|
||
Division of Basic Sciences and Molecular and Cellular Biology Program, Fred Hutchinson Cancer Research Center, Seattle, Washington 98109
| |
Abstract |
|---|
|
|
|---|
Regulation of ribosome synthesis is an essential aspect of growth control. Thus far, little is known about the factors that control and coordinate these processes. We show here that the Caenorhabditis elegans gene ncl-1 encodes a zinc finger protein and may be a repressor of RNA polymerase I and III transcription and an inhibitor of cell growth. Loss of function mutations in ncl-1, previously shown to result in enlarged nucleoli, result in increased rates of rRNA and 5S RNA transcription and enlarged cells. Furthermore, ncl-1 adult worms are larger, have more protein, and have twice as much rRNA as wild-type worms. Localization studies show that the level of NCL-1 protein is independently regulated in different cells of the embryo. In wild-type embryos, cells with the largest nucleoli have the lowest level of NCL-1 protein. Based on these results we propose that ncl-1 is a repressor of ribosome synthesis and cell growth.
| |
Introduction |
|---|
|
|
|---|
DURING the life cycle of metazoans, growth occurs by
increases in both the size of individual cells and in
the actual number of cells. Most often these two
processes are coordinated; cells are born at a certain size,
double in size during the cell cycle, and then divide (Prescott, 1976
). In some cases, however, cell size increase and
cell division occur independently, as in early embryogenesis of many organisms where rapid cleavage divisions occur without any increase in cell size (Wilson, 1896
). Similarly, growth of individual cells can occur in the absence of
cell division. For instance, many adult tissues such as cardiac muscle increase in mass by cell size increase, or hypertrophy, rather than by cell division (Rakusan, 1984
). A
striking example of growth without division is during amphibian oocyte development (Dumont, 1972
). Furthermore, an increase in cell size independent of cell division may also account for the fact that distinct cell types having identical DNA content can vary greatly in size within an
individual organism (Altman and Katz, 1976
).
Previous studies in bacteria and yeast have demonstrated that cell growth (increase in cell size and number)
is tightly coupled to an increase in both protein synthesis
and ribosome biogenesis (for review see Nomura et al.,
1984
). In higher eukaryotes, this correlation is seen in the
diminished transcription of ribosomal RNAs (rRNA and
5S RNA) during quiescence and the subsequent increase after stimulation with growth factors (Johnson et al.,
1974
). Cell division is not a requirement for this coordination, however, as studies of hypertrophy in vertebrate cardiomyocytes also link rRNA and 5S RNA synthesis with
control of cell size (McDermott et al., 1989
). These studies
suggest that regulators of ribosome synthesis may play an
important role in cellular growth control. One gene that
appears to function in the control of cell growth is the Retinoblastoma gene (Rb).1 In addition to its role in the control of cell division, Rb has been shown to inhibit the synthesis of both rRNA and 5S RNA (Cavanaugh et al., 1995
;
White et al., 1996
).
In eukaryotes, the nucleolus, the nuclear organelle in
which rRNA synthesis and assembly of preribosomal subunits occurs (for review see Melese and Xue, 1995
), is a
good cytological marker of ribosome synthesis as the size
of the nucleolus is indicative of the level of rRNA synthesis (Kurata et al., 1978
; Altmann and Leblond, 1982
; Moss
and Stefanovsky, 1995
). Interestingly, tumor cells not only
exhibit rapid cell growth and division, but also often have
enlarged nucleoli (Busch and Smetana, 1970
; Derenzini and Trere, 1991
). Similarly, during both normal developmental cardiac hypertrophy and aberrant hypertrophy
that occurs in many forms of heart disease, nucleoli are enlarged (Hatt et al., 1978
; Cluzeaud et al., 1984
; Dalen et al.,
1987
). Enlarged nucleoli have also been observed in the
ncl-1 mutant of the nematode Caenorhabditis elegans
(Hedgecock and Herman, 1995
). We have isolated the ncl-1 gene and show that it appears to repress rRNA and 5S
RNA synthesis and to be an inhibitor of both ribosome
biosynthesis and cell growth.
| |
Materials and Methods |
|---|
|
|
|---|
Strains and Alleles
Bristol strain N2 was used as the standard wild-type strain. The ncl-1 alleles
used were: e1865 (Hedgecock and Herman, 1995
) and e1942 (provided by
C. Kenyon, University of California, San Francisco, CA). Both were outcrossed against N2 five times. clr-1 (e1745) was used for cell size analysis.
Nematode strains were cultured as described by Brenner (1974)
.
Worm Size and Total Protein Measurements
Two-dimensional images of wild-type and ncl-1 (e1942) worms grown for
50 h at 20°C after hatching were collected using a charge-coupled device
camera and National Institutes of Health (NIH) image. Worm sizes were
determined in Canvas (Deneba Software, Miami, FL) and then analyzed
in Microsoft Excel (Redmond, WA). The amount of total protein was determined for wild-type and ncl-1 (e1942) adult worms grown at 20°C for 44 h
after hatching using the Amidoschwarz assay (Schaffner and Weissmann,
1973
). Total DNA in each sample was determined using a fluorometer
(model TKO-100; Hoefer Scientific Instruments, San Francisco, CA).
Analysis of total protein to DNA ratios and statistics was performed using
Microsoft Excel.
In Situ Hybridization
In situ hybridization using either 5.8S or internal transcribed spacer
(ITS)2 probes was done according to the method of Seydoux and Fire
(1994)
. The 5.8S (GGAGGCCCAGTTGGTGCTATGCGTTCG) and
ITS2 (CAAGTCGGACGCCATTTGGCAGCTCCTCCG) antisense oligo
probes were directed against nucleotides 2204-2230 and 2426-2455, respectively, of the C. elegans rDNA repeat (Ellis et al., 1986
). Probes were
end labeled with terminal deoxynucleotidyl transferase and digoxigenin- ddUTP (Boehringer Mannheim Biochemicals, Indianapolis, IN) and then
used at a concentration of 1.0 µg/ml in 7.7% formamide, 2× SSC hybridization buffer. Probes were then visualized using FITC-conjugated antidigoxigenin antibodies (Boehringer Mannheim Biochemicals). The following controls for specificity of hybridization were performed: an anti-SL1
(spliced leader) probe (CTCAAACTTGGGTAATTAAACC) hybridized to the cytoplasm of all cells and to cytoplasmic granules in the P cells as
previously described (Seydoux and Fire, 1994
), but did not hybridize to
nucleoli; and prehybridizing of slides with 20 µg/ml of unlabeled 5.8S or
ITS2 antisense oligo inhibited hybridization with the respective labeled
oligos.
