|
|
|
|
|
|
|
||
© The Rockefeller University Press,
0021-9525/1998//1321 $5.00
The Journal of Cell Biology, Volume 140, Number 6,
, 1998 1321-1329
Article |
ncl-1 Is Required for the Regulation of Cell Size and Ribosomal RNA Synthesis in Caenorhabditis elegans
Regulation of ribosome synthesis is an essential aspect of growth control. Thus far, little is known about the factors that control and coordinate these processes. We show here that the Caenorhabditis elegans gene ncl-1 encodes a zinc finger protein and may be a repressor of RNA polymerase I and III transcription and an inhibitor of cell growth. Loss of function mutations in ncl-1, previously shown to result in enlarged nucleoli, result in increased rates of rRNA and 5S RNA transcription and enlarged cells. Furthermore, ncl-1 adult worms are larger, have more protein, and have twice as much rRNA as wild-type worms. Localization studies show that the level of NCL-1 protein is independently regulated in different cells of the embryo. In wild-type embryos, cells with the largest nucleoli have the lowest level of NCL-1 protein. Based on these results we propose that ncl-1 is a repressor of ribosome synthesis and cell growth.
Abbreviations used in this paper: ITS, internal transcribed spacer; PML, promyelocytic leukemia; RAR, retinoic acid receptor; Rb, retinoblastoma gene; UTP, uridine 5'triphosphate.
DURING the life cycle of metazoans, growth occurs by increases in both the size of individual cells and in the actual number of cells. Most often these two processes are coordinated; cells are born at a certain size, double in size during the cell cycle, and then divide (Prescott, 1976). In some cases, however, cell size increase and cell division occur independently, as in early embryogenesis of many organisms where rapid cleavage divisions occur without any increase in cell size (Wilson, 1896). Similarly, growth of individual cells can occur in the absence of cell division. For instance, many adult tissues such as cardiac muscle increase in mass by cell size increase, or hypertrophy, rather than by cell division (Rakusan, 1984). A striking example of growth without division is during amphibian oocyte development (Dumont, 1972). Furthermore, an increase in cell size independent of cell division may also account for the fact that distinct cell types having identical DNA content can vary greatly in size within an individual organism (Altman and Katz, 1976).
Previous studies in bacteria and yeast have demonstrated that cell growth (increase in cell size and number) is tightly coupled to an increase in both protein synthesis and ribosome biogenesis (for review see Nomura et al., 1984). In higher eukaryotes, this correlation is seen in the diminished transcription of ribosomal RNAs (rRNA and 5S RNA) during quiescence and the subsequent increase after stimulation with growth factors (Johnson et al., 1974). Cell division is not a requirement for this coordination, however, as studies of hypertrophy in vertebrate cardiomyocytes also link rRNA and 5S RNA synthesis with control of cell size (McDermott et al., 1989). These studies suggest that regulators of ribosome synthesis may play an important role in cellular growth control. One gene that appears to function in the control of cell growth is the Retinoblastoma gene (Rb).1 In addition to its role in the control of cell division, Rb has been shown to inhibit the synthesis of both rRNA and 5S RNA (Cavanaugh et al., 1995; White et al., 1996).
In eukaryotes, the nucleolus, the nuclear organelle in which rRNA synthesis and assembly of preribosomal subunits occurs (for review see Melese and Xue, 1995), is a good cytological marker of ribosome synthesis as the size of the nucleolus is indicative of the level of rRNA synthesis (Kurata et al., 1978; Altmann and Leblond, 1982; Moss and Stefanovsky, 1995). Interestingly, tumor cells not only exhibit rapid cell growth and division, but also often have enlarged nucleoli (Busch and Smetana, 1970; Derenzini and Trere, 1991). Similarly, during both normal developmental cardiac hypertrophy and aberrant hypertrophy that occurs in many forms of heart disease, nucleoli are enlarged (Hatt et al., 1978; Cluzeaud et al., 1984; Dalen et al., 1987). Enlarged nucleoli have also been observed in the ncl-1 mutant of the nematode Caenorhabditis elegans (Hedgecock and Herman, 1995). We have isolated the ncl-1 gene and show that it appears to repress rRNA and 5S RNA synthesis and to be an inhibitor of both ribosome biosynthesis and cell growth.
 |
Materials and Methods |
|---|
 TopAbstract Materials and Methods ResultsDiscussionReferences |
|---|
Worm Size and Total Protein Measurements
Two-dimensional images of wild-type and ncl-1 (e1942) worms grown for 50 h at 20°C after hatching were collected using a charge-coupled device camera and National Institutes of Health (NIH) image. Worm sizes were determined in Canvas (Deneba Software, Miami, FL) and then analyzed in Microsoft Excel (Redmond, WA). The amount of total protein was determined for wild-type and ncl-1 (e1942) adult worms grown at 20°C for 44 h after hatching using the Amidoschwarz assay (Schaffner and Weissmann, 1973). Total DNA in each sample was determined using a fluorometer (model TKO-100; Hoefer Scientific Instruments, San Francisco, CA). Analysis of total protein to DNA ratios and statistics was performed using Microsoft Excel.
