|
||

* Department of Neurobiology, Harvard Medical School, Boston, Massachusetts 02115; and
Department of Genetics, Harvard
Medical School, McLean Hospital, Belmont, Massachusetts 02178
Synaptic vesicles are concentrated in the distal axon, far from the site of protein synthesis. Integral membrane proteins destined for this organelle must therefore make complex targeting decisions. Short amino acid sequences have been shown to act as targeting signals directing proteins to a variety of intracellular locations. To identify synaptic vesicle targeting sequences and to follow the path that proteins travel en route to the synaptic vesicle, we have used a defective herpes virus amplicon expression system to study the targeting of a synaptobrevin-transferrin receptor (SB-TfR) chimera in cultured hippocampal neurons. Addition of the cytoplasmic domain of synaptobrevin onto human transferrin receptor was sufficient to retarget the transferrin receptor from the dendrites to presynaptic sites in the axon. At the synapse, the SB-TfR chimera did not localize to synaptic vesicles, but was instead found in an organelle with biochemical and functional characteristics of an endosome. The chimera recycled in parallel with synaptic vesicle proteins demonstrating that the nerve terminal efficiently sorts transmembrane proteins into different pathways. The synaptobrevin sequence that controls targeting to the presynaptic endosome was not localized to a single, 10- amino acid region of the molecule, indicating that this targeting signal may be encoded by a more distributed structural conformation. However, the chimera could be shifted to synaptic vesicles by deletion of amino acids 61-70 in synaptobrevin, suggesting that separate signals encode the localization of synaptobrevin to the synapse and to the synaptic vesicle.
SINCE synaptic vesicles are found at presynaptic specializations in the distal axon, far from the site of
protein synthesis in the cell body, neurons must
have high fidelity mechanisms that regulate the trafficking
of proteins to this organelle during synaptic vesicle biogenesis. Short amino acid sequences in the cytoplasmic domains of transmembrane proteins have been found to encode targeting signals to organelles in many other cell types (Trowbridge et al., 1993 Studies on the biogenesis of synapticlike microvesicles
(SLMVs)1 in the neuroendocrine cell line PC12 suggest
that synaptic vesicles are derived by endocytosis (Kelly et al.,
1993 As polarized cells, neurons have a more complex endosomal system than PC12 cells; they have heterogeneous
subcompartments distributed throughout the axon, dendrites, and cell body (Parton et al., 1992 In this study we examined the mechanisms and pathways of synaptic vesicle biogenesis in cultured hippocampal neurons by following the sorting of a chimera of two
proteins with distinct intracellular localizations. We have
identified two distinct signal-dependent sorting steps that direct the synaptic vesicle protein synaptobrevin to its final
destination. When added to the NH2-terminus of the human transferrin receptor (hTfR), the cytoplasmic domain
of synaptobrevin is sufficient to target the synaptobrevin-transferrin receptor (SB-TfR) chimera to the synapse. This
synapse-targeting signal is not confined to a single, 10-
amino acid region of synaptobrevin, indicating that it depends on either a distributed signal or the overall conformation of the molecule. At the synapse, the chimera is
sorted to a presynaptic endosome, through which it recycles in parallel with synaptic vesicle proteins, revealing that
the nerve terminal is capable of sorting and maintaining
separate populations of recycling membrane proteins. A
distinct signal is required for sorting into synaptic vesicles,
as the chimera can be targeted to this organelle only by the
deletion of amino acids 61-70 in synaptobrevin; deletion
of these amino acids also enhances targeting of synaptobrevin to SLMVs in PC12 cells (Grote et al., 1995 Antibodies
The primary antibodies used in this study were as follows: mAb against
human transferrin receptor (H68.4) was provided by Dr. I. Trowbridge
(Salk Institute, La Jolla, CA) or was purchased from Zymed Labs Inc.
(South San Francisco, CA); cell line for the mAb against human transferrin receptor (OKT9) was purchased from American Type Culture Collection (ATCC) (Rockville, MD); polyclonal antibody against MAP2 was
provided by Dr. R. Vallee (Worchester Foundation for Experimental Biology, Shrewsbury, MA); mAb against rat synaptobrevin II (C1 69.1) was
provided by Dr. R. Jahn (Yale University, New Haven, CT); rabbit polyclonal antibody against the hemagglutinin (HA) epitope tag was purchased
from MBL International (Watertown, MA); mAb against MAP2 (AP20)
was purchased from Boehringer-Mannheim Corp. (Indianapolis, IN); rabbit polyclonal antibody against synaptophysin was provided by Dr. D. Cutler (Medical Research Council, London, England); mAb against synaptophysin (SY38) was purchased from Boehringer Mannheim Corp. (Indianapolis, IN); mAb against SV2 was as described (Buckley and Kelly,
1985 Hippocampal Cell Culture
Primary cultures of rat hippocampal neurons were prepared from E18 rats
(Sprague-Dawley; Taconic, Germantown, NY) as described (Banker and
Cowan, 1977 DNA Constructs
A human transferrin receptor cDNA (McClelland et al., 1984 Herpes Virus Amplicon Packaging
Engineered constructs were packaged as defective herpes simplex virus-1
(HSV-1) particles using an amplicon-based vector as described (Geller
and Breakefield, 1988 Infection of Neurons
Coverslips were removed from the glial cocultures and placed cell side up
in 1 ml of N2 medium (Goslin and Banker, 1991 Immunofluorescence
Cells were fixed in 4% paraformaldehyde, 0.05% glutaraldehyde in PBS
for 10 min at 37°C. The cells were then blocked and permeabilized in a solution of 16% goat serum and 0.1% Triton X-100 in PBS, pH 7.4, for 1 h at
room temperature. Primary antibodies were applied in the block/permeabilization solution at 4°C overnight. After washing twice with PBS containing 0.05% Triton X-100 (to minimize shear force on the neurons), goat
anti-mouse IgG conjugated to fluorescein (Pierce Chemical Co., Rockford, IL) and goat anti-rabbit IgG conjugated to Texas red (Vector Labs,
Inc., Burlingame, CA), secondary antibodies in the block/permeabilization solution were bound for 60 min at room temperature. Cells were
mounted in Vectashield mounting medium (Vector Labs, Inc., Burlingame, CA) to resist bleaching. Neurons were viewed at x40 (dry) or x63
(oil) on a Zeiss axioskop (Carl Zeiss Inc., Thornwood, NY) equipped with epifluorescence and photographed on Kodak (Rochester, NY) asa 400 black and white print film or color slide film. All photographs were taken
with 30-s exposures and treated equivalently during developing. Slides or
negatives were scanned into Photoshop (Adobe Systems Corp., San Jose,
CA) for display. All backgrounds were adjusted equally to ensure that the
images of different constructs can be legitimately compared.
Fractionation of Intracellular Organelles in Glycerol
Velocity Gradients
Neurons were washed with 3 ml buffer A (150 mM NaCl, 10 mM Hepes,
pH 7.4, 1 mM EGTA, 1 mM MgCl2), scraped into 1 ml of buffer A, and
spun down 5 min at 5,500 g. Pellets from four 60-mm dishes (about six million cells) were combined for one gradient. Cells were resuspended in 0.45 ml ice-cold ddH2O and homogenized in a 1 ml Teflon-glass tissue homogenizer for 10 strokes at 500 rpm. After homogenization the osmolarity of
the solution was adjusted with 50 µl of 10x buffer A. Nuclei and unbroken cells were spun out at 1,000 g for 5 min, and a protease inhibitor cocktail was added to the supernatant (1 µg/ml pepstatin, 1 µg/ml aprotinin, 1 mM PMSF, 1 µg/ml leupeptin). Velocity gradients were run essentially as described (Clift-O'Grady et al., 1990 Western Blots
Proteins were separated on 10% SDS-PAGE minigels, and then transferred overnight at 50 V to nitrocellulose in transfer buffer (20 mM Tris,
150 mM glycine, 20% methanol). Proteins were visualized with Ponceau S
to determine the fidelity of transfer. Blots were blocked for 1-8 h at room
temperature in a solution of 5% milk, 5% goat serum in TBST (50 mM
Tris, 150 mM NaCl, 0.05% Tween 20). Primary antibodies were applied
overnight at 4°C in the block solution. Goat anti-mouse IgG conjugated
to HRP (Pierce Chemical Co.) was applied at a dilution of 1:5,000 in the
block solution for 60 min at room temperature. Blots were reacted for 5 min with "SuperSignal" ECL reagents (Pierce Chemical Co.) diluted 1:5
in ddH2O, and exposed to Kodak X-AR film. Bands were quantitated on
a densitometer (LKB-Wallac, Gaithersburg, MD) with the linear range of
the film determined by comparison to synaptosomal standards.
