|
||
B Mediates
v
3 Integrin-induced
Endothelial Cell Survival

* Department of Pathology, University of Washington, Seattle, Washington 98195; and
Department of Pathology, Allegheny
University of Health Sciences, Philadelphia, Pennsylvania 19102
| |
Abstract |
|---|
|
|
|---|
The
v
3 integrin plays a fundamental role
during the angiogenesis process by inhibiting endothelial cell apoptosis. However, the mechanism of inhibition is unknown. In this report, we show that integrin-mediated cell survival involves regulation of nuclear factor-kappa B (NF-
B) activity. Different extracellular matrix molecules were able to protect rat aorta-
derived endothelial cells from apoptosis induced by serum withdrawal. Osteopontin and
3 integrin ligation
rapidly increased NF-
B activity as measured by gel
shift and reporter activity. The p65 and p50 subunits
were present in the shifted complex. In contrast, collagen type I (a
1-integrin ligand) did not induce NF-
B
activity. The
v
3 integrin was most important for osteopontin-mediated NF-
B induction and survival,
since adding a neutralizing anti-
3 integrin antibody blocked NF-
B activity and induced endothelial cell
death when cells were plated on osteopontin. NF-
B
was required for osteopontin- and vitronectin-induced
survival since inhibition of NF-
B activity with nonphosphorylatable I
B completely blocked the protective effect of osteopontin and vitronectin. In contrast,
NF-
B was not required for fibronectin, laminin, and
collagen type I-induced survival. Activation of NF-
B
by osteopontin depended on the small GTP-binding
protein Ras and the tyrosine kinase Src, since NF-
B reporter activity was inhibited by Ras and Src dominant-negative mutants. In contrast, inhibition of MEK
and PI3-kinase did not affect osteopontin-induced
NF-
B activation. These studies identify NF-
B as an
important signaling molecule in
v
3 integrin-mediated endothelial cell survival.
| |
Introduction |
|---|
|
|
|---|
IN recent years it has become evident that integrin-
mediated adhesion to extracellular matrix (ECM)1
proteins is required for growth and survival of many
cell types. Adhesion to ECM is required for progression of
cells through the cell cycle by regulating cyclinD1, cyclinE-Cdk2, and Rb protein activities (Fang et al., 1996
). Disruption of adhesion arrests cells in the G1 phase and causes
apoptosis (Boudreau et al., 1996
; Frisch and Francis, 1994
;
Howlett and Bissell, 1993
; Ingber et al., 1995
; Meredith et al.,
1993
; Re et al., 1994
). The requirement of cell-ECM adhesive interactions for cell cycle progression and cell survival
is likely to be important in tissue development and involution as a mechanism to regulate cell positioning and cell
number (Lin and Bissell, 1993
). In addition, anchorage dependence of survival may serve to limit tumor progression
by preventing invasion or metastasis of tumor cells (Varner and Cheresh, 1996
). Integrin-regulated survival properties have also been shown to be relevant in wound repair
since integrin antagonists induced apoptosis of migrating
endothelial cells, thereby blocking angiogenesis (Brooks
et al., 1994a
; Brooks et al., 1994b
; Friedlander et al., 1996
).
The mechanism by which integrin-mediated ECM adhesion is able to prevent apoptosis is unclear and under intense investigation. Focal adhesion kinase (FAK) is phosphorylated in response to cell adhesion, and constitutively
activated membrane-targeted FAK was able to rescue
cells from suspension-induced cell death (Frisch et al.,
1996b
). The JNK pathway is active in detached epithelial cell (Frisch et al., 1996a
), and the Ras, PI3-kinase, Akt
pathways are activated and functionally implicated in cell
attachment-induced survival (Khwaja et al., 1997
). Two
groups suggest that integrin engagement positively regulates expression of the antiapoptotic gene bcl-2 in COS
and endothelial cells (Stromblad et al., 1996
; Zhang et al.,
1995
). In addition, Stromblad et al. showed that
v
3 engagement and clustering in endothelial cells, but not
1 or
v
5 ligation, conferred an antiapoptotic phentoype to endothelial cells. Importantly, the same group showed that
inhibition of angiogenesis by anti-
v
3 antibody correlates
with angiogenic endothelial cell apoptosis (Brooks et al.,
1994b
).
