|
||
© The Rockefeller University Press,
0021-9525/1998//183 $5.00
The Journal of Cell Biology, Volume 140, Number 1,
, 1998 183-195
Article |
Signaling and Adhesion Activities of Mammalian β-Catenin and Plakoglobin in Drosophila

Max-Planck-Institut fuer Immunbiologie, 79108 Freiburg, Germany
The armadillo protein of Drosophila and its vertebrate homologues, β-catenin and plakoglobin, are implicated in cell adhesion and wnt signaling. Here, we examine the conservation of these two functions by assaying the activities of mammalian β-catenin and plakoglobin in Drosophila. We show that, in the female germ line, both mammalian β-catenin and plakoglobin complement an armadillo mutation. We also show that shotgun mutant germ cells (which lack Drosophila E-cadherin) have a phenotype identical to that of armadillo mutant germ cells. It therefore appears that armadillo's role in the germ line is solely in a complex with Drosophila E-cadherin (possibly an adhesion complex), and both β-catenin and plakoglobin can function in Drosophila cadherin complexes. In embryonic signaling assays, we find that plakoglobin has no detectable activity whereas β-catenin's activity is weak. Surprisingly, when overexpressed, either in embryos or in wing imaginal disks, both β-catenin and plakoglobin have dominant negative activity on signaling, an effect also obtained with COOH-terminally truncated armadillo. We suggest that the signaling complex, which has been shown by others to comprise armadillo and a member of the lymphocyte enhancer binding factor-1/T cell factor–family, may contain an additional factor that normally binds to the COOH-terminal region of armadillo.
Abbreviations used in this paper: DE-cadherin, Drosophila E-cadherin; LEF, lymphocyte enhancing binding factor; MBP, maltose-binding protein; TCF, T cell factor; XTCF, xenopus T cell factor.
WNT genes encode secreted glycoproteins required for a large number of developmental processes in a variety of species (for reviews see Nusse and Varmus, 1992; Klingensmith and Nusse, 1994; Parr and McMahon, 1994). In the developing fly, the wnt-1 homologue, wingless, is used at many times and places. Most notably, it is required for the patterning of each segment, and for pattern formation and cell proliferation in imaginal discs (Nusslein-Volhard et al., 1984; Peifer et al., 1991; Neumann and Cohen, 1996). Downstream members of the wingless signaling pathway have been identified and characterized genetically. They include disheveled, shaggy/zeste-white-3, armadillo, and pangolin. Vertebrate homologues of all four genes have also been identified, and recent biochemical work has identified a potential wingless receptor (D-frizzled2) (Bhanot et al., 1996), which also has vertebrate homologues (Wang et al., 1996). Most relevant to this study, armadillo is homologous to both β-catenin and plakoglobin, also known as
-catenin (Peifer and Wieschaus, 1990; Peifer et al., 1992).
In Xenopus laevis, overexpression of β-catenin leads to ectopic axis formation, an effect also obtained with overexpressed Xenopus wnt, implying that β-catenin is part of the wnt pathway (Sokol et al., 1991; Funayama et al., 1995). β-Catenin is clearly required for axis formation as depletion of β-catenin messages leads to ventralization and loss of dorsal structures (Heasman et al., 1994). Overexpression of plakoglobin also induces ectopic axes in Xenopus (Karnovsky and Klymkowsky, 1995), suggesting that it too can act in the wnt pathway.
In addition to their roles in wnt signaling, β-catenin and plakoglobin are components of adherens junctions. β-Catenin forms complexes linking classical cadherins to the actin cytoskeleton via
-catenin (Kemler, 1993; Aberle et al., 1994; Oyama et al., 1994), and formation of such complexes is required for cell–cell adhesion (Nagafuchi and Takeichi, 1988; Ozawa et al., 1990; Hirano et al., 1992). Mice missing E-cadherin (Larue et al., 1994; Riethmacher et al., 1995) or β-catenin (Haegel et al., 1995) exhibit defects in adherens junction function during embryogenesis. Plakoglobin can also form similar cadherin complexes which might be functionally significant (Franke et al., 1989; Knudsen and Wheelock, 1992; Sacco et al., 1995; Chitaev et al., 1996). Plakoglobin is best known for being a major component of desmosomes, junctional structures mediating the interaction between desmosomal cadherins (desmogleins and desmocollins) and intermediate filaments, and is the only known junctional component found in both desmosomes and adherens junctions (Cowin et al., 1986; Garrod, 1993; Koch and Franke, 1994; Chitaev et al., 1996). In contrast, β-catenin does not form complexes with desmosomal cadherins despite strong sequence similarity between classical and desmosomal cadherins (Collins et al., 1991; Mechanic et al., 1991; Wheeler et al., 1991). There seems to be only one armadillo gene in Drosophila. Apparently two distinct adhesion functions have evolved in vertebrates whereas one suffices in Drosophila.
As expected from its homology with β-catenin, armadillo appears to be required for cell–cell adhesion in Drosophila, and evidence so far suggests that the roles in signaling and cadherin complexes are separable (Peifer, 1995; Orsulic and Peifer, 1996; Sanson et al., 1996). Armadillo interacts biochemically with both Drosophila E-cadherin (DE-cadherin)1 (Oda et al., 1994) and
-catenin (D
-catenin) (Oda et al., 1993) and is believed to participate in the adherens junction complex. Defects in cell–cell adhesion and epithelial integrity can be seen in embryos depleted for maternal and zygotic armadillo (Cox et al., 1996). Likewise, an adhesion role has been suggested in the germline; females lacking armadillo activity in the germ line do not lay eggs and their ovaries are abnormal (Peifer et al., 1993; and this work). Because the shaggy/zeste-white-3 and dishevelled genes are not required for oogenesis, it appears that these defects are not due to lack of wingless signaling. Therefore, it was suggested that the defects of armadillo mutant germ cells are due only to a lack of cell adhesion or a cadherin-related function. In this paper we add support to this conclusion by showing that an armadillo mutant germline displays defects identical to those of a DE-cadherin (shotgun) mutant.
The sequence similarity between armadillo and its vertebrate counterparts is strong (71% overall identity with β-catenin and 63% with plakoglobin). Most of the similarity lies in a central "core" repeat region containing 13 42– amino acid repeats, and in the
-catenin binding site at the end of the NH2-terminal domain. The central repeats mediate interactions with a variety of proteins including adenomatous polyposis coli (Rubinfeld et al., 1993), fascin (Tao et al., 1996), pangolin/T cell factor (TCF)/lymphocyte enhancer binding factor-1 (LEF) (Behrens et al., 1996; Brunner et al., 1997; Riese et al., 1997), and DE-cadherin (Oda et al., 1994). The sequence similarity is significantly lower in the NH2- and COOH-terminal domains, the COOH-terminal region of plakoglobin being only 36% identical to armadillo with large intervening gaps. (The plakoglobin COOH-terminal domain is less than half as long as armadillo's and lacks the gly/pro rich region.)