Transferrin Uptake
Coverslips were placed face up in 12-well dishes on a 37°C slide warmer.
Cells were washed twice with Hepes-buffered solution (119 mM NaCl, 2.5 mM KCl, 2 mM CaCl2, 2 mM MgCl2, 25 mM Hepes, pH 7.4, 30 mM glucose, 0.1% albumin). To visualize recycling, Cy3-transferrin (Cy3-Tf; provided by Dr. P. Leopold, Cornell University Medical School, New York)
was added to 0.4 ml of the Hepes solution at 10 µg/ml and incubated for
20 min at 37°C. Cells were washed twice in HBSS (GIBCO BRL, Gaithersburg, MD) before fixing as above. Receptor-mediated uptake was assessed by blocking binding of the labeled Tf with an excess of unlabeled Tf
at 1 µg/ml.
Herpes Infection Does Not Alter Polarized Targeting of
Synaptobrevin or the Transferrin Receptor
To uncover sequences acting as targeting signals in synaptic vesicle proteins, we have used a defective HSV-1 expression system to express mutations and chimeras of two
proteins known to have a polarized distribution in neurons. The transferrin receptor, a marker of early endosomes, is restricted to the dendrites and strictly excluded
from the axon (Cameron et al., 1991
To show that overexpression does not affect protein targeting, we compared the immunofluorescence patterns of
these endogenous proteins to a recombinant human transferrin receptor and an HA epitope-tagged synaptobrevin
expressed from viral vectors. As shown in Fig. 1 b, in cells
infected with a vector encoding human transferrin receptor and stained 20 h later, the immunoreactivity for the expressed transferrin receptor matched exactly the distribution of the endogenous protein: both were found only in
MAP2-positive dendrites and cell bodies, demonstrating
that overexpression of this protein did not cause entry into
the axon. The human transferrin receptor was detected with
the OKT9 mAb, which binds the extracellular domain
(Sutherland et al., 1981 We saw little toxicity from the herpes virus within the time
frame studied (up to 24 h after infection). To demonstrate
that virus infection alone did not influence protein targeting or neuronal morphology, we infected cells with virus
particles containing only the empty cloning vector and
stained for markers of polarity. As shown in Fig. 1 c, in a
cell infected with the empty vector, MAP2 was found in
several short, tapered dendrites, and synaptobrevin was
concentrated in a long, thin axon, indicating that herpes virus infection alone does not alter either the morphological or molecular polarity of these neurons.
The Cytoplasmic Domain of Synaptobrevin Is Sufficient
to Target the Transferrin Receptor to Presynaptic Sites
To identify potential targeting sequences in synaptobrevin, we constructed a chimera consisting of the cytoplasmic
domain of synaptobrevin (amino acids 1-93) added onto the
NH2-terminus of the complete human transferrin receptor
(Fig. 2 a, SB-TfR). Both molecules are topologically similar, with short (61 or 93 amino acids) cytoplasmic NH2-terminal domains and a single transmembrane domain (McClelland et al., 1984
In striking contrast to the axonal exclusion of the transferrin receptor, the SB-TfR chimera expressed in 5 DIV
neurons was found well out into the MAP2-negative axon
(Fig. 2 b). Staining was concentrated in bright puncta, resembling the staining pattern of synaptic vesicle proteins
(compare, for example, to the axonal staining for synaptobrevin in Fig. 1 c). More dendritic staining was seen for the
chimera than for synaptic vesicle proteins at this stage of
development (again compare to Fig. 1 c). The presence of
the chimera in dendrites was not due to targeting sequences contributed by the transferrin receptor in the chimera,
since SV2 (a synaptic vesicle protein) expressed from an
HSV-1 vector also showed significant expression in the
dendrites (data not shown). The elevated levels of dendritic staining may indicate that newly synthesized synaptic vesicle proteins follow the bulk flow of membrane
throughout the cell before recognition of synapse and synaptic vesicle targeting signals locally at the nerve terminal (see Discussion).
The bright axonal puncta of SB-TfR were found at sites
of synaptic vesicle clusters, as indicated by the colocalization of SB-TfR with the synaptic vesicle marker synaptophysin. Clusters of synaptic vesicles (as defined by their
electron microscopic morphology, the presence of synaptic
vesicle proteins, and calcium-dependent exocytosis) can
be found in the axons of isolated neurons as early as 3 DIV, although these organelle clusters remain mobile in
the axon until the time of synapse formation, which begins
to occur just after 3 DIV in neurons that make intercellular contacts (Fletcher et al., 1994
The cytoplasmic domain of the transferrin receptor contains a dendritic targeting signal; deletion of amino acids
3-18 (d3-18/hTfR) results in the appearance of the human
transferrin receptor in the axon of rat hippocampal neurons (West et al., 1997 We were unable to disrupt presynaptic localization of the
SB-TfR chimera by making consecutive deletions of 10 amino acids each through synaptobrevin, suggesting that
the synapse-targeting signal is not a short linear sequence,
but is instead encoded in a distributed signal or dependent
on the global structure of the molecule. Proteins expressed
from a series of nine SB-TfR constructs, each deleted for
10 amino acids in synaptobrevin (d2-10, d11-20, d31-40,
etc. to d81-90) had nearly indistinguishable immunofluorescence patterns. Just like the full-length chimera, each
deletion mutant was expressed as bright puncta well out
into the distal axon in a pattern reminiscent of synaptic
vesicle protein staining (Fig. 4 shows three of the constructs). Fig. 4 a shows a particularly striking example in
which the d11-20/SB-TfR puncta delineate the axon of the
infected cell as it climbs along the dendrites and cell body
of a neighboring uninfected cell. Interestingly, deletion of
amino acids 31-40 in synaptobrevin, which decreases targeting to SLMVs in PC12 cells without reducing endocytosis (Grote et al., 1995
The SB-TfR Chimera Is Sorted to a
Presynaptic Endosome
Although the SB-TfR chimera was concentrated at synapses, upon glycerol gradient fractionation of intracellular
organelles we discovered that the chimera was not sorted
into synaptic vesicles. Fig. 6 shows the results of glycerol
gradient fractionation of hippocampal cultures. To promote the development of synapses and increase the yield
of synaptic vesicles, neurons were plated at high density
(53,000 cell/cm2) and cultured for 7 d before infection. 24 h
after infection, the cells were homogenized and organelles
were separated in a continuous 5-25% glycerol velocity
gradient, a fractionation technique that has been used to
isolate synaptic vesicles from brain and SLMVs from endocrine cells (Clift-O'Grady et al., 1990
Fig. 6 a shows the distribution of synaptic vesicle proteins in this gradient. For each of three integral membrane
proteins of synaptic vesicles (SV2, synaptophysin, and synaptobrevin), a peak of immunoreactivity was present in the
middle of the gradient (Fig. 6 a, lanes 3-5), corresponding
to the small, light, homogeneous synaptic vesicles, which
travel only a short distance into the gradient during centrifugation; a second large peak of immunoreactivity was
present at the bottom of the gradient, corresponding to
protein in endosomes, plasma membrane, or other large
heterogeneous membranes such as Golgi or ER (Clift-O'Grady et al., 1990 To ensure that the SB-TfR chimera was not excluded
from synaptic vesicles because of competing targeting information in the cytoplasmic domain of TfR, we studied
the sorting of another SB-TfR chimera in which the cytoplasmic domain of synaptobrevin was substituted for the
cytoplasmic domain of the human transferrin receptor
(Fig. 7 a). The targeting of the cytoplasmic replacement
chimera was indistinguishable from that of SB-TfR both
by immunofluorescence and by gradient fractionation
(Fig. 7, b and c). Thus the cytoplasmic signals that localize
SB-TfR in the axon must be contained within the synaptobrevin sequence.
By immunofluorescence the SB-TfR chimera was targeted to presynaptic sites, but by biochemical criteria the
chimera was present in an organelle larger than synaptic
vesicles. Since the SB-TfR chimera was sorted to a compartment that cofractionated with endosomes in the glycerol gradient, we asked if this organelle had other properties of a putative presynaptic sorting/recycling endosome. The axonal organelles containing the SB-TfR chimera were
labeled by constitutive endocytotic uptake of Cy3-labeled
human transferrin (Cy3-hTf) from the medium surrounding the cells, indicating that the organelle is derived by
endocytosis, fulfilling one functional criterion of an endosome. Cy3-hTf was added for 20 min to the medium surrounding low density neurons expressing the SB-TfR chimera. Labeling in cells expressing the chimera was present
well out into long, thin axonal processes, in puncta indistinguishable from those labeled by immunofluorescence
for the chimera (Fig. 8 a, compare to Fig. 2 b). Under these
conditions, uptake of the Cy3-hTf by uninfected cells was
minimal, and labeling of axons of uninfected cells was undetectable (Fig. 8 b). Uptake of Cy3-hTf into both infected
and uninfected cells was blocked by addition of a 100-fold
excess of unlabeled hTf, indicating that cell labeling occurred by receptor-mediated endocytosis (data not shown).
