|
||
-Filagenin, a Newly Identified Protein
Coassembling with Myosin and Paramyosin
in Caenorhabditis elegans

* Department of Neurology,
Department of Microbiology and Immunology, and § Department of Biochemistry, Baylor College
of Medicine, Houston, Texas 77030
| |
Abstract |
|---|
|
|
|---|
Muscle thick filaments are stable assemblies
of myosin and associated proteins whose dimensions
are precisely regulated. The mechanisms underlying the
stability and regulation of the assembly are not understood. As an approach to these problems, we have studied the core proteins that, together with paramyosin,
form the core structure of the thick filament backbone
in the nematode Caenorhabditis elegans. We obtained
partial peptide sequences from one of the core proteins,
-filagenin, and then identified a gene that encodes a
novel protein of 201-amino acid residues from databases using these sequences.
-Filagenin has a calculated isoelectric point at 10.61 and a high percentage of
aromatic amino acids. Secondary structure algorithms
predict that it consists of four
-strands but no
-helices. Western blotting using an affinity-purified antibody showed that
-filagenin was associated with the
cores.
-Filagenin was localized by immunofluorescence microscopy to the A bands of body-wall muscles,
but not the pharynx.
-filagenin assembled with the
myosin homologue paramyosin into the tubular cores
of wild-type nematodes at a periodicity matching the
72-nm repeats of paramyosin, as revealed by immunoelectron microscopy. In CB1214 mutants where
paramyosin is absent,
-filagenin assembled with myosin to form abnormal tubular filaments with a periodicity identical to wild type. These results verify that
-filagenin is a core protein that coassembles with either myosin or paramyosin in C. elegans to form tubular
filaments.
| |
Introduction |
|---|
|
|
|---|
THE thick filaments of striated muscles are stable,
highly differentiated supramolecular structures in
contrast to the dynamic assemblies of the cytoskeleton. In the assembly of muscle thick filaments, myosin
forms characteristic structures of uniform symmetry, length,
and diameter. However, myosin alone, in the case of vertebrate thick filaments, and myosin and its homologous
companion paramyosin, in invertebrates, do not assemble
in this characteristic manner in the test tube. Furthermore,
transgenic experiments in Drosophila melanogaster show
that different myosin isoforms from muscles with structurally distinct thick filaments can be exchanged with one another without changes in the muscle-specific assembly (Wells et al., 1996
). The cellular mechanisms for assembling these
intricate and regularly organized structures of striated muscle, therefore, are still not understood, despite their significance in hereditary cardiac and neuromuscular diseases,
protein metabolism in starvation and diabetes, and normal
muscle development (Epstein and Fischman, 1991
).
The nematode Caenorhabditis elegans provides a genetically, biochemically, and structurally tractable model for
studying mechanisms of filament assembly in muscle. The
thick filaments of C. elegans body-wall muscle contain two
myosins with different myosin heavy chains. The two myosins are differentially located in the thick filaments with
myosin A (its heavy chain encoded by myo-3) in the center, and myosin B (its heavy chain encoded by unc-54) in the polar regions (Miller et al., 1983
). Furthermore, paramyosin (Waterston et al., 1974
; Harris and Epstein, 1977
),
an
-helical coiled-coil protein encoded by unc-15 (Waterston et al., 1977
), homologous to the rod domains of myosin heavy chains, is also found in the thick filaments (Epstein et al., 1985
). Genetic studies have shown that myosin
A can substitute for myosin B in the thick filaments in unc-54 mutants (Epstein et al., 1986
). However, myo-3 null
mutants do not assemble thick filaments at all, which leads to embryonic lethality (Waterston, 1989
), whereas unc-15
null mutant worms produce abnormal filament-like structures with scrambled myosins A and B in the medial region, and myosin B in the hollow polar regions. Although
viable, the unc-15 null worms appear very thin and paralyzed. Therefore, myosin A and paramyosin are essential for proper thick filament assembly. In addition to myosin
and paramyosin, other proteins appear to be critical for
thick filament assembly. For example, unc-45 and unc-82
mutants do not alter the amino acid sequences of myosin
or paramyosin, but produce abnormal thick filaments (Epstein and Thomson, 1974
; Waterston et al., 1980
; Venolia
and Waterston, 1990
).