In this paper we examine the functional homology between armadillo, β-catenin, and plakoglobin in vivo, assaying both their signaling and adhesion activities. As there is only one armadillo gene in Drosophila compared with two in vertebrates, encoding β-catenin and plakoglobin, we can assess the activities of these proteins individually without the potential complication arising from the presence of other functional homologues. We find that despite their normal participation in different junctions, both mammalian proteins can fulfill the adhesion (or cadherin-related) role of armadillo. In terms of signaling activity in the wingless pathway, we find that, in the absence of endogenous armadillo, plakoglobin shows none whereas that of β-catenin is low. Surprisingly, in an overexpression assay, both proteins act as dominant negatives on wingless signaling. Because these proteins diverge most at their carboxy termini, we asked whether this dominant negative activity resulted from the absence of a functional COOH-terminal domain. We tested the effect of overexpressing a COOH-terminally truncated form of armadillo. We found that this mutant also has dominant negative activity, thus implying a role for the COOH terminus in the regulation of signaling.
| Materials and Methods |
|---|
|
|
|---|
-catenin was cloned in the prokaryotic expression vector pQE60. Construction was as follows: Drosophila
-catenin carrying a COOH-terminal histidine tag was cloned from pBS-DCT-EK (kind gift of T. Uemura and M. Takeichi, Kyoto University, Kyoto, Japan) by PCR using Pwo-polymerase (Boehringer Mannheim, Mannhein, Germany). An NH2-terminal fragment was amplified with primer D
53 5'-TCAAGATCTATGCTGCAGCCAGCTCTC. One primer was sufficient for amplification since d
53 has a false priming site 18 bp in length on the sense strand at position 942 of the cDNA. A COOH-terminal fragment was amplified with primers D
758 5'ATGCTTAAAAAACATTCAACTATGC and D
2856r 5'AGTCGGCCGTTAAGATCTAACAGCGTCAGCAGGACTC. The NH2-terminal fragment was cut with BglII/MroI and the COOH-terminal fragment with MroI/MscI and MscI/BglII. All three fragments were cloned simultaneously into the BglII site of the prokaryotic expression vector pQE60 (Qiagen Inc., Hilden, Germany). D
-catenin was expressed in Escherichia coli strain M15.
Cells were lysed in buffer H (PBS, pH 7.4, 10 mM imidazole, 0.25% Triton X-100, 10 µ/ml of each DNaseI, PMSF, and leupeptin) using a French pressure cell. His-tagged proteins were isolated from the soluble fraction by affinity chromatography on a Ni2+ chelate resin equilibrated with lysis buffer. After absorption of the proteins, the resin was washed with buffer H containing 10, 20, 40, and 80 mM imidazole, pH 7.4. D
-catenin was eluted stepwise with 250 mM imidazole in PBS. Protein fractions were pooled, adjusted to 50% glycerol, and stored at –20°C.
For in vitro reconstitution, recombinant proteins were mixed in PBS, pH 7.4, containing 0.01% Triton-X100. Protein complexes were collected with amylose agarose, as described in Aberle et al. (1996).
Immunoprecipitations to assay in vivo interactions were done according to Hoschuetzky et al. (1994), except that the lysates were obtained by homogenizing the embryos in a Dounce homogenizer.
Drosophila Expression Constructs (under armadillo Promoter Control)
To express armadillo, β-catenin, and plakoglobin under armadillo control, the expression vector pCASV40 was constructed. An armadillo promoter fragment was excised from pCaSpeR-arm-β-Gal (Vincent et al., 1994) with EcoRI and KpnI and transferred to pCaSpeR-4 (Thummel and Pirrotta, 1992) digested with EcoRI and KpnI. An SV-40 polyA termination sequence was ligated into the BamHI/StuI(blunt) sites of this vector. cDNAs encoding armadillo and human plakoglobin were cut from the prokaryotic expression vectors pGEXArm (Aberle et al., 1996) and pGEXPlako (Aberle et al., 1994) as BamHI/NotI fragments and ligated blunt ended (reverse orientation) into CASV40 digested with BamHI and NotI. Mouse β-catenin cDNA was cut from pGEXBeta (Aberle et al., 1994) as an NdeI/NotI fragment and ligated blunt ended (reverse orientation) into pCASV40 digested with BamHI and NotI. These P-element constructs were injected, and 10 homozygous transformant lines were established for each construct.
Drosophila Expression Constructs (under UAS/Gal4 Control)
UAS-armadillo.
An armadillo cDNA was transferred from the E9 plasmid (E9 cDNA cloned into Bluescript KS(+); Riggleman et al., 1989) as a KpnI/NotI fragment into pUAST (Brand and Perrimon, 1993) digested with KpnI and NotI.
UAS-β–catenin.
A cDNA encoding β-catenin was transferred from pGEXBeta as an NdeI(klenow)/NotI fragment and ligated into pUAST digested with EcoRI(klenow) and NotI.
UAS-plakoglobin.
A cDNA encoding plakoglobin was transferred from pGEXPlako as a BamHI(klenow)/NotI fragment and ligated into pUAST as for β-catenin.
UAS-arm
C.
A truncated form of an armadillo cDNA was inserted in pUAST in such a way as to introduce an in frame stop codon. The site of truncation was at the NdeI at position 2102 downstream of the ATG. This leaves the first 31 residues of repeat 13 unaffected (the XM19 mutation introduces a stop codon at nucleotide 2043). The end generated by NdeI was treated with Klenow and ligated blunt to the T4-polished KpnI end of pUAST. This construction results in one unrelated amino acid (leu) and a stop codon being introduced at the amino terminus of residue 31 of armadillo repeat 13.
UAS-wgts.
As described in Wilder and Perrimon (1995).
Stocks, Constructs, and Generation of Germline Clones
Phenotypes of armXM19, armXP33, and armXK22 have already been described (Peifer et al., 1993; Cox et al., 1996). yw flies were used in transformation and as controls. Generation of germline clones to produce germlines and embryos depleted of maternal product and containing armadilloXM19, armadilloXP33, armadilloXK22, or shotgunIG29 mutant product only were performed using the FLP recombinase–dominant female sterile technique (Chou and Perrimon, 1992). The stocks, XXy f/ovoD1 FRT101; hsflp-38, y w hsflp-12; CyO/ScO, and FRT-G13 ovoD1/CyO are as described in Chou and Perrimon (1992).
For the generation of armadilloXM19 and armadilloXP33 germline clones, second to third instar larvae generated from the cross between arm FRT101/FM7 females and ovoD1 FRT101; hsflp males were heat shocked in an air flow incubator at 37°C for 4 h. This induces site-specific homologous mitotic recombination at the FRT sequences. Due to the presence of the ovoD1 female sterile mutation, which allows only germ cells homozygous for the armadillo mutation to develop, the only fertile females hatching from this cross will have armadillo mutant germlines.
Germline clones homozygous for armadilloXK22 cannot complete oogenesis. Therefore, to assess the rescue of armadilloXK22 germline clones by any transgene, the following stock was constructed: armXK22 FRT101/ FM7; ** (where * denotes the required transgene). These stocks were then used as above to generate armXK22 FRT101/ovoD1 FRT101; */hsflp-38 females with armadilloXK22 mutant germlines and one copy of the required transgene. This method was also used with armadilloXM19 to provide the rescuing transgene or the arm-gal-4 driver maternally in armadilloXM19 germline clones.