These data indicate that the SB-TfR chimera was present
in an axonal organelle derived by endocytosis. Since the
chimera was actively recycling in the axon of unstimulated
neurons, these data are consistent with evidence from the
glycerol gradients that the chimera was in an axonal organelle other than synaptic vesicles; depolarization is required to stimulate the exo-endocytic recycling of synaptic
vesicles and to facilitate the labeling of synaptic vesicle proteins by extracellular markers (Kraszewski et al., 1995
Deletion of Amino Acids 61-70 in
Synaptobrevin Enhances Synaptic Vesicle Targeting
of the SB-TfR Chimera
Previous work in PC12 cells has shown that deletion of
amino acids 61-70 in synaptobrevin increases the amount
of protein targeted into SLMVs from the plasma membrane 50-fold over wild type (Grote et al., 1995 We have shown that multiple sorting steps are required to
target proteins to the synaptic vesicle, and we have found
evidence for cytoplasmic sequences in synaptobrevin that
mediate at least two of these steps: to the synapse and to
the synaptic vesicle. Targeting to the synapse is a distinct
step from entry into the axon. At the synapse we have labeled a presynaptic endosomal compartment through which
proteins recycle in parallel with synaptic vesicle proteins.
Finally, we have presented data supporting the hypothesis that the synaptic vesicle targeting signal acts at the synapse rather than earlier in the pathway, pinpointing the nerve
terminal as the most likely site to find the proteins that assemble synaptic vesicles.
Targeting to the Synapse
The cytoplasmic domain of synaptobrevin contains a signal for localization to the synapse. Addition of synaptobrevin amino acids 1-93 onto the NH2-terminus of the
transferrin receptor, which is normally excluded from the
axon, was sufficient to direct this chimera to presynaptic
sites where it colocalized with the synaptic vesicle protein
synaptophysin. Localization of the chimera to the synapse
was not due to inactivation of the dendritic targeting signal
in the transferrin receptor, because a mutated transferrin receptor lacking the dendritic targeting motif but without
added synaptobrevin sequences entered the axon but did
not accumulate at synapses (West et al., 1997 Protein targeting in neurons is frequently compared to
that of another polarized cell type, the MDCK epithelial
cell line. It has been proposed that the apical/axonal and
basolateral/dendritic plasma membranes are similar and
may share sorting mechanisms (Dotti and Simons, 1990 In contrast to this model, our results show that the targeting sequences that guide the localization of synaptobrevin within the axon are found in the cytoplasmic domain of
the molecule. Short cytoplasmic sequences have been identified as targeting signals for transmembrane proteins trafficking to a variety of intracellular destinations (Trowbridge et al., 1993 That different types of signals are used to sort axonal
proteins suggests that the mechanism used to generate a
restricted distribution of any particular transmembrane
protein may depend on the nature of the compartment to
which that protein is targeted at steady state. The endomembrane system is a dynamic network of intracellular
membranes that flow throughout the cell (Hopkins et al.,
1990 Presynaptic Endosomes
At the nerve terminal, the SB-TfR chimera was sorted into
an organelle with biochemical and functional characteristics of an endosome. The chimera cycled constitutively on
and off the plasma membrane at the synapse, but it was
not detectable in synaptic vesicles, demonstrating that the
nerve terminal can sort recycling membrane proteins in
the endocytic pathway to different intracellular destinations. Protein sorting is one of the primary functions of endosomes; the majority of the membrane and the membrane proteins endocytosed are not degraded, but either
recycle back to the plasma membrane or are targeted to
other intracellular membranes from sorting/recycling endosomes, which shunt recycling membrane proteins away
from those bound for the lysosomal pathway (Trowbridge
et al., 1993 Synaptic Vesicle Assembly at the Nerve Terminal
Although the SB-TfR chimera was present at synapses, it
was not targeted to synaptic vesicles. The deletion of amino
acids 61-70 in synaptobrevin allowed the chimera to enter
synaptic vesicles with an efficiency similar to that of endogenous synaptophysin and synaptobrevin, indicating that
this sequence negatively regulates entry to synaptic vesicles. In PC12 cells, this mutation enhances targeting of
synaptobrevin to SLMVs from the plasma membrane 50-fold (Grote et al., 1995 In PC12 cells, amino acids 31-38 and 41-50 in synaptobrevin are proposed to contain SLMV targeting signals
(Grote et al., 1995 If the synapse-targeting signal functions to trap synaptobrevin in a local recycling circuit as described above, our
data suggest that the synaptic vesicle targeting signal acts
locally to remove synaptobrevin from this circuit into
newly assembled synaptic vesicles. This two-step system
would enable the presynaptic endosomal compartment to
serve as a reservoir for different synaptic vesicle proteins
arriving independently at the nerve terminal until they
were present in the correct ratios for synaptic vesicle assembly to proceed. We observed that the immunofluorescence patterns for all of the deletion chimeras of SB-TfR
were indistinguishable, regardless of whether the proteins
reached synaptic vesicles. Notably, amino acids 31-38 are
necessary for SLMV targeting in PC12 cells (Grote et al.,
1995
; Hunziker and Geuze, 1996
). Synaptic vesicle proteins might be expected to make multiple
sorting decisions as they travel from the TGN to the nerve
terminal; however, the signals that direct these transport
steps and the organelle pathways leading to the synaptic
vesicle in neurons remain ill defined.
; Régnier-Vigouroux and Huttner, 1993
). In these cells,
the synaptic vesicle protein synaptophysin leaves the TGN
in constitutive secretory vesicles that fuse with the plasma
membrane; upon internalization, synaptophysin colocalizes with fluid phase endocytic tracers before being sorted away to SLMVs (Régnier-Vigouroux et al., 1991
). The immediate donor compartment for synaptic vesicles has been
proposed to be either transferrin receptor-containing
early endosomes (Johnston et al., 1989
; Clift-O'Grady et al.,
1990
; Cameron et al., 1991
; Linstedt and Kelly, 1991
) or a
specialized invagination of the plasma membrane that lacks
the transferrin receptor (Schmidt et al., 1997
). Cytoplasmic sequences were identified in the synaptic vesicle protein synaptobrevin that mediate two steps in this sorting pathway (endocytosis and synaptic vesicle targeting) in
PC12 cells (Grote et al., 1995
; Grote and Kelly, 1996
).
; Augenbraun et al.,
1993
; Overly and Hollenbeck, 1996
). The transferrin receptor is found only in endosomes of the dendrites and cell
body (Cameron et al., 1991
; Parton et al., 1992
). The individual synaptic vesicle proteins are thought to travel independently from the TGN to the synapse through several precursor compartments, with final synaptic vesicle assembly occurring only at the nerve terminal (Mundigl et al.,
1993
; Mundigl and De Camilli, 1994
; Okada et al., 1995
).
Synaptic vesicle assembly has been best studied through
the vesicle recycling process that occurs after every round
of release (Holtzman et al., 1971
). Smooth tubular-vesicular, endosomal-like membranes containing small amounts of synaptic vesicle proteins are found in the nerve terminal
in close proximity to synaptic vesicles (Kadota et al., 1994
);
however, the role of an endosomal intermediate in the recycling process is debated (Heuser and Reese, 1973
; De
Camilli and Takei, 1996
; Koenig and Ikeda, 1996
).
). Together these data support the idea that synaptic vesicle
proteins make a number of sorting decisions to reach the synaptic vesicle in neurons, and reinforce the importance
of local events at the nerve terminal for synaptic vesicle
biogenesis.
Materials and Methods
); a cell line producing a mAb against the myc epitope (9E10) was
purchased from ATCC; rabbit polyclonal antibody against SCAMP
(SG7C12) was provided by Dr. D. Castle (University of Virginia, Charlottesville, VA); mAb against the a subunit of rat kidney Na/K-ATPase (Mck1)
was provided by Dr. K. Sweadner (Massachusetts General Hospital, Boston, MA); rabbit polyclonal antibody against translocon-associated protein & subunit (TRAP
) was provided by Dr. T. Rapoport (Harvard
Medical School, Boston, MA); mouse IgG1k (MOPC21) was purchased
from Sigma Chemical Co. (St. Louis, MO).