In the thick filaments of C. elegans body-wall muscle
cells, a core substructure has been proposed as the template for the differential assembly of myosin heavy chains
(Epstein et al., 1985
). The cores are composed of a subpopulation of paramyosin molecules and at least three
"core" proteins (Deitiker and Epstein, 1993
). A three-dimensional model of the cores has been proposed based
on the reconstruction of electron microscopy images of
isolated cores (Fig. 1; Epstein et al., 1995
). In this model,
the core is composed of seven subfilaments of paramyosin
that are cross-linked or coupled to form a tubule by the
putative core proteins. We have named these proteins of
30-, 28-, and 20-kD
-,
-, and
-filagenins (from the Latin
filum; thread, and generare; to beget). The characterization of the filagenins should provide insights into the assembly of the cores and the subsequent assembly of native
thick filaments.
|
We report here the molecular identification and characterization of
-filagenin, a core protein of novel amino
acid sequence and predicted properties. Using an affinity-purified antipeptide antibody, we have localized
-filagenin to the A bands in C. elegans body-wall muscles by
immunofluorescence microscopy, and to the cores by Western blotting. Using wild-type and paramyosin-deficient mutant strains, we have shown by immunoelectron microscopy that
-filagenin can coassemble with either myosin or
paramyosin into tubular substructures of thick filaments in
C. elegans.
| |
Materials and Methods |
|---|
|
|
|---|
Nematode Growth and Strains
For thick filament preparation, N2 (wild-type) C. elegans were grown on
the peptone-enriched plates with a lawn of Escherichia coli strain NA22 at
20°C (Schachat et al., 1978
). The nematodes were synchronized by starvation at L1 stage to obtain a relatively homogeneous population, and then
harvested as L4 larvae. The nematodes were then cleaned and stored by
mixing with two volumes of O.C.T. compound (Miles, Inc., Elkhart, IN) as
described (Deitiker and Epstein, 1993
). The paramyosin-deficient strain
CB1214 was grown without starvation. For whole-mount immunofluorescence microscopy, nematodes were grown on nematode growth medium
plates seeded with E. coli strain OP50 (Brenner, 1974
).
Purification of Thick Filaments
The isolation of thick filaments was in accordance with the previously described procedures (Deitiker and Epstein, 1993
). The 15K pellets made
from 6 g of nematodes were resuspended in 3 ml of buffer used for extracting the thick filaments, and then loaded to a 34 ml 19-38% sucrose
gradient. The gradient was centrifuged for 17 h at 5,000 rpm in a swing rotor (model SW 28; Beckman Instrs., Fullerton, CA). The gradient was divided into 12 fractions. Fractions 2-6 from the bottom of the gradient
were pooled for filament protein precipitation. Because of the low abundance of the filagenins, multiple preparations were performed to accumulate enough thick filament proteins.
Ethanol Precipitation of Thick Filament Proteins
The pooled gradient fractions enriched with purified thick filaments were
dialyzed against 10 mM sodium phosphate buffer, pH 6.36. Three volumes
of precooled 95% ethanol were added slowly to the dialyzed fractions
while stirring. After all ethanol was added, the precipitation was allowed
to continue for 2 h by slow stirring at room temperature. Precipitated proteins were collected by centrifugation at 12,000 g for 20 min. The protein pellet was air-dried and stored at
80°C before being separated by SDS-PAGE.
Protein Separation, Digestion, and Sequencing
The precipitated thick filament proteins were separated by SDS-PAGE
containing 11% acrylamide. Proteins were transferred to polyvinylidene
difluoride (PVDF)1 membrane and stained with Coomassie blue as described previously. Because >90% of thick filament proteins by mass is
myosin and paramyosin, large quantities of thick filament proteins were
loaded in each lane to visualize the relatively scarce filagenins. Multiple lanes were required to obtain sufficient amounts of
-filagenin. The membranes containing
-filagenin were pooled and then digested with endoprotease Lys-C. Peptide fragments were separated by high performance
liquid chromatography and sequenced on a protein sequencer (model
477A or 473A; Applied Biosystems, Foster City, CA).
Sequence Analysis
Most of the sequence information and homology searches were obtained
through the C. elegans Genome Sequencing Project (The Sanger Centre,
Hinxton Hall, Cambridge, UK; and the Washington University School of
Medicine, St. Louis, MO). Further searches were done over the World
Wide Web with the BCM Search Launcher (Smith et al., 1996
). The cDNA
clones were located using the BCM Search Launcher to the dbEST databases. The cDNA sequences originated from the C. elegans cDNA Sequencing Project in Japan (National Institute of Genetics, Mishima, Japan).
Secondary structure prediction used the Type-1 Discrete State-Space Models from the Boston University BioMolecular Engineering Research Center PSA server (http://bmerc-www.bu.edu/psa/; Stultz et al., 1993
; White et
al., 1994
). Other algorithms that we used are found in the Peptidestructure
program of the Genetics Computer Group (GCG) Package, Wisconsin
Package Version 9.0, GCG, Madison, Wisconsin; Chou and Fasman (1978)
,
and Garnier et al. (1978)
. Isoelectric point calculation was obtained from
the Isoelectric Program in the GCG Package.
Cloning of
-Filagenin cDNA
Primers P28gstup (35 nucleotide NH2-terminal) 5
GTGGATCCATGCCTTCGAGTCTTTCAGAGCC3
and P28gstdn (35 nucleotide COOH-terminal) 5
CGGAATTCTTAAGAGAAAGAGTAGAAGTAGCGATG3
were selected to amplify the complete predicted open reading frame
of the
-filagenin gene by reverse transcriptase (RT)-PCR from total
RNA isolated from nematodes of mixed stages. A single band of 630 bp
was obtained, subcloned, and sequenced.
Antibodies
Rabbit antibody against
-filagenin was generated against the selected
synthetic peptide YSSTLHKYRRDYDTL conjugated to the multiple antigenic peptide carrier protein core. The peptide was chosen based on its
predicted high accessibility and antigenicity using the Surface Probability
and Antigenicity subprograms of the Peptidestructure program in the
GCG Package. The antiserum was affinity purified using the antigen as
the ligand coupled to the matrix (model Affi-gel 10; Bio-Rad Laboratories, Hercules, CA). Coupling of the matrix and peptide was carried out
mainly according to the manufacturer's instructions. 1 ml of the Affi-gel was drained of isopropanol and washed with 5 vol of cold water (4°C). The
gel was then mixed with 4 ml of the peptide (2.5 mg/ml in 0.1 M morpholinepropanesulfonic acid, pH 7.5) by gentle rocking for 4 h at 4°C to allow
coupling reaction to occur. Active esters left in the gel matrix were
blocked by reacting the gel slurry with 0.1 ml of 1.0 M ethanolamine HCl,
pH 8.0, for 1 h. The gel was then packed in a column, washed extensively
with doubly distilled H2O, and then equilibrated with PBS (137 mM NaCl,
3 mM KCl, 10 mM Na2PO4, 2 mM KH2PO4, pH 7.2). For antibody binding, 5 ml of antiserum was dialyzed against PBS overnight, brought to 10 ml in total volume, and then passed through the column three times. Bound
antibody was eluted with 0.1 M glycine-HCl, pH 2.5, and 1-ml fractions of
the eluate were immediately neutralized, each with 0.3 ml of 1.0 M Tris-HCl, pH 8.2. The purified antibody was characterized by Western blotting
using thick filament-enriched 6,200 g supernatants of C. elegans (Deitiker
and Epstein, 1993
) separated by 11% SDS-PAGE. Western blotting followed a previously described procedure using an affinity-purified IgG secondary antibody conjugated with alkaline phosphatase (Liu et al., 1997
).
The affinity-purified anti-
-filagenin antibody was used at 2.5 µg/ml. The
antibodies against myosin heavy chains and paramyosin have been described (Miller et al., 1983
).
Immunofluorescence Microscopy
Nematodes were freeze fractured (Liu et al., 1997
) and fixed immediately
in
20°C methanol for 5 min, and then followed by another 5 min in
20°C acetone. The fixed nematodes were rehydrated through a serial dilution of methanol, and then reacted with the antibodies as described (Epstein et al., 1993
). The anti-
-filagenin antibody (2.5 µg/ml) was mixed
with the rhodamine-conjugated monoclonal antiparamyosin antibody 5-23 (5 µg/ml). The mixed antibodies were used for the primary antibody reaction. The rabbit anti-
-filagenin antibody was reacted with affinity-purified, fluorescein isothiocyanate-conjugated goat anti-rabbit IgG secondary antibody.
Dissociation of Thick Filaments and Western Blotting
The 6.2K supernatant was dissociated with 450 mM NaCl (Deitiker and
Epstein, 1993
), and then centrifuged at 100,000 g for 40 min in an ultracentrifuge (model TL-100; Beckman Instrs., Inc.) using the microcentrifuge
PA rotor. The pellets (cores) were resuspended and brought to the same
volume as the supernatant. Equal volumes of 6.2K supernatant (thick filaments), dissociated supernatant, and resuspended pellet (cores) were separated by 11% polyacrylamide SDS-PAGE for Coomassie blue staining
and Western blotting.
Immunoelectron Microscopy
Procedures for electron microscopy were as described (Miller et al., 1983
;
Epstein et al., 1985
). Both monoclonal antibody 5-23 against paramyosin
and anti-
-filagenin antibody were used at 50 µg/ml. The high concentration of both antibodies was necessary to visualize labeling in the electron
microscope by the antibodies at relatively long repeats, observed in contrast to the lower concentration of antibody used in labeling myosin at
shorter intervals (Levine et al., 1982
; 1983
; Woodhead, J.L., R.J.C. Levine,
and H.A. King. 1986. J. Cell Biol. 109:267a; Deitiker and Epstein, 1993
).
Affinity-purified goat anti-mouse and goat anti-rabbit IgG secondary antibodies were used at 20 µg/ml.
| |
Results |
|---|
|
|
|---|
Purification and Peptide Sequencing of
-Filagenin
Because no previous examples of proteins that couple myosin or paramyosin subfilaments were known at the start
of our experiments, we had to rely on direct biochemical
methods to purify and initially characterize
-filagenin
based upon our previous structural studies, rather than on
more functional or genetic approaches. The biochemical approach was made more difficult by its low abundance of
~0.01% of total protein (Deitiker and Epstein, 1993
). Fig.
2 A outlines our procedure for isolating
-filagenin and
characterizing it by peptide analysis and amino acid sequencing. Previously, purified thick filaments from the sucrose gradients were collected by sedimentation at high
speed, a process that lowers the yield of thick filaments probably as the result of depolymerization (Deitiker and
Epstein, 1993
). One critical step that enabled us to obtain
a sufficient amount of filagenins for protease digestion and
amino acid sequencing was the ethanol precipitation of the
proteins of thick filament preparation. Fig. 2 B shows another key step in this procedure, the Commassie blue-
stained PVDF membrane to which the filagenins and other
thick filament proteins were transferred after ethanol precipitation and SDS-PAGE. The
-filagenin band was proteolytically digested so that internal peptides could be purified and sequenced.
|
The Primary and Secondary Structures of
-Filagenin
Two peptides were purified from protease digestion of
-filagenin and sequenced from their NH2 terminals. Computer-based searches with the peptide sequences obtained
led to perfect matches within the predicted open reading
frame of an X-linked genomic DNA sequence that had
been determined by the C. elegans Genome Project, cosmid T14G12. The full predicted sequence of 201-amino
acid residues is shown in Fig. 3. The predicted exons were
verified by a partial cDNA sequence in the dbEST database, the cDNA clone yk102c12, and by our sequencing of
a full-length cDNA generated by reverse transcriptase-PCR (data not shown). The amino acid sequence shows that
-filagenin may represent a novel group of proteins.
The only homologous protein detected by a computer-based search to date is another C. elegans protein predicted from a genomic sequence, which shares 32% identity with
-filagenin. This predicted protein is also small,
with only 221-amino acid residues, and has no known function. The gene encoding this protein is located physically on chromosome V (EMBL/GenBank/DDBJ accession number Z81579). Analysis of the
-filagenin sequence predicts
four isolated
-strands separated by turns and loops as the
only regular secondary structural motifs using the Discrete
State-Space Models. Several other programs were also
used, but none of them indicated any strong
-helical structures for
-filagenin unlike myosin or paramyosin.