Run-on Transcription Assays
Extracts were prepared from early embryos (95% earlier than 100-cell
stage) by collecting and bleaching worms from the different genetic backgrounds just as they began to become gravid and contained <10 embryos
per hermaphrodite. Preparation of extracts for transcription assays and
quantitation of DNA in the extracts was done as described (Schauer and
Wood, 1990
), except that salmon sperm DNA was used to provide a standard curve and a fluorometer (model TKO-100; Hoefer Scientific Instruments) was used.
For some experiments, run-on transcription reactions and hybridizations were performed as described (Schauer and Wood, 1990
), except that
volumes of embryonic extracts corresponding to 50 µg of DNA, 100 µCi
of [32P]uridine 5'-triphosphate (UTP), 2 mM ATP, 2 mM CTP, 2 mM
GTP, and 0.05 mM cold UTP were used in 100-µl reactions and then hybridizations were done for 2 d at 42°C. In other experiments, the reaction conditions were as follows: volumes of extract corresponding to 2.5 µg of
DNA were incubated in buffer containing 5 mM Tris-HCl, pH 8.0, 2.5 mM
MgCl2, 150 mM KCl, 100 µCi [32P] cytosine 5'-triphosphate (CTP), 0.8 mM
ATP, 0.8 mM GTP, 0.8 mM UTP, 1 mM DTT, and 200 U/ml RNAsin
(Promega Corp., Madison, WI) (final volume was 20 µl) for 30 min at
room temperature. For these experiments, hybridization was performed
for 18 h at 65°C in 10 mM TES (Sigma Chemical Co., St. Louis, MO) pH
7.5, 1% SDS, 10 mM EDTA, 250 µg/ml Escherichia coli RNA, 300 mM
NaCl, 100× Denhardt's (2% Ficoll 400, 2% polyvinylpyrrolidone, 2% bovine serum albumin), and 0.25% powdered nonfat milk. In each experiment, three reactions were performed for each genotype tested.
Slot blot filters were prepared as follows: for each reaction performed,
5 µg of each of the DNAs of interest were denatured in 0.3 M NaOH at
65°C for 10 min and then neutralized by the addition of 1 vol of 2 M ammonium acetate. Denatured DNAs were loaded onto Gene Screen Plus
membrane (DuPont-NEN, Boston, MA), presoaked in 1× SSC, 10 mM
Tris, pH 7.4, using a slot blotting apparatus (Schleicher & Schuell, Inc.,
Keene, NH). DNAs of interest were as follows: rDNA was pCe7 (Files
and Hirsh, 1981
); 5S RNA gene construct was made by cloning a 160-bp
StuI-HindIII fragment of plasmid 985(Sl1/5S) (Ferguson et al., 1996
) into
Bluescript KS+ (Stratagene, La Jolla, CA) cut with EcoRV and HindIII;
histone genes were in clone pCeh-3 (Roberts et al., 1989
). Quantitation of
hybridization signals was performed using a phosphorimager (Molecular
Dynamics, Sunnyvale, CA) and data from all experiments performed
(four experiments for wild-type and ncl-1 [e1865] on rDNA and 5S; two
experiments for ncl-1 [e1942] on rDNA, 5S, and histones, and wild-type
and ncl-1 [e1865] on histones) were collated for the graphs presented in
Fig. 3.
|
Northern Blot Analysis
Northern blots were performed as described in Ausubel et al. (1987)
. The
28S rRNA (CTGCACTGACGGAAGCTCCAGCCGAGCC) antisense oligo probe was directed against nucleotides 4113-4140 of the C. elegans
rDNA repeat (Ellis et al., 1986
). The histone (AGAGGGCCGTTGGGTTCGGT) antisense oligo probe was directed against the conserved 3' sequence in all C. elegans histone messages (Roberts et al., 1989
).
Cloning of ncl-1
The ncl-1 locus was identified through a series of germline transformation
experiments with cosmids and subclones of cosmid ZK112. DNA was injected with the dominant marker rol-6 (Mello et al., 1991
) into the syncytial gonad of ncl-1 (e1865) or ncl-1 (e1942) animals. DNA was injected at a
final concentration of 0.1 mg/ml. Adult Rol progeny were analyzed by differential interference contrast microscopy for rescue of the Ncl phenotype. Partial rescue (not all cells were rescued) was obtained with the 7.5-kb
rescuing fragment (pZK112-1b).
Antisense RNA derived from a 1-kb HindIII-XhoI fragment of
pZK112-1b was injected into the syncytial gonad of wild-type hermaphrodites according to the procedure of Guo and Kemphues (1995)
. These
worms gave progeny with enlarged nucleoli, indicative of ncl-1 phenocopy.
A full-length ncl-1 cDNA was obtained by screening a C. elegans mixed
stage library (Stratagene) with the 1-kb HindIII-XhoI fragment of
pZK112-1b. Sequencing of this cDNA revealed the same exon boundaries
as predicted by GeneFinder. This cDNA begins at a position 134-bp upstream of the first ATG and terminates with a poly A tail 1,355-bp downstream of the first in-frame stop codon. The Matcher program (Fischetti et
al., 1993
) was used to identify the predicted coiled-coil motif in NCL-1.
Sequence data is available under EMBL/GenBank/DDBJ accession number AF047027.
Production of Monoclonal Antibody, Immunoblotting, and Immunostaining
The pET-16b vector (Novagen Inc., Madison, WI) was used to generate a
protein fusion between the 10-His tag and amino acids 24-377 of NCL-1.
The bacterially expressed fusion protein 10-His-NCL was purified by
chromatography on Ni2+-NTA-Agarose (QIAGEN Inc., Santa Clarita,
CA). mAb D3C2 and ascites fluid were generated as described by Harlow
and Lane (1988)
.
