|
|
|
|
|
|
|
||
© The Rockefeller University Press,
0021-9525/1997//831 $5.00
The Journal of Cell Biology, Volume 139, Number 4,
, 1997 831-840
Article |
Neocentromere-mediated Chromosome Movement in Maize
Department of Genetics, University of Georgia, Athens, Georgia 30602; and Department of Molecular and Cell Biology, University of California, Berkeley, California 94720
Neocentromere activity is a classic example of nonkinetochore chromosome movement. In maize, neocentromeres are induced by a gene or genes on Abnormal chromosome 10 (Ab10) which causes heterochromatic knobs to move poleward at meiotic anaphase. Here we describe experiments that test how neocentromere activity affects the function of linked centromere/kinetochores (kinetochores) and whether neocentromeres and kinetochores are mobilized on the spindle by the same mechanism. Using a newly developed system for observing meiotic chromosome congression and segregation in living maize cells, we show that neocentromeres are active from prometaphase through anaphase. During mid-anaphase, normal chromosomes move on the spindle at an average rate of 0.79 µm/min. The presence of Ab10 does not affect the rate of normal chromosome movement but propels neocentromeres poleward at rates as high as 1.4 µm/min. Kinetochore-mediated chromosome movement is only marginally affected by the activity of a linked neocentromere. Combined in situ hybridization/immunocytochemistry is used to demonstrate that unlike kinetochores, neocentromeres associate laterally with microtubules and that neocentromere movement is correlated with knob size. These data suggest that microtubule depolymerization is not required for neocentromere motility. We argue that neocentromeres are mobilized on microtubules by the activity of minus end–directed motor proteins that interact either directly or indirectly with knob DNA sequences.
CURRENT models suggest that chromosomes move by a combination of forces generated by microtubule disassembly (Inoue and Salmon, 1995; Waters et al., 1996) and the activity of molecular motors (Vernos and Karsenti, 1996; Yen and Schaar, 1996). Microtubule disassembly generates a constant poleward force; while molecular motors can generate force in either poleward or away-from-pole directions, depending on the characteristics of the motor protein. Both plus and minus end–directed microtubule-based motors are localized to kinetochores (Hyman and Mitchison, 1991). Immunolocalization experiments indicate that mammalian kinetochores contain the minus end– directed motor dynein throughout metaphase and anaphase (Pfarr et al., 1990; Steuer et al., 1990). The kinesin-like proteins CENP-E, which has a transient kinetochore localization in animals, and MCAK, which is localized between the kinetochore plates of mammalian chromosomes, are also thought to generate and/or regulate chromosome movement (Yen et al., 1992; Lombillo et al., 1995; Wordeman and Mitchison, 1995).
In addition to the molecular motors on kinetochores, several kinesin-like proteins are localized to chromosome arms (Vernos and Karsenti, 1996). Two subfamilies of arm-based motors have been identified in animals: the NOD subfamily (Afshar et al., 1995; Tokai et al., 1996) and the Xklp1/chromokinesin subfamily (Vernos et al., 1995; Wang and Adler, 1995). Both Nod and Xklp1 are required for positioning chromosomes on the metaphase plate, suggesting that they encode plus end–directed motors (Afshar et al., 1995; Vernos et al., 1995). Other evidence suggests that minus end–directed motors interact with chromosome arms. In the plant Haemanthus, a poleward force acts along chromosome arms during metaphase (Khodjakov et al., 1996), and forces propelling chromosome arms poleward have been detected during anaphase in crane fly spermatocytes (Adames and Forer, 1996). Little is known about how poleward arm motility at metaphase–anaphase affects the fidelity or rate of chromosome segregation.
The neocentromeres of maize (Rhoades and Vilkomerson, 1942) provide a particularly striking example of poleward chromosome arm motility. In the presence of Abnormal chromosome 10 (Ab10),1 heterochromatic DNA domains known as knobs are transformed into neocentromeres and mobilized on the spindle (Rhoades and Vilkomerson, 1942; Peacock et al., 1981; Dawe and Cande, 1996). Knobs are primarily composed of a tandem 180-bp repeat (Peacock et al., 1981) which shows homology to a maize B centromere clone (Alfenito and Birchler, 1993). A characteristic feature of neocentromeres is that they arrive at the spindle poles in advance of centromeres; in extreme cases the neocentromere-bearing chromosome arms stretch towards the poles (Rhoades and Vilkomerson, 1942; Rhoades, 1952). A recently identified mutation (smd1) demonstrates that a trans-acting factor(s) encoded on Ab10 is essential for converting the normally quiescent heterochromatic knobs into active neocentromeres (Dawe and Cande, 1996).
Here we use neocentromeres as a model for understanding the mechanisms and importance of nonkinetochore chromosome movement. As a part of our analysis, we developed a four-dimensional system for observing chromosome segregation in living meiocytes. Our experiments were designed to determine (a) how poleward arm motility affects the rate and fidelity of chromosome segregation; and (b) whether the mechanism of neocentromere motility is comparable to the mechanism of kinetochore motility.
 |
Materials and Methods |
|---|
 TopAbstract Materials and Methods ResultsDiscussionReferences |
|---|
Analysis of Living Meiocytes
Tassels from greenhouse-grown plants were harvested at a stage when anthers were 1–2 mm in length. The tips were excised from anthers using a No. 15 scalpel blade, and the meiocytes were gently extruded into a Petri dish filled with liquid culture medium. The culture medium was essentially that published by Pena (1986), except that the sucrose concentration was reduced to 0.1 M and the medium was supplemented with 0.1 M maltose, 1% Guillard's antibiotic concentrated solution (G5535; Sigma Chemical Co., St. Louis, MO), and 0.25 mM n-propyl gallate. The medium was filter sterilized. Meiocytes in roughly 65 µl of culture medium were transferred from the petri dish to a depression slide (12-560A; Fisher Scientific, Pittsburgh, PA). The fluorescent DNA stain Syto 12 was added to the medium at a final concentration of 2 µM (10 other fluorescent DNA stains were found not to stain the chromosomes in cultured maize meiocytes: DAPI, Hoechst 33258, Hoechst 33342, propidium iodide, and Syto 11 and 13–17). A coverslip was placed over the concavity, leaving a 
2 mm air bubble and sealed using rubber cement. The temperature on the microscope stage was maintained at 25 ± 1°C and continuously monitored using a digital recording thermometer. The Syto 12–stained chromosomes were visualized using an FITC filter set.
Cell viability after 6 or 9 h under various treatments (Table I) was determined by adding 5 µm Calcein AM to the cultured cells (Molecular Probes, Eugene, OR). Calcein AM is converted into a fluorescent product in living cells but does not stain dead cells. The 5-min green light treatment (450–490 nm) reported in Table I was delivered using a fluorescence microscope (Axiophot, Zeiss, Inc., Thornwood, NY) with the objective removed so that the entire concavity was irradiated.
|
-tubulin monoclonal antibody (generously supplied by D. Asai, Purdue University, Layfayette, Indiana; Asai et al., 1982), diluted 1:500 in antibody dilution buffer (1x PBS, 3% BSA, 0.02% sodium azide), was applied to the coverslip. The cells were incubated with the tubulin primary antibody in a moist chamber overnight at 30°C. After three 5-min rinses with PBS, the cells were treated for 2 h with 20% goat serum in antibody dilution buffer at 30°C. Rhodamine-conjugated goat anti–mouse secondary antibody (115-025-146; Jackson ImmunoResearch, West Grove, PA) at a dilution of 1:30 in antibody dilution buffer was applied to the coverslip and incubated at 30°C for another 2 h. The cells were stained with 0.01 µg/ml DAPI, mounted in Mowiol mounting medium (Harlow and Lane, 1988), and observed using three-dimensional light microscopy.
Centromere/Spindle Staining.
PCR primers (GATTGGAAACAGTTAAAGAAC and CATGCTTAAAATGGACTCTGT) were used to amplify the pSau3A9 centromere repeat (Jiang et al., 1996) from Sorghum bicolor DNA. The 700-bp PCR product was cloned using the TA cloning kit (Invitrogen Corp., San Diego, CA). The gel-purified insert from this clone was labeled using a random priming kit (Prime-It Fluor; Stratagene, LaJolla, CA) and tetramethylrhodamine-6-dUTP (Boehringer Mannheim, Indianapolis, IN). Unincorporated nucleotides were removed using microcolumns (ProbeQuant G-50; Pharmacia Biotech, Piscataway, NJ) before in situ hybridization. W23 meiocytes were spun down onto poly-L-lysine–coated coverslips and hybridized with the labeled probe essentially as described previously (Dawe and Cande, 1996). Unlike the knob labeling protocol, this protocol involves the use of 30% deionized formamide. The protocol for spindle staining was the same as for knob/ spindle staining, except that all solutions were in 2x PBS, incubations were at 27°C, and the secondary antibody was FITC-conjugated goat anti– mouse (14274020; Boehringer Mannheim).
Microscopy and Image Analysis
All microscopy and image analysis was carried out using a multidimensional microscopy system (DeltaVision SA3.1; Applied Precision Inc., Issaquah, WA) equipped with a thermoelectrically cooled CCD (TEA/ CCD-768K-1UV; Princeton Instruments, Princeton, NJ). Slides were mounted on an inverted microscope (IMT2; Olympus Corp., Lake Success, NY) and observed with a 1.4 oil immersion objective (60x NA; Nikon, Inc., Melville, NY). For observing living meiocytes, the exposure time required for each optical section was reduced to 0.1 s by summing each 2 x 2 array of pixels and assigning the resulting values to one pixel (a process called binning; see Chen et al., 1995). This process increases sensitivity by fourfold but reduces resolution by twofold (pixel size = 0.294 µm). Optical sections from live cells were taken at either 0.5- or 1.0-µm intervals. For fixed specimens, optical sections were taken using a 1.5x Optivar without binning (pixel size = 0.0981 µm) at 0.2-µm intervals.
The out-of-focus information in the raw data was removed by three- dimensional constrained iterative deconvolution (Chen et al., 1995) using software supplied with the DeltaVision system. The resulting images were scaled to optimize contrast but were not processed further. The stereo pair in Fig. 8 was generated by volume rendering (Chen et al., 1995). When making measurements, the cursor was placed over the approximate center of the chromosome or neocentromere being measured. To determine the rate of anaphase chromosome movement in living cells (Table II), two or three pairs of chromosomes (presumably disjoining sister chromatids) were chosen for measurement. The distance between the chromosomes was recorded for each pair at each time point. These distances were divided in half (to obtain the rates for the individual chromosomes), averaged with the distances from the one or two other pairs of chromosomes from the same cell, and plotted with respect to elapsed time. When measuring the distance of neocentromeres from the equatorial plate (see Fig. 10), the equatorial plate was calculated as the midway point between the spindle poles (or when the poles were not well defined, the cell walls closest to the poles).
|
|
|
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
To identify a vital chromosome stain, 11 commercially available fluorescent DNA dyes were screened (see Materials and Methods). Only Syto 12, a green-fluorescent DNA dye, selectively stained living cells. Syto 12 did not affect the viability of maize meiocytes (Table I). However, aberrant division planes were observed when some meiocytes, particularly those going through prometaphase, were exposed to excessive light (490 nm). We were able to eliminate this problem by keeping the total light exposure during time-lapse experiments to <1 min (see Materials and Methods). Four-dimensional data (three dimensions over time) were collected using wide field three-dimensional light microscopy (Chen et al., 1995). To minimize light exposure, images were acquired from four to six optical sections at 1 to 5 min intervals. A series of optical sections from a living meiocyte undergoing meiosis II can be seen in Fig. 1. These and other data indicate that meiosis II in maize takes 5 h to complete: the interkinesis between telophase I and prophase II takes 150 min; prometaphase– metaphase takes 90 min; and anaphase–telophase II takes 60 min.
|
During prometaphase II in both wild-type and Ab10 plants, the chromosomes move towards the spindle and then slowly oscillate in the midzone of the spindle. We defined metaphase as the stage when the chromosomes ceased to oscillate, or alternatively, as the stage when a nonstaining gap appeared between the chromatids at the metaphase plate (presumably due to tension from the half spindles; Fig. 1 A). Significant poleward arm movement was not observed in any of the 38 living wild-type meiocytes observed during prometaphase. However, in the presence of Ab10, distinct poleward chromatin extensions were observed. Fig. 2 shows a living meiocyte from a plant that was homozygous for Ab10 and five additional knobs on other chromosomes (there are 10 chromosomes in maize). Poleward chromatin extensions were first observed 30 min before metaphase (Fig. 2, arrows) and continued throughout prometaphase, metaphase, and anaphase. Evidence that the chromatin extensions observed in live cells are the result of neocentromere activity was obtained by hybridizing fixed cells with fluorescent oligonucleotide probes that identify the knob repeat. Knob-terminated chromatin extensions were clearly observed in one fixed prometaphase II cell (not shown) and two fixed prometaphase I cells carrying Ab10. A meiosis I cell that was fixed and stained for chromosomes, knobs, and microtubules is illustrated in Fig. 3. This cell was heterozygous for Ab10 and at the time of fixation was in the process of aligning the chromosomes on the metaphase plate. As shown, a noticeably elongated neocentromere is positioned midway between the spindle equator and pole (Fig. 3, arrow).
|
|
|
|
As observed in studies with other plants (e.g., Inoue, 1953), we observed that maize microtubules are evenly distributed throughout the spindle in prometaphase I and II. The uniform spindle staining typical of prometaphase can be seen in Fig. 3 C. As the cell progresses into metaphase and anaphase (I or II), the spindle staining shifts to a pattern primarily composed of bundled fibers. The fibers were divided into two classes: the nonkinetochore fibers, which pass from pole-to-pole or terminate without contacting chromosomes; and the kinetochore fibers, which terminate at chromosomes. The kinetochore fibers have the following characteristics: (a) they terminate 0.3 µm from the DAPI-stained chromatin, leaving a nonstaining gap that presumably represents the kinetochore; (b) they are more brightly stained adjacent to the chromosomes (appearing thicker; Fig. 6, arrows); and (c) they interact with centromere/kinetochores as judged by their colocalization with centromere sequences. A conserved cereal centromere sequence that was identified in sorghum by Jiang et al. (1996) was used as a probe for maize chromosomes. The centromere signal was associated with the ends of spindle fibers, as expected if the fibers interact with the centromere/kinetochore complex (Fig. 7). To detect hybridization of the sorghum sequence on maize chromosomes it was necessary to add formamide in the hybridization step (see Materials and Methods). Under these conditions, the kinetochore fibers at metaphase I were resolved into two distinct fibers that presumably interact with the sister kinetochores of the chromosome (Fig. 7, inset). A separation of sister spindle fibers in metaphase I has not been observed previously, but it is consistent with observations from other plants that sister kinetochores can be resolved at late metaphase I (Lima-de-Faria, 1956).
|
|
Rhoades (1952) suggested that the true centromere was inactivated when a neocentromere on the same chromosome was formed. Because of the tight grouping of chromosomes at anaphase, we found it difficult to identify single chromosomes and their respective kinetochore fibers. However, in two cases we were able to identify chromosomes with both an active neocentromere and a distinct kinetochore fiber (one is shown in Fig. 9).
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Neocentromere Activity Has Little Effect on the Overall Rate of Chromosome Segregation: Kinetochores Govern Chromosome Motion at Anaphase
It is well documented that chromosomes segregate synchronously during anaphase even when the chromosomes differ dramatically in size or when forces are applied that restrain poleward motion. For instance, when two segregating chromosomes are joined by a chromatin bridge, chromosome movement continues nearly unabated (Bajer, 1963). Using glass needles to impede chromosome motion, Nicklas estimated that the available force at the kinetochore is 10,000 times more than is actually needed. Nicklas proposed that there is a "governor" at the centromere regulating chromosome motion and indicated that the best candidate for the rate governor is the kinetochore fiber (Nicklas, 1988).
We have shown that neocentromeres can cause a chromosome arm to lengthen by as much as 4 µm during the course of anaphase (Fig. 4). Assuming maize chromosomes are elastic (as are Haemanthus chromosomes; Bajer, 1963), anaphase neocentromere activity generates a poleward force at the kinetochore. However, kinetochores rarely respond by moving faster towards the pole (Fig. 4), providing evidence of a "brake" at the kinetochore. We attribute the braking effect of the kinetochore to structural constraints associated with end-on microtubule interactions at the kinetochore and the slow process of microtubule depolymerization (Nicklas, 1988). Neocentromeres, by interacting with microtubules laterally (Fig. 8), can move rapidly poleward without these constraints.
The importance of nonkinetochore chromosome motility is a matter of debate (Östergren, 1960; Bajer et al., 1987; Fuge, 1990; Adames and Forer, 1996). Recent data show that chromosome arms carry molecular motors that are involved in positioning chromosomes on the metaphase plate (Afshar et al., 1995; Vernos et al., 1995). However, more subtle arm motility events are also observed at anaphase. It has been shown that poleward arm motility at anaphase is a normal part of crane fly spermatogenesis (Fuge, 1975; Adames and Forer, 1996). Similar poleward forces at anaphase have been observed in mammalian cells (Liang et al., 1993). However, it is more commonly observed that chromosome arms move towards the spindle equator during anaphase (e.g., Rieder and Salmon, 1994; Khodjakov et al., 1996). In maize, chromosome arms normally lag behind the kinetochores, presumably applying an away-from-the-pole force to the kinetochore (a chromosome with lagging arms can be seen in the upper right of Fig. 6 A; Rhoades, 1952). Neocentromeres reverse this orientation and apply a poleward force to the kinetochore that only marginally affects the rate of movement (Fig. 4). We have also failed to detect any obvious effects on the fidelity of chromosome segregation. This is surprising because neocentric chromosomes effectively have two centromeres: the true centromere and the neocentromere (Fig. 9). The data of McClintock (1943) and Novitski (1952) suggest that chromatin bridges should be produced from such dicentric chromosomes due to the occasional segregation of linked centromeres to opposite poles. A single Ab10 meiocyte may have a large number of chromosomes with both a centromere and a neocentromere; nevertheless, no chromatin bridges were observed in this study and are apparently very rare (Rhoades, 1952). One possible explanation for the absence of bridges is that the early prometaphase activity of neocentromeres (Figs. 2 and 3; Rhoades, 1952) causes kinetochores to preferentially orient with the poleward-stretching chromosome arms.
The Mechanism of Neocentromere Motility in Maize
As a first step towards understanding the mechanism of neocentromere movement, we determined at which point during the cell cycle neocentromeres are active. The data in Figs. 2 and 3 substantiate the claim by Rhoades (1952) that neocentromeres are first observed in meiotic prometaphase and continue their poleward movement into metaphase. Before our study, it remained possible that all or most of the neocentromere activity was completed in these stages. If the neocentromeres had already moved close to the poles in metaphase, they could have conceivably ceased their poleward motion at anaphase and still arrived early at the poles. However, the data in Fig. 4 showing that chromosome arms continue to stretch during anaphase rule out this possibility. These data, combined with the observation that Ab10 has no effect on the movement of chromosomes lacking knobs (Table II), suggest that Ab10 encodes a product that acts specifically at neocentromeres from prometaphase through anaphase.
Two major forces have been implicated in chromosome movement: the disassembly of spindle fibers at kinetochores (Gorbsky et al., 1988; Waters et al., 1996) and the forces generated by molecular motors at the centromere/ kinetochore complex (Vernos and Karsenti, 1996). Recent data suggest that the two forces are tethered together by molecular motors at the kinetochore, such as CENP-E, which remain coupled to shortening microtubules (Lombillo et al., 1995; Desai and Mitchison, 1995). We believe it is unlikely that microtubule depolymerization plays a major role in neocentromere motility for two reasons. First, neocentromeres interact with spindle microtubules primarily in a lateral manner, not the end-on fashion required to use the energy of depolymerization (Fig. 8). Second, the rate of neocentromere movement varies with knob size (Fig. 10). Tubulin polymerization/depolymerization, while varying as a function of the cell cycle, is relatively uniform within the spindle (Gorbsky et al., 1988; Mitchison and Salmon, 1992). The spindle-wide uniformity of depolymerization is inconsistent with the asynchronous movement of neocentromeres.
Our neocentromere data are best explained by the activity of a motor protein that associates with microtubules laterally. The asynchronous movement of knobs (Fig. 10) is similar to a known motor-driven process: the placement of achiasmate (nonrecombinant) chromosomes in the Drosophila meiotic spindle. Achiasmate chromosomes are seen within metaphase half spindles at locations that correspond to size. Smaller chromosomes are very close to the pole, while larger chromosomes are positioned farther from the pole. The placement of achiasmate chromosomes is regulated by the Drosophila NOD protein, which is a kinesin-like motor that is localized to chromosome arms (Afshar et al., 1995). It has been argued that the larger chromosomes contain more of the NOD protein and as a result are pushed closer to the metaphase plate (Afshar et al., 1995). Similarly, by binding more motor proteins, the larger neocentromeres may be more effective at overcoming the elastic (drag) forces associated with chromosome stretching. In vitro, kinesin-mediated motility is positively correlated with the number of kinesin molecules and negatively correlated with drag forces (e.g., Hunt et al., 1994; Hall et al., 1996). Unlike NOD (Afshar et al., 1995), the motor responsible for neocentromere motility is presumably minus end directed because the minus ends of the microtubules are predominantly localized at the spindle poles (Euteneuer et al., 1982).
Lateral microtubule interactions were observed with nearly all of the 160 neocentromeres analyzed here and appear to be typical of a wide variety of nonkinetochore transport phenomena (for review see Fuge, 1990). For example, rows of microtubules interact laterally with poleward-pointing chromosome arms, as well as with poleward-moving acentric fragments in the crane fly Pales ferruginea (Fuge, 1972, 1975). Microtubules also interact laterally with animal kinetochores during prometaphase (Rieder et al., 1990; Merdes and De May, 1990), and this interaction generates rates of chromosome movement up to 10 times faster than anaphase chromosome movement (Rieder et al., 1990). Similarly, neocentromeres move at rates significantly faster than normal anaphase chromosomes (Fig. 4 and Table II). The similarities to animal prometaphase kinetochores may indicate that neocentromeres are "normal" maize kinetochores that only display prometaphase-like movement. However, the mechanism of chromosome alignment in animal mitotic (astral) spindles and maize meiotic (anastral) spindles may differ significantly (Rieder et al., 1993).
An additional property of kinetochores is that they function as microtubule organizing centers (e.g., Galatis and Apostolakos, 1991). Whether neocentromeres can also nucleate microtubules was addressed indirectly by Rhoades and Dempsey (1966). Using inversion heterozygotes in an Ab10 background, they generated a series of chromatin fragments that carried a knob but lacked a centromere. The knobbed acentric fragments migrated to a pole when they were brought to the equator in meiosis I (by association with a bivalent), but after the neocentromeres had separated from their linked kinetochores at meiosis II, they lost their ability to interact with the spindle. We have reproduced these results and further observed that acentric neocentromeres in meiosis II are nearly always isolated in the cytoplasm and devoid of any association with microtubules (data not shown). Plant spindles are thought to be organized in large part by microtubule nucleation at the kinetochores and side-by-side associations between microtubules (for review see Smirnova and Bajer, 1992; Palevitz, 1993). Given this, one interpretation of the acentric fragment data is that neocentromeres cannot nucleate microtubules. A neocentromere on a chromosome fragment will be ejected from the spindle by its minus end–directed motor activity and once isolated, will have no means of nucleating the microtubules that would allow it to reassociate with the main spindle (Smirnova and Bajer, 1992; Vernos and Karsenti, 1995). An inability to nucleate microtubules is also consistent with the observation that neocentromeres do not interact in an end-on fashion with spindle fibers (Figs. 8 and 9).
In contrast to kinetochores, neocentromeres interact with microtubules laterally, appear to be incapable of regulating their rates of movement, and are probably incapable of congressing on a metaphase plate. The primary similarity to kinetochore motility appears to be the involvement of a microtubule-based motor(s); indeed, all the available data on neocentromeres can be explained by a meiosis-specific, minus end–directed motor activity that interacts either directly or indirectly with knobs from prometaphase to anaphase. No chromosome-associated motors have been identified in plants, although several kinesin-like proteins have recently been described (Liu et al., 1996; Reddy et al., 1996; Wang et al., 1996). To identify the proteins responsible for neocentromere motility, and ultimately the evolutionarily related proteins required for normal chromosome segregation, we are taking a genetic approach. Neocentromeres are one component in a complex meiotic drive system that causes aberrant segregation ratios (for review see Rhoades and Dempsey, 1985). Because neocentromeres are required for meiotic drive, meiotic drive can be used as a phenotype to score for mutations in neocentromere activity (Dawe and Cande, 1996). One mutation derived from such a screen, suppressor of meiotic drive 1 (smd1), showed a 69% reduction in neocentromeres by a quantitative assay (Dawe and Cande, 1996). Smd1, or other genes identified in our ongoing mutant screens, may encode the postulated knob-associated minus end–directed motor.
|
Acknowledgments |
|---|
This work was supported by a grant from the National Science Foundation. A. Chan was supported by a National Institutes of Health grant to W.Z. Cande.
Submitted: 16 July 1997
Revised: 19 September 1997
Address all correspondence to R. Kelly Dawe, Department of Botany, Miller Plant Sciences Building, University of Georgia, Athens, GA 30602. Tel.: (706) 542-1658. Fax: (706) 542-1805. E-mail: kelly{at}dogwood.botany.uga.edu
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Adames KA & Forer A. Evidence for polewards forces on chromosome arms during anaphase, Cell Motil Cytoskeleton, 1996, 34, 13–25.[Medline]
Afshar K, Barton NR, Hawley RS & Goldstein LSB. DNA binding and meiotic chromosomal localization of the DrosophilaNod kinesin-like protein, Cell, 1995, 81, 129–138.[Medline]
Alfenito MR & Birchler JA. Molecular characterization of a maize B chromosome centric sequence, Genetics, 1993, 135, 589–597.[Abstract]
Asai DJ, Brokaw CJ, Thompson WC & Wilson L. Two different monoclonal antibodies to tubulin inhibit the bending of reactivated sea urchin spermatozoa, Cell Motil, 1982, 2, 599–614.[Medline]
Bajer A. Observations of dicentrics in living cells, Chromosoma, 1963, 14, 18–30.
Bajer A, Vantard M & Mole-Bajer J. Multiple mitotic transports expressed by chromosome and particle movement, Fortschr Zool, 1987, 34, 171–186.
Chen, H., J.R. Swedlow, M. Grote, J.W. Sedat, and D.A. Agard. 1995. The collection, processing, and display of digital three-dimensional images of biological specimens. In Handbook of Biological Confocal Microscopy. J.B. Pawley, editor. Plenum Press, New York. 197–210.
Cutler AJ, Saleem M, Coffey MA & Loewen MK. Role of oxidative stress in cereal protoplast recalcitrance, Plant Cell Tiss Organ Cult, 1989, 18, 113–128.
Dawe RK & Cande WZ. Induction of centromeric activity in maize by suppressor of meiotic drive 1, Proc Natl Acad Sci USA, 1996, 93, 8512–8517.
Desai A & Mitchison TJ. A new role for motor proteins as couplers to depolymerizing microtubules, J Cell Biol, 1995, 128, 1–4.
Emmerling MH. Preferential segregation of structurally modified chromosomes in maize, Genetics, 1959, 44, 625–645.
Euteneuer U, Jackson WT & McIntosh JR. Polarity of spindle microtubules in Haemanthusendosperm, J Cell Biol, 1982, 94, 644–653.
Fuge H. Morphological studies on the structure of univalent sex chromosomes during anaphase movement in spermatocytes of the crane fly, Chromosoma, 1972, 39, 403–417.[Medline]
Fuge H. Anaphase transport of akinetochoric fragments in tipulid spermatocytes, Chromosoma, 1975, 52, 149–158.[Medline]
Fuge H. Non-kinetochore transport phenomena, microtubule-chromosome associations, and force transmission in nuclear division, Protoplasma, 1990, 158, 1–9.
Galatis B & Apostolakos P. Patterns of microtubule reappearance in root cells of Vigna sinensisrecovering from a colchicine treatment, Protoplasma, 1991, 160, 131–143.
Gorbsky GJ, Sammak PJ & Borisy GG. Microtubule dynamics and chromosome motion visualized in living anaphase cells, J Cell Biol, 1988, 106, 1185–1192.
Hall K, Cole D, Yeh Y & Baskin RJ. Kinesin force generation measured using a centrifuge microscope sperm-gliding motility assay, Biophys J, 1996, 71, 3467–3476.[Medline]
Harlow, E., and D. Lane. 1988. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. p. 418.
Hunt AJ, Gittes F & Howard J. The force exerted by a single kinesin molecule against a viscous load, Biophys J, 1994, 67, 766–781.[Medline]
Hyman AA & Mitchison TJ. Two different microtubule-based motor activities with opposite polarities in kinetochores, Nature, 1991, 351, 206–211.[Medline]
Inoue S. Polarization optical studies of the mitotic spindle. I. The demonstration of spindle fibers in living cells, Chromosoma, 1953, 5, 487–500.[Medline]
Inoue S & Salmon ED. Force generation by microtubule assembly/ disassembly in mitosis and related movements, Mol Biol Cell, 1995, 6, 1619–1640.[Medline]
Jiang J, Nasuda S, Dong F, Scherrer CW, Woo S, Wing RA, Gill BS & Ward DC. A conserved repetitive DNA element located in the centromeres of cereal chromosomes, Proc Natl Acad Sci USA, 1996, 93, 14210–14213.
Khodjakov A, Cole RW, Bajer AS & Rieder CL. The force for poleward chromosome motion in Haemanthuscells acts along the length of the chromosome during metaphase but only at the kinetochore during anaphase, J Cell Biol, 1996, 132, 1093–1104.
Lima-de-Faria A. The role of the kinetochore in chromosome organization, Hereditas, 1956, 42, 85–160.
Liang H, Wright WH, Cheng S, He W & Berns MW. Micromanipulations of chromosomes in PtK2 cells using laser microsurgery (optical scalpel) in combination with laser-induced optical force (optical tweezers), Exp Cell Res, 1993, 204, 110–120.[Medline]
Liu B, Cyr R & Palevitz BA. A kinesin-like protein, KatAp, in the cells of Arabidopsisand other plants, Plant Cell, 1996, 8, 119–132.[Abstract]
Lombillo VA, Nislow C, Yen TJ, Gelfand VI & McIntosh JR. Antibodies to the kinesin motor domain and CENP-E inhibit microtubule depolymerization-dependent motion of chromosomes in vitro, J Cell Biol, 1995, 128, 107–115.
Longley AE. Knob positions on corn chromosomes, J Agric Res, 1939, 59, 475–490.
Merdes A & De May J. The mechanism of kinetochore-spindle attachment and polewards movement analyzed in PtK2cells at the prophase-prometaphase transition, Eur J Cell Biol, 1990, 53, 313–325.[Medline]
Mitchison TJ & Salmon ED. Poleward kinetochore fiber movement occurs during both metaphase and anaphase-A in newt lung cell mitosis, J Cell Biol, 1992, 119, 569–582.
McClintock B. Maize genetics, Yearbook Carnegie Inst Wash, 1943, 42, 148–152.
Nicklas RB. The forces that move chromosomes in mitosis, Annu Rev Biophys Biophys Chem, 1988, 17, 431–449.[Medline]
Novitski E. The genetic consequences of anaphase bridge formation in Drosophila. , Genetics, 1952, 37, 270–287.
Östergren G, Mole-Bajer J & Bajer A. An interpretation of transport phenomena at mitosis, Ann NY Acad Sci, 1960, 90, 381–408.[Medline]
Palevitz BA. Morphological plasticity of the mitotic apparatus in plants and its developmental consequences, Plant Cell, 1993, 5, 1001–1009.
Peacock WJ, Dennis ES, Rhoades MM & Pryor AJ. Highly repeated DNA sequence limited to knob heterochromatin in maize, Proc Natl Acad Sci USA, 1981, 78, 4490–4494.
Pena ADL. "In vitro" culture of isolated meiocytes of rye, Secale cereale L, Environ Exp Bot, 1986, 26, 17–23.
Pfarr CM, Coue M, Grissom PM, Hays TS, Porter ME & McIntosh JR. Cytoplasmic dynein is localized to kinetochores during mitosis, Nature, 1990, 345, 263–266.[Medline]
Reddy ASN, Narasimhulu SB, Safadi F & Golovkin M. A plant kinesin heavy chain-like protein is a calmodulin-binding protein, Plant J, 1996, 10, 9–21.[Medline]
Rhoades, M.M. 1952. Preferential segregation in maize. In Heterosis. J.W. Gowen, editor. Iowa State College Press, Ames, Iowa. 66–80.
Rhoades MM & Dempsey E. The effect of abnormal chromosome 10 on preferential segregation and crossing over in maize, Genetics, 1966, 53, 989–1020.
Rhoades, M.M., and Dempsey, E. 1985. Structural heterogeneity of chromosome 10 in races of maize and teosinte. In Plant Genetics. M. Freeling, editor. Alan R. Liss, Inc. New York. 1–18.
Rhoades MM & Vilkomerson H. On the anaphase movement of chromosomes, Proc Natl Acad Sci USA, 1942, 28, 433–443.
Rieder CL & Salmon ED. Motile kinetochores and polar ejection forces dictate chromosome position on the vertebrate mitotic spindle, J Cell Biol, 1994, 124, 223–233.
Rieder CL, Alexander SP & Rupp G. Kinetochores are transported poleward along a single astral microtubule during chromosome attachment to the spindle in Newt lung cells, J Cell Biol, 1990, 110, 81–90.
Rieder, C.L., J. Ault, U. Eichenlaub-Ritter, and G. Sluder. 1993. Morphogenesis of the mitotic and meiotic spindle: conclusions from one system are not necessarily applicable to the other. In Chromosome Segregation and Aneuploidy. B.K. Vig, editor. Springer-Verlag, Berlin. 183–197.
Ryan KG. Prometaphase and anaphase chromosome movements in living pollen mother cells, Protoplasma, 1983, 116, 24–33.
Scott P & Lyne RL. The effect of different carbohydrate sources upon the initiation of embryogenesis from barley microspores, Plant Cell Tiss Organ Cult, 1994, 36, 129–133.
Smirnova EA & Bajer A. Spindle poles in higher plant mitosis, Cell Motil Cytoskel, 1992, 23, 1–7.[Medline]
Steuer ER, Wordeman L, Schroer TA & Sheetz MP. Localization of cytoplasmic dynein to mitotic spindles and kinetochores, Nature, 1990, 345, 266–268.[Medline]
Tokai N, Fujimoto-Nishiyama A, Toyishima Y, Yonemura S, Tsukita S, Inoue J & Yamamoto T. Kid, a novel kinesin-like DNA binding protein, is localized to chromosomes and the mitotic spindle, EMBO (Eur Mol Biol Organ) J, 1996, 15, 457–467.[Medline]
Vernos I & Karsenti E. Chromosomes take the lead in spindle assembly, Trends Cell Biol, 1995, 5, 297–301.[Medline]
Vernos I & Karsenti E. Motors involved in spindle assembly and chromosome segregation, Curr Opin Cell Biol, 1996, 8, 4–9.[Medline]
Vernos I, Raats J, Hirano T, Heasman J, Karsenti E & Wylie C. Xklp1, a chromosomal Xenopuskinesin-like protein essential for spindle organization and chromosome positioning, Cell, 1995, 81, 117–127.[Medline]
Wang S & Adler R. Chromokinesin: a DNA-binding, kinesin-like nuclear protein, J Cell Biol, 1995, 128, 761–768.
Wang W, Takezawa D, Narasimhulu SB, Reddy ASN & Poovaiah BW. A novel kinesin-like protein with a calmodulin-binding domain, Plant Mol Biol, 1996, 31, 87–100.[Medline]
Waters JC, Mitchison TJ, Rieder CL & Salmon ED. The kinetochore microtubule minus-end disassembly associated with poleward flux produces a force that can do work, Mol Biol Cell, 1996, 7, 1547–1558.[Abstract]
Wordeman L & Mitchison TJ. Identification and partial characterization of mitotic centromere-associated kinesin, a kinesin-related protein that associates with centromeres during mitosis, J Cell Biol, 1995, 128, 95–104.
Yen TJ & Schaar BT. Kinetochore function: molecular motors, switches and gates, Curr Opin Cell Biol, 1996, 8, 381–388.[Medline]
Yen TJ, Li G, Schaar BT, Szilak I & Cleveland DW. CENP-E is a putative kinetochore motor that accumulates just before mitosis, Nature, 1992, 359, 536–539.[Medline]
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
) Distance of a neocentromere from the metaphase plate; (•) rate of movement for the neocentromere; (
) distance of a normal chromosome from the metaphase plate; (
) rate of movement for the normal chromosome. Rates shown occurred over the preceding time interval; e.g., the rate shown at 7.5 min is the rate that occurred between 5.0 and 7.5 min after anaphase onset.