The transcription factor nuclear factor-kappa B (NF-
B)
is a pleiotropic regulator of many genes involved in immune and inflammatory responses. The NF-
B family of
proteins consists of homo- or heterodimeric subunits of
the Rel family, including p50 and p65. In unstimulated cells, most of the NF-
B is localized in the cytoplasm in
complex with an inhibitory protein, I
B (Baldwin, 1996
).
Upon stimulation, the inhibitory I
B becomes phosphorylated, ubiquinated, and subsequently degraded by the proteosome machinery (Palombella et al., 1994
). This allows
NF-
B to translocate to the nucleus, bind DNA, and transactivate transcription of specific genes. Recently, several lines of evidence have suggested that NF-
B is an important cell survival factor (Beg and Baltimore, 1996
; Liu et
al., 1996
; Van Antwerp et al., 1996
; Wang et al., 1996
).
However, integrin-mediated survival has never been functionally linked to NF-
B activation.
In the present study, we explored the possibility that integrin-mediated endothelial cell survival is controlled by
NF-
B activation. Our experiments indicate that different
ECM molecules, including osteopontin, promote endothelial cell survival upon serum deprivation. Moreover, adhesion of endothelial cells to the
v
3 ligand osteopontin increases nuclear NF-
B activity. Furthermore, we find that
3 integrin mediates osteopontin's protective effect and
NF-
B activation. Most importantly, we show that the osteopontin and vitronectin-mediated cell protective effect
is abolished by inhibiting NF-
B nuclear translocation.
Thus, NF-
B activation is required for endothelial cell
protective effects of
v
3 ligands after serum deprivation-
induced apoptosis.
| |
Materials and Methods |
|---|
|
|
|---|
Materials
Recombinant wild-type and RGE-mutant mouse osteopontin were expressed in Escherichia coli as glutathione S-transferase fusion proteins as
previously described (Liaw et al., 1995
). Purified bovine plasma fibronectin was obtained from GIBCO BRL (Gaithersburg, MD); purified rat
plasma vitronectin was obtained from Sigma Chemical Co. (St. Louis,
MO); purified mouse laminin and rat tail collagen type I were obtained
from Collaborative Biomedical Products (Bedford, MA), and polylysine
was obtained from Sigma Chemical Co. Mouse monoclonal antibody F11
directed against the rat
3 integrin, and hamster monoclonal antibody
Ha2/5 directed against the rat
1 integrin were obtained from PharMingen
(San Diego, CA). Rabbit polyclonal antibodies against NF-
B p65, p50
subunits were obtained from Santa Cruz Biotechnology (Santa Cruz, CA).
Rabbit polyclonal antibody against poly(ADP-ribose) polymerase was obtained from Upstate Biotechnology Inc. (Lake Placid, NY). Constructs
containing the fos gene core promoter by itself (pfLUC) or fused to two
NF-
B sites derived from the Ig
promoter (pBIIX-LUC) driving the luciferase gene were a kind gift from D. Baltimore (Massachusetts Institute of Technology, Boston, MA). Dominant negative constructs for Ras (RasN17) and Src (kinase-dead) were a kind gift of Dr. Berk (University of Washington, Seattle, WA). The LY-294002 compound was purchased from Biomol Research Laboratories, Inc. (Plymouth Meeting, PA), and
the PD98059 was purchased from Calbiochem-Novabiochem Corp. (La
Jolla, CA).
Cell Cultures
Rat aortic endothelial cells (RAEC) were isolated as previously described
(Nicosia et al., 1994
). Cells were routinely maintained in MCBD 131 medium (GIBCO BRL), supplemented with 10mM L-glutamine, 10% FCS
(HyClone Laboratories Inc., Logan, UT), and 100 U/ml each penicillin
and streptomycin (GIBCO BRL). Cells were passaged by detaching with
0.05% trypsin and maintained at 37°C with 5% CO2. For all experiments,
cells were used between passage 15 and 25. Human microvascular endothelial cells were obtained from Clonetics (San Diego, CA).