For immunoblotting, embryo extracts prepared by overnight extraction of embryos in N,N-dimethylformamide (Sigma Chemical Co.) followed by sonication of insoluble material in NEST-2 (5% SDS, 20 mM EDTA, 50 mM Tris-HCl, pH 6.8) were run on 6% SDS-polyacrylamide gels and then transferred to nitrocellulose. Blots were stained with Ponceau S, blocked for 1 h in 3% BSA and 10% nonfat dry milk in TBST (50 mM Tris-Hcl, pH 8.0, 150 mM NaCl, 0.05% Tween 20), incubated overnight at room temperature in primary antibody, washed in TBST, incubated in horseradish peroxidase-linked anti-mouse Ig (Amersham Corp., Arlington Heights, IL) diluted 1:2,500 in 3% BSA in TBST, washed extensively in TBST, and then processed for detection using the SuperSignal Substrate, Western blotting kit (Pierce Chemical Co., Rockford, IL). mAb D3C2 was used as undiluted hybridoma supernatant.
Fixation of embryos was as described (Albertson, 1984
) with the following exceptions. Slides were pretreated with 3-aminopropyltriethoxysilane (Sigma Chemical Co.) and fixation was then done in N,N-dimethylformamide at
20°C for 5 min. Gonad fixation and staining was
performed in solution. For immunostaining, mAb D3C2 ascites fluid was
used at a 1:500 dilution. mAb K121 against 2,2,7-trimethylguanosine (Oncogene Science, Inc., Manhasset, NY) was used at a 1:50 dilution.
| |
Results |
|---|
|
|
|---|
Increased Nucleolar and Cellular Size in ncl-1 Mutants
To begin to investigate the mechanisms regulating cell
growth and ribosome synthesis, we have focused on the
gene ncl-1 in C. elegans. ncl-1 (e1865) and ncl-1 (e1942)
have previously been described as recessive mutations that
result in enlarged nucleoli that can be detected by Nomarski microscopy in nearly all cells of live worms (Hedgecock and Herman, 1995
). Both alleles are recessive and
appear genetically to be loss of function mutations. This phenotype is fully penetrant in both alleles and is especially evident in embryos. For example, nucleoli are clearly
detectable in a ncl-1 four-cell embryo but are not visible in
a wild-type four-cell embryo (Fig. 1). In larvae and adult
worms, enlarged nucleoli can be seen in all cells with the
exception of the gut and syncytial gonad since these tissues
have large nucleoli in wild type. Similarly, the degree to
which nucleolar size changes in the mutant differs in distinct cell types; the small or not detectable nucleoli of
some wild-type cells are clearly enlarged in ncl-1 mutants,
whereas the large nucleoli of other cells are only slightly
enlarged in ncl-1 mutants.
|
In addition to enlarged nucleoli, ncl-1 mutants also exhibit increases in growth. By microscopic imaging and
measurement of worms in two dimensions, we observed
that adult ncl-1 (e1942) worms are 9% larger than wild-type worms at identical times after hatching (n = 20 for
each, P < 0.01). Previous studies have shown that there is
no difference in cell division timing or final number of
cells between ncl-1 mutants and wild type (Hedgecock and
Herman, 1995
). The enlarged size of ncl-1 mutants, therefore, is likely due to increased cell sizes. To test this, we
used Nomarski microscopic imaging of live worms to analyze the sizes of specific cells and found that some cells in
ncl-1 mutants are larger than the respective cells in wild-type worms. To quantitate the size increase, we made use
of the mutant clr-1; these mutant worms are clear when shifted to the nonpermissive temperature, thereby allowing cell outlines to be visualized and cell sizes to be measured (Kipreos et al., 1996
). We made two-dimensional
measurements of specific cells and compared their sizes
between clr-1 and ncl-1 (e1942);clr-1 larvae at identical
times after hatching. The cell anterior lateral microtubule
(ALM) is 47-78% larger in ncl-1;clr-1 than in clr-1, and
the cell Q2.pap is 75-126% larger (Table I). The evidence that the ncl-1 gene product functions in these two cells is
that they both have enlarged nucleoli in ncl-1 and ncl-1;clr-1
worms (data not shown), and that ncl-1 is known to function cell autonomously (Hedgecock and Herman, 1995
).
These results demonstrate that ncl-1 mutants have larger
cells than wild-type worms and suggest that the ncl-1 gene
product represses cell growth.
|
Increased Protein and rRNA in ncl-1 Mutants
Because an increase in cell size is likely to indicate increased protein synthesis, we assayed protein levels in wild-type and mutant worms and found that adult ncl-1 (e1942) worms have 22% more protein than wild-type worms (n = 10 for each, P < 0.0005). Because this increased level of protein in ncl-1 worms may indicate an increased capacity for protein synthesis, or more ribosomes, and because ncl-1 mutants have enlarged nucleoli, we hypothesized that ncl-1 mutant worms might have an increased amount of ribosomal RNA. To quantitate steady-state rRNA, we performed Northern blots on RNA from mutant and wild-type worms 48 h after hatching. We found that the ratio of histone mRNA to total DNA is the same in ncl-1 and wild-type worms at identical times after hatching, and therefore standardized the 28S rRNA hybridization signal to the histone message on the same blot. We found that ncl-1 (e1865) adults contain 1.6 times more rRNA than wild-type worms (P < 0.05) and that ncl-1 (e1942) adults contain 2.2 times more rRNA than wild-type worms (P < 0.05) (Fig. 2). Thus, one way in which the ncl-1 gene product could restrict cell size is by repression of the steady-state level of rRNA and, therefore, the capacity for protein synthesis.
|
Increased RNA Polymerase I and III Transcription in ncl-1 Mutants
We next considered the possibility that the increased
amount of rRNA in ncl-1 mutants is due to an increase in
the rate of rRNA transcription. To test this hypothesis, we
compared the level of rRNA present in the nuclei of early
wild-type and ncl-1 embryos by in situ hybridization. Although we detected 5.8S rRNA in the cytoplasm in both
wild-type and ncl-1 embryos, hybridization in the nucleus
was higher in ncl-1 embryos than in wild-type (Fig. 3, a and
b). In all ncl-1 embryos examined, nuclear hybridization was seen in one or two sites that overlapped with the sites
of visible nucleoli, whereas this pattern was not seen in any
of the wild-type embryos examined (Fig. 3 b). To distinguish between precursor and mature rRNA, we next performed in situ hybridizations using an oligo probe directed
against ITS2 that is present in precursor rRNA but is removed during processing (Perry, 1976
). No signal was detected in the cytoplasm of either wild-type or ncl-1 embryos using this probe. In the nucleus, hybridization was
much stronger in ncl-1 than in wild-type embryos (Fig. 3, e
and f). Similar to the 5.8S probe, we detected one or two
sites of hybridization that colocalize with nucleoli in nuclei
of all ncl-1 embryos examined (Fig. 3 f) This was not seen
in any of the wild-type embryos examined. These data indicate that in ncl-1 embryos, there is an increase in the
level of precursor rRNA present in the nucleus.
To determine if this increase in level of precursor rRNA
in the nucleus is due to an increase in the rate of rRNA
transcription in mutant embryos, we performed nuclear
run-on assays on wild-type and mutant embryos (refer to
Materials and Methods). We analyzed early embryos because at this time in development there is a very clear difference between the size of nucleoli in mutant and wild-type (refer to Fig. 1). Nuclear run-on assays were performed on
equivalent numbers of nuclei from mutant and wild-type
extracts as determined by standardization to DNA by fluorometry. We first analyzed rRNA transcription by hybridization of nascent RNA labeled in the run-on reaction
to DNA corresponding to one repeat of C. elegans rDNA. We found that the rate of rRNA transcription is 2-2.5 times
higher in ncl-1 early embryos than in wild-type embryos
(Fig. 4 a). This observation suggests that, as hypothesized
by Hedgecock and Herman (1995)
, the ncl-1 gene product
represses rRNA transcription, and that ncl-1 worms have
enlarged nucleoli because of increased nucleolar activity.
|
To address the polymerase specificity of the ncl-1 phenotype, we assayed RNA polymerase II and III transcription using the nuclear run-on assay. To detect RNA polymerase III transcription, we hybridized radiolabeled nascent RNA to DNA encoding the C. elegans 5S gene. RNA polymerase II transcription was detected by hybridization of radiolabeled nascent RNA to DNA encoding the histone H2A, H2B, H3, and H4 genes. We found that 5S transcription was approximately twofold higher in ncl-1 than in wild-type embryos (Fig. 4 b), whereas histone transcription was not significantly affected (Fig. 4 c). These data indicate that the ncl-1 gene product functions to modulate both RNA polymerase I (rRNA) and RNA polymerase III (5S) transcription, whereas it does not appear to play a general role in the regulation of RNA polymerase II transcription. This suggests that ncl-1 may repress the production of ribosomes, and thus the capacity for protein synthesis, through inhibition of RNA polymerase I and III transcription.
NCL-1 Is a B Box Zinc Finger Protein
ncl-1 had previously been localized to cosmid C33C3 by
transformation rescue (Miller et al., 1996
). We achieved
rescue with the neighboring cosmid ZK112, which has
been sequenced by the C. elegans genome consortium
(Sulston et al., 1992
). Analysis of subclones from this
cosmid resulted in identification of a 7.5-kb genomic fragment containing one predicted gene that partially rescued
the ncl-1 enlarged nucleolus phenotype (Fig. 5). To confirm that this gene is ncl-1, we injected antisense RNA
transcribed from this genomic fragment into the syncytial
gonad of wild-type hermaphrodites. This resulted in enlarged nucleoli in larval progeny (Fig. 5). In both the rescue and antisense experiments, the numbers of affected
nuclei varied from animal to animal. These lines of evidence together indicate that this gene is ncl-1.
|
The ncl-1 cDNA can encode an 851-amino acid protein
(Fig. 6 a) with two zinc finger motifs previously described
as B boxes (Reddy et al., 1992
). It also contains a predicted
coiled-coil motif. Proteins that share these motifs include
the oncogenic proteins promyelocytic leukemia (PML),
T18, and ret finger protein (RFP), as well as other proteins
such as XNF7, SS-A/Ro, regulatory protein, T lymphocyte
(RPT-1), and PwA33 (for review see Reddy et al., 1992
).
Although NCL-1 does not contain a really interesting new
gene (RING) zinc finger motif common to many of these
proteins, it is most like PML and T18 in that these proteins
all have two B box zinc finger motifs. Outside of the B
boxes and coiled-coil motif, there is no homology between
NCL-1 and any other proteins.
|
Expression of NCL-1 Is Correlated with Repression of rRNA Synthesis and Decreased Cell Size in Wild-type Embryos
We were interested in learning the spatial and temporal expression of NCL-1 and therefore generated mouse polyclonal antisera and a mouse mAb against the amino-terminal half of NCL-1 (refer to Materials and Methods). Results with polyclonal antisera and the monoclonal antibody are identical; only those experiments using mAb D3C2 are presented here. mAb D3C2 recognizes two bands of ~100-kD in wild-type extracts, but not in extracts made from either of the two mutant alleles of ncl-1 (Fig. 6 b). The upper band is a phosphorylated form of NCL-1 (data not shown). The predicted molecular weight of NCL-1 is 92-kD. In ncl-1(e1865) embryo extracts, a faster migrating polypeptide of ~80-kD was detected, whereas no immunoreactive species was detected in extracts from ncl-1 (e1942). These results confirm that this gene is ncl-1 and suggest that ncl-1(e1942) is a protein-null allele, whereas ncl-1(e1865) produces a shorter form of the protein.
Given that NCL-1 appears to act as an inhibitor of RNA polymerase I transcription, and thus nucleolar size and function, we hypothesized that it would be expressed when nucleoli are absent, and not expressed when nucleoli are visible. We first examined early embryos in which nucleoli are not detectable in wild-type. Indirect immunofluorescence using mAb D3C2 showed that in wild-type embryos, NCL-1 is a cytoplasmic protein with no obvious nuclear accumulation. NCL-1 staining is abundant in early embryos and then rapidly diminishes during development (Fig. 7 a). We detect no staining with mAb D3C2 in ncl-1 (e1942) mutant embryos at any stage (data not shown).
|
We next assayed NCL-1 expression in 300-cell stage embryos, since nucleoli are first visible in some cells at this stage in development. As a marker for nucleoli in these cells, we stained similarly staged embryos with mAb K121 that recognizes nucleoli in C. elegans (Fig. 7 d). Immunostaining with mAb D3C2 showed that NCL-1 is present in the cytoplasm of all cells except those of the developing gut (Fig. 7 c); these cells are among the first to differentiate in the embryo, are the largest cells in the embryo, and have very large nucleoli. Lastly, we analyzed the NCL-1 staining pattern in the hermaphrodite gonad. Nucleoli are visible in the syncytial gonad of adult hermaphrodites but disappear as oocytes mature. We observed that cytoplasmic NCL-1 staining is absent in the mitotic region of the syncytial gonad, low in the meiotic region, and then increases throughout oocyte maturation such that the most intense staining is seen in the most mature oocyte (Fig. 7 e). Together these staining experiments indicate that NCL-1 protein is present in cells in which nucleoli are absent, and absent from large cells in which nucleoli are prominent. This suggests that the regulation of NCL-1 protein expression is important for the control of cell growth and ribosome synthesis.
| |
Discussion |
|---|
|
|
|---|
NCL-1, a Key Molecule in the Regulation of Cell Growth and Ribosome Synthesis
We have shown that the C. elegans gene ncl-1 may inhibit
ribosome synthesis and restrict cell growth. In ncl-1 loss of
function mutants, individual cells are larger than wild-type
and as a result, the worms themselves are larger. In addition, we observed a twofold increase in steady-state amount
of rRNA in ncl-1 mutant worms relative to wild-type. As
rRNA is very stable (for example, Liebhaber et al. [1978]
reported a rRNA half-life of
700 h in primary human fibroblasts), this increase is likely due to the 2-2.5 fold increase in the rate of rRNA transcription we observed in
ncl-1 mutant embryos relative to wild-type. We observed a
similar effect on the rate of 5S RNA transcription. These
results are consistent with those seen by others in systems
in which rRNA or 5S RNA transcription are experimentally induced, such as by application of 12-o-tetradecanoylphorbol-13-acetate to cells (Allo et al., 1991
; Garber
et al., 1991
; Vallett et al., 1993
). Furthermore, since ribosomal RNA makes up 60-90% of cellular RNA, a twofold
increase is a substantial alteration. This result suggests that
ncl-1 worms may have more ribosomes than wild-type worms, consistent with our finding that ncl-1 worms contain more protein than wild-type worms. Therefore, the
difference in cell size and whole animal size between ncl-1
and wild-type worms may be accounted for by an increased ability to synthesize proteins.
The regulation of expression of NCL-1 protein appears
to be important for the control of cell growth and ribosome synthesis as its abundance is inversely related to the
presence of visible nucleoli, the nuclear organelles in
which rRNA synthesis occurs. NCL-1 is present in the
early embryo where nucleoli are not visible and high levels
of zygotic rRNA production are perhaps not necessary because of the maternal contribution of ribosomes. At the
300-cell stage, NCL-1 protein is present in all cells except
those of the gut. Gut cells are the first cells to differentiate
in the embryo, are the largest cells in the embryo (Wood,
1988
), and have large nucleoli. In addition to being very
large, the gut cells are quite active metabolically (the gut
produces all of the digestive enzymes as well as the yolk
for the gonad; White, 1988
) and therefore presumably require high levels of ribosome synthesis. Tissues with high
metabolic activity, such as the gut, produce high levels of
ribosomes as demonstrated in studies of Drosophila paragonial glands (Schmidt et al., 1985
). Such cells likely synthesize high levels of ribosomes not solely to increase their
size, but rather to maintain a high level of biosynthetic activity. Therefore, it is possible that the function of ncl-1
can be thought of not simply as being a repressor of cell
size, but more specifically as an inhibitor of the level of
biosynthetic activity within a cell. Together, our results indicate that NCL-1 is a key molecule in the regulation of
cell growth and ribosome synthesis.
Possible Mechanisms for ncl-1-mediated Regulation of Ribosome Synthesis and Cell Size
The mechanism by which ribosome synthesis is coupled to
cell growth is unclear. It has been proposed that a feedback mechanism exists wherein the ratio of free ribosomes
to polysomes is monitored. When this ratio becomes too
high (i.e., there are many inactive ribosomes not engaged
in translation), ribosomal RNA synthesis is downregulated, and when this ratio becomes too low (i.e., the majority of ribosomes are engaged) then ribosomal RNA synthesis is upregulated (for review see Nomura et al., 1984
).
In light of this, two models for the molecular function of
ncl-1 can be considered. The first is that ncl-1 functions to
inhibit translation. This would result in a decrease in polysomes and an increase in free ribosomes, which would lead
to a decrease in rRNA transcription. The fact that ncl-1
worms have more protein, and presumably a higher level
of protein synthesis, than wild-type worms is consistent with this model. The second model is that ncl-1 functions
in sensing the ratio of free ribosomes to polysomes and directs the level of rRNA transcription. Finally, it is possible
that although the majority of NCL-1 protein appears by
immunocytochemistry to be cytoplasmic, some NCL-1
protein may be nuclear, and might act directly as a transcription factor to inhibit RNA polymerase I and III transcription.
The control of cell size is of clinical interest as many
forms of human heart failure and kidney disease caused by
diabetes are associated with enlarged cells (hypertrophy)
in cardiac and renal tissues (for review see Hannan and
Rothblum, 1995
; Kurabayashi and Yazaki, 1996
; Rabkin
and Fervenza, 1996
). In studies of cardiac hypertrophy, it
has been found that ribosomal RNA synthesis increases (McDermott et al., 1989
), consistent with the idea that increased cell size is correlated with an increased capacity
for protein synthesis. Although the mechanism of this
transcriptional upregulation has not been determined, it
has been found that UBF (upstream binding factor, the
RNA polymerase I transcriptional activator) becomes
phosphorylated (Hershey et al., 1995
), an event which is
correlated with its activation (Voit et al., 1992
). Likewise, ribosomal protein S6 becomes phosphorylated by S6 kinase (Takano et al., 1996
); phosphorylation of S6 correlates with higher translation efficiency (Proud, 1996
). It is
possible that this results in an increase in rRNA transcription via the feedback mechanism discussed above. Thus
far, there are no genetic systems available to study hypertrophy. As ncl-1 mutants exhibit phenotypes characteristic of hypertrophy (increased cell size, increased steady-state
rRNA, and increased rate of rRNA transcription), we propose that ncl-1 provides a model genetic system in which
to approach this problem of the regulation of hypertrophic
growth.
NCL-1 Is Related in Sequence to Oncogenes Such as PML and May Share with Rb the Ability to Repress the Synthesis of Ribosomal RNAs
NCL-1 has B box zinc finger and coiled-coil motifs common to several proteins including PML, T18, and RFP (for
review see Reddy et al., 1992
). This similarity is intriguing
in that these three genes were all identified as translocations that result in tumorigenesis. For instance, PML was
found as a translocation resulting in a fusion protein between the zinc fingers and coiled-coil of PML and the retinoic acid receptor (RAR); the fusion protein PML-RAR
is responsible for acute promyelocytic leukemia in humans (Borrow et al., 1990
; de The et al., 1990
; Kakizuka et al.,
1991
). Although the mechanism of transformation by the
PML-RAR fusion protein is still unclear, PML alone may
function normally as a growth suppressor since it has been
shown to be able to inhibit transformation in cell culture
(Mu et al., 1994
). Because tumor cells often have enlarged
nucleoli (Busch and Smetana, 1970
; Derenzini and Trere,
1991
), it is conceivable that these genes and ncl-1 might
have overlapping functions.
One other cancer related gene, the tumor suppressor
Rb, is structurally unrelated but does share some common
functions with ncl-1. Recent evidence suggests that, like
ncl-1 mutants, loss of Rb function may derepress transcription by RNA polymerase I and III (Cavanaugh et al., 1995
;
White et al., 1996
). It is possible that one way in which tumor cells are able to achieve an increase in cell growth is
by increasing their ability to synthesize proteins through
mutation of a gene such as Rb that normally functions to
repress RNA polymerase I and III transcription (for review see Nasmyth, 1996
; White, 1997
). Interestingly, it has
been shown that chimeric mice containing Rb-deficient
cells have enlarged cells in the liver and cerebellum (Williams et al., 1994
), suggesting that Rb, like ncl-1, may be required to limit the size of cells. Furthermore, induction of
cellular hypertrophy in cardiomyocytes leads to increased
phosphorylation of Rb (Sadoshima et al., 1997
). It will be
interesting to learn if there is Rb in C. elegans, and if so,
how it and ncl-1 might function together to achieve the
goal of negatively regulating cell size and ribosomal RNA synthesis. Conversely, it will be interesting to learn if there is a ncl-1-like gene in mammalian cells and whether or not
its function is abrogated in tumor cells.
| |
Footnotes |
|---|
Received for publication 21 November 1997 and in revised form 21 January 1998.
D.J. Frank was supported by a graduate fellowship from the National Science Foundation. This work was supported by a National Institutes of Health grant (GM48435-01A2) to M.B. Roth.We thank our colleagues at Fred Hutchinson Cancer Research Center: B. Edgar, L. Moore, M. Morrison, S. Parkhurst, J. Priess, J. Roberts, L.B. Roth, and J. Stark for critical reading of the manuscript and D. Waring for helpful advice.
| |
Abbreviations used in this paper |
|---|
ITS, internal transcribed spacer; PML, promyelocytic leukemia; RAR, retinoic acid receptor; Rb, retinoblastoma gene; UTP, uridine 5'triphosphate.
| |
References |
|---|
|
|
|---|
| 1. | Albertson, D.G.. 1984. Formation of the first cleavage spindle in nematode embryos. Dev. Biol. 101: 61-72 [Medline]. |
| 2. |
Allo, S.N.,
P.J. McDermott,
L.L. Carl, and
H.E. Morgan.
1991.
Phorbol ester
stimulation of protein kinase C activity and ribosomal DNA transcription.
J.
Biol. Chem.
266:
22003-22009
|
| 3. | Altman, P.L., and D.D. Katz 1976. Cell Biology. FASEB (Fed. Am. Soc. Exp. Biol.), Bethesda, MD. 454 pp. |
| 4. |
Altmann, G.G., and
C.P. Leblond.
1982.
Changes in the size and structure of
the nucleolus of columnar cells during their migration from crypt base to villus top in rat jejunum.
J. Cell Sci.
56:
83-99
|
| 5. | Ausubel, F.M., R. Brent, R.R. Kingston, D.D. Moore, J.G. Seideman, J.A. Smith, and K. Struhl. 1987. Analysis of RNA by Northern Hybridization. In Current Protocols in Molecular Biology. Vol. 1. Wiley/Greene, New York. 4.9.1-4.9.4. |
| 6. |
Borrow, J.,
A. Goddard,
D. Sheer, and
E. Solomon.
1990.
Molecular analysis of
acute promyelocytic leukaemia breakpoint cluster region on chromosome
17.
Science.
249:
1577-1580
|
| 7. |
Brenner, S..
1974.
The genetics of Caenorhabditis elegans.
Genetics.
77:
71-94
|
| 8. | Busch, H., and K. Smetana. 1970. The Nucleolus. Academic Press, New York. 626 pp. |
| 9. | Cavanaugh, A.H., W.M. Hempel, L.J. Taylor, V. Rogalsky, G. Todorov, and L.I. Rothblum. 1995. Activity of RNA polymerase I transcription factor UBF blocked by Rb gene product. Nature. 374: 177-180 [Medline]. |
| 10. | Cluzeaud, F., J. Perennec, E. deAmoral, M. Willemin, and P.Y. Hatt. 1984. Myocardial cell nucleus in cardiac overloading in the rat. Eur. Heart J. 5: 271-280 . |
| 11. | Dalen, H., T. Saetersdal, and S. Odegarden. 1987. Some ultrastructural features of the myocardial cells in the hypertrophied human papillary muscle. Virchows Arch. A Pathol. Anat. Histopathol. 410: 281-294 [Medline]. |
| 12. | Derenzini, M., and D. Trere. 1991. Importance of interphase nucleolar organizer regions in tumor pathology. Virchows Arch. B Cell Pathol. 61: 1-8 [Medline]. |
| 13. |
de The, H.,
C. Chomienne,
M. Lanotte,
L. Degos, and
A. Dejean.
1990.
The t(15;17) translocation of acute promyelocytic leukaemia fuses the retinoic
acid receptor gene to a novel transcribed locus.
Nature.
347:
558-561
[Medline].
|
| 14. | Dumont, J.N.. 1972. Oogenesis in Xenopus laevis (Daudin) I. Stages of oocyte development in laboratory maintained animals. J. Morphol. 136: 153-180 [Medline]. |
| 15. |
Ellis, R.E.,
J.E. Sulston, and
A.R. Coulson.
1986.
The rDNA of C. elegans: sequence and structure.
Nucleic Acids Res.
14:
2345-2363
|
| 16. |
Ferguson, K.C.,
P.J. Heid, and
J.H. Rothman.
1996.
The SL1 trans-spliced
leader RNA performs an essenetial embryonic function in Caenorhabditis elegans that can also be supplied by SL2 RNA.
Genes Dev.
10:
1543-1556
|
| 17. | Files, J.G., and D. Hirsh. 1981. Ribosomal DNA of Caenorhabditis elegans. J. Mol. Biol. 149: 223-240 [Medline]. |
| 18. | Fischetti, V.A., G.M. Landau, J.P. Schmidt, and P. Sellers. 1993. Identifying periodic occurrences of a template with applications to protein structure. Inf. Proc. Lett. 45: 11-18 . |
| 19. |
Garber, M.,
S. Panchanathan,
R.S. Fan, and
D.L. Johnson.
1991.
The phorbol
ester, 12-O-tetradec specific transcription by RNA polymerase III in Drosophila Schneider cells.
J. Biol. Chem.
266:
20598-20601
|
| 20. | Guo, S., and K.J. Kemphues. 1995. par-1, a gene required for establishing polarity in C. elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed. Cell. 81: 611-620 [Medline]. |
| 21. | Hannan, R.D., and L.I. Rothblum. 1995. Regulation of ribosomal DNA transcription during neonatal cardiomyocyte hypertrophy. Card. Res. 30: 501-510 . |
| 22. | Harlow, E., and D. Lane. 1988. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 726 pp. |
| 23. | Hatt, P.Y., P. Jouannot, J. Moravec, J. Perennec, and M. Laplace. 1978. Development and reversal of pressure-induced cardiac hypertrophy. Light and electron microscopic study in the rat under temporary aortic constriction. Basic Res. Cardiol. 73: 405-421 [Medline]. |
| 24. | Hedgecock, E.M., and R.K. Herman. 1995. The ncl-1 gene and genetic mosaics of Ceanorhabditis elegans. Genetics. 141: 989-1006 [Abstract]. |
| 25. |
Hershey, J.C.,
M. Hautmann,
M.M. Thompson,
L.I. Rothblum,
T.A.J. Haystead, and
G.K. Owens.
1995.
Angiotensin II-induced hypertrophy of rat
vascular smooth muscle is associated with increased 18S rRNA synthesis and
phosphorylation of the rRNA transcription factor, upstream binding factor.
J. Biol. Chem.
270:
25096-25101
|
| 26. | Johnson, L.F., H.T. Abelson, H. Green, and S. Penman. 1974. Changes in RNA in relation to growth of the fibroblast. I. Amounts of mRNA, rRNA, and tRNA in resting and growing cells. Cell. 1: 95-100 . |
| 27. |
Kakizuka, A.,
W.H. Miller,
R.P. Umesono,
S. Warrell,
V.V.V.S. Frankel,
E. Marty,
E. Dmitrowsky, and
R.M. Evans.
1991.
Chromosomal translocation
t(15;17) in human acute promyelocytic leukaemia fuses RAR with a novel
putative transcription factor, PML.
Cell.
66:
663-674
[Medline].
|
| 28. | Kipreos, E.T., L.E. Lander, J.P. Wing, W.W. He, and E.M. Hedgecock. 1996. cul-1 is required for cell cycle exit in C. elegans and identifies a novel gene family. Cell. 85: 829-839 [Medline]. |
| 29. | Kurabayashi, M., and Y. Yazaki. 1996. Molecular biology of heart disease synopsis of the pathophysiological basis of cardiac hypertrophy, familial hypertrophic cardiomyopathy, long QT syndrome and Marfan syndrome. Int. Med. 35: 243-248 . |
| 30. | Kurata, S., K. Koga, and B. Sakaguchi. 1978. Nucleolar size in parallel with ribosomal RNA synthesis at diapause termination in the eggs of Bombyx mori. Chromosoma (Berl.). 68: 313-317 [Medline]. |
| 31. | Liebhaber, S.A., S. Wolf, and D. Schlessinger. 1978. Differences in rRNA metabolism of primary and SV40-transformed human fibroblasts. Cell. 13: 121-127 [Medline]. |
| 32. |
McDermott, P.J.,
L.I. Rothblum,
D. Smith, and
H.E. Morgan.
1989.
Accelerated rates of ribosomal RNA synthesis during growth of contracting heart
cells in culture.
J. Biol. Chem.
264:
18220-18227
|
| 33. | Melese, T., and Z. Xue. 1995. The nucleolus: an organelle formed by the act of building a ribosome. Curr. Opin. Cell Biol. 7: 319-324 [Medline]. |
| 34. | Mello, C.C., J.M. Kramer, D. Stinchcomb, and V. Ambros. 1991. Efficient gene transfer in C. elegans: extrachromosomal maintenance and integration of transforming sequences. EMBO (Eur. Mol. Biol. Organ.) J. 10: 3959-3970 [Medline]. |
| 35. | Miller, L.M., D.A. Waring, and S.K. Kim. 1996. Mosaic analysis using a ncl-1 (+) extrachromosomal array reveals that lin-31 acts in the Pn.p cells during Caenorhabditis elegans vulval development. Genetics. 143: 1181-1191 [Abstract]. |
| 36. | Moss, T., and V.Y. Stefanovsky. 1995. Promotion and regulation of ribosomal transcription in eukaryotes by RNA polymerase I. Prog. Nucleic Acid Res. Mol. Biol. 50: 25-66 [Medline]. |
| 37. |
Mu, Z.,
K. Chin,
J. Liu,
G. Lozano, and
K. Chang.
1994.
PML, a growth suppressor disrupted in acute promyelocytic leukemia.
Mol. Cell. Biol.
14:
6858-6867
|
| 38. | Nasmyth, K.. 1996. Another role rolls in. Nature. 382: 28-29 [Medline]. |
| 39. | Nomura, M., R. Gourse, and G. Baughman. 1984. Regulation of the synthesis of ribosomes and ribosomal components. Annu. Rev. Biochem. 53: 75-117 [Medline]. |
| 40. | Perry, R.P.. 1976. Processing of RNA. Annu. Rev. Biochem. 45: 605-629 [Medline]. |
| 41. | Prescott, D.M. 1976. Reproduction of Eukaryotic Cells. Academic Press, New York, 177 pp. |
| 42. | Proud, C.G.. 1996. p70 S6 kinase: an enigma with variations. Trends Biochem. Sci. 21: 181-185 [Medline]. |
| 43. | Rabkin, R., and F.C. Fervenza. 1996. Renal hypertrophy and kidney disease in diabetes. Diabetes/Metab. Rev. 12:217-241. |
| 44. | Rakusan, K. 1984. Cardiac growth, maturation, and aging. In Growth of the Heart in Health and Disease. R. Zak, editor. Raven Press, New York, 131- 164. |
| 45. | Reddy, B.A., L.D. Etkin, and P.S. Freemont. 1992. A novel zinc finger coiled-coil domain in a family of nuclear proteins. Trends Biochem. Sci. 17: 344-345 [Medline]. |
| 46. | Roberts, S.B., S.W. Emmons, and G. Childs. 1989. Nucleotide sequences of Caenorhabditis elegans core histone genes. J. Mol. Biol. 206: 567-577 [Medline]. |
| 47. |
Sadoshima, J.,
H. Aoki, and
S. Izumo.
1997.
Angiotensin II and serum differentially regulate expression of cyclins, activity of cyclin-dependent kinases, and
phosphorylation of retinoblastoma gene product in neonatal cardiac myocytes.
Circ. Res.
80:
228-241
|
| 48. | Schaffner, W., and C. Weissmann. 1973. A rapid, sensitive, and specific method for the determination of protein in dilute solution. Anal. Biochem. 56: 502-514 [Medline]. |
| 49. |
Schauer, I.E., and
W.B. Wood.
1990.
Early C. elegans embryos are transcriptionally active.
Development (Camb.).
110:
1303-1317
|
| 50. |
Schmidt, T.,
P.S. Chen, and
M. Pellegrini.
1985.
The induction of ribosome biosynthesis in a nonmitotic secretory tissue.
J. Biol. Chem.
260:
7645-7650
|
| 51. | Seydoux, G., and A. Fire. 1994. Soma-germline asymmetry in the distributions of embryonic RNAs in Caenorhabditis elegans. Development (Camb.). 120: 2823-2834 [Abstract]. |
| 52. | Sulston, J., Z. Du, D. Thomas, R. Wilson, L. Hillier, R. Staden, N. Halloran, P. Green, J. Thierry-Mieg, L. Qiu, et al . 1992. The C. elegans genome sequencing project: a beginning. Nature. 356: 37-41 [Medline]. |
| 53. | Takano, H., I. Komuro, Y. Zou, S. Kudoh, T. Yamazaki, and Y. Yazaki. 1996. Activation of p70 S6 protein kinase is necessary for angiotensin II-induced hypertrophy in neonatal rat cardiac myocytes. FEBS (Fed. Eur. Biochem. Soc.) Lett. 379: 255-259 . |
| 54. |
Vallett, S.M.,
M. Brudnak,
M. Pellegrini, and
H.W. Weber.
1993.
In vivo regulation of rRNA transcription occurs rapidly in nondividing and dividing
Drosophila cells in response to a phorbol ester and serum.
Mol. Cell. Biol.
13:
928-933
|
| 55. | Voit, R., A. Schnapp, A. Kuhn, H. Rosenbauer, P. Hirschmann, H.G. Stunnenberg, and I. Grummt. 1992. The nucleolar transcription factor mUBF is phosphorylated by casein kinase II in the C-terminal hyperacidic tail which is essential for transactivation. EMBO (Eur. Mol. Biol. Organ.) J. 11: 2211-2218 [Medline]. |
| 56. | White, J. 1988. The anatomy. In The Nematode Caenorhabditis elegans. W.B. Wood, editor. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 81-122. |
| 57. | White, R.J.. 1997. Regulation of RNA polymerases I and III by the retinoblastoma protein: a mechanism for growth control? Trends Biochem. Sci. Soc. 22: 77-80 . |
| 58. | White, R.J., D. Trouche, K. Martin, S.P. Jackson, and T. Kouzarides. 1996. Repression of RNA polymerase III transcription by the retinoblastoma protein. Nature. 382: 88-90 [Medline]. |
| 59. | Williams, B.O., E.M. Schmitt, L. Remington, R.T. Bronson, D.M. Albert, R.A. Weinberg, and T. Jacks. 1994. Extensive contribution of Rb-deficient cells to adult chimeric mice with limited histopathological consequences. EMBO (Eur. Mol. Biol. Organ.) J. 13: 4251-4259 [Medline]. |
| 60. | Wilson, E.B. 1896. The Cell in Development and Inheritance. Johnson Reprint Corporation, New York. 371 pp. |
| 61. | Wood, W.B. 1988. Embryology. In The Nematode Caenorhabditis elegans. W.B. Wood, editor. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 215-241. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|