The protein is very basic with an isoelectric point of 10.61. Interestingly, tryptophan and tyrosine comprise ~15% of
the total amino acids, an unusually high fraction. These results may have functional significance for
-filagenin, as
tryptophan and tyrosine are found in many protein binding sites, and the strongly basic character may be related to
its putative interactions with the polyanionic subfilaments
(Kagawa et al., 1989
). It is unlikely that
-filagenin interacts with myosin or paramyosin through formation of
-helical coiled coils.
|
-Filagenin Localizes to A Bands of Body-Wall Muscle
To demonstrate that
-filagenin is a true component of
thick filaments and their cores in C. elegans, we produced
a specific antibody to
-filagenin in rabbits with a synthetic
peptide (underlined sequence in Fig. 3) for localization experiments. The antiserum was purified by affinity chromatography against the same peptide, and the specificity of
the resulting antibody was verified by Western blotting of
thick filament-enriched proteins (Fig. 4). The purified antibody shows high affinity and specificity to
-filagenin.
|
To confirm that
-filagenin is associated with thick filaments, C. elegans whole mounts were reacted with the affinity-purified antibody and viewed by immunofluorescence
microscopy. The antibody labeled the thick filament-containing A bands of the body-wall muscles and the anal-
intestinal muscles, but not the pharyngeal muscles (Fig. 5
B). This distribution is identical to the localization of myosin A and B (Miller et al., 1983
; Ardizzi and Epstein,
1987
). In contrast, antibody to paramyosin labeled all C. elegans muscles (Fig. 5 A), and served as a control for the
more restricted localization of
-filagenin.
|
Association of
-Filagenin with Cores by
Western Blotting
To verify that
-filagenin is a component of the cores,
6,200 g supernatants that are enriched for muscle filaments
(Deitiker and Epstein, 1993
) were dissociated with 450 mM
NaCl, and then
-filagenin was traced by Western blotting
using the affinity-purified antibody. Western blotting of
thick filament- and core-enriched fractions reacted with the
anti-
-filagenin antibody, whereas the fraction containing
dissociated, soluble myosin and paramyosin did not (Fig.
6). This result is consistent with
-filagenin being a component of body-wall thick filaments and their core substructures in C. elegans.
|
Localization of
-Filagenin to Cores by
Electron Microscopy
The localization of
-filagenin was further confirmed by immunofluorescence (data not shown) and immunoelectron
microscopy of isolated tubular core structures after reaction with the specific antibody. The isolated cores showed
a periodicity of 72 nm either by negative staining with uranyl acetate (Fig. 7 A), or by labeling with monoclonal antiparamyosin antibody (Fig. 7 B). The 72-nm repeats are
also observed in paracrystals formed with purified paramyosin from either molluscan muscles (Cohen et al., 1971
), or C. elegans (Waterston et al., 1974
; Harris and Epstein,
1977
). When isolated cores were reacted with the affinity-purified anti-
-filagenin antibody (Fig. 7 C), a repeating
pattern matching the 72-nm repeats in the negatively
stained and the antiparamyosin antibody-labeled cores
was observed. This periodic nature of
-filagenin localization was consistent with the predictions of the model for
the core structure (Epstein et al., 1995
), and the coassembly of
-filagenin and paramyosin.
|
Localization of
-Filagenin in the Filaments of
Paramyosin-null Mutant CB1214
To test whether
-filagenin functions in assembly, we examined the thick filament-like structures produced in the
paramyosin-deficient mutant CB1214 (Fig. 7 E; Waterston
et al., 1977
; Waterston and Brenner, 1978
; Mackenzie and
Epstein, 1980
; Gengyo-Ando and Kagawa, 1991
). In these
mutant filaments, tubular core-like substructures that contain myosin B protrude from medial filament-like regions containing myosin A and myosin B (Epstein et al., 1986
).
Since purified myosin from C. elegans does not assemble
into tubular structures (Harris and Epstein, 1977
), the behavior of myosin B in CB1214 was likely the result of interactions with
-filagenin and the other core proteins.
The anti-
-filagenin antibody reacted with the CB1214
structures (Fig. 7 D), matching the periodicity observed in
wild-type cores. This result is consistent with
-filagenin being necessary for the assembly of tubular substructures,
whether of wild-type cores with paramyosin or of CB1214
mutant core-like structures with myosin B.
| |
Discussion |
|---|
|
|
|---|
Previous work from this laboratory has shown that two
myosin isoforms, A and B, are assembled about a core
containing paramyosin within the thick filaments of body-
wall muscle cells in C. elegans (Epstein et al., 1985
, 1995
).
The core has been proposed to serve as a template for the
assembly of the myosins. A major question remains as to
what mechanism regulates the assembly of paramyosin to
yield core structures of precise length and, thereby, thick filaments of precisely regulated dimensions. The role of
additional core proteins in this process has been suggested
(Epstein et al., 1985
, 1988
, 1995
; Deitiker and Epstein,
1993
), and we have described here the first identification
and characterization of such a protein,
-filagenin.
Using several antibody-based methods, we have shown
that
-filagenin is a core protein. The direct localization of
-filagenin in cores isolated from wild-type C. elegans was
observed at the electron microscope level. Its labeling with
specific antibody produced a repeating pattern consistent
with the predictions of our structural model as shown in
Fig. 1. This result is consistent with the proposal that
paramyosin strands in the cores are cross-linked or coupled by
-filagenin. The filagenins may be essential, therefore, for the assembly and stabilization of the paramyosin
cores and, consequently, the assembly of thick filaments.
-Filagenin is also localized to the mutant thick filaments of CB1214, which is produced by the premature
chain termination e1214 mutation in the unc-15 locus, and
leads to a paramyosin-deficient state. The CB1214 thick
filaments are core-like tubular structures where myosin B
assembles in place of paramyosin. Importantly,
-filagenin
localized to these myosin tubules with the same repeat pattern as in wild-type cores. Since myosin itself does not
form tubules or assemble into wild-type cores, these results
suggest that
-filagenin and other possible core proteins
(
-,
-filagenins) may be capable of directing the assembly
of myosin as well as of paramyosin. Although apparently
not homologous at the amino acid sequence level to
-filagenin, the myosin binding protein C family of cardiac
and skeletal muscles may perform analogous functions during the assembly of thick filaments in vertebrates (Moos
et al., 1975
; Einheber and Fischman, 1990
; Okagaki et al., 1993
).
Analysis of the amino acid sequence of
-filagenin suggests that it is a protein of unusual biochemical characteristics. The protein is very basic with a predicted isoelectric
point of 10.61. The protein also has a high percentage of
tryptophan and tyrosine, two amino acids often found at
the binding sites of protein-protein interactions. Whether
these characteristics are of special importance to the
function of
-filagenin is unknown. Biochemical studies using purified protein should provide further information
on the relationships between the structure and function of
-filagenin.
Our studies also showed that
-filagenin was present in
body-wall muscle cells and the specialized anal-intestinal
muscles, but not in the pharynx. The pharyngeal thick filaments contain myosin C and D instead of myosin A and B
(Ardizzi and Epstein, 1987
). The thick filaments of the
pharynx are also characteristically shorter and more electronlucent than those of the body-wall (Epstein et al., 1974
;
Albertson and Thomson, 1976
). However, they share the
only paramyosin (Ardizzi and Epstein, 1987
). What protein performs the putative functions of
-filagenin in the
pharynx is not known. We have identified another protein
in C. elegans with a predicted sequence of 221-amino acid
residues that shares 32% identity in sequence as well as
other characteristics with
-filagenin (Liu, F., C.C. Bauer,
and H.F. Epstein, unpublished results). The possibility
that
-filagenin and this putative homologue could, in
part, be responsible for the different properties of body-
wall and pharyngeal muscle thick filaments will be tested in future experiments. The potential interactions of
-filagenin with proteins operating in thick filament assembly
other than myosin and paramyosin, including such likely
candidates as the
- and
- filagenins and the UNC-45 protein (Epstein and Thomson, 1974
; Venolia and Waterston,
1990
), are also under study.
| |
Footnotes |
|---|
Received for publication 27 October 1997 and in revised form 26 November 1997.
Address all correspondence to Henry F. Epstein, Department of Neurology, Baylor College of Medicine, One Baylor Plaza, Houston, TX 77030. Tel.: (713) 798-4629. Fax: (713) 798-3771. E-mail: hepstein{at}bcm.tmc.eduWe thank our colleagues at Baylor, D.L. Casey for excellent assistance and J.M. Barral for comments.
Supported by grants from the Muscular Dystrophy Association and National Science Foundation.
| |
Abbreviations used in this paper |
|---|
GCG, Genetics Computer Group; PVDF, polyvinylidene difluoride.
| |
References |
|---|
|
|
|---|
| 1. | Albertson, D.G., and J.N. Thomson. 1976. The pharynx of Caenorhabditis elegans. Philos. Trans. R. Soc. Lond. B Biol. Sci. 275: 299-325 [Medline]. |
| 2. |
Ardizzi, J.P., and
H.F. Epstein.
1987.
Immunochemical localization of myosin
heavy chain isoforms and paramyosin in developmentally and structurally
diverse muscle cell types of the nematode Caenorhabditis elegans.
J. Cell
Biol.
105:
2763-2770
|
| 3. |
Brenner, S..
1974.
The genetics of Caenorhabditis elegans.
Genetics
77:
71-94
|
| 4. | Chou, P.Y., and G.D. Fasman. 1978. Empirical prediction of protein conformation. Annu. Rev. Biochem. 49: 251-276 . |
| 5. | Cohen, C., A.G. Szent-Gyorgyi, J. Kendrick, and Jones. 1971. Paramyosin and the filaments of the molluscan "catch" muscles. I. Paramyosin: structure and assembly. J. Mol. Biol. 56: 223-237 [Medline]. |
| 6. |
Deitiker, P.R., and
H.F. Epstein.
1993.
Thick filament substructures in Caenorhabditis elegans: evidence for two populations of paramyosin.
J. Cell Biol.
123:
303-311
|
| 7. |
Einheber, S., and
D.A. Fischman.
1990.
Isolation and characterization of a
cDNA clone encoding avian skeletal muscle C-protein: an intracellular
member of the immunoglobulin superfamily.
Proc. Natl. Acad. Sci. USA.
87:
2157-2161
|
| 8. | Epstein, H.F., R.H. Waterston, and S. Brenner. 1974. A mutant affecting the heavy chain of myosin in Caenorhabditis elegans. J. Mol. Biol. 90: 291-300 [Medline]. |
| 9. | Epstein, H.F., and J.N. Thomson. 1974. Temperature-sensitive mutation affecting myofilament assembly in Caenorhabditis elegans. Nature. 250: 579-580 [Medline]. |
| 10. | Epstein, H.F., and D.A. Fischman. 1991. Molecular analysis of protein assembly in muscle development. Science (Wash. DC). 251:1039-1044. |
| 11. |
Epstein, H.F.,
D.M. Miller,
I. Ortiz, and
G.C. Berliner.
1985.
Myosin and
paramyosin are organized around a newly identified core structure.
J. Cell
Biol.
100:
904-915
|
| 12. |
Epstein, H.F.,
I. Ortiz,
L.A. Traeger, and
Mackinnon.
1986.
The alteration of
myosin isoform compartmentation in specific mutants of Caenorhabditis elegans.
J. Cell Biol.
103:
985-993
|
| 13. |
Epstein, H.F.,
G.C. Berliner,
D.L. Casey, and
I. Ortiz.
1988.
Purified thick filaments from the nematode Caenorhabditis elegans: evidence for multiple proteins associated with core structures.
J. Cell Biol.
106:
1985-1995
|
| 14. |
Epstein, H.F.,
D.L. Casey, and
I. Ortiz.
1993.
Myosin and paramyosin of Caenorhabditis elegans embryos assemble into nascent structures distinct from
thick filaments and multi-filament assemblages.
J. Cell Biol.
122:
845-858
|
| 15. | Epstein, H.F., G.Y. Lu, P.R. Deitiker, I. Ortiz, and M.F. Schmid. 1995. Preliminary three-dimensional model for nematode thick filament core. J. Struct. Biol. 115: 163-174 [Medline]. |
| 16. | Garnier, J., D.J. Osguthorpe, and B. Robson. 1978. Analysis of the accuracy and implications of simple methods for predicting the secondary structure of globular proteins. J. Mol. Biol. 120: 97-120 [Medline]. |
| 17. | Gengyo-Ando, K., and H. Kagawa. 1991. Single charge change on the helical surface of the paramyosin rod dramatically disrupts thick filament assembly in Caenorhabditis elegans. J. Mol. Biol. 291: 429-441 . |
| 18. | Harris, H.E., and H.F. Epstein. 1977. Myosin and paramyosin of Caenorhabditis elegans: biochemical and structural properties of wild type and mutant proteins. Cell. 10: 709-719 [Medline]. |
| 19. | Kagawa, H., K. Gengyo, A.D. McLachlan, S. Brenner, and J. Karn. 1989. Paramyosin gene (unc-15) of Caenorhabditis elegans. Molecular cloning, nucleotide sequence and models for thick filament structure. J. Mol. Biol. 207: 311-333 [Medline]. |
| 20. | Levine, R.J.C., R.W. Kensler, M. Stewart, and J.C. Haselgrove. 1982. Molecular organization of Limulus thick filaments. In Basic Biology of Muscles: A Comparative Approach. B.M. Twarog, R.J. Levine, and M.M. Dewey, editors. Raven Press. New York. 37-52. |
| 21. |
Levine, R.J.C.,
R.W. Kensler,
M. Reedy,
W. Hofmann, and
H.A. King.
1983.
Structure and paramyosin content of tarantula thick filaments.
J. Cell Biol.
97:
186-195
|
| 22. | Liu, F., J.D. Thatcher, and H.F. Epstein. 1997. Induction of glyoxylate cycle expression in Caenorhabditis elegans: a fasting response throughout larval development. Biochemistry. 36: 255-260 [Medline]. |
| 23. | Mackenzie, J.M., and H.F. Epstein. 1980. Paramyosin is necessary for determination of nematode thick filament length in vivo. Cell. 22: 747-755 [Medline]. |
| 24. | Miller, D.M., I. Ortiz, G.C. Berliner, and H.F. Epstein. 1983. Differential localization of two myosins within nematode thick filaments. Cell. 34: 477-490 [Medline]. |
| 25. | Moos, C., G. Offer, R. Starr, and P. Bennett. 1975. Interaction of C-protein with myosin, myosin rod and light meromyosin. J. Mol. Biol. 97: 1-9 [Medline]. |
| 26. |
Okagaki, T.,
F.E. Weber,
D.A. Fischman,
K.T. Vaughan,
T. Mikawa, and
F.C. Reinach.
1993.
The major myosin-binding domain of skeletal muscle MyBP-C
(C-protein) resides in the COOH-terminal, immunoglobulin C2 motif.
J. Cell Biol.
123:
619-626
|
| 27. | Schachat, F., R.L. Garcea, and H.F. Epstein. 1978. Myosins exist as homodimers of heavy chains: demonstration with specific antibody purified by nematode mutant myosin affinity chromatography. Cell. 15: 405-411 [Medline]. |
| 28. |
Smith, R.F.,
B.A. Wiese,
M.K. Wojzynski,
D.B. Davison, and
K. C. Worley.
1996.
BCM Search Launcher an integrated interface to molecular biology
data base search and analysis services available on the World Wide Web.
Genome Res.
6:
454-462
|
| 29. | Stultz, C.M., J.V. White, and T.F. Smith. 1993. Structural analysis based on state-space modeling. Protein Sci. 2: 305-314 [Medline]. |
| 30. | Venolia, L., and R.H. Waterston. 1990. The unc-45 gene of Caenorhabditis elegans is an essential muscle-affecting gene with maternal expression. Genetics. 126: 345-353 [Abstract]. |
| 31. | Waterston, R.H.. 1989. The minor myosin heavy chain, mhc A, of Caenorhabditis elegans is necessary for the initiation of thick filament assembly. EMBO (Eur. Mol. Biol. Organ.) J. 8: 3429-3436 [Medline]. |
| 32. | Waterston, R.H., and S. Brenner. 1978. A supressor mutation in the nematode acting on specific alleles of many genes. Nature. 275: 715-719 [Medline]. |
| 33. | Waterston, R.H., H.F. Epstein, and S. Brenner. 1974. Paramyosin in Caenorhabditis elegans. J. Mol. Biol. 90: 285-290 [Medline]. |
| 34. | Waterston, R.H., R.M. Fishpool, and S. Brenner. 1977. Mutants affecting paramyosin in Caenorhabditis elegans. J. Mol. Biol. 117: 679-697 [Medline]. |
| 35. | Waterston, R.H., J.N. Thomson, and S. Brenner. 1980. Mutants with altered muscle structure in Caenorhabditis elegans. Dev. Biol. 77: 271-302 [Medline]. |
| 36. | Wells, L., K.A. Edwards, and S.I. Bernstein. 1996. Myosin heavy chain isoforms regulate muscle function but not myofibril assembly. EMBO (Eur. Mol. Biol. Organ.) J. 15: 4454-4459 [Medline]. |
| 37. | White, J.V., C.M. Stultz, and T.F. Smith. 1994. Protein classification by stochastic modeling and optimal filtering of amino-acid sequences. Mathemat. Biosci. 119: 35-75 . |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|