Survival Assay
Cells were detached, and equal numbers were replated on permanox slides (Nalge Nunc International, Pittsburgh, PA) either left uncoated or coated with different substrates. Substrates were diluted in PBS and coated onto permanox slides overnight at 4°C. Substrates were used at concentrations giving maximal adhesion and survival. Osteopontin was used at 100 nM; fibronectin, vitronectin, and laminin at 50 nM; collagen type I at 5 µg/ml; and F11 at 500 µg/ml. For the inhibition experiment, antibodies were diluted in serum-free medium and added to the cells ~2 h after plating. F11 was used at 50 µg/ml; nonimmune mouse IgG at 50 µg/ml; Ha2/5 at 10 µg/ml; and nonimmune hamster IgM at 10 µg/ml. 48 h after plating, nuclei were stained with the membrane-permeant dye Hoechst 33342 (Molecular Bioprobes, Eugene, OR). Live cells were incubated for 30 min at 37°C with a 4 µg/ml solution of the dye. Cells were then fixed with 4% paraformaldehyde and viewed with a fluorescence microscope. Experiments were repeated at least three times. For AnnexinV staining, 106 cells were plated on osteopontin- and polylysine-coated 60-mm tissue culture dishes. 24 and 48 h after plating, cells were detached and incubated with AnnexinV-FITC (PharMingen) according to the manufacturer's instructions and analyzed by flow cytometry.
Western Blot
Proteins were extracted from cell monolayers in Laemmli's buffer containing protease inhibitors (0.2 µg/ml aprotinin, 0.2 µg/ml leupeptin, and 0.1 mM PMSF). After centrifugation and boiling, protein concentration was measured using the MicroBCA assay (Pierce, Rockford, IL). 50 µg of total protein were loaded onto 9% SDS-polyacrylamide gel for poly (ADP-ribose) polymerase (PARP) detection. Gels were transferred to a polyvinyldene difluoride membrane (Dupont-NEN, Boston, MA). Peroxidase-conjugated goat anti-rabbit antibody (Jackson ImmunoResearch Laboratories, Inc., West Grove, PA) was used as secondary antibody. Proteins were visualized by adding chemiluminescence reagent according to the manufacturer's instructions (Dupont-NEN).
Electrophoretic Mobility Shift Assay (EMSA)
Gel shift assays were performed as described by Qwarnstrom et al. (1994)
.
A double-stranded oligonucleotide containing the DNA-binding site for
the NF-
B proteins (5'AGTTGAGGGGACTTTCCCAGGC 3') was obtained from Promega Corp. (Madison, WI), and was end-labeled using
[
32P]ATP according to the manufacturer's protocol (Promega Corp.) and
purified using a Sephadex G-25 column (Pharmacia Biotech, Inc., Piscataway, NJ). The binding assay for the proteins was carried out as previously described (Guo et al., 1995
). In brief, nuclear extracts were obtained
using a modified Dignam protocol (Lee et al., 1988
). Cells were scraped,
washed with PBS, and resuspended in 20 µl of buffer A (10 mM Hepes,
pH 7.9, 10 mM KCl, 1.5 mM MgCl2, and 0.5 mM EDTA, pH 8.0) and allowed to swell on ice for 20 min. The nuclei were separated from the cell
lysate by centrifugation at 12,000 g for 5 min in a microfuge. This nuclear
pellet was resuspended in 20 µl of buffer C (20 mM Hepes, pH 7.9, 420 mM NaCl, 15 mM MgCl2, 0.2 mM EDTA, pH 8.0, 25% glycerol, 0.5 mM
PMSF, and 0.5 mM DTT), and incubated for 10 min in ice. The lysed nuclei were centrifuged for 5 min at 4°C at 12,000 g in a microfuge. The nuclear extracts were assayed for protein content using the Biorad assay
method. Aliquots of the extracts were used for the gel-shift assay, or were
quick-frozen in dry ice and stored at
70°C. 5-10 µg of nuclear extracts
were mixed with 60,000-80,000 cpm of labeled probe along with 300 µg/ml
BSA and 133 µg/ml poly dIdC.dIdC (to prevent nonspecific binding). The
binding reaction was carried out at room temperature for 15 min, and the
samples were run on a 4% nondenaturing acrylamide gel. Reactions containing competitive and uncompetitive oligonucleotides used 10 µg of nuclear extract, and were preincubated for 15 min before adding the labeled probe. For supershift EMSA, the samples were incubated with 6 µl of the
proper antibodies for 45 min just before running. The gels were dried, and
bands were detected by autoradiography.