For the generation of shotgun germline clones, a recombinant stock y w; shgIG29 FRT-G13/CyO was constructed. Second to third instar larvae from the cross between y w hsflp-12/Y;FRT-G13 ovoD1/CyO males and y w; shgIG29 FRT-G13/CyO females were heat shocked for 4 h at 37°C as above. From this cross, females lacking CyO (genotype y w; hsflp-12/+; FRT-G13 ovoD1/FRT-G13 shgIG29) will contain only shotgunIG29 germ cells.
Whole-Mount Immunocytochemistry and Actin/DNA Visualization
Embryos were dechorionated and fixed for 30 min at the interface of a heptane/7.5% formaldehyde in PBS fix. (For staining with antiarmadillo, anti–β-catenin or antiplakoglobin, the fix also contained Tween-20 to a final concentration of 0.1%.) The aqueous phase was removed and the embryos devitellinized by adding equal amounts of methanol and shaking vigorously. Embryos were then washed for 30 min in PBS/0.1% Triton-X/ 1%BSA/0.05% azide (PTX), and incubated with the primary antibody overnight at 4°C. For antiengrailed staining, a biotinylated secondary followed by peroxidase histochemistry was used. Antiarmadillo, anti–β-catenin, or antiplakoglobin were detected with fluorescent secondaries. All secondary antibodies were from Jackson Laboratory (West Grove, PA). The following primary antibodies were used: antiengrailed (mAb 4D9 from the Developmental Studies Hybridoma Bank, University of Iowa, Des Moines, IA), antiarmadillo (mAb N2 7A1 from the Developmental Studies Hybridoma Bank), anti–β-catenin (mAb C19220 from Transduction Laboratories, Lexington, KY), and antiplakoglobin (mAb C26220 from Transduction Laboratories).
For actin/DNA visualization, ovaries were fixed in 4% paraformaldehyde (PFA) in PBS, 0.1% Tween-20 (PBT) for 20 min, washed in PBT, and stained for 20 min in rhodamine-phalloidin (5% in PBT; Sigma Chemical Co., Poole, UK). They were then washed again in PBT, then in 0.1% Tween-20 in H2O, and stained for 3 min in Hoechst (Sigma B-2883, bis-BENZIMIDE, 10 mg/ml in H2O/0.1% Tween-20) and mounted in Fluoromount-G (Southern Technologies Associates, Birmingham, AL).
Cuticle and Wing Preparations
Embryos collected overnight and aged 24 h were dechorionated, washed in PTX, and mounted in Hoyers' medium. In some cases the vitelline membranes were removed manually after attaching the embryos to double-sided sticky tape.
Wings were dissected in isopropanol and mounted in Euparal.
| Results |
|---|
|
|
|---|
-catenin–binding sites, and mutants show no adhesion defects even in the absence of the wild-type maternal contribution. armadilloXP33 and armadilloXK22 are intermediate and strong alleles, respectively. Homozygotes show a strong segment polarity phenotype indicating no signaling function. In addition, they show adhesion defects in the germline (armadilloXK22; Peifer et al., 1993) and embryo (armadilloXP33; Cox et al., 1996) when wild-type maternal contribution is removed. These adhesion defects are believed to arise because of the inability of the mutant proteins to bind DE-cadherin.
|
Loss of armadillo or DE-Cadherin (shotgun) Function Leads to Identical Phenotypes in the Germline
Localization of armadillo to adherens junctions in the follicle cells and the phenotype of mutant egg chambers has suggested an adhesion function for armadillo in oogenesis (Peifer et al., 1993). If armadillo mutant germ cells are truly deficient for adhesion, we would expect germ cells lacking DE-cadherin function (mutant for shotgun) to look identical to armadillo mutant germ cells. We have examined the germline defects of a strong shotgun mutant, shotgunIG29 (Nusslein-Volhard et al., 1984), and compared them to those of a strong armadillo mutant (armadilloXK22).
Egg chambers lacking armadillo function (armadilloXK22 germlines) show a variety of defects (Fig. 2; see also Peifer et al., 1993). Defects include random positioning of the oocyte within the egg chamber, irregular shape and size of nurse cells and nuclei, floating ring canals, and actin inclusions (Fig. 2, D and E). Cytoplasmic actin filaments in the nurse cells do form, although they are somewhat disorganized and nurse cell dumping (the rapid transfer of nurse cell contents into the oocyte occurring after stage 10) is inhibited. Egg chambers derived from shotgunIG29 germline clones (lacking DE-cadherin function) show strikingly similar phenotypes (Fig. 2, F–I). The oocyte is often mispositioned, and nurse cells have an irregular size and shape and can be multinucleate. Similar disruptions of the actin cytoskeleton, such as floating ring canals (Fig. 2, arrowheads) and actin inclusions, are also visible. Again nurse cell dumping is inhibited despite the formation of cytoplasmic actin filaments. Identical phenotypes exhibited by germ cells mutant for armadillo and shotgun suggests that the two proteins act in the same complex there. This complex is likely to function in cell adhesion, although we cannot exclude yet another activity such as, for example, in organizing the cytoskeleton (see below). In accordance with our analysis of mutant germ lines, it has been recently reported that embryos carrying weaker alleles of armadillo and shotgun also display similar phenotypes. Germ cells carrying either the armadilloXP33 mutation or shotgunP34-1 mutations can survive oogenesis, but the embryos display a similar cuticle phenotype due to disruption of epithelial integrity by loss of adhesion (Cox et al., 1996; Tepass, 1996; Tepass et al., 1996).
|
Mammalian β-Catenin and Plakoglobin Can Form Functional Complexes with Drosophila E-Cadherin and
-Catenin
Before attempting to rescue armadillo mutations with the mammalian homologues, we considered whether the cadherin–catenin and catenin–catenin interactions are conserved across species. First, we investigated the ability of D
-catenin to interact with mammalian β-catenin and plakoglobin in in vitro reconstitution assays. As can be seen in Fig. 3 A, D
-catenin interacts with both β-catenin and plakoglobin. This was expected because D
-catenin and mouse
-catenin are 60% identical. The binding sites themselves seem to be conserved, because plako
128/139, which contains an in frame deletion of its
-catenin binding site, showed a strongly reduced affinity to D
-catenin. Second, we determined whether mammalian β-catenin and plakoglobin can interact with D
-catenin and DE-cadherin in vivo. We expressed β-catenin and plakoglobin in transgenic Drosophila embryos, prepared extracts from such embryos, and assayed protein interactions with immunoprecipitation experiments. Fig. 3 B shows that immunoprecipitates obtained with anti–β-catenin or antiplakoglobin antibodies do contain endogenous D
-catenin (Fig. 3 B, lanes 4 and 6), although, in lesser amounts than immunoprecipitates obtained with antiarmadillo. Likewise, as can be seen in Fig. 3 C, both β-catenin and plakoglobin expressed in transgenic flies interact in vivo with endogenous DE-cadherin.
|
|
Although β-catenin and plakoglobin clearly have the ability to function as adhesion molecules, they do not appear to be as active as wild-type armadillo. This is apparent when we consider the rescue of the germline cadherin- related defects of the strong armadilloXK22 allele. In addition to this rescue, females can lay eggs, and a small percentage of them (2% β-catenin, 1% plakoglobin) are fertilized. (These embryos [Fig. 4, C and F] cannot usually be obtained because of the requirement for armadillo in the germ line.) Although development begins in these embryos, the transgenes are not sufficient for a normal pattern. The head regions and parts of the cuticle are missing much like in a strong zygotic shotgun mutant, suggesting a possible lack of adherens junction function during embryonic development. Thus, whereas there is sufficient activity from β-catenin and plakoglobin to rescue the cadherin-related defects of armadilloXK22 germ lines, there appears to be insufficient activity for the formation of wild-type adherens junctions in the embryo. This is reminiscent of what is seen with the armadilloXP33 allele. In the absence of maternal and zygotic wild-type contribution, the armadilloXP33 allele encodes a protein that has sufficient activity to support oogenesis but insufficient activity for embryogenesis leading to a phenotype similar to that of strong shotgun mutants. This implies that there is a higher requirement for the cadherin-related function of armadillo in the embryo than in the germline. Adding extra doses of the transgene does not improve the phenotype, indicating that expression level of the transgene is probably not the limiting factor. Rather, it is likely that cross-species protein–protein interactions are not as stable as those within a species. Indeed, the cytoplasmic domain of DE-cadherin is only 30% identical to mouse E-cadherin, and this may explain why it binds less tightly to β-catenin and plakoglobin than to armadillo (as shown in Fig. 3).
β-Catenin and Plakoglobin as Signaling Molecules
We looked at the ability of β-catenin and plakoglobin to replace the second function of armadillo—its transduction of the wingless signal. We assayed their ability to rescue a strong segment polarity phenotype. This phenotype was obtained either by removing zygotic function with a strong allele (armadilloXK22; as in Fig. 5) or by removing wild-type maternal function in a weak allele (germline clones of armadilloXM19; as in Fig. 6). Neither of these conditions seem to lead to adhesion defects (Peifer and Wieschaus, 1990).
|
|
We wanted to test whether the activity observed above depends on the presence of wild-type maternal armadillo. To address this issue we analyzed embryos from germline clones containing only armadilloXM19, which appears to have no signaling activity (see Materials and Methods for details), and assayed the rescue of their strong segment polarity phenotype by zygotic expression of β-catenin or plakoglobin (Fig. 6). Expression of engrailed in the ectoderm (used as an indicator of wingless signaling) is completely lost in embryos derived from armadilloXM19 germline clones (Fig. 6 C, expression in the central nervous system is still present), confirming that armadilloXM19 has no signaling function. (The strong segment polarity cuticle phenotype also indicates this [Fig. 6 E].) One copy of the plakoglobin transgene provided zygotically does not rescue engrailed expression (Fig. 6 D), and one copy of β-catenin shows a slight rescue indicated by patches of engrailed expression on the lateral surfaces of the embryo (Fig. 6 B). When these embryos are allowed to make cuticle, the pattern seen is in accordance with the analysis of engrailed expression: no rescue by plakoglobin and slight rescue by β-catenin (data not shown). To eliminate the possibility that the lack of rescue by zygotically provided plakoglobin might be due to expression of the rescuing transgene occurring too late, we repeated the experiments, but this time providing the rescuing transgene maternally (Fig. 6, E–H). Results support the evidence obtained from the zygotic rescue experiments and show that whereas a control armadillo transgene rescues to wild-type (Fig. 6 F), plakoglobin does not rescue the strong segment polarity cuticle phenotype (Fig. 6 H), and β-catenin shows only partial rescue (Fig. 6 G).
The evidence from rescue of armadilloXM19 mutants suggests that, in the absence of wild-type maternal contribution, plakoglobin cannot function in the Drosophila wingless pathway, and β-catenin has only slight activity. This evidence is further supported by the rescue of armadilloXP33 germline clones (see above; Fig. 4 b) where both β-catenin and plakoglobin can fully rescue the adhesion phenotype, but the cuticles obtained are identical to that of wingless null mutants.
To ensure that the near lack of rescue by β-catenin and plakoglobin is not due to insufficient expression, we also assayed the activity of these two proteins expressed at high levels with the Gal-4/UAS system (Brand and Perrimon, 1993). We made females with a germline carrying armadilloXM19 as well as one copy of the arm-gal-4 driver and crossed them to males homozygous for UAS-β-catenin or UAS-plakoglobin (Fig. 7; see Materials and Methods for detail). This enables us to add high levels of β-catenin or plakoglobin in embryos lacking wild-type armadillo activity. There are four equally possible genotypes arising from this cross (Fig. 7). These include heterozygote armadilloXM19, which are viable (column 1), and hemizygote armadilloXM19 males, which show a strong segment polarity phenotype (column 3, maternal contribution is absent). In the case of overexpressed β-catenin, we observe four phenotypic classes, each making up
25% of the progeny. To each we can assign a genotype as indicated in Fig. 7. We find that, as seen in column 2, overexpressed β-catenin leads to a weak segment polarity phenotype (extra denticles in the naked cuticle regions) in armadilloXM19 heterozygous embryos. These embryos are normally identical to wild-type; therefore this indicates a dominant negative effect. Nevertheless, armadilloXM19 mutant embryos are partially rescued by overexpressed β-catenin (column 4) showing that β-catenin has some positive signaling activity as well. In the case of plakoglobin, this phenotypic class (partial rescue) is absent while the proportion of armadilloXM19-like embryos goes to
50%, indicating that plakoglobin has no rescuing activity but like β-catenin, it has dominant negative activity (column 2).
|
Activation of the wingless pathway leads to the stabilization and cytoplasmic accumulation of armadillo (Van Leeuwen et al., 1994). A 54–amino acid region of armadillo containing a glycogen synthase kinase-3 consensus phosphorylation site has been shown to be required for the control of stability by wingless (Pai et al., 1997). Cytoplasmic accumulation can be seen in stripes in embryos stained with antiarmadillo antibodies (Peifer et al., 1994). To find out if β-catenin and plakoglobin are also stabilized in wingless-responding cells, we stained embryos carrying a β-catenin or plakoglobin transgene with the appropriate antibodies. As can be seen in Fig. 8 B, β-catenin does accumulate in stripes like armadillo does (although not as clearly), indicating that β-catenin responds to the upstream components of the pathway despite its relative inability to transduce the signal further downstream. In contrast, we were unable to detect stripes of plakoglobin accumulation in the cytoplasm. This was surprising since the region surrounding the glycogen synthase kinase-3 consensus is highly conserved between armadillo and plakoglobin (even more so than between armadillo and β-catenin). Our antibody against plakoglobin clearly recognizes plakoglobin in situ since we do see membrane staining. It may be that the antibody does not recognize modified, stabilized plakoglobin. Alternatively, plakoglobin may not be stabilized by wingless because another, less conserved region of the protein, possibly in the COOH teminus, is required for stabilization. If the second alternative is correct, one would conclude that plakoglobin does not respond to upstream components of the wingless pathway. In any case, we suggest that it cannot act downstream since it has no rescuing activity even when overexpressed in embryos at levels known to lead to dominant negative effects on endogenous armadillo activity.
|
Overexpression of both wingless and armadillo in the wing induces ectopic vein material and the formation of margin bristles in the blade (Fig. 9). These effects are also observed upon overexpression of Dishevelled suggesting that they represent activation of the wingless pathway. For both wingless and armadillo, we have assessed the dose response; in the case of wingless by driving the expression of a temperature-sensitive protein at different temperature (UAS-wgts) and in the case of armadillo by driving transgenes of various strengths (as determined by position in a phenotypic series). At a low activity, wingless overexpression induces ectopic vein material, whereas at high activity, ectopic bristles form (Fig. 9 D). In the case of armadillo, ectopic veins and bristles appear simultaneously throughout the phenotypic range (Fig. 9 G). The effects of overexpressed β-catenin (Fig. 9, B and C) and plakoglobin (Fig. 9, E and F) differ somewhat from those of overexpressed wingless and armadillo. We do see ectopic vein formation throughout the wing blade, but instead of extra bristles, there is a loss of both anterior and posterior margin bristles (Fig. 9, C and F, arrows). At high levels of overexpression, we see loss of the margin altogether leading to a smaller wing blade (Fig. 9 E). The loss of margin structures, including bristles, is a characteristic of weak wingless loss of function (Couso et al., 1994) and therefore confirms our previous conclusion that β-catenin and plakoglobin have dominant negative activity on wingless signaling.
|
The COOH-terminal Domain of Armadillo Is Required for Signaling
The sequence similarity between plakoglobin/β-catenin and armadillo is significantly lower in the COOH-terminal domain. To ask whether this divergence might explain the dominant negative activity (and thus indicate a requirement for the COOH terminal in signaling), we overexpressed a COOH terminally deleted form of armadillo (arm
C; see Materials and Methods) (Fig. 9, H and I). Like β-catenin and plakoglobin, overexpression of arm
C in wing discs causes a loss of margin bristles indicating dominant negative activity. However, arm
C also induces ectopic bristles and veins in the wing blade, although at a frequency lower than wild-type armadillo (Fig. 9 I, arrowhead). Thus we conclude that, like β-catenin, arm
C does have a dominant negative effect on wingless signaling while at the same time and somewhat paradoxically, retaining some positive activity. This result is confirmed in embryos where overexpression of arm
C in armadilloXM19 germline clones showed slight rescue of the strong segment polarity phenotype (Fig. 7, column 4), but also a dominant negative effect (column 2) similar to that seen with β-catenin and plakoglobin.
| Discussion |
|---|
|
|
|---|
β-Catenin and Plakoglobin Can Act as Adhesion Molecules in Drosophila
Both β-catenin and plakoglobin provide a link between junctional complexes and the cytoskeleton in vertebrate cells. Plakoglobin is believed to be primarily a component of desmosomes that link to intermediate filaments (Cowin et al., 1986) whereas β-catenin participates in adherens junctions that connect to the actin cytoskeleton. Because neither desmosomes nor intermediate filaments have yet been identified in Drosophila (Tepass and Hartenstein, 1994), it may be that plakoglobin arose from a β-catenin– like molecule and took up a specialized role in desmosomes, in the process retaining its ability to participate in adherens junctions. In vitro binding studies have shown that in addition to interacting with desmosomal cadherins, plakoglobin can bind to the adherens junction components E-cadherin (Ozawa et al., 1989; McCrea et al., 1991) and
-catenin (Hinck et al., 1994), although with considerably lower affinity than β-catenin (McCrea and Gumbiner, 1991; Aberle et al., 1994). We have assayed the ability of plakoglobin and β-catenin to form functional adherens junction complexes in Drosophila. We show that both plakoglobin and β-catenin bind in vitro to D
-catenin as well as to DE-cadherin suggesting that the molecular assembly at adhesion complexes has been extensively conserved through evolution. We next applied functional tests of conservation in the armadilloXK22 (strong allele) female germline and in embryos derived from armadilloXP33 (intermediate allele) germline clones. Both conditions lead to phenotypes believed to reflect defects in a cadherin-related function. In accordance with our in vitro results, we find that both β-catenin and plakoglobin rescue these armadillo mutations in flies. Therefore, plakoglobin has the ability to interact functionally with DE-cadherin and D
-catenin, most likely in a similar way as has been shown for vertebrate cadherin complexes. It has never been demonstrated that E-cadherin/plakoglobin/
-catenin complexes are sufficient for adhesion in the absence of β-catenin; our results show that plakoglobin could replace β-catenin if expressed appropriately, although its main functional requirement would be in desmosomes.
Signaling Activity of β-Catenin and Plakoglobin
We have assayed the signaling activity of β-catenin and plakoglobin in Drosophila by looking at their ability to rescue the segment polarity phenotype of armadillo mutants. In the absence of wild-type armadillo, plakoglobin has no signaling activity regardless of whether it is provided maternally or zygotically and in the same assay, β-catenin has weak activity. In the presence of maternal armadillo (zygotic rescue of the strong armadilloXK22 allele), plakoglobin does show some activity. It could be that, by virtue of its ability to form functional adhesion complexes, plakoglobin competes with wild-type maternal armadillo for binding to DE-cadherin creating a larger cytoplasmic pool of armadillo that can act in the signaling pathway (see also below). Alternatively, or in addition, it could compete with armadillo for its negative regulator shaggy/zeste-white-3 thus preventing phosphorylation/ degradation of maternal armadillo, leading to a cytoplasmic enrichment available for signaling. The weak signaling activity of β-catenin in Drosophila (even in the absence of wild-type armadillo) as opposed to the total lack of signaling by plakoglobin confirms the suggestion, based on sequence comparison that β-catenin is the true homologue of armadillo (Peifer et al., 1992). However, from the high sequence identity between β-catenin and armadillo, and the demonstrated ability of Drosophila dishevelled to induce ectopic axis formation in Xenopus (Rothbacher et al., 1995), one might have expected more complete rescue. Homologues of upstream components such as dishevelled and shaggy/zeste-white-3 have been identified and shown to be conserved in frogs and mice. Recently, potential downstream components (LEF-1, XTCF-3 [xenopus T cell factor]) have been uncovered in frogs (Behrens et al., 1996; Molenaar et al., 1996) and a fly homologue, pangolin, has been shown to be involved in wingless signaling (Brunner et al., 1997).
LEF-1 and XTCF-3 are transcription factors that have been shown in vitro to interact with the central repeat region of β-catenin and induce its translocation to the nucleus. Interestingly, LEF-1 and XTCF-3 also interact with plakoglobin and translocate it to the nucleus in a similar fashion (Behrens et al., 1996; Molenaar et al., 1997) suggesting that plakoglobin might be a signaling molecule as well. Moreover, wnt signaling in mammalian tissue culture cells leads to an increase in plakoglobin levels (and, of course, of β-catenin as well; Bradley et al., 1993; Hinck et al., 1994). Consistent with this, plakoglobin contains a region matching a consensus GSK-3 phosphorylation site implying that it might be under wnt control. This contrasts with the complete lack of signaling by plakoglobin (even when overexpressed) that we report as well as with the apparent insensitivity of plakoglobin levels to wingless in Drosophila (Fig. 8). Also, the loss of plakoglobin function in mouse or Xenopus does not indicate a signaling function. In mouse, plakoglobin knock-out leads to a loss of desmosomes in heart tissues and skin defects (Bierkamp et al., 1996; Ruiz et al., 1996) whereas depletion of plakoglobin in Xenopus results in partial adhesion defects (Kofron et al., 1997). More work is needed to determine whether plakoglobin is indeed regulated by GSK-3 and whether its interaction with LEF-1 is functionally significant.
We found that, in an overexpression assay, both β-catenin and plakoglobin have a dominant negative effect in embryos and on bristle formation in the wing margin (where wingless signaling is required). This was surprising in the case of β-catenin because it partially rescues the signaling defect of armadillo mutations. A similarly paradoxical result was obtained with the overexpression of a COOH-terminal deletion of armadillo (arm
C). Arm
C encodes a protein that is truncated within the 13th (and last) armadillo repeat, the same repeat where the armadilloXM19 mutation introduces a nonsense codon (although the truncation is not at an identical position and arm
C is longer by 21 residues; see Materials and Methods). Homozygous armadilloXM19 embryos display a rather weak segment polarity phenotype, indicating that in the presence of wild-type maternal armadillo, this truncated protein makes some positive contribution to wingless signaling. Likewise, arm
C shows a positive effect on signaling in adult precursors where, when overexpressed, it induces margin bristles in the wing blade. However, in apparent contradiction with these positive effects, overexpressed arm
C has a dominant negative effect at the margin where it suppresses bristle formation. We have suggested that an adhesion-competent protein (such as β-catenin, plakoglobin, or arm
C) could have a positive effect at low level by freeing up residual maternal armadillo from the membrane, making it available for signaling. However, β-catenin and arm
C clearly have signaling activity even in the absence of maternal wild-type armadillo. This activity is weak, and when either protein is expressed at a high level it brings down the level of signaling, probably by titrating away one or more components required for a fully active signaling complex. For example, β-catenin, plakoglobin, and arm
C are likely to have retained the ability to bind Drosophila LEF-1/TCF/pangolin, as this interaction is mediated by the central repeat region. But, this complex may not be sufficient to fully activate transcription of target genes due to loss of, or a nonfunctional COOH-terminal domain. In this way, pangolin would be titrated out of the wingless pathway and into a nonsignaling (or weakly signaling) complex leading to the dominant negative effects observed.
Our results suggest that a factor binding to the COOH-terminal domain of armadillo is required for maximum signaling activity. We anticipate that the COOH-terminal domain of β-catenin is equally important in vertebrates, although this proposal appears inconsistent with the findings in Xenopus that the core region is sufficient to activate the pathway when overexpressed. One possible explanation for the discrepancy is that at very high expression levels, as often attained in Xenopus (e.g., Heasman et al., 1994), the core is weakly active on its own and that once the axis-specifying process has been initiated, it is self- enhanced by endogenous wild-type protein. Nevertheless, it is clear from the low signaling activity and dominant negative effect of arm
C that the COOH-terminal region of armadillo is crucial to transduce the signal.
It appears that the different domains of armadillo and β-catenin required for signaling have been differentially conserved in evolution: The central core region and its interaction with pangolin is highly conserved (Drosophila armadillo core binds to mouse LEF-1; Riese et al., 1997), while the COOH-terminal domain and its interaction with other factors is more diverged. In contrast, the various domains required for cell adhesion (such as the domains of interaction with
-catenin and cadherin) have been coordinately conserved. The signaling domains that have not been conserved may correspond to those that are not required for adhesion. This appears true for the COOH-terminal region that, while being required for signaling, is poorly conserved and completely dispensable for cell adhesion (Orsulic and Peifer, 1996).
| Acknowledgments |
|---|
Submitted: 24 March 1997
Revised: 31 October 1997
Address all correspondence to Jean-Paul Vincent, Medical Research Council, National Institute for Medical Research, The Ridgeway Mill Hill, London NW7 1AA, United Kingdom. Tel.: (44) 181 959 3666 ext. 2004. Fax: (44) 181 913 8543. E-mail: JP.Vincent{at}nimr.mrc.ac.uk
| References |
|---|
|
|
|---|
Aberle H, Butz S, Stappert J, Weissig H, Kemler R & Hoschuetzky H. Assembly of the cadherin-catenin complex in vitro with recombinant proteins, J Cell Sci, 1994, 107, 3655–3663.[Abstract]
Aberle H, Schwartz H, Hoschuetzky H & Kemler R. Single amino acid substitutions in proteins of the armadillogene family abolish their binding to
-catenin, J Biol Chem, 1996, 271, 1520–1526.
Baker N. Embryonic and imaginal requirements for wingless, a segment-polarity gene in Drosophila. , Dev Biol, 1988, 125, 96–108.[Medline]
Behrens J, von Kries J, Kuhl M, Bruhn L, Wedlich D, Grosschedl R & Birchmeier W. Functional interaction of β-catenin with the transcription factor LEF-1, Nature, 1996, 382, 638–642.[Medline]
Bhanot P, Brink M, Samos C, Hsieh J-C, Wang Y, Macke J, Andrew D, Nathans J & Nusse R. A new member of the frizzled family from Drosophilafunctions as a wingless receptor, Nature, 1996, 382, 225–230.[Medline]
Bierkamp C, McLaughlin K, Schwarz H, Huber O & Kemler R. Embryonic heart and skin defects in mice lacking plakoglobin, Dev Biol, 1996, 180, 780–785.[Medline]
Bradley RS, Cowin P & Brown AM. Expression of wnt-1 in PC12 cells results in modulation of plakoglobin and E-cadherin and increased cellular adhesion, J Cell Biol, 1993, 123, 1857–1865.
Brand AH & Perrimon N. Targeted gene expression as a means of altering cell fates and generating dominant phenotypes, Development (Camb), 1993, 118, 401–415.[Abstract]
Brunner E, Peter O, Schweizer L & Basler K. pangolin encodes a LEF-1 homologue that acts downstream of armadillo to transduce the wingless signal in Drosophila. , Nature, 1997, 385, 829–833.[Medline]
Cant K, Knowles BA, Mooseker MS & Cooley L. Drosophila singed, a fascin homolog, is required for actin bundle formation during oogenesis and bristle extension, J Cell Biol, 1994, 125, 369–380.
Capdevila J & Guerrero I. Targeted expression of the signaling molecule decapentaplegic induces pattern duplications and growth alterations in Drosophilawings, EMBO (Eur Mol Biol Organ) J, 1994, 13, 4459–4468.[Medline]
Chitaev NA, Leube RE, Troyanovsky RB, Eshkind LG, Franke WW & Troyanovsky SM. The binding of plakoglobin to desmosomal cadherins: patterns of binding sites and topogenic potential, J Cell Biol, 1996, 133, 359–369.
Chou TB & Perrimon N. Use of a yeast site-specific recombinase to produce female germline chimeras in Drosophila. , Genetics, 1992, 131, 643–653.[Abstract]
Collins JE, Legan PK, Kenny TP, MacGarvie J, Holton JL & Garrod DR. Cloning and sequence analysis of desmosomal glycoproteins 2 and 3 (desmocollins): cadherin-like desmosomal adhesion molecules with heterogeneous cytoplasmic domains, J Cell Biol, 1991, 113, 381–391.
Cooley L, Verheyen E & Ayers K. chickadee encodes a profilin required for intercellular cytoplasm transport during Drosophilaoogenesis, Cell, 1992, 69, 173–184.[Medline]
Couso JP, Bishop SA & Martinez-Arias A. The wingless signaling pathway and the patterning of the wing margin in Drosophila. , Development (Camb), 1994, 120, 621–636.[Abstract]
Cowin P, Kapprell HP, Franke WW, Tamkun J & Hynes RO. Plakoglobin: a protein common to different kinds of intercellular adhering junctions, Cell, 1986, 46, 1063–1073.[Medline]
Cox RT, Kirkpatrick C & Peifer M. Armadillo is required for adherens junction assembly, cell polarity, and morphogenesis during Drosophilaembryogenesis, J Cell Biol, 1996, 134, 133–148.
Franke WW, Goldschmidt MD, Zimbelmann R, Mueller HM, Schiller DL & Cowin P. Molecular cloning and amino acid sequence of human plakoglobin, the common junctional plaque protein, Proc Natl Acad Sci USA, 1989, 86, 4027–4031.
Funayama N, Fagotto F, McCrea P & Gumbiner BM. Embryonic axis induction by the armadillo repeat domain of β-catenin: evidence for intracellular signaling, J Cell Biol, 1995, 128, 959–968.
Garrod DR. Desmosomes and hemidesmosomes, Curr Opin Cell Biol, 1993, 5, 30–40.[Medline]
Gutzeit HO. The role of microfilaments in cytoplasmic streaming in Drosophilafollicles, J Cell Sci, 1986, 80, 159–169.[Abstract]
Haegel H, Larue L, Ohsugi M, Fedorov L, Herrenknecht K & Kemler R. Lack of β-catenin affects mouse development at gastrulation, Development (Camb), 1995, 121, 3529–3537.[Abstract]
Heasman J, Crawford A, Goldstone K, Garner HP, Gumbiner B, McCrea P, Kintner C, Noro CY & Wylie C. Overexpression of cadherins and underexpression of β-catenin inhibit dorsal mesoderm induction in early Xenopusembryos, Cell, 1994, 79, 791–803.[Medline]
Hinck L, Nathke IS, Papkoff J & Nelson WJ. Dynamics of cadherin/catenin complex formation: novel protein interactions and pathways of complex assembly, J Cell Biol, 1994, 125, 1327–1340.
Hirano S, Kimoto N, Shimoyama Y, Hirohashi S & Takeichi M. Identification of a neural
-catenin as a key regulator of cadherin function and multicellular organization, Cell, 1992, 70, 293–301.[Medline]
Hoschuetzky H, Aberle H & Kemler R. β-catenin mediates the interaction of the cadherin-catenin complex with epidermal growth factor receptor, J Cell Biol, 1994, 127, 1375–1380.
Karnovsky A & Klymkowsky MW. Anterior axis duplication in Xenopusinduced by the over-expression of the cadherin-binding protein plakoglobin, Proc Natl Acad Sci USA, 1995, 92, 4522–4526.
Kemler R. From cadherins to catenins: cytoplasmic protein interactions and regulation of cell adhesion, Trends Genet, 1993, 9, 317–321.[Medline]
Klingensmith J & Nusse R. Signaling by wingless in Drosophila. , Dev Biol, 1994, 166, 396–414.[Medline]
Knudsen KA & Wheelock MJ. Plakoglobin, or an 83-kD homologue distinct from β-catenin, interacts with E-cadherin and N-cadherin, J Cell Biol, 1992, 118, 671–679.
Koch PJ & Franke WW. Desmosomal cadherins: another growing multigene family of adhesion molecules, Curr Opin Cell Biol, 1994, 6, 682–687.[Medline]
Kofron M, Spagnuolo A, Klymkowsky M, Wylie C & Heasman J. The roles of maternal
-catenin and plakoglobin in the early Xenopusembryo, Development (Camb), 1997, 124, 1553–1560.[Abstract]
Larue L, Ohsugi M, Hirchenhain J & Kemler R. E-cadherin null mutant embryos fail to form a trophectoderm epithelium, Proc Natl Acad Sci USA, 1994, 91, 8263–8267.
Lawrence PA, Sanson B & Vincent J-P. Compartments, wingless and engrailed: patterning the ventral epidermis of Drosophilaembryos, Development (Camb), 1996, 122, 4095–4103.[Abstract]
Mahajan-Miklos S & Cooley L. The villin-like protein encoded by the Drosophila quailgene is required for actin bundle assembly during oogenesis, Cell, 1994, 78, 291–301.[Medline]
McCrea PD & Gumbiner BM. Purification of a 92-kD cytoplasmic protein tightly associated with the cell–cell adhesion molecule E-cadherin (uvomorulin). Characterization and extractability of the protein complex from the cell cytostructure, J Biol Chem, 1991, 266, 4514–4520.
Mechanic S, Raynor K, Hill JE & Cowin P. Desmocollins form a distinct subset of the cadherin family of cell adhesion molecules, Proc Natl Acad Sci USA, 1991, 88, 4476–4480.
Molenaar M, van de Wetering M, Oosterwegel M, Peterson MJ, Godsave S, Korinek V, Roose J, Destree O & Clevers H. XTcf-3 transcription factor mediates β-catenin–induced axis formation in Xenopusembryos, Cell, 1996, 86, 391–399.[Medline]
Nagafuchi A & Takeichi M. Cell binding function of E-cadherin is regulated by the cytoplasmic domain, EMBO (Eur Mol Biol Organ) J, 1988, 7, 3679–3684.[Medline]
Neumann CJ & Cohen SM. Distinct mitogenic and cell fate specification functions of wingless in different regions of the wing, Development (Camb), 1996, 122, 1781–1789.[Abstract]
Nusse R & Varmus HE. wntgenes, Cell, 1992, 69, 1073–1087.[Medline]
Nusslein-Volhard C, Wieschaus E & Kluding H. Mutations affecting the pattern of the larval cuticle in Drosophilamelanogaster. - I. Zygotic loci on the second chromosome, Roux's Arch Dev Biol, 1984, 193, 267–282.
Oda H, Uemura T, Shiomi K, Nagafuchi A, Tsukita S & Takeichi M. Identification of a Drosophilahomologue of
-catenin and its association with the armadillo protein, J Cell Biol, 1993, 121, 1133–1140.
Oda H, Uemura T, Harada Y, Iwai Y & Takeichi M. A Drosophilahomolog of cadherin associated with armadillo and essential for embryonic cell–cell adhesion, Dev Biol, 1994, 165, 716–726.[Medline]
Orsulic S & Peifer M. An in vivo structure-function study of armadillo, the β-catenin homologue, reveals both separate and overlapping regions of the protein required for cell adhesion and for wingless signaling, J Cell Biol, 1996, 134, 1283–1300.
Oyama T, Kanai Y, Ochiai A, Akimoto S, Oda T, Yanagihara K, Nagafuchi A, Tsukita S, Shibamoto S & Ito F. A truncated β-catenin disrupts the interaction between E-cadherin and
-catenin: a cause of loss of intercellular adhesiveness in human cancer cell lines, Cancer Res, 1994, 54, 6282–6287.
Ozawa M, Baribault H & Kemler R. The cytoplasmic domain of the cell adhesion molecule uvomorulin associates with three independent proteins structurally related in different species, EMBO (Eur Mol Biol Organ) J, 1989, 8, 1711–1717.[Medline]
Ozawa M, Ringwald M & Kemler R. Uvomorulin-catenin complex formation is regulated by a specific domain of the cytoplasmic region of the cell adhesion molecule, Proc Nat Acad Sci USA, 1990, 87, 4246–4250.
Pai L-M, Orsulic S, Bejsovec A & Peifer M. Negative regulation of armadillo, a wingless effector in Drosophila. , Development (Camb), 1997, 124, 2255–2266.[Abstract]
Parr BA & McMahon AP. wnt genes and vertebrate development, Curr Opin Genet Dev, 1994, 4, 523–528.[Medline]
Peifer M. Cell adhesion and signal transduction: The armadillo connection, Trends Cell Biol, 1995, 5, 224–229.[Medline]
Peifer M & Wieschaus E. The segment polarity gene armadillo encodes a functionally modular protein that is the Drosophilahomolog of human plakoglobin, Cell, 1990, 63, 1167–1176.[Medline]
Peifer M, Rauskolb C, Williams M, Riggleman B & Wieschaus E. The segment polarity gene armadillointeracts with the wingless signaling pathway in both embryonic and adult pattern formation, Development (Camb), 1991, 111, 1029–1043.
Peifer M, McCrea PD, Green KJ, Wieschaus E & Gumbiner BM. The vertebrate adhesive junction proteins β-catenin and plakoglobin and the Drosophila segment polarity gene armadilloform a multigene family with similar properties, J Cell Biol, 1992, 118, 681–691.
Peifer M, Orsulic S, Sweeton D & Wieschaus E. A role for the Drosophila segment polarity gene armadilloin cell adhesion and cytoskeletal integrity during oogenesis, Development (Camb), 1993, 118, 1191–1207.[Abstract]
Peifer M, Sweeton D, Casey M & Wieschaus E. Wingless signal and zeste-white 3 kinase trigger opposing changes in the intracellular distribution of armadillo, Development (Camb), 1994, 120, 369–380.[Abstract]
Riese J, Yu X, Munnerlyn A, Eresh S, Hsu S-C, Grosschedl R & Bienz M. LEF-1 a nuclear factor coordinating signaling inputs from wingless and decapentaplegic. , Cell, 1997, 88, 777–787.[Medline]
Riethmacher D, Brinkmann V & Birchmeier C. A targeted mutation in the mouse E-cadherin gene results in defective preimplantation development, Proc Natl Acad Sci USA, 1995, 92, 855–859.
Riggleman B, Wieschaus E & Schedl P. Molecular analysis of the armadillo locus: uniformly distributed transcripts and a protein with novel internal repeats are associated with a Drosophilasegment polarity gene, Genes Dev, 1989, 3, 96–113.
Rothbacher U, Laurent MN, Blitz IL, Watabe T, Marsh JL & Cho KW. Functional conservation of the wnt signaling pathway revealed by ectopic expression of Drosophila dishevelled in Xenopus. , Dev Biol, 1995, 170, 717–721.[Medline]
Rubinfeld B, Souza B, Albert I, Muller O, Chamberlain SH, Masiarz FR, Munemitsu S & Polakis P. Association of the APC gene product with β-catenin, Science, 1993, 262, 1731–1734.
Ruiz P, Brinkmann V, Ledermann B, Behrend M, Grund C, Thalhammer C, Vogel F, Birchmeier C, Gunthert U, Franke WW & Birchmeier W. Targeted mutation of plakoglobin in mice reveals essential functions of desmosomes in the embryonic heart, J Cell Biol, 1996, 135, 215–225.
Sacco PA, McGranahan TM, Wheelock MJ & Johnson KR. Identification of plakoglobin domains required for association with N-cadherin and
-catenin, J Biol Chem, 1995, 270, 20201–20206.
Sanson B, White P & Vincent J-P. Uncoupling cadherin-based adhesion from wingless signaling in Drosophila. , Nature, 1996, 383, 627–630.[Medline]
Sokol S, Christian JL, Moon RT & Melton DA. Injected wnt RNA induces a complete body axis in Xenopusembryos, Cell, 1991, 67, 741–752.[Medline]
Tao YS, Edwards RA, Tubb B, Wang S, Bryan J & McCrea PD. β-Catenin associates with the actin-bundling protein fascin in a noncadherin complex, J Cell Biol, 1996, 134, 1271–1281.
Tepass U. Crumbs, a component of the apical membrane, is required for zonula adherens formation in primary epithelia of Drosophila. , Dev Biol, 1996, 177, 217–225.[Medline]
Tepass U & Hartenstein V. The development of cellular junctions in the Drosophilaembryo, Dev Biol, 1994, 161, 563–596.[Medline]
Tepass U, Gruszynski DE, Haag TA, Omatyar L, Torok T & Hartenstein V. shotgun encodes DrosophilaE-cadherin and is preferentially required during cell rearrangement in the neurectoderm and other morphogenetically active epithelia, Genes Dev, 1996, 10, 672–685.
Thummel CS & Pirrotta V. Technical notes: new pCasper P-element vectors, DIS (Drosophila Information Service), 1992, 71, 150.
van Leeuwen F, Samos CH & Nusse R. Biological activity of soluble wingless protein in cultured Drosophilaimaginal disc cells, Nature, 1994, 368, 342–344.[Medline]
Vincent J-P, Girdham CH & O'Farrell PH. A cell-autonomous, ubiquitous marker for the analysis of Drosophilagenetic mosaics, Dev Biol, 1994, 164, 328–331.[Medline]
Wang Y, Macke JP, Abella BS, Andreasson K, Worley P, Gilbert DJ, Copeland NG, Jenkins NA & Nathans J. A large family of putative transmembrane receptors homologous to the product of the Drosophila tissue polarity gene frizzled. , J Biol Chem, 1996, 271, 4468–4476.
Wheeler GN, Parker AE, Thomas CL, Ataliotis P, Poynter D, Arnemann J, Rutman AJ, Pidsley SC, Watt FM, Rees DA et al.. Desmosomal glycoprotein DGI, a component of intercellular desmosome junctions, is related to the cadherin family of cell adhesion molecules, Proc Natl Acad Sci USA, 1991, 88, 4796–4800.
Wilder EL & Perrimon N. Dual functions of wingless in the Drosophilaleg imaginal disc, Development (Camb), 1995, 121, 477–488.[Abstract]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|