; Goslin and Banker, 1991
). Neurons were plated onto coverslips at densities of 2,600 cells/cm2 for immunofluorescence. For gradients,
the neurons were plated at 53,000 cells/cm2 onto poly-L-lysine-coated 60-mm tissue culture dishes. Coverslips were cocultured over glia, and dense
cultures for gradients were fed with medium that had been conditioned
over glia for 24 h. Neurons were grown for 5-9 d (stage 4-5 cells [Dotti et al.,
1988
]) before infection, fixation, or fractionation.
) was kindly
provided by Dr. M. Birnbaum (University of Pennsylvania, Philadelphia,
PA). A rat synaptobrevin II cDNA (Elferink et al., 1989
) was isolated by
oligonucleotide hybridization from a rat brain cDNA library in
gt11 (a
gift of Dr. R. Joho, University of Texas, Southwestern Medical School,
Dallas, TX). All PCR was performed with the Pfu enzyme (Stratagene, La
Jolla, CA). A BglII restriction site was engineered by PCR immediately
upstream of the start site of the transferrin receptor cDNA. The cDNA
was cloned into Bluescript SK
(Stratagene) at the BamHI and XbaI sites,
using the XbaI site that lies 45 bases past the stop codon. The synaptobrevin-transferrin receptor chimera was created by the technique of extension overlap PCR (Horton et al., 1993
). Amino acids 1-93 of synaptobrevin were amplified in a PCR reaction that added a BglII site to the 5
end
of synaptobrevin and a region of overlap with transferrin receptor to the
3
region. Amino acids 1-761 of transferrin receptor were amplified adding a region of overlap with amino acids 87-93 of synaptobrevin to the
NH2-terminal end, and including the XbaI cloning site on the 3
end. These
PCR products were annealed, and a second amplification was performed
with only the outside primers. A region of the transferrin receptor from
NdeI (at 451 bases past the transferrin receptor translation start site) to XbaI (at the 3
end) was replaced with an insert from a transferrin receptor cDNA that had not been amplified to eliminate possible mutations
from this region. All constructs were fully sequenced to ensure that no unwanted mutations had been introduced during PCR. Deletions were generated in the chimera by the technique of PCR-ligation-PCR (Ali and
Steinkasserer, 1995
), in which blunt ended products are generated in the
first reaction flanking the region to be deleted. The products are ligated
and a second PCR reaction using the outside primers creates a single product across the ligation. For HA-SB, the HA epitope (MYPYDVPDYA) was
synthesized as an oligonucleotide (ATGTACCCATACGATGTTCCGGATTACGCT) with EcoRI and BamHI ends, cloned into Bluescript SK
and attached in frame at the NH2-terminus of synaptobrevin to a BamHI
site engineered immediately upstream of the synaptobrevin start site. For
SV2-myc, the myc epitope (EQKLISEEDL) was attached in frame to the
COOH-terminus of SV2 by PCR with an oligonucleotide (GAGCAGAAGCTCATCTCAGAAGAAGACCTC). All constructs were cloned
into the defective herpes vector pHSVPrPUC (Geller et al., 1993
) using the SalI and XbaI sites.
; Lim et al., 1996
). Briefly, cDNAs in the vector
pHSVPrPUC were transfected into 2-2 cells (Smith et al., 1992
) with lipofectamine (Life Technologies Inc., Gaithersburg, MD) and superinfected
1 d later with the helper virus strain 5dl 1.2 (McCarthy et al., 1989
). Virus
was harvested and passaged on fresh 2-2 cells three additional times to
amplify the yield and to increase the ratio of vector to helper virus. Stocks
were stored in small aliquots at
70°C and thawed a maximum of three
times. Helper virus was titered in a plaque assay on 2-2 cells, and the vector-containing particles were titered by expression in PC12 cells. The titers
for each stock of virus used in this study are listed here in units of infectious particles x 106/ml as vector (v), helper (h), and vector to helper ratio
(v:h): hTfR, 56(v), 520(h), 0.1(v:h); HA-SB, 167(v), 92(h), 1.8(v:h); SB-TfR,
130(v), 180(h), 0.7(v:h); d3-18/TfR, 27(v), 100(h), 0.3(v:h); d11-20/SB-TfR,
36(v), 68(h), 0.5(v:h); d31-40/SB-TfR, 38(v), 85(h), 0.4(v:h); d41-50/
SB-TfR, 120(v), 370(h), 0.3(v:h); d61-70/SB-TfR, 158(v), 490(h), 0.3(v:h);
SV2myc, 20(v), 138(h), 0.1(v:h).
). Virus was added to the
medium at a multiplicity of infection (based on the vector titer) of 0.1-1.0.
Cells were incubated for 16-24 h before fixing and staining for protein expression. Dense cultures for gradients were infected by adding 3 ml fresh
N2 medium plus virus at an multiplicity of infection of 0.1-0.3 to the culture. The cells were left for 24 h before homogenization.
). The low speed supernatant was
loaded on top of a 4.5 ml continuous 5-25% (in buffer A) glycerol gradient with a 0.4 ml 50% sucrose pad. The gradient was spun for 66 min at 4°C
at 48,000 rpm in an SW50.1 rotor (Beckman Instruments, Fullerton, CA)
in a Sorvall ultracentrifuge. 16 0.3-ml fractions were taken from the top of
the gradient, and every two fractions were combined to yield a total of
eight fractions. To pellet membranes from the fractions, each 0.6 ml was
mixed with 2.5 ml buffer A and placed in 3 ml polycarbonate ultracentrifuge tubes (Beckman Instruments). Membranes were pelleted at 150,000 g
for 2 h at 4°C in a tabletop TLA100.4 rotor. Membrane pellets were resuspended directly into SDS sample buffer and loaded onto SDS-PAGE gels.
Results
; Fig. 1 a). The synaptic vesicle protein synaptobrevin is concentrated in the distal axon (Fig. 1 c), although some immunoreactivity is
present in the dendrites, especially in less mature neurons before synaptogenesis (Mundigl et al., 1993
). We studied
targeting of these proteins in cultured embryonic rat hippocampal neurons, which undergo a characteristic development of polarity in vitro (Dotti et al., 1988
). We infected
neurons after 5-7 d in vitro (DIV), which corresponds to
stages 4-5 of development, when the axons and dendrites
of these cells show clear evidence of morphological and
molecular polarity. Each neuron at this stage has elaborated several short, tapered dendrites that are characterized by their expression of the microtubule-associated protein, MAP2 (Caceres et al., 1984
), and a single, long, thin
axon that can be identified by the absence of MAP2 staining and the accumulation of synaptic vesicle proteins
(Fletcher et al., 1991
).
Fig. 1.
The distribution of
the transferrin receptor and
synaptobrevin expressed from
defective HSV-1 vectors matches
the localization of the endogenous proteins in cultured hippocampal neurons. Neurons cultured for 5-7 d were either
fixed immediately, or infected, and then fixed 20 h later. Asterisks indicate the axon. (a)
The endogenous transferrin
receptor (green) was colocalized with the dendritic marker
MAP2 (red) and was strictly
excluded from the axon. (b)
Human transferrin receptor
(green) expressed from a defective HSV-1 vector was also
restricted to the dendrites
(stained for MAP2 in red). (c)
Endogenous synaptobrevin
(green) in a control cell infected with the empty HSV-1
vector was concentrated in the
distal axon although a small
amount of protein colocalized with MAP2 (red) in the dendrites. (d and e) Synaptobrevin with an NH2-terminal HA epitope tag (red)
expressed from a defective HSV-1 vector was transported well out into the distal axon (dendrites in e were stained for MAP2 in green).
Bar, 20 µm.
[View Larger Version of this Image (16K GIF file)]
) and shows no cross-reactivity with
rat transferrin receptor (data not shown). Epitope-tagged synaptobrevin, which was detected with a rabbit polyclonal
anti-HA antiserum, was present in long, thin MAP2-negative
axons (Fig. 1, d and e), where the endogenous synaptobrevin is known to be concentrated (Fig. 1 c). The localization
of HA-tagged synaptobrevin in the distal axon indicated
that a 20-h incubation was sufficient to target newly synthesized proteins to distant synaptic regions.
; Elferink et al., 1989
). However, rat
synaptobrevin has only two amino acids predicted to be on the lumenal side of the membrane, whereas the transferrin
receptor has an extracellular domain of several hundred
amino acids. Deletion of this extracellular domain did not
affect the localization of the transferrin receptor, nor did
addition of the transferrin receptor extracellular domain
to synaptobrevin influence targeting (data not shown); thus
relevant sorting signals must be found in either the transmembrane or cytoplasmic domains of these proteins.
Fig. 2.