In Situ Hybridization
In situ hybridization using either 5.8S or internal transcribed spacer (ITS)2 probes was done according to the method of Seydoux and Fire (1994). The 5.8S (GGAGGCCCAGTTGGTGCTATGCGTTCG) and ITS2 (CAAGTCGGACGCCATTTGGCAGCTCCTCCG) antisense oligo probes were directed against nucleotides 2204–2230 and 2426–2455, respectively, of the C. elegans rDNA repeat (Ellis et al., 1986). Probes were end labeled with terminal deoxynucleotidyl transferase and digoxigenin– ddUTP (Boehringer Mannheim Biochemicals, Indianapolis, IN) and then used at a concentration of 1.0 µg/ml in 7.7% formamide, 2x SSC hybridization buffer. Probes were then visualized using FITC-conjugated antidigoxigenin antibodies (Boehringer Mannheim Biochemicals). The following controls for specificity of hybridization were performed: an anti-SL1 (spliced leader) probe (CTCAAACTTGGGTAATTAAACC) hybridized to the cytoplasm of all cells and to cytoplasmic granules in the P cells as previously described (Seydoux and Fire, 1994), but did not hybridize to nucleoli; and prehybridizing of slides with 20 µg/ml of unlabeled 5.8S or ITS2 antisense oligo inhibited hybridization with the respective labeled oligos.
Run-on Transcription Assays
Extracts were prepared from early embryos (95% earlier than 100-cell stage) by collecting and bleaching worms from the different genetic backgrounds just as they began to become gravid and contained <10 embryos per hermaphrodite. Preparation of extracts for transcription assays and quantitation of DNA in the extracts was done as described (Schauer and Wood, 1990), except that salmon sperm DNA was used to provide a standard curve and a fluorometer (model TKO-100; Hoefer Scientific Instruments) was used.
For some experiments, run-on transcription reactions and hybridizations were performed as described (Schauer and Wood, 1990), except that volumes of embryonic extracts corresponding to 50 µg of DNA, 100 µCi of [32P]uridine 5'-triphosphate (UTP), 2 mM ATP, 2 mM CTP, 2 mM GTP, and 0.05 mM cold UTP were used in 100-µl reactions and then hybridizations were done for 2 d at 42°C. In other experiments, the reaction conditions were as follows: volumes of extract corresponding to 2.5 µg of DNA were incubated in buffer containing 5 mM Tris-HCl, pH 8.0, 2.5 mM MgCl2, 150 mM KCl, 100 µCi [32P] cytosine 5'-triphosphate (CTP), 0.8 mM ATP, 0.8 mM GTP, 0.8 mM UTP, 1 mM DTT, and 200 U/ml RNAsin (Promega Corp., Madison, WI) (final volume was 20 µl) for 30 min at room temperature. For these experiments, hybridization was performed for 18 h at 65°C in 10 mM TES (Sigma Chemical Co., St. Louis, MO) pH 7.5, 1% SDS, 10 mM EDTA, 250 µg/ml Escherichia coli RNA, 300 mM NaCl, 100x Denhardt's (2% Ficoll 400, 2% polyvinylpyrrolidone, 2% bovine serum albumin), and 0.25% powdered nonfat milk. In each experiment, three reactions were performed for each genotype tested.