Transfections and Reporter Assays
For transfections, 2 × 106 cells in 100-mm dishes were transfected with 10 µg
of DNA, using SuperFectTM (QIAGEN Inc., Chatsworth, CA). For
cotransfection experiments, equal molar amounts of each plasmid were
used for a total of 10 µg of DNA per 100-mm dish. Cells were allowed to
recuperate overnight, and were then trypsinized and plated either on osteopontin or polylysine-coated surfaces in serum free medium. Cells were
harvested 8 h after plating, and luciferase activity was measured using a
luciferase assay system (Promega Corp.) according to the manufacturer's
instructions. As a control, transfected cells were treated with IL1-
or vehicle for 1 h. Luciferase activity was normalized relative to human growth
hormone secretion as described (Allegro Inc., Madison, WI). Experiments
were repeated at least three times.
Immunocytochemistry
Cells were plated either on osteopontin or polylysine-coated permanox
slides (Nalge Nunc International) in serum-free medium. 2 h after plating,
cells were rinsed with PBS and fixed with cold methanol for 5 min. Endogenous peroxidases were blocked with 0.1% hydrogen peroxide in methanol for 10 min. After rinsing with PBS, nonspecific binding was minimized
by blocking with 1.5% normal rabbit serum in PBS. Anti-NF-
B p65
polyclonal antibody at the concentration of 1 µg/ml was used as primary
antibody. A biotinylated anti-rabbit antibody was then applied, followed by an avidin-peroxidase conjugate (ABC Elite; Vector Labs, Inc., Burlingame, CA). 3,3'diaminobenzidine was used as detection substrate. Cells
were counterstained with Fast Red.
Construction of Nonphosphorylatable I
B Construct
and Development of Stable Cell Lines
Murine I
B
cDNA was obtained from Paul Noble (Johns Hopkins,
Baltimore, MD). Specific oligonucleotide primers (5'TTGGGATCCATGGACTACAAAGACGATGACGATAAAATGAAGGACGACGAG- TACGACC3' and 5'CCAGGATCCACTTATAATGTCAGACGCTGGCCT3') were used to construct an I
B
deletion mutant lacking amino
acids 1-37, and to insert a FLAG sequence in frame with amino acid 37. The PCR product was initially cloned in the pCR2.1 vector (Invitrogen Corp., Carlsbad, CA) and then subcloned into the MREpNeo vector (MREpNeo
N; Searle et al., 1985
). Stable lines were obtained by transfecting endothelial cells with MREpNeo
N using SuperFectTM (Qiagen
Inc.). Cells were selected for 10 d with medium containing 500 µg/ml of
G418 and 10% Zn-depleted serum (Searle et al., 1985
). Five independent
clones were isolated. All experiments were repeated with two independent clones (REAC
N2 and REAC
N5). Cell lines were routinely maintained in medium containing 10% Zn-depleted serum.
| |
Results |
|---|
|
|
|---|
Osteopontin Rescues Endothelial Cells from Serum Deprivation-induced Apoptosis
Adhesion to ECM via integrin receptors has previously
been shown to protect endothelial cells from suspension-induced apoptosis (Meