglobin and DP-NTP co-immunoprecipitate, yeast two hybrid analysis
demonstrated that DP-NTP binds directly to plakoglobin,
but not Dsg1 (Fig. 12). The lack of DP-NTP binding to
Dsg1 in the two hybrid system is consistent with the observation that Dsg1 clustering did not occur in L-cell lines in
the absence of plakoglobin and with the observation that DP-NTP was not recruited to COS cell-cell borders with
the EcadDsg1 chimera in the absence of plakoglobin (Fig.
10). These results lead us to propose that plakoglobin couples desmoplakin to the desmosomal cadherins, thereby linking these cadherins to the intermediate filament cytoskeleton. Previous studies by Troyanovsky et al. (1993
, 1994
)
demonstrated that a connexin-Dsc2a chimera recruited endogenous desmoplakin to the plasma membrane, even
when the plakoglobin-binding region of the Dsc2a tail was
deleted. The data presented here do not rule out the possibility that desmoplakin binds to desmocollin directly, or
that other proteins in addition to plakoglobin can facilitate
desmoplakin-desmosomal cadherin interactions. However, our data indicate that plakoglobin plays an important role
in linking desmoplakin to the desmoglein cytoplasmic domain. In the desmosome, therefore, plakoglobin may play
a role analogous to the adherens junction protein
-catenin,
which couples the classical cadherins to
-catenin (Aberle
et al., 1994
; Jou et al., 1995
; Cowin and Burke, 1996
).
Recently, transgenic mice with a null mutation in the plakoglobin gene were reported to have defects in desmosome assembly in the intercalated discs of the heart (Bierkamp et al., 1996
; Ruiz et al., 1996
). In these mice, Dsg2 no
longer clustered into distinct junctional structures but exhibited a diffuse distribution on the cell surface. In addition, normal desmosomes were no longer detected in the
intercalated discs of the plakoglobin null mice, and adherens junctions and desmosomal components appeared to be mixed into the same junctional structures. Interestingly,
desmoplakin localized in these structures, suggesting that
this molecule can associate with other junctional proteins
in addition to plakoglobin. A family of proteins related to
plakoglobin, termed plakophilins, has been identified, and
the desmosomal component originally termed band 6 is
now known to be a plakophilin family member (Hatzfeld et al., 1994
; Heid et al., 1994
; Hatzfeld and Nachtsheim,
1996
; Mertens et al., 1996
). It is possible that plakophilin
family members or other desmosomal components also
play a role in linking the desmosomal cadherins to desmoplakin.
An interesting property of plakoglobin is that it binds to
both classical and desmosomal cadherins. The observation
that DP-NTP binds to plakoglobin and clusters desmosomal cadherin-plakoglobin complexes implies that desmoplakin binds to plakoglobin that is associated with the
desmosomal cadherin cytoplasmic domain. In contrast,
plakoglobin that is associated with the desmosomal cadherin cytoplasmic domain is unable to bind to
-catenin
(Fig. 8; Plott et al., 1994
; Roh and Stanley, 1995a
). Recent
studies have demonstrated that the
-catenin and Dsg1
binding sites on plakoglobin overlap in the amino-terminal
armadillo repeats of plakoglobin, suggesting that Dsg1 and
-catenin cannot bind to the same plakoglobin molecule simultaneously (Sacco et al., 1995
; Aberle et al., 1996
; Chitaev et al., 1996
; Troyanovsky et al., 1996
; Witcher et al.,
1996
). However, the classical cadherins bind to the central
armadillo repeats of plakoglobin, leaving the amino-terminal
armadillo repeats of plakoglobin available to bind
-catenin. In the present study, deletion mutants of plakoglobin
lacking either the amino- or carboxyl-terminal domain co-immunoprecipitated with DP-NTP and were clustered in L-cells co-expressing DP-NTP. These results, along with
the ability of the amino-terminal plakoglobin deletion to
interact with DP-NTP in the two hybrid system, suggest
that desmoplakin may bind to the central armadillo repeats of plakoglobin. In A431 cells, the expression of plakoglobin deletion mutants lacking the amino- and carboxyl-terminal end domains promoted the assembly of
elongated and fused desmosomes, suggesting that the central armadillo repeats of plakoglobin can promote interactions between desmosomal proteins, which may include
desmoplakin (Palka and Green, 1997
). Future studies will
be directed at mapping precisely where desmoplakin binds
to plakoglobin in relation to the sites on plakoglobin that bind to the desmosomal cadherins. Such studies should
provide insight into the mechanisms by which the cadherin
cytoplasmic tails govern the domains on plakoglobin that
are available for interactions with either
-catenin or desmoplakin.
Received for publication 20 January 1997 and in revised form 8 August 1997.
Address all correspondence to Kathleen Green, Department of Pathology, Northwestern University Medical School, 303 East Chicago Avenue, Chicago, IL 60611. Tel.: (312) 503-5300. Fax: (312) 503-8240.The authors would like to thank Drs. M. Wheelock, K. Johnson, J. Papkoff, M. Udey, M. Takeichi, K. Trevor, and J. Stanley for sharing antibody -and cDNA reagents that made this work possible. Thanks also to Drs. S. Elledge and M. Klymkowsky for generously providing yeast two hybrid reagents and expertise. We also would like to thank S. Norvell for assistance with the confocal microscopy, D. Kopp for assistance with the COS transfections, S. Guy for cDNA sequence analysis, and K. Myung and M. Moody for assistance preparing samples for electron microscopy.
This work was supported by the National Institutes of Health (RO1AR43380 and RO1AR41836) and a March of Dimes Birth Defects Foundation grant (1-FY96-0146) to K.J. Green. A.P. Kowalczyk was supported by a postdoctoral fellowship from the Dermatology Foundation, and K.J. Green is a Faculty Research Award recipient of the American Cancer Society.
| 1. | Aberle, H., S. Butz, J. Stappert, H. Weissig, R. Kemler, and H. Hoschuetzky. 1994. Assembly of the cadherin-catenin complex in vitro with recombinant proteins. J. Cell Sci. 107: 3655-3663 [Abstract]. |
| 2. |
Aberle, H.,
H. Schwartz,
H. Hoschuetzky, and
R. Kemler.
1996.
Single amino
acid substitutions in proteins of the armadillo gene family abolish their binding to -catenin.
J. Biol. Chem.
271:
1520-1526
|
| 3. | Amagai, M., S. Karpati, V. Klaus-Kovtun, M.C. Udey, and J.R. Stanley. 1994. The extracellular domain of pemphigus vulgaris antigen (Desmoglein 3) mediates weak homophilic adhesion. J. Investig. Dermatol. 102: 402-408 [Medline]. |
| 4. | Bai, C., and S.J. Elledge. 1995. Cloning using the two-hybrid system. Methods Enzymol. 273: 331-347 . |
| 5. | Bierkamp, C., K.J. Mclaughlin, H. Schwarz, O. Huber, and R. Kemler. 1996. Embryonic heart and skin defects in mice lacking plakoglobin. Dev. Biol. 180: 780-785 [Medline]. |
| 6. |
Bornslaeger, E.A.,
C.M. Corcoran,
T.S. Stappenbeck, and
K.J. Green.
1996.
Breaking the connection: displacement of the desmosomal plaque protein
desmoplakin from cell-cell interfaces disrupts anchorage of intermediate filament bundles and alters intercellular junction assembly.
J. Cell Biol.
134:
985-1001
|
| 7. |
Buxton, R.S.,
P. Cowin,
W.W. Franke,
D.R. Garrod,
K.J. Green,
I.A. King,
P.J. Koch,
A.I. Magee,
D.A. Rees,
J.R. Stanley, and
M.S. Steinberg.
1993.
Nomenclature of the desmosomal cadherins.
J. Cell Biol.
121:
481-483
|
| 8. | Chidgey, M.A.J., J.P. Clarke, and D.R. Garrod. 1996. Expression of full-length desmosomal glycoproteins (desmocollins) is not sufficient to confer strong adhesion on transfected L929 cells. J. Investig. Dermatol. 106: 689-695 [Medline]. |
| 9. |
Chitaev, N.A., and
S.M. Troyanovsky.
1997.
Direct Ca2+-dependent heterophilic interaction between desmosomal cadherins, desmoglein, and desmocollin contributes to cell-cell adhesion.
J. Cell Biol.
138:
193-201
|
| 10. |
Chitaev, N.A.,
R.E. Leube,
R.B. Troyanovsky,
L.G. Eshkind,
W.W. Franke, and
S.M. Troyanovsky.
1996.
The binding of plakoglobin to desmosomal
cadherins: patterns of binding sites and topogenic potential.
J. Cell Biol.
133:
359-369
|
| 11. | Collins, J.E., and D.R. Garrod. 1994. Molecular biology of desmosomes and hemidesmosomes. R.G. Landes Co., Austin, Texas. |
| 12. | Coulombe, P.A., and E. Fuchs. 1994. Molecular mechanisms of keratin gene disorders and other bullous diseases of the skin. In Molecular Mechanisms of Epithelial Cell Junctions: From Development to Disease. S. Citi, editor. R.G. Landes Co., Austin, Texas. 259-285. |
| 13. | Cowin, P., and S. Mechanic. 1994. Desmosomal cadherins and their cytoplasmic interactions. In Molecular Mechanisms of Epithelial Cell Junctions: From Development to Disease. S. Citi, editor. R.G. Landes Co., Austin, Texas. 141-155. |
| 14. | Cowin, P., and B. Burke. 1996. Cytoskeleton-membrane interactions. Curr. Opin. Cell Biol. 8: 56-65 [Medline]. |
| 15. |
Demlehner, M.P.,
S. Schafer,
C. Grund, and
W.W. Franke.
1995.
Continual assembly of half-desmosomal structures in the absence of cell contacts and
their frustrated endocytosis: a coordinated sisyphus cycle.
J. Cell Biol.
131:
745-760
|
| 16. |
Evans, M.J., and
R.C. Scarpulla.
1988.
Both upstream and intron elements are
required for elevated expression of rat somatic cytochrome c gene expression in COS-1 cells.
Mol. Cell Biol.
8:
35-41
|
| 17. |
Farquhar, M.G., and
G.E. Palade.
1963.
Junctional complexes in various epithelia.
J. Cell Biol.
17:
375-412
|
| 18. |
Franke, W.W.,
M.D. Goldschmidt,
R. Zimbelmann,
H.M. Mueller,
D.L. Schiller, and
P. Cowin.
1989.
Molecular cloning and amino acid sequence of
human plakoglobin, the common junctional plaque protein.
Proc. Natl.
Acad. Sci. USA.
86:
4027-4031
|
| 19. |
Fuchs, E..
1994.
Intermediate filaments and disease: mutations that cripple cell
strength.
J. Cell Biol.
125:
511-516
|
| 20. | Garrod, D.. 1993. Desmosomes and hemidesmosomes. Curr. Opin. Cell Biol. 5: 30-40 [Medline]. |
| 21. |
Gorbsky, G., and
M.S. Steinberg.
1981.
Isolation of the intercellular glycoproteins of desmosomes.
J. Cell Biol.
90:
243-248
|
| 22. |
Green, K.J.,
D.A.D. Parry,
P.M. Steinert,
M.L.A. Virata,
R.M. Wagner,
B.D. Angst, and
L.A. Nilles.
1990.
Structure of the human desmoplakins. Implications for function in the desmosomal plaque.
J. Biol. Chem.
265:
2603-2612
|
| 23. | Green, K.J., T.S. Stappenbeck, S. Noguchi, R. Oyasu, and L.A. Nilles. 1991. Desmoplakin expression and distribution in cultured rat bladder epithelial cells of varying tumorogenic potential. Exp. Cell Res. 193: 134-143 [Medline]. |
| 24. | Harper, J.W., G. Adami, N. Wei, K. Keyomarsi, and S.J. Elledge. 1993. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell. 75: 805-816 [Medline]. |
| 25. | Hatzfeld, M., and C. Nachtsheim. 1996. Cloning and characterization of a new armadillo family member, p0071, associated with the junctional plaque: evidence for a subfamily of closely related proteins. J. Cell Sci. 109: 2767-2778 [Abstract]. |
| 26. | Hatzfeld, M., I.K. Gunnar, U. Plessmann, and K. Weber. 1994. Band 6 protein, a major constituent of desmosomes from stratified epithelia, is a novel member of the armadillo multigene family. J. Cell Sci. 107: 2259-2270 [Abstract]. |
| 27. | Heid, H.W., A. Schmidt, R. Zimbelmann, S. Schafer, S. Winter-Simanowski, S. Stumpp, M. Keith, U. Figge, M. Schnolzer, and W.W. Franke. 1994. Cell type-specific desmosomal plaque proteins of the plakoglobin family: plakophilin 1 (band 6 protein). Differentiation. 58: 113-131 [Medline]. |
| 28. |
Hinck, L.,
W.J. Nelson, and
J. Papkoff.
1994.
Wnt-1 modulates cell-cell adhesion in mammalian cells by stabilizing -catenin binding to the cell adhesion
protein cadherin.
J. Cell Biol.
124:
729-741
|
| 29. | Jones, S.M., J.C.R. Jones, and R.D. Goldman. 1988. Comparison of the polypeptide composition of desmosomes prepared from two bovine epithelial tissues. J. Cell. Biochem. 36: 223-236 [Medline]. |
| 30. |
Jou, T.-S.,
D.B. Stewart,
J. Stappert,
W.J. Nelson, and
J.A. Marrs.
1995.
Genetic
and biochemical dissection of protein linkages in the cadherin-catenin complex.
Proc. Natl. Acad. Sci. USA.
92:
5067-5071
|
| 31. |
Knudson, K.A.,
A.P. Soler,
K.R. Johnson, and
M.J. Wheelock.
1995.
Interaction of -actinin with the cadherin/catenin cell-cell adhesion complex via
-catenin.
J. Cell Biol.
130:
67-77
|
| 32. | Koch, P.J., M.J. Walsh, M. Schmelz, M.D. Goldschmidt, R. Zimbelmann, and W.W. Franke. 1990. Identification of desmoglein, a constitutive desmosomal glycoprotein, as a member of the cadherin family of cell adhesion receptors. Eur. J. Cell Biol. 53: 1-12 [Medline]. |
| 33. |
Kouklis, P.D.,
E. Hutton, and
E. Fuchs.
1994.
Making a connection: direct binding between keratin intermediate filaments and desmosomal proteins.
J. Cell
Biol.
127:
1049-1060
|
| 34. |
Kowalczyk, A.P.,
H.L. Palka,
H.H. Luu,
L.A. Nilles,
J.E. Anderson,
M.J. Wheelock, and
K.J. Green.
1994.
Posttranslational regulation of plakoglobin
expression: influence of the desmosomal cadherins on plakoglobin metabolic
stability.
J. Biol. Chem.
269:
31214-31223
|
| 35. | Kowalczyk, A.P., J.E. Anderson, J.E. Borgwardt, T. Hashimoto, J.R. Stanley, and K.J. Green. 1995. Pemphigus sera recognize conformationally sensitive epitopes in the amino-terminal region of desmoglein-1. J. Investig. Dermatol. 105: 147-152 [Medline]. |
| 36. | Kowalczyk, A.P., J.E. Borgwardt, and K.J. Green. 1996. Analysis of desmosomal cadherin adhesive function and stoichiometry of the desmosomal cadherin/plakoglobin complex. J. Investig. Dermatol. 107: 293-300 [Medline]. |
| 37. | Kowalczyk, A.P., and K.J. Green. 1996. The desmosome: a component system for adhesion and intermediate filament attachment. In Current Topics in Membranes. Vol. 43. W.J. Nelson, editor. Academic Press, Inc., San Diego. 187-209. |
| 38. | Lewis, J.E., III, J.K.W., K.M. Sass, P.J. Jensen, K.R. Johnson, and M.J. Wheelock. 1997. Cross-talk betwen adherens junctions and desmosomes depends on plakoglobin. J. Cell Biol. 136:919-934. |
| 39. |
Mathur, M.,
L. Goodwin, and
P. Cowin.
1994.
Interactions of the cytoplasmic
domain of the desmosomal cadherin Dsg1 with plakoglobin.
J. Biol. Chem.
269:
14075-14080
|
| 40. |
McCrea, P.D.,
C.W. Turck, and
B. Gumbiner.
1991.
A homologue of the armadillo protein in Drosophila (plakoglobin) associates with E-cadherin.
Science
(Wash. DC)
254:
1359-1361
|
| 41. | McLean, W.H.I., and E.B. Lane. 1995. Intermediate filaments in disease. Curr. Opin. Cell Biol. 7: 118-125 [Medline]. |
| 42. |
Meng, J.-J.,
E.A. Bornslaeger,
K.J. Green,
P.M. Steinert, and
W. Ip.
1997.
Two-hybrid analysis reveals fundamental differences in direct interactions between desmoplakin and cell type-specific intermediate filaments.
J. Biol.
Chem.
272:
21495-21503
|
| 43. |
Mertens, C.,
C. Kuhn, and
W.W. Franke.
1996.
Plakophilins 2a and 2b: constitutive proteins of dual location in the karyoplasm and the desmosomal plaque.
J. Cell Biol.
135:
1009-1025
|
| 44. | Nagafuchi, A.Y., K. Shirayoshi, K. Okazaki, K. Yasuda, and M. Takeichi. 1987. Transformation of cell adhesion properties by exogenously introduced E-cadherin cDNA. Nature (Lond.). 329: 341-343 [Medline]. |
| 45. | Nagafuchi, A., M. Takeichi, and S. Tsukita. 1991. The 102kd cadherin-associated protein: similarity to vinculin and posttranscriptional regulation of expression. Cell. 65: 849-857 [Medline]. |
| 46. |
Nieset, J.E.,
A.R. Redfield,
F. Jin,
K.A. Knudsen,
K.R. Johnson, and
M.J. Wheelock.
1997.
Characterization of the interactions of -catenin with -actinin and -catenin/plakoglobin.
J. Cell Science.
110:
1013-1022
[Abstract].
|
| 47. | Nilles, L.A., D.A.D. Parry, E.E. Powers, B.D. Angst, R.M. Wagner, and K.J. Green. 1991. Structural analysis and expression of human desmoglein: cadherin-like component of the desmosome. J. Cell Sci. 99: 809-821 [Abstract]. |
| 48. |
Obama, H., and
M. Ozawa.
1997.
Identification of the domain of -catenin involved in its association with -catenin and plakoglobin ( -catenin).
J. Biol.
Chem.
272:
11017-11020
|
| 49. |
O'Keefe, E.J.,
H.P. Erickson, and
V. Bennett.
1989.
Desmoplakin I and desmoplakin II. Purification and characterization.
J. Biol. Chem.
264:
8310-8318
|
| 50. |
Ouyang, P., and
S.P. Sugrue.
1992.
Identification of an epithelial protein related
to the desmosome and intermediate filament network.
J. Cell Biol.
118:
1477-1488
|
| 51. |
Ouyang, P., and
S. Sugrue.
1996.
Characterization of pinin, a novel protein associated with the desmosome-intermediate filament complex.
J. Cell Biol.
135:
1027-1042
|
| 52. |
Ozawa, M.,
M. Ringwald, and
R. Kemler.
1990.
Uvomorulin-catenin complex
formation is regulated by a specific domain in the cytoplasmic region of the
cell adhesion molecule.
Proc. Natl. Acad. Sci. USA.
87:
4246-4250
|
| 53. | Palka, H.L., and K.J. Green. 1997. Roles of plakoglobin end domains in desmosome assembly. J. Cell Science. 110: 2359-2371 [Abstract]. |
| 54. |
Parker, A.E.,
G.N. Wheeler,
J. Arnemann,
S.C. Pidsley,
P. Ataliotis,
C.L. Thomas,
D.A. Rees,
A.I. Magee, and
R.S. Buxton.
1991.
Desmosomal glycoproteins II and III. Cadherin-like junctional molecules generated by alternative
splicing.
J. Biol. Chem.
266:
10438-10445
|
| 55. | Peifer, M., and E. Wieschaus. 1990. The segment polarity gene armadillo encodes a functionally modular protein that is the Drosophila homolog of human plakoglobin. Cell. 63: 1167-1178 [Medline]. |
| 56. |
Peifer, M.,
P. McCrea,
K.J. Green,
E. Wieschaus, and
B. Gumbiner.
1992.
The
vertebrate adhesive junction proteins -catenin and plakoglobin and the
drosophila segment polarity gene armadillo form a multigene family with
similar properties.
J. Cell Biol.
118:
681-691
|
| 57. | Peifer, M., S. Berg, and A.B. Reynolds. 1994. A repeating amino acid motif shared by proteins with diverse cellular roles. Cell. 76: 789-791 [Medline]. |
| 58. | Plott, R.T., M. Amagai, M.C. Udey, and J.R. Stanley. 1994. Pemphigus vulgaris antigen lacks biochemical properties characteristic of classical cadherins. J. Investig. Dermatol. 103: 168-172 [Medline]. |
| 59. |
Rimm, D.L.,
E.R. Koslov,
P. Kebriaei,
C.D. Cianci, and
J.S. Morrow.
1995.
(E)-catenin is an actin-binding and -bundling protein mediating the attachment of F-actin to the membrane adhesion complex.
Proc. Natl. Acad. Sci.
USA.
92:
8813-8817
|
| 60. |
Roh, J.-Y., and
J.R. Stanley.
1995a.
Intracellular domain of desmoglein 3 (pemphigus vulgaris antigen) confers adhesive function on the extracellular domain of E-cadherin without binding catenins.
J. Cell Biol.
128:
939-947
|
| 61. | Roh, J.-Y., and J.R. Stanley. 1995b. Plakoglobin binding by human Dsg3 (pemphigus vulgaris antigen) in keratinocytes requires the cadherin-like intracytoplasmic segment. J. Investig. Dermatol. 104: 720-724 [Medline]. |
| 62. |
Ruhrberg, C.,
M.A.N. Hajibagheri,
M. Simon,
T.P. Dooley, and
F.M. Watt.
1996.
Envoplakin, a novel precursor of the cornified envelope that has homology to desmoplakin.
J. Cell Biol.
134:
715-729
|
| 63. |
Ruiz, P.,
V. Brinkmann,
B. Ledermann,
M. Behrend,
C. Grund,
C. Thalhammer,
F. Vogel,
C. Birchmeier,
U. Gunthert,
W.W. Franke, et al
.
1996.
Targeted mutation of plakoglobin in mice reveals essential functions of desmosomes in the embryonic heart.
J. Cell Biol.
135:
215-225
|
| 64. |
Sacco, P.A.,
T.M. McGranahan,
M.J. Wheelock, and
K.R. Johnson.
1995.
Identification of plakoglobin domains required for association with N-cadherin
and -catenin.
J. Biol. Chem.
270:
20201-20206
|
| 65. | Schmidt, A., H.W. Heid, S. Schafer, U.A. Nuber, R. Zimbelmann, and W.W. Franke. 1994. Desmosomes and cytoskeletal architecture in epithelial differentiation: cell type-specific plaque components and intermediate filament anchorage. Eur. J. Cell Biol. 65: 229-245 [Medline]. |
| 66. | Schwarz, M.A., K. Owaribe, J. Kartenbeck, and W.W. Franke. 1990. Desmosomes and hemidesmosomes: constitutive molecular components. Annu. Rev. Cell Biol. 6: 461-491 . |
| 67. |
Shimoyama, Y.,
A. Nagafuch,
S. Fujita,
M. Gotoh,
M. Takeichi,
S. Tsukita, and
S. Hirohashi.
1992.
Cadherin dysfunction in a human cancer cell line: possible involvement of loss of -catenin expression in reduced cell-cell adhesiveness.
Cancer Res.
52:
5770-5774
|
| 68. |
Skerrow, C.J., and
A.G. Matoltsy.
1974.
Chemical characterization of isolated
epidermal desmosomes.
J. Cell Biol.
63:
524-530
|
| 69. | Staehelin, L.A.. 1974. Structure and function of intercellular junctions. Int. Rev. Cytol. 39: 191-283 [Medline]. |
| 70. |
Stanley, J.R..
1995.
Autoantibodies against adhesion molecules and structures in
blistering skin diseases.
J. Exp. Med.
181:
1-4
|
| 71. |
Stappenbeck, T.S., and
K.J. Green.
1992.
The desmoplakin carboxyl terminus
coaligns with and specifically disrupts intermediate filament networks when
expressed in cultured cells.
J. Cell Biol.
116:
1197-1209
|
| 72. |
Stappenbeck, T.S.,
E.A. Bornslaeger,
C.M. Corcoran,
H.H. Luu,
M.L.A. Virata, and
K.J. Green.
1993.
Functional analysis of desmoplakin domains:
specification of the interaction with keratin versus vimentin intermediate filament networks.
J. Cell Biol.
123:
691-705
|
| 73. | Steinert, P.M., and S.J. Bale. 1993. Genetic skin diseases caused by mutations in keratin intermediate filaments. Trends Genet. 9: 280-284 [Medline]. |
| 74. | Troyanovsky, S.M., L.G. Eshkind, R.B. Troyanovsky, R.E. Leube, and W.W. Franke. 1993. Contributions of cytoplasmic domains of desmosomal cadherins to desmosome assembly and intermediate filament anchorage. Cell. 72: 561-574 [Medline]. |
| 75. |
Troyanovsky, S.M.,
R.B. Troyanovsky,
L.G. Eshkind,
R.E. Leube, and
W.W. Franke.
1994.
Identification of amino acid sequence motifs in desmocollin, a
desmosomal glycoprotein, that are required for plakoglobin binding and
plaque formation.
Proc. Natl. Acad. Sci. USA.
91:
10790-10794
|
| 76. | Troyanovsky, R.B., N.A. Chitaev, and S.M. Troyanovsky. 1996. Cadherin binding sites of plakoglobin: localization, specificity and role in targeting to adhering junctions. J. Cell Sci. 109: 3069-3078 [Abstract]. |
| 77. |
Virata, M.L.A.,
R.M. Wagner,
D.A.D. Parry, and
K.J. Green.
1992.
Molecular
structure of the human desmoplakin I and II amino terminus.
Proc. Natl.
Acad. Sci. USA.
89:
544-548
|
| 78. |
Witcher, L.L.,
R. Collins,
S. Puttagunta,
S.E. Mechanic,
M. Munson,
B. Gumbiner, and
P. Cowin.
1996.
Desmosomal cadherin binding domains of plakoglobin.
J. Biol. Chem.
271:
10904-10909
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|