Slot blot filters were prepared as follows: for each reaction performed, 5 µg of each of the DNAs of interest were denatured in 0.3 M NaOH at 65°C for 10 min and then neutralized by the addition of 1 vol of 2 M ammonium acetate. Denatured DNAs were loaded onto Gene Screen Plus membrane (DuPont-NEN, Boston, MA), presoaked in 1x SSC, 10 mM Tris, pH 7.4, using a slot blotting apparatus (Schleicher & Schuell, Inc., Keene, NH). DNAs of interest were as follows: rDNA was pCe7 (Files and Hirsh, 1981); 5S RNA gene construct was made by cloning a 160-bp StuI-HindIII fragment of plasmid 985(Sl1/5S) (Ferguson et al., 1996) into Bluescript KS+ (Stratagene, La Jolla, CA) cut with EcoRV and HindIII; histone genes were in clone pCeh-3 (Roberts et al., 1989). Quantitation of hybridization signals was performed using a phosphorimager (Molecular Dynamics, Sunnyvale, CA) and data from all experiments performed (four experiments for wild-type and ncl-1 [e1865] on rDNA and 5S; two experiments for ncl-1 [e1942] on rDNA, 5S, and histones, and wild-type and ncl-1 [e1865] on histones) were collated for the graphs presented in Fig. 3.
|
Cloning of ncl-1
The ncl-1 locus was identified through a series of germline transformation experiments with cosmids and subclones of cosmid ZK112. DNA was injected with the dominant marker rol-6 (Mello et al., 1991) into the syncytial gonad of ncl-1 (e1865) or ncl-1 (e1942) animals. DNA was injected at a final concentration of 0.1 mg/ml. Adult Rol progeny were analyzed by differential interference contrast microscopy for rescue of the Ncl phenotype. Partial rescue (not all cells were rescued) was obtained with the 7.5-kb rescuing fragment (pZK112-1b).
Antisense RNA derived from a 1-kb HindIII-XhoI fragment of pZK112-1b was injected into the syncytial gonad of wild-type hermaphrodites according to the procedure of Guo and Kemphues (1995). These worms gave progeny with enlarged nucleoli, indicative of ncl-1 phenocopy.
A full-length ncl-1 cDNA was obtained by screening a C. elegans mixed stage library (Stratagene) with the 1-kb HindIII-XhoI fragment of pZK112-1b. Sequencing of this cDNA revealed the same exon boundaries as predicted by GeneFinder. This cDNA begins at a position 134-bp upstream of the first ATG and terminates with a poly A tail 1,355-bp downstream of the first in-frame stop codon. The Matcher program (Fischetti et al., 1993) was used to identify the predicted coiled-coil motif in NCL-1. Sequence data is available under EMBL/GenBank/DDBJ accession number AF047027.
Production of Monoclonal Antibody, Immunoblotting, and Immunostaining
The pET-16b vector (Novagen Inc., Madison, WI) was used to generate a protein fusion between the 10-His tag and amino acids 24–377 of NCL-1. The bacterially expressed fusion protein 10-His–NCL was purified by chromatography on Ni2+-NTA-Agarose (QIAGEN Inc., Santa Clarita, CA). mAb D3C2 and ascites fluid were generated as described by Harlow and Lane (1988).
For immunoblotting, embryo extracts prepared by overnight extraction of embryos in N,N-dimethylformamide (Sigma Chemical Co.) followed by sonication of insoluble material in NEST-2 (5% SDS, 20 mM EDTA, 50 mM Tris-HCl, pH 6.8) were run on 6% SDS–polyacrylamide gels and then transferred to nitrocellulose. Blots were stained with Ponceau S, blocked for 1 h in 3% BSA and 10% nonfat dry milk in TBST (50 mM Tris-Hcl, pH 8.0, 150 mM NaCl, 0.05% Tween 20), incubated overnight at room temperature in primary antibody, washed in TBST, incubated in horseradish peroxidase-linked anti–mouse Ig (Amersham Corp., Arlington Heights, IL) diluted 1:2,500 in 3% BSA in TBST, washed extensively in TBST, and then processed for detection using the SuperSignal Substrate, Western blotting kit (Pierce Chemical Co., Rockford, IL). mAb D3C2 was used as undiluted hybridoma supernatant.
Fixation of embryos was as described (Albertson, 1984) with the following exceptions. Slides were pretreated with 3-aminopropyltriethoxysilane (Sigma Chemical Co.) and fixation was then done in N,N-dimethylformamide at –20°C for 5 min. Gonad fixation and staining was performed in solution. For immunostaining, mAb D3C2 ascites fluid was used at a 1:500 dilution. mAb K121 against 2,2,7-trimethylguanosine (Oncogene Science, Inc., Manhasset, NY) was used at a 1:50 dilution.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
|
|
|
To determine if this increase in level of precursor rRNA in the nucleus is due to an increase in the rate of rRNA transcription in mutant embryos, we performed nuclear run-on assays on wild-type and mutant embryos (refer to Materials and Methods). We analyzed early embryos because at this time in development there is a very clear difference between the size of nucleoli in mutant and wild-type (refer to Fig. 1). Nuclear run-on assays were performed on equivalent numbers of nuclei from mutant and wild-type extracts as determined by standardization to DNA by fluorometry. We first analyzed rRNA transcription by hybridization of nascent RNA labeled in the run-on reaction to DNA corresponding to one repeat of C. elegans rDNA. We found that the rate of rRNA transcription is 2–2.5 times higher in ncl-1 early embryos than in wild-type embryos (Fig. 4 a). This observation suggests that, as hypothesized by Hedgecock and Herman (1995), the ncl-1 gene product represses rRNA transcription, and that ncl-1 worms have enlarged nucleoli because of increased nucleolar activity.
|
NCL-1 Is a B Box Zinc Finger Protein
ncl-1 had previously been localized to cosmid C33C3 by transformation rescue (Miller et al., 1996). We achieved rescue with the neighboring cosmid ZK112, which has been sequenced by the C. elegans genome consortium (Sulston et al., 1992). Analysis of subclones from this cosmid resulted in identification of a 7.5-kb genomic fragment containing one predicted gene that partially rescued the ncl-1 enlarged nucleolus phenotype (Fig. 5). To confirm that this gene is ncl-1, we injected antisense RNA transcribed from this genomic fragment into the syncytial gonad of wild-type hermaphrodites. This resulted in enlarged nucleoli in larval progeny (Fig. 5). In both the rescue and antisense experiments, the numbers of affected nuclei varied from animal to animal. These lines of evidence together indicate that this gene is ncl-1.
|
|
100-kD in wild-type extracts, but not in extracts made from either of the two mutant alleles of ncl-1 (Fig. 6 b). The upper band is a phosphorylated form of NCL-1 (data not shown). The predicted molecular weight of NCL-1 is 92-kD. In ncl-1(e1865) embryo extracts, a faster migrating polypeptide of 80-kD was detected, whereas no immunoreactive species was detected in extracts from ncl-1 (e1942). These results confirm that this gene is ncl-1 and suggest that ncl-1(e1942) is a protein-null allele, whereas ncl-1(e1865) produces a shorter form of the protein. Given that NCL-1 appears to act as an inhibitor of RNA polymerase I transcription, and thus nucleolar size and function, we hypothesized that it would be expressed when nucleoli are absent, and not expressed when nucleoli are visible. We first examined early embryos in which nucleoli are not detectable in wild-type. Indirect immunofluorescence using mAb D3C2 showed that in wild-type embryos, NCL-1 is a cytoplasmic protein with no obvious nuclear accumulation. NCL-1 staining is abundant in early embryos and then rapidly diminishes during development (Fig. 7 a). We detect no staining with mAb D3C2 in ncl-1 (e1942) mutant embryos at any stage (data not shown).
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
700 h in primary human fibroblasts), this increase is likely due to the 2–2.5 fold increase in the rate of rRNA transcription we observed in ncl-1 mutant embryos relative to wild-type. We observed a similar effect on the rate of 5S RNA transcription. These results are consistent with those seen by others in systems in which rRNA or 5S RNA transcription are experimentally induced, such as by application of 12-o-tetradecanoylphorbol-13-acetate to cells (Allo et al., 1991; Garber et al., 1991; Vallett et al., 1993). Furthermore, since ribosomal RNA makes up 60–90% of cellular RNA, a twofold increase is a substantial alteration. This result suggests that ncl-1 worms may have more ribosomes than wild-type worms, consistent with our finding that ncl-1 worms contain more protein than wild-type worms. Therefore, the difference in cell size and whole animal size between ncl-1 and wild-type worms may be accounted for by an increased ability to synthesize proteins. The regulation of expression of NCL-1 protein appears to be important for the control of cell growth and ribosome synthesis as its abundance is inversely related to the presence of visible nucleoli, the nuclear organelles in which rRNA synthesis occurs. NCL-1 is present in the early embryo where nucleoli are not visible and high levels of zygotic rRNA production are perhaps not necessary because of the maternal contribution of ribosomes. At the 300-cell stage, NCL-1 protein is present in all cells except those of the gut. Gut cells are the first cells to differentiate in the embryo, are the largest cells in the embryo (Wood, 1988), and have large nucleoli. In addition to being very large, the gut cells are quite active metabolically (the gut produces all of the digestive enzymes as well as the yolk for the gonad; White, 1988) and therefore presumably require high levels of ribosome synthesis. Tissues with high metabolic activity, such as the gut, produce high levels of ribosomes as demonstrated in studies of Drosophila paragonial glands (Schmidt et al., 1985). Such cells likely synthesize high levels of ribosomes not solely to increase their size, but rather to maintain a high level of biosynthetic activity. Therefore, it is possible that the function of ncl-1 can be thought of not simply as being a repressor of cell size, but more specifically as an inhibitor of the level of biosynthetic activity within a cell. Together, our results indicate that NCL-1 is a key molecule in the regulation of cell growth and ribosome synthesis.