Expression of a SB-TfR chimera in the axon. A cDNA
was constructed by PCR in which the cytoplasmic domain of rat
synaptobrevin II (amino acids 1-93) was added onto the NH2-terminus of the complete human transferrin receptor (amino acids
1-760). Chimeric cDNAs were cloned into a defective HSV-1
vector, packaged, and then infected into neurons on day 5 in
vitro. The cells were fixed 20 h later and the distribution of the
chimera was compared to the dendritic marker MAP2. (a) Diagram of the SB-TfR chimera. (b) SB-TfR was evident as bright
puncta well into the axon of the infected neuron (asterisks) as
well as in the dendrites. (c) MAP2. Bar, 20 µm.
[View Larger Version of this Image (55K GIF file)]
; Kraszewski et al., 1995
).
In cultures expressing the SB-TfR chimera, numerous
bright spots of reactivity for synaptophysin were seen
along the axon (Fig. 3 a, asterisks), indicating the location
of synaptic vesicle clusters. SB-TfR reactivity colocalized precisely with many of these puncta (Fig. 3 b, asterisks correspond to those in Fig. 3 a), indicating that some significant fraction of the chimera was targeted to axonal regions
where synaptic vesicles accumulate. Note that only a subset of the neurons in this field were infected with the chimera as shown by synaptophysin-positive, SB-TfR-negative processes.
Fig. 3.
SB-TfR protein in the axon colocalized with the synaptic vesicle marker synaptophysin at synaptic vesicle clusters. Neurons infected with SB-TfR or d3-18/hTfR-defective HSV-1 vectors on day 5-7 were incubated for 20 h and then double-stained
with antibodies against hTfR and synaptophysin. (a) Bright spots
of synaptophysin staining indicate the location of synaptic vesicle
clusters (asterisks). (b) The SB-TfR chimera was colocalized precisely with synaptophysin at many of the puncta. (c) Synaptophysin marks synaptic vesicle clusters in a cell infected with the
d3-18/hTfR vector. (d) A mutant transferrin receptor (d3-18/
hTfR) that is not restricted to dendrites was not colocalized precisely with synaptophysin. Bar, 10 µm.
[View Larger Version of this Image (69K GIF file)]
). To demonstrate that the localization of the SB-TfR chimera to presynaptic sites in the axon
was due to synaptobrevin sequences rather than inactivation of the dendritic targeting signal, we compared the immunofluorescence patterns of d3-18/hTfR and the SB-TfR chimera in the axon (Fig. 3, c and d). In contrast to
the punctate, intracellular staining extending to the distal
axon seen for SB-TfR, the staining for d3-18/hTfR diminished with distance from the cell body, labeled the plasma
membrane, and was relatively uniform rather than brightly punctate (West et al., 1997
). At high power, the d3-18/hTfR
staining overlapped with, but did not appear similar to
synaptophysin (Fig. 3 c). Thus although deletion of a dendritic targeting signal permitted axonal entry, sequences
from the cytoplasmic domain of synaptobrevin were necessary for precise colocalization of the transferrin receptor with synaptic vesicle proteins. Synaptobrevin sequences
therefore mediated a targeting step within the axon that
localized the SB-TfR chimera to a specific axonal domain.
; Grote and Kelly, 1996
), did not affect the presynaptic localization of the SB-TfR chimera.
Fig. 5 shows that d31-40/SB-TfR colocalized precisely with
synaptophysin at sites of synaptic vesicle clusters. These
data indicate that the signal mediating targeting to the synapse in these neurons is distinct from the SLMV targeting
signal in synaptobrevin identified in PC12 cells (Grote et al.,
1995
).
Fig. 4.
Expression patterns for three deletion mutants of the
SB-TfR chimera in the axons of infected cells. A series of nine
SB-TfR constructs were built in the HSV-1 vector by PCR, each
with a single, 10-amino acid deletion in synaptobrevin (d2-10,
d11-20, etc. to d81-90). 5-7 DIV neurons were infected and
stained 20 h later for the mutant chimeras. The nine constructs
showed nearly indistinguishable distributions of bright puncta extending to the distal axon, and three examples are shown here.
Asterisks mark the axon. (a) d11-20/SB-TfR. A particularly synaptic-looking pattern is seen where the axon of the infected cell
wraps around the cell body of an adjacent uninfected cell (asterisks). (b) d31-40/SB-TfR. (c) d61-70/SB-TfR. Bar, 20 µm.
[View Larger Version of this Image (54K GIF file)]
Fig. 5.
Colocalization of d31-40/SB-TfR with synaptophysin.
Neurons were infected with the d31-40/SB-TfR vector, fixed 20 h
later, and double stained for the chimera and synaptophysin. (a)
d31-40/SB-TfR staining in bright intracellular puncta (asterisks).
(b) Bright puncta of synaptophysin mark synaptic vesicle clusters.
Asterisks indicate the puncta that colocalize with d31-40/SB-TfR. Bar, 10 µm.
[View Larger Version of this Image (18K GIF file)]
). 6 x 106 neurons
were used per gradient (the yield of hippocampal neurons from about one full litter of rats).
Fig. 6.
Distribution of synaptic vesicle proteins, virally
expressed constructs, and
markers of intracellular compartments from homogenized, cultured hippocampal neurons
fractionated on a glycerol velocity gradient. Neurons were
grown at high density (53,000/
cm2) for 7 d and then some
were infected with virus at a
multiplicity of infection of 0.35. 24 h later cells were collected, osmotically lysed, homogenized,
and the organelles separated by velocity centrifugation in a continuous 5-25% glycerol gradient. Control cells were homogenized after 8 DIV. (a) Endogenous synaptic vesicle proteins
showed a bimodal distribution, with a synaptic vesicle peak in
lanes 3-5 and a second peak coincident with larger organelles in
the bottom fractions. SV2 (
), synaptophysin (
), and synaptobrevin (
). (b) Virally expressed constructs. The SB-TfR chimera
was found mainly in the bottom fractions (
). A myc-tagged SV2
construct matched the synaptic vesicle protein pattern (
). hTfR
was present primarily in the bottom fractions (
). (c) Markers of
other intracellular compartments peaked in the bottom fractions
of the gradient: the endogenous rat TfR (endosomes;
), the Na/
K-ATPase (plasma membrane;
), SCAMPs (the recycling
system;
), TRAP
(rough ER;
). (d) The distribution of the
d61-70/SB-TfR chimera was identical to that of synaptic vesicle
proteins. The results of two separate experiments are shown
(d61-70/SB-TfR;
and d61-70/SB-TfR #2;
) along with synaptic vesicle protein distributions from the same gradients (synaptophysin;
and synaptobrevin;
). (e) Two other deletion mutants of the SB-TfR chimera were not targeted to synaptic
vesicles: d11-20/SB-TfR (
) and d31-40/SB-TfR (
).
[View Larger Versions of these Images (17 + 22K GIF file)]
; Schmidt et al., 1997
). Fig. 6 c demonstrates the distribution of a number of markers of these
larger compartments on the gradients. The endogenous transferrin receptor, a marker of early endosomes (Hopkins and Trowbridge, 1983
), the Na/K-ATPase, a plasma
membrane protein (Hammerton et al., 1991
), SCAMP (a
general marker of the recycling system) (Brand et al., 1991
;
Brand and Castle, 1993
), and TRAP
, a rough ER protein
(Prehn et al., 1990
), were all concentrated in the bottom
fractions of the gradient. Fig. 6 b shows the distribution of
three constructs expressed from defective HSV-1 vectors.
The pattern of fractionation of the SB-TfR chimera
matched that of proteins sorted to larger organelles rather
than that of synaptic vesicle proteins (Fig. 6 b,
). The major peak of reactivity for SB-TfR was in the bottom two
fractions, and although some protein was detectable in the
lighter fractions, there was no peak of signal intensity in
Fig. 6 b, lanes 3-5 as would be expected for synaptic vesicle proteins, which are greatly enriched in the middle fractions. Expression of proteins by viral infection did not alter protein targeting. A myc epitope-tagged SV2 protein
expressed from a viral vector showed a peak of reactivity
in fractions 3-5, indicating that it was targeted to synaptic
vesicles, similar to its endogenous counterpart (Fig. 6 b,
), and the distribution of the expressed human transferrin receptor also matched that of the endogenous protein,
concentrated in the bottom two fractions (Fig. 6 b,
).
Fig. 7.
Like SB-TfR, a second
chimera in which the cytoplasmic domain of the transferrin
receptor was replaced with the
cytoplasmic domain of synaptobrevin was concentrated in axonal puncta but did not reach
synaptic vesicles. (a) Diagram of
the Rep/SB-TfR chimera. A
cDNA was constructed by PCR
in which the cytoplasmic domain of synaptobrevin (amino acids
1-93) was attached to the transmembrane and extracellular domains of hTfR (amino acids 61-760). (b) Immunofluorescence of
Rep/SB-TfR expressed from a defective herpes virus vector. Rep/
SB-TfR reactivity was found in bright puncta well out into the
distal axon (asterisks). (c) Distribution of Rep/SB-TfR after fractionation of homogenates of infected neurons in glycerol gradients. Rep/SB-TfR reactivity (
) was concentrated only in the
bottom two fractions of the gradient and did not colocalize with
the peak of synaptophysin representing synaptic vesicles (
) in
fractions 3-5. Bar, 20 µm.