Possible Mechanisms for ncl-1–mediated Regulation of Ribosome Synthesis and Cell Size
The mechanism by which ribosome synthesis is coupled to cell growth is unclear. It has been proposed that a feedback mechanism exists wherein the ratio of free ribosomes to polysomes is monitored. When this ratio becomes too high (i.e., there are many inactive ribosomes not engaged in translation), ribosomal RNA synthesis is downregulated, and when this ratio becomes too low (i.e., the majority of ribosomes are engaged) then ribosomal RNA synthesis is upregulated (for review see Nomura et al., 1984). In light of this, two models for the molecular function of ncl-1 can be considered. The first is that ncl-1 functions to inhibit translation. This would result in a decrease in polysomes and an increase in free ribosomes, which would lead to a decrease in rRNA transcription. The fact that ncl-1 worms have more protein, and presumably a higher level of protein synthesis, than wild-type worms is consistent with this model. The second model is that ncl-1 functions in sensing the ratio of free ribosomes to polysomes and directs the level of rRNA transcription. Finally, it is possible that although the majority of NCL-1 protein appears by immunocytochemistry to be cytoplasmic, some NCL-1 protein may be nuclear, and might act directly as a transcription factor to inhibit RNA polymerase I and III transcription.
The control of cell size is of clinical interest as many forms of human heart failure and kidney disease caused by diabetes are associated with enlarged cells (hypertrophy) in cardiac and renal tissues (for review see Hannan and Rothblum, 1995; Kurabayashi and Yazaki, 1996; Rabkin and Fervenza, 1996). In studies of cardiac hypertrophy, it has been found that ribosomal RNA synthesis increases (McDermott et al., 1989), consistent with the idea that increased cell size is correlated with an increased capacity for protein synthesis. Although the mechanism of this transcriptional upregulation has not been determined, it has been found that UBF (upstream binding factor, the RNA polymerase I transcriptional activator) becomes phosphorylated (Hershey et al., 1995), an event which is correlated with its activation (Voit et al., 1992). Likewise, ribosomal protein S6 becomes phosphorylated by S6 kinase (Takano et al., 1996); phosphorylation of S6 correlates with higher translation efficiency (Proud, 1996). It is possible that this results in an increase in rRNA transcription via the feedback mechanism discussed above. Thus far, there are no genetic systems available to study hypertrophy. As ncl-1 mutants exhibit phenotypes characteristic of hypertrophy (increased cell size, increased steady-state rRNA, and increased rate of rRNA transcription), we propose that ncl-1 provides a model genetic system in which to approach this problem of the regulation of hypertrophic growth.
NCL-1 Is Related in Sequence to Oncogenes Such as PML and May Share with Rb the Ability to Repress the Synthesis of Ribosomal RNAs
NCL-1 has B box zinc finger and coiled-coil motifs common to several proteins including PML, T18, and RFP (for review see Reddy et al., 1992). This similarity is intriguing in that these three genes were all identified as translocations that result in tumorigenesis. For instance, PML was found as a translocation resulting in a fusion protein between the zinc fingers and coiled-coil of PML and the retinoic acid receptor (RAR); the fusion protein PML–RAR is responsible for acute promyelocytic leukemia in humans (Borrow et al., 1990; de The et al., 1990; Kakizuka et al., 1991). Although the mechanism of transformation by the PML–RAR fusion protein is still unclear, PML alone may function normally as a growth suppressor since it has been shown to be able to inhibit transformation in cell culture (Mu et al., 1994). Because tumor cells often have enlarged nucleoli (Busch and Smetana, 1970; Derenzini and Trere, 1991), it is conceivable that these genes and ncl-1 might have overlapping functions.
One other cancer related gene, the tumor suppressor Rb, is structurally unrelated but does share some common functions with ncl-1. Recent evidence suggests that, like ncl-1 mutants, loss of Rb function may derepress transcription by RNA polymerase I and III (Cavanaugh et al., 1995; White et al., 1996). It is possible that one way in which tumor cells are able to achieve an increase in cell growth is by increasing their ability to synthesize proteins through mutation of a gene such as Rb that normally functions to repress RNA polymerase I and III transcription (for review see Nasmyth, 1996; White, 1997). Interestingly, it has been shown that chimeric mice containing Rb-deficient cells have enlarged cells in the liver and cerebellum (Williams et al., 1994), suggesting that Rb, like ncl-1, may be required to limit the size of cells. Furthermore, induction of cellular hypertrophy in cardiomyocytes leads to increased phosphorylation of Rb (Sadoshima et al., 1997). It will be interesting to learn if there is Rb in C. elegans, and if so, how it and ncl-1 might function together to achieve the goal of negatively regulating cell size and ribosomal RNA synthesis. Conversely, it will be interesting to learn if there is a ncl-1-like gene in mammalian cells and whether or not its function is abrogated in tumor cells.
|
Acknowledgments |
|---|
Submitted: 21 November 1997
Revised: 21 January 1998
D.J. Frank was supported by a graduate fellowship from the National Science Foundation. This work was supported by a National Institutes of Health grant (GM48435-01A2) to M.B. Roth.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Albertson DG. Formation of the first cleavage spindle in nematode embryos, Dev Biol, 1984, 101, 61–72.[Medline]
Allo SN, McDermott PJ, Carl LL & Morgan HE. Phorbol ester stimulation of protein kinase C activity and ribosomal DNA transcription, J Biol Chem, 1991, 266, 22003–22009.
Altman, P.L., and D.D. Katz 1976. Cell Biology. FASEB (Fed. Am. Soc. Exp. Biol.), Bethesda, MD. 454 pp.
Altmann GG & Leblond CP. Changes in the size and structure of the nucleolus of columnar cells during their migration from crypt base to villus top in rat jejunum, J Cell Sci, 1982, 56, 83–99.
Ausubel, F.M., R. Brent, R.R. Kingston, D.D. Moore, J.G. Seideman, J.A. Smith, and K. Struhl. 1987. Analysis of RNA by Northern Hybridization. In Current Protocols in Molecular Biology. Vol. 1. Wiley/Greene, New York. 4.9.1–4.9.4.
Borrow J, Goddard A, Sheer D & Solomon E. Molecular analysis of acute promyelocytic leukaemia breakpoint cluster region on chromosome 17, Science, 1990, 249, 1577–1580.
Brenner S. The genetics of Caenorhabditis elegans. , Genetics, 1974, 77, 71–94.
Busch, H., and K. Smetana. 1970. The Nucleolus. Academic Press, New York. 626 pp.
Cavanaugh AH, Hempel WM, Taylor LJ, Rogalsky V, Todorov G & Rothblum LI. Activity of RNA polymerase I transcription factor UBF blocked by Rb gene product, Nature, 1995, 374, 177–180.[Medline]
Cluzeaud F, Perennec J, deAmoral E, Willemin M & Hatt PY. Myocardial cell nucleus in cardiac overloading in the rat, Eur Heart J, 1984, 5, 271–280.
Dalen H, Saetersdal T & Odegarden S. Some ultrastructural features of the myocardial cells in the hypertrophied human papillary muscle, Virchows Arch A Pathol Anat Histopathol, 1987, 410, 281–294.[Medline]
Derenzini M & Trere D. Importance of interphase nucleolar organizer regions in tumor pathology, Virchows Arch B Cell Pathol, 1991, 61, 1–8.[Medline]
de The H, Chomienne C, Lanotte M, Degos L & Dejean A. The t(15;17) translocation of acute promyelocytic leukaemia fuses the retinoic acid receptor 
gene to a novel transcribed locus, Nature, 1990, 347, 558–561.[Medline]
Dumont JN. Oogenesis in Xenopus laevis(Daudin) I. Stages of oocyte development in laboratory maintained animals, J Morphol, 1972, 136, 153–180.[Medline]
Ellis RE, Sulston JE & Coulson AR. The rDNA of C. elegans: sequence and structure, Nucleic Acids Res, 1986, 14, 2345–2363.
Ferguson KC, Heid PJ & Rothman JH. The SL1 trans-spliced leader RNA performs an essenetial embryonic function in Caenorhabditis elegansthat can also be supplied by SL2 RNA, Genes Dev, 1996, 10, 1543–1556.
Files JG & Hirsh D. Ribosomal DNA of Caenorhabditis elegans. , J Mol Biol, 1981, 149, 223–240.[Medline]
Fischetti VA, Landau GM, Schmidt JP & Sellers P. Identifying periodic occurrences of a template with applications to protein structure, Inf Proc Lett, 1993, 45, 11–18.
Garber M, Panchanathan S, Fan RS & Johnson DL. The phorbol ester, 12-O-tetradec specific transcription by RNA polymerase III in Drosophila Schneider cells, J Biol Chem, 1991, 266, 20598–20601.
Guo S & Kemphues KJ. par-1, a gene required for establishing polarity in C. elegansembryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed, Cell, 1995, 81, 611–620.[Medline]
Hannan RD & Rothblum LI. Regulation of ribosomal DNA transcription during neonatal cardiomyocyte hypertrophy, Card Res, 1995, 30, 501–510.
Harlow, E., and D. Lane. 1988. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 726 pp.
Hatt PY, Jouannot P, Moravec J, Perennec J & Laplace M. Development and reversal of pressure-induced cardiac hypertrophy. Light and electron microscopic study in the rat under temporary aortic constriction, Basic Res Cardiol, 1978, 73, 405–421.[Medline]
Hedgecock EM & Herman RK. The ncl-1 gene and genetic mosaics of Ceanorhabditis elegans. , Genetics, 1995, 141, 989–1006.[Abstract]
Hershey JC, Hautmann M, Thompson MM, Rothblum LI, Haystead TAJ & Owens GK. Angiotensin II-induced hypertrophy of rat vascular smooth muscle is associated with increased 18S rRNA synthesis and phosphorylation of the rRNA transcription factor, upstream binding factor, J Biol Chem, 1995, 270, 25096–25101.
Johnson LF, Abelson HT, Green H & Penman S. Changes in RNA in relation to growth of the fibroblast. I. Amounts of mRNA, rRNA, and tRNA in resting and growing cells, Cell, 1974, 1, 95–100.
Kakizuka A, Miller WH, Umesono RP, Warrell S, Frankel VVVS, Marty E, Dmitrowsky E & Evans RM. Chromosomal translocation t(15;17) in human acute promyelocytic leukaemia fuses RAR with a novel putative transcription factor, PML, Cell, 1991, 66, 663–674.[Medline]
Kipreos ET, Lander LE, Wing JP, He WW & Hedgecock EM. cul-1 is required for cell cycle exit in C. elegansand identifies a novel gene family, Cell, 1996, 85, 829–839.[Medline]
Kurabayashi M & Yazaki Y. Molecular biology of heart disease synopsis of the pathophysiological basis of cardiac hypertrophy, familial hypertrophic cardiomyopathy, long QT syndrome and Marfan syndrome, Int Med, 1996, 35, 243–248.
Kurata S, Koga K & Sakaguchi B. Nucleolar size in parallel with ribosomal RNA synthesis at diapause termination in the eggs of Bombyx mori, Chromosoma (Berl), 1978, 68, 313–317.[Medline]
Liebhaber SA, Wolf S & Schlessinger D. Differences in rRNA metabolism of primary and SV40-transformed human fibroblasts, Cell, 1978, 13, 121–127.[Medline]
McDermott PJ, Rothblum LI, Smith D & Morgan HE. Accelerated rates of ribosomal RNA synthesis during growth of contracting heart cells in culture, J Biol Chem, 1989, 264, 18220–18227.
Melese T & Xue Z. The nucleolus: an organelle formed by the act of building a ribosome, Curr Opin Cell Biol, 1995, 7, 319–324.[Medline]
Mello CC, Kramer JM, Stinchcomb D & Ambros V. Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences, EMBO (Eur Mol Biol Organ) J, 1991, 10, 3959–3970.[Medline]
Miller LM, Waring DA & Kim SK. Mosaic analysis using a ncl-1 (+) extrachromosomal array reveals that lin-31 acts in the Pn.p cells during Caenorhabditis elegansvulval development, Genetics, 1996, 143, 1181–1191.[Abstract]
Moss T & Stefanovsky VY. Promotion and regulation of ribosomal transcription in eukaryotes by RNA polymerase I, Prog Nucleic Acid Res Mol Biol, 1995, 50, 25–66.[Medline]
Mu Z, Chin K, Liu J, Lozano G & Chang K. PML, a growth suppressor disrupted in acute promyelocytic leukemia, Mol Cell Biol, 1994, 14, 6858–6867.
Nasmyth K. Another role rolls in, Nature, 1996, 382, 28–29.[Medline]
Nomura M, Gourse R & Baughman G. Regulation of the synthesis of ribosomes and ribosomal components, Annu Rev Biochem, 1984, 53, 75–117.[Medline]
Perry RP. Processing of RNA, Annu Rev Biochem, 1976, 45, 605–629.[Medline]
Prescott, D.M. 1976. Reproduction of Eukaryotic Cells. Academic Press, New York, 177 pp.
Proud CG. p70 S6 kinase: an enigma with variations, Trends Biochem Sci, 1996, 21, 181–185.[Medline]
Rabkin, R., and F.C. Fervenza. 1996. Renal hypertrophy and kidney disease in diabetes. Diabetes/Metab. Rev. 12:217–241.
Rakusan, K. 1984. Cardiac growth, maturation, and aging. In Growth of the Heart in Health and Disease. R. Zak, editor. Raven Press, New York, 131– 164.
Reddy BA, Etkin LD & Freemont PS. A novel zinc finger coiled-coil domain in a family of nuclear proteins, Trends Biochem Sci, 1992, 17, 344–345.[Medline]
Roberts SB, Emmons SW & Childs G. Nucleotide sequences of Caenorhabditis eleganscore histone genes, J Mol Biol, 1989, 206, 567–577.[Medline]
Sadoshima J, Aoki H & Izumo S. Angiotensin II and serum differentially regulate expression of cyclins, activity of cyclin-dependent kinases, and phosphorylation of retinoblastoma gene product in neonatal cardiac myocytes, Circ Res, 1997, 80, 228–241.
Schaffner W & Weissmann C. A rapid, sensitive, and specific method for the determination of protein in dilute solution, Anal Biochem, 1973, 56, 502–514.[Medline]
Schauer IE & Wood WB. Early C. elegansembryos are transcriptionally active, Development (Camb), 1990, 110, 1303–1317.
Schmidt T, Chen PS & Pellegrini M. The induction of ribosome biosynthesis in a nonmitotic secretory tissue, J Biol Chem, 1985, 260, 7645–7650.
Seydoux G & Fire A. Soma-germline asymmetry in the distributions of embryonic RNAs in Caenorhabditis elegans. , Development (Camb), 1994, 120, 2823–2834.[Abstract]
Sulston J, Du Z, Thomas D, Wilson R, Hillier L, Staden R, Halloran N, Green P, Thierry-Mieg J, Qiu L et al.. The C. elegansgenome sequencing project: a beginning, Nature, 1992, 356, 37–41.[Medline]
Takano H, Komuro I, Zou Y, Kudoh S, Yamazaki T & Yazaki Y. Activation of p70 S6 protein kinase is necessary for angiotensin II-induced hypertrophy in neonatal rat cardiac myocytes, FEBS (Fed Eur Biochem Soc) Lett, 1996, 379, 255–259.
Vallett SM, Brudnak M, Pellegrini M & Weber HW. In vivo regulation of rRNA transcription occurs rapidly in nondividing and dividing Drosophila cells in response to a phorbol ester and serum, Mol Cell Biol, 1993, 13, 928–933.
Voit R, Schnapp A, Kuhn A, Rosenbauer H, Hirschmann P, Stunnenberg HG & Grummt I. The nucleolar transcription factor mUBF is phosphorylated by casein kinase II in the C-terminal hyperacidic tail which is essential for transactivation, EMBO (Eur Mol Biol Organ) J, 1992, 11, 2211–2218.[Medline]
White, J. 1988. The anatomy. In The Nematode Caenorhabditis elegans. W.B. Wood, editor. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 81–122.
White RJ. Regulation of RNA polymerases I and III by the retinoblastoma protein: a mechanism for growth control? , Trends Biochem Sci Soc, 1997, 22, 77–80.[Medline]
White RJ, Trouche D, Martin K, Jackson SP & Kouzarides T. Repression of RNA polymerase III transcription by the retinoblastoma protein, Nature, 1996, 382, 88–90.[Medline]
Williams BO, Schmitt EM, Remington L, Bronson RT, Albert DM, Weinberg RA & Jacks T. Extensive contribution of Rb-deficient cells to adult chimeric mice with limited histopathological consequences, EMBO (Eur Mol Biol Organ) J, 1994, 13, 4251–4259.[Medline]
Wilson, E.B. 1896. The Cell in Development and Inheritance. Johnson Reprint Corporation, New York. 371 pp.
Wood, W.B. 1988. Embryology. In The Nematode Caenorhabditis elegans. W.B. Wood, editor. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 215–241.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