[View Larger Versions of these Images (15 + 58K GIF file)]
).
Fig. 8.
Endocytosis of
Cy3-hTf by SB-TfR in axons.
Cy3-hTf was added at 37°C
to low density cultures of
neurons that either had been infected with the SB-TfR
vector or were uninfected.
After 20 min of labeling, the
cells were washed twice,
fixed, and then mounted in
glycerol for fluorescence microscopy. Asterisks mark the
axons. (a) Endocytosed Cy3-hTf labeling of an SB-TfR-
infected neuron. Bright puncta
were present well out into
the long, thin axon. (b) An
uninfected neuron showed
much less total uptake with
no labeling of the axon. Bar,
20 µm.
[View Larger Version of this Image (32K GIF file)]
). This sequence has been proposed to inhibit the interaction of synaptobrevin with a synaptic vesicle sorting protein (Grote
et al., 1995
). To determine if the same sequence regulated
sorting of the SB-TfR chimera to synaptic vesicles in hippocampal neurons, we expressed the d61-70/SB-TfR chimera in dense cultures of neurons, and fractionated intracellular organelles on a glycerol gradient. In contrast to
the SB-TfR chimera, d61-70/SB-TfR did show a peak of
immunoreactivity in Fig. 6 d, lanes 3-5, cofractionating with the synaptic vesicle markers synaptophysin and synaptobrevin. Quantitation of the bands by densitometry
demonstrated that d61-70/SB-TfR was targeted to the
synaptic vesicle fractions with similar efficiency to synaptophysin and synaptobrevin. 35.3 and 16% of total d61-70/ SB-TfR was recovered in fractions 3-5 in two separate trials as compared to 30% of total synaptophysin and 35.1%
of total synaptobrevin. This distribution differed from that
of the SB-TfR chimera (Fig. 6 b,
) and other deletion
chimeras, for example d11-20/SB-TfR and d31-40/SB-TfR
(Fig. 6 e). Although immunoreactivity for these proteins
was found in some of the upper and middle fractions of the
gradient, they did not peak in Fig. 6 e, lanes 3-5 with the synaptic vesicle proteins, indicating that d11-20/SB-TfR
and d31-40/SB-TfR were not targeted to synaptic vesicles.
Discussion
). This observation suggests that synapse targeting is a separate event
from axonal entry. The synapse-targeting signal was not
restricted to a single, 10-amino acid region of synaptobrevin, which indicates that the signal is either (a) redundant, (b) not colinear, or (c) dependent on the global conformation of the molecule. Regardless of which interpretation is
correct, it is clear that targeting to the synapse is distinct
from sorting to the synaptic vesicle since amino acids 61-70
in synaptobrevin influence protein targeting to synaptic
vesicles without affecting synaptic localization. Thus synaptobrevin makes at least three sorting decisions upon exit
from the TGN: axonal entry, synapse localization, and synaptic vesicle targeting.
).
Apical targeting motifs have been identified in the extracellular or transmembrane domains of proteins (Simons and
Wandinger-Ness, 1990
; Fiedler and Simons, 1995
); lipid
and carbohydrate modifications of proteins also act as apical targeting signals (Lisanti and Rodriguez-Boulan, 1990
;
Fiedler and Simons, 1995
). These sequences are proposed
to act by sorting these proteins to distinct lipid domains in
the TGN and plasma membrane (Simons and Wandinger-Ness, 1990
). In cultured neurons, the polyimmunoglobulin receptor and the
-amyloid precursor protein are targeted
to the axon by similar transmembrane, extracellular, and
carbohydrate signals (de Hoop et al., 1995
; Tienari et al.,
1996
).
), and are thought in many cases to function
by interacting with coated vesicle-associated proteins (Heilker et al., 1996
; Marks et al., 1997
). Consistent with the
idea that synapse-targeting signals differ from the apical/ axonal signals above, the synaptic vesicle protein synaptophysin expressed in MDCK cells recycles equally from
both polar surfaces, indicating that it does not contain a
recognizable apical targeting signal despite the fact that it
is efficiently sorted to synapses in the axon of neurons
(Cameron et al., 1993
).
). Transmembrane proteins internalized into endosomes will follow the path of bulk membrane flow through
the cell unless recognition of a sorting signal causes them
to be retained in a particular branch of the membrane network (Mayor et al., 1993
; French and Lauffenburger, 1996
).
Steady-state maintenance of proper protein sorting from
the endosomal system therefore requires the repeated recognition of sorting signals and retrieval to the proper destination upon each round of recycling. At the nerve terminal, the bulk of internalized membrane flows retrogradely
toward the cell body (Gonatas et al., 1977
). The synaptobrevin synapse-targeting signal may therefore act locally
at the nerve terminal to actively encode axonal and synaptic enrichment of the chimera by repeatedly retrieving the
protein to either the presynaptic endosome or the synaptic
plasma membrane, trapping it in a local recycling circuit.
; Gruenberg and Maxfield, 1995
; Sofer et al.,
1996
). The nerve terminal is the site of the majority of
endocytosis in axons of mature neurons (Parton et al.,
1992
), and proteins internalized here are eventually targeted to a wide variety of intracellular locations. For example, the
-amyloid precursor protein and tetanus toxin
both follow transcytotic pathways from the axon to the
dendrites (Schwab et al., 1979
; Yamazaki et al., 1995
),
whereas wheat germ agglutinin taken up in the axon accumulates in a Golgi or para-Golgi compartment in the cell
body (Gonatas et al., 1977
; Matteoli et al., 1992
). Amyloid
precursor protein colocalizes with synaptic vesicle proteins
in clathrin-coated vesicles purified from rat brain synaptosomes, but it is not present in purified synaptic vesicles
(Ikin et al., 1996
; Marquez-Sterling et al., 1997
). Further
characterization of presynaptic endosomes like the one labeled by SB-TfR may help to reveal the molecular components responsible for these regional sorting events.
). Synaptobrevin is phosphorylated
at serine 61 by calcium/calmodulin protein kinase II, which
could provide a mechanism to physiologically modulate this
regulatory signal and influence targeting (Hirling and Scheller, 1996
).
); however, in neurons, the SB-TfR chimera did not reach synaptic vesicles at detectable levels
despite the presence of these sequences. This result may
reflect saturation of the synaptic vesicle protein-targeting machinery by endogenous synaptobrevin. Alternatively,
competing signals in the transferrin receptor domain could
restrict entry of the chimera into synaptic vesicles unless
the synaptic vesicle targeting signal was strengthened by
the deletion of the negative regulatory domain from amino
acids 61-70.
), but their deletion did not affect synapse targeting in
neurons as indicated by the precise colocalization of d31-
40/SB-TfR with synaptophysin in the axon. This result supports the hypothesis that targeting to the synapse and to
the synaptic vesicle are separate events mediated by distinct signals in synaptobrevin. In addition, it pinpoints the
synapse as the site where the machinery that drives synaptic vesicle assembly is likely be found. Identification of
proteins that interact with the synaptic vesicle targeting
signals in synaptobrevin may help to resolve the debate
over exactly where and how at the nerve terminal synaptic
vesicle proteins are assembled into functional synaptic
vesicles.
Received for publication 19 February 1997 and in revised form 19 August 1997.
Address all correspondence to K.M. Buckley, Department of Neurobiology, Harvard Medical School, 220 Longwood Avenue, Boston, MA 02115. Tel.: (617) 432-2288. Fax: (617) 734-7557. E-mail: kbuckley{at}warren.med.harvard.eduWe thank C. Sadow and J. Cheung for technical assistance. We also thank R. Kelly and E. Grote for sharing their data on synaptobrevin in PC12 cells, M. Birnbaum for the initial idea, P. Leopold, P. Hollenbeck, and K. Overly for invaluable advice, and J.B. Miller, C. Provoda, and P. Purcell for comments on the manuscript.
This work was supported by National Institutes of Health Grant NS27536 (to K.M. Buckley), the Stuart H. and Victoria Quan Fellowship in Neurobiology and National Research Scientist Award 2 T32 NS07009-21 (to A.E. West).
Cy3-hTf, Cy3-labeled human transferrin;
DIV, days in vitro;
HA, hemagglutinin;
HSV-1, herpes simplex virus-1;
hTfR, human transferrin receptor;
SB, synaptobrevin;
SB-TfR, synaptobrevin-transferrin receptor;
SLMV, synapticlike microvesicles;
TRAP
, translocon-associated protein subunit-
.
| 1. | Ali, S.A., and A. Steinkasserer. 1995. PCR-Ligation-PCR mutagenesis: a protocol for creating gene fusions and mutations. Biotechniques. 18: 746-749 [Medline]. |
| 2. | Augenbraun, E., F.R. Maxfield, R. St. Jules, W. Setlik, and E. Holtzman. 1993. Properties of acidified compartments in hippocampal neurons. Eur. J. Cell Biol. 61: 34-43 [Medline]. |
| 3. | Banker, G.A., and W.M. Cowan. 1977. Rat hippocampal neurons in dispersed cell culture. Brain Res. 126: 397-425 [Medline]. |
| 4. | Brand, S.H., and J.D. Castle. 1993. SCAMP 37, a new marker within the general cell surface recycling system. EMBO (Eur. Mol. Biol. Organ.) J. 12: 3753-3761 [Medline]. |
| 5. |
Brand, S.H.,
S.M. Laurie,
M.B. Mixon, and
J.D. Castle.
1991.
Secretory carrier
membrane proteins 31-35 define a common protein composition among
secretory carrier membranes.
J. Biol. Chem.
266:
18949-18957
|
| 6. |
Buckley, K.M., and
R.B. Kelly.
1985.
Identification of a transmembrane glycoprotein specific for secretory vesicles of neural and endocrine cells.
J. Cell
Biol.
100:
1284-1294
|
| 7. | Caceres, A., G. Banker, O. Steward, L. Binder, and M. Payne. 1984. MAP2 is localized to the dendrites of hippocampal neurons which develop in culture. Dev. Brain Res. 13: 314-318 . |
| 8. |
Cameron, P.L.,
T.C. Südhof,
R. Jahn, and
P. De Camilli.
1991.
Colocalization of
synaptophysin with transferrin receptors: implications for synaptic vesicle
biogenesis.
J. Cell Biol.
115:
151-164
|
| 9. | Cameron, P., O. Mundigl, and P. De Camilli. 1993. Traffic of synaptic vesicle proteins in polarized and nonpolarized cells. J. Cell Sci. 17(Suppl.):93-100. |
| 10. |
Clift-O'Grady, L.,
A.D. Linstedt,
A.W. Lowe,
E. Grote, and
R.B. Kelly.
1990.
Biogenesis of synaptic vesicle-like structures in a pheochromocytoma cell
line PC12.
J. Cell Biol.
110:
1693-1703
|
| 11. | De Camilli, P., and K. Takei. 1996. Molecular mechanisms in synaptic vesicle endocytosis and recycling. Neuron. 16: 481-486 [Medline]. |
| 12. |
de Hoop, M.,
C. von Poser,
C. Lange,
E. Ikonen,
W. Hunziker, and
C.G. Dotti.
1995.
Intracellular routing of wild-type and mutated polymeric immunoglobulin receptor in hippocampal neurons in culture.
J. Cell Biol.
130:
1447-1459
|
| 13. | Dotti, C.G., and K. Simons. 1990. Polarized sorting of viral glycoproteins to the axon and dendrites of hippocampal neurons in culture. Cell. 62: 63-72 [Medline]. |
| 14. | Dotti, C.G., C.A. Sullivan, and G.A. Banker. 1988. The establishment of polarity by hippocampal neurons in culture. J. Neurosci. 8: 1454-1468 [Abstract]. |
| 15. |
Elferink, L.A.,
W.S. Trimble, and
R.H. Scheller.
1989.
Two vesicle-associated
membrane protein genes are differentially expressed in the rat central nervous system.
J. Biol. Chem.
264:
11061-11064
|
| 16. | Fiedler, K., and K. Simons. 1995. The role of N-glycans in the secretory pathway. Cell. 81: 309-311 [Medline]. |
| 17. | Fletcher, T.L., P. Cameron, P. De Camilli, and G. Banker. 1991. The distribution of synapsin I and synaptophysin in hippocampal neurons developing in culture. J. Neurosci. 11: 1617-1626 [Abstract]. |
| 18. | Fletcher, T.L., P. De Camilli, and G. Banker. 1994. Synaptogenesis in hippocampal cultures: evidence indicating that axons and dendrites become competent to form synapses at different stages of neuronal development. J. Neurosci. 14: 6695-6706 [Abstract]. |
| 19. | French, A.R., and D.A. Lauffenburger. 1996. Intracellular receptor/ligand sorting based on endosomal retention components. Biotechnol. Bioeng. 51: 281-297 . |
| 20. |
Geller, A.I., and
X.O. Breakefield.
1988.
A defective HSV-1 vector expresses
Escherichia coli -galactosidase in cultured peripheral neurons.
Science.
241:
1667-1669
|
| 21. |
Geller, A.I.,
M.J. During,
J.W. Haycock,
A. Freese, and
R. Neve.
1993.
Long-term increases in neurotransmitter release from neuronal cells expressing a
constitutively active adenylate cyclase from a herpes simplex virus type 1 vector.
Proc. Natl. Acad. Sci. USA.
90:
7603-7607
|
| 22. |
Gonatas, N.K.,
S.U. Kim,
A. Stieber, and
S. Avramens.
1977.
Internalization of
lectins in neuronal GERL.
J. Cell Biol.
73:
1-13
|
| 23. | Goslin, K., and G. Banker. 1991. Rat hippocampal neurons in low density culture. In Culturing Nerve Cells. G. Banker, and K. Goslin, editors. MIT Press, Cambridge, MA. 251-282. |
| 24. |
Grote, E., and
R.B. Kelly.
1996.
Endocytosis of VAMP is facilitated by a synaptic vesicle targeting signal.
J. Cell Biol.
132:
537-547
|
| 25. | Grote, E., J.C. Hao, M.K. Bennett, and R.B. Kelly. 1995. A targeting signal in VAMP regulating transport to synaptic vesicles. Cell. 81: 581-589 [Medline]. |
| 26. | Gruenberg, J., and F.R. Maxfield. 1995. Membrane transport in the endocytic pathway. Curr. Opin. Cell Biol. 7: 552-563 [Medline]. |
| 27. |
Hammerton, R.W.,
K.A. Krzeminski,
R.W. Mays,
T.A. Ryan,
D.A. Wollner, and
W.J. Nelson.
1991.
Mechanism for regulating cell surface distribution of
Na+, K+-ATPase in polarized epithelial cells.
Science.
254:
847-850
|
| 28. | Heilker, R., U. Manning-Kreig, J.-F. Zuber, and M. Spiess. 1996. In vitro binding of clathrin adaptors to sorting signals correlates with endocytosis and basolateral sorting. EMBO (Eur. Mol. Biol. Organ.) J. 15: 2893-2899 [Medline]. |
| 29. |
Heuser, J.E., and
T.S. Reese.
1973.
Evidence for recycling of synaptic vesicle
membrane during neurotransmitter release at the frog neuromuscular junction.
J. Cell Biol.
57:
315-344
|
| 30. |
Hirling, H., and
R.H. Scheller.
1996.
Phosphorylation of synaptic vesicle proteins modulation of the -SNAP interaction with the core complex.
Proc.
Natl. Acad. Sci. USA.
93:
11945-11949
|
| 31. |
Holtzman, E.,
A.R. Freeman, and
L.A. Kashner.
1971.
Stimulation-dependent
alterations in peroxidase uptake at lobster neuromuscular junctions.
Science.
173:
733-736
|
| 32. |
Hopkins, C.R., and
I.S. Trowbridge.
1983.
Internalization and processing of
transferrin and the transferrin receptor in human carcinoma A431 cells.
J.
Cell Biol.
97:
508-521
|
| 33. | Hopkins, C.R., A. Gibson, M. Shipman, and K. Miller. 1990. Movement of internalized ligand-receptor complexes along a continuous endosomal reticulum. Nature. 346: 335-339 [Medline]. |
| 34. | Horton, R.M., S.N. Ho, J.K. Pullen, H.D. Hunt, Z. Cai, and L.R. Pease. 1993. Gene splicing by overlap extension. Methods Enzymol. 217: 270-279 [Medline]. |
| 35. | Hunziker, W., and H.J. Geuze. 1996. Intracellular trafficking of lysosomal membrane proteins. Bioessays. 18: 379-389 [Medline]. |
| 36. |
Ikin, A.F.,
W.G. Annaert,
K. Takei,
P. De Camilli,
R. Jahn,
P. Greengard, and
J.D. Buxbaum.
1996.
Alzheimer amyloid protein precursor is localized in
nerve terminal preparations to rab5-containing vesicular organelles distinct
from those implicated in the synaptic vesicle pathway.
J. Biol. Chem.
271:
31783-31786
|
| 37. | Johnston, P.A., P.L. Cameron, H. Stukenbrok, R. Jahn, P. De Camilli, and T.C. Südhof. 1989. Synaptophysin is targeted to similar microvesicles in CHO and PC12 cells. EMBO (Eur. Mol. Biol. Organ.) J. 8: 2863-2872 [Medline]. |
| 38. |
Kadota, T.,
M. Mizote, and
K. Kadota.
1994.
Dynamics of presynaptic endosomes produced during transmitter release.
J. Electron Microsc.
43:
62-71
|
| 39. | Kelly, R.B., F. Bonzelius, A. Cleves, L. Clift-O'Grady, E. Grote, and G. Herman. 1993. Biogenesis of synaptic vesicles. J. Cell Sci. 17(Suppl.):81-83. |
| 40. |
Koenig, J. H., and
K. Ikeda.
1996.
Synaptic vesicles have two distinct recycling
pathways.
J. Cell Biol.
135:
797-808
|
| 41. | Kraszewski, K., O. Mundigl, L. Daniell, C. Verderio, M. Matteoli, and P. De Camilli. 1995. Synaptic vesicle dynamics in living cultured hippocampal neurons visualized with CY3-conjugated antibodies directed against the lumenal domain of synaptotagmin. J. Neurosci. 15: 4328-4342 [Abstract]. |
| 42. | Lim, F., D. Hartley, P. Starr, P. Lang, S. Song, L. Yu, Y. Wang, and A.I. Geller. 1996. Generation of high-titer defective HSV-1 vectors using an IE 2 deletion mutant and quantitative study of expression in cultured cortical cells. Biotechniques. 20: 460-469 [Medline]. |
| 43. | Linstedt, A.D., and R.B. Kelly. 1991. Synaptophysin is sorted from endocytic markers in neuroendocrine PC12 cells but not in transfected fibroblasts. Neuron. 7: 309-317 [Medline]. |
| 44. | Lisanti, M.P., and E. Rodriguez-Boulan. 1990. Glycophospholipid membrane anchoring provides clues to the mechanism of protein sorting in polarized epithelial cells. Trends Biochem. Sci. 15: 113-118 [Medline]. |
| 45. | Marks, M.S., H. Ohno, T. Kirchhausen, and J.S. Bonifacino. 1997. Protein sorting by tyrosine-based signals: adapting to the Ys and wherefores. Trends Cell Biol. 7: 124-128 . [Medline] |
| 46. |
Marquez-Sterling, N.R.,
A.C.Y. Lo,
S.S. Sisodia, and
E.H. Koo.
1997.
Trafficking of cell-surface amyloid precursor protein: evidence that a sorting intermediate participates in synaptic vesicle recycling.
J. Neurosci.
17:
140-151
|
| 47. |
Matteoli, M.,
K. Takei,
M.S. Perin,
T.C. Südhof, and
P. De Camilli.
1992.
Exo-endocytotic recycling of synaptic vesicles in developing processes of cultured
hippocampal neurons.
J. Cell Biol.
117:
849-861
|
| 48. |
Mayor, S.,
J.F. Presley, and
F.R. Maxfield.
1993.
Sorting of membrane components from endosomes and subsequent recycling to the cell surface occurs by
a bulk flow process.
J. Cell Biol.
121:
1257-1269
|
| 49. |
McCarthy, A.M.,
L. McMahan, and
P. A. Schaffer.
1989.
Herpes simplex virus
type I ICP27 deletion mutants exhibit altered patterns of transcription and
are DNA deficient.
J. Virol.
63:
18-27
|
| 50. | McClelland, A., L.C. Kühn, and F.H. Ruddle. 1984. The human transferrin receptor gene: genomic organization, and the complete primary structure of the receptor deduced from a cDNA sequence. Cell. 39: 267-274 [Medline]. |
| 51. | Mundigl, O., and P. De Camilli. 1994. Formation of synaptic vesicles. Curr. Opin. Cell Biol. 6: 561-567 [Medline]. |
| 52. |
Mundigl, O.,
M. Matteoli,
L. Daniell,
A. Thomas-Reetz,
A. Metcalf,
R. Jahn, and
P. De Camilli.
1993.
Synaptic vesicle proteins and early endosomes in
cultured hippocampal neurons: differential effects of Brefeldin A in axon
and dendrites.
J. Cell Biol.
122:
1207-1221
|
| 53. | Okada, Y., H. Yamazaki, Y. Sekine-Aizawa, and N. Hirokawa. 1995. The neuron-specific kinesin superfamily protein KIF1A is a unique monomeric motor for anterograde axonal transport of synaptic vesicle precursors. Cell. 81: 769-780 [Medline]. |
| 54. |
Overly, C.C., and
P.J. Hollenbeck.
1996.
Dynamic organization of endocytic
pathways in axons of cultured sympathetic neurons.
J. Neurosci.
16:
6056-6064
|
| 55. |
Parton, R.G.,
K. Simons, and
C.G. Dotti.
1992.
Axonal and dendritic endocytic
pathways in cultured neurons.
J. Cell Biol.
119:
123-137
|
| 56. | Prehn, S., J. Henz, E. Hartmann, T.V. Kurzchalia, R. Frank, K. Remisch, B. Dobberstein, and T.A. Rapoport. 1990. Structure and biosynthesis of the signal-sequence receptor. Eur. J. Biochem. 188: 439-445 [Medline]. |
| 57. | Régnier-Vigouroux, A., and W.B. Huttner. 1993. Biogenesis of small synaptic vesicles and synaptic-like microvesicles. Neurochem. Res. 18: 59-64 [Medline]. |
| 58. | Régnier-Vigouroux, A., S.A. Tooze, and W.B. Huttner. 1991. Newly synthesized synaptophysin is transported to synaptic-like microvesicles via constitutive secretory vesicles and the plasma membrane. EMBO (Eur. Mol. Biol. Organ.) J 10: 3589-3601 [Medline]. |
| 59. |
Schmidt, A.,
M.J. Hannah, and
W.B. Huttner.
1997.
Synaptic-like microvesicles
of neuroendocrine cells originate from a novel compartment that is continuous with the plasma membrane and devoid of transferrin receptor.
J. Cell
Biol.
137:
445-458
|
| 60. |
Schwab, M.E.,
K. Suda, and
H. Thoenen.
1979.
Selective retrograde transsynaptic transfer of a protein, tetanus toxin, subsequent to its retrograde axonal
transport.
J. Cell Biol.
82:
798-810
|
| 61. | Simons, K., and A. Wandinger-Ness. 1990. Polarized sorting in epithelia. Cell. 62: 207-210 [Medline]. |
| 62. | Smith, I.L., M.A. Hardwicke, and R.M. Sandri-Goldin. 1992. Evidence that the herpes simplex virus immediate early protein ICP27 acts post-transcriptionally during infection to regulate gene expression. Virology. 186: 74-86 [Medline]. |
| 63. | Sofer, A., G. Schwarzmann, and A.H. Futerman. 1996. The internalization of a short acyl chain analogue of ganglioside GM1 in polarized neurons. J. Cell Sci. 109: 2111-2119 [Abstract]. |
| 64. |
Sutherland, D.R.,
D. Delia,
C. Schneider,
R.A. Newman,
J. Kemshead, and
M.F. Greaves.
1981.
Ubiquitous cell-surface glycoprotein on tumor cells is a
proliferation associated receptor for transferrin.
Proc. Natl. Acad. Sci. USA.
78:
4515-4519
|
| 65. |
Tienari, P.J.,
B. Destrooper,
E. Ikonen,
M. Simons,
A. Wiedemann,
C. Czech,
T. Hartman,
N. Ida,
G. Multhaup,
C.L. Masters, et al
.
1996.
The -amyloid
domain is essential for axonal sorting of amyloid precursor protein.
EMBO
(Eur. Mol. Biol. Organ.) J.
15:
5218-5229
[Medline].
|
| 66. | Trowbridge, I.S., J.F. Collawn, and C.R. Hopkins. 1993. Signal-dependent membrane protein trafficking in the endocytic pathway. Annu. Rev. Cell Biol. 9: 129-161 . |
| 67. |
West, A.E.,
R.L. Neve, and
K.M. Buckley.
1997.
Identification of a somatodendritic targeting signal in the cytoplasmic domain of the transferrin receptor.
J. Neurosci.
17:
6038-6047
|
| 68. |
Yamazaki, T.,
D.J. Selkoe, and
E.H. Koo.
1995.
Trafficking of cell surface amyloid precursor protein: retrograde and transcytotic transport in cultured
neurons.
J. Cell Biol.
129:
431-442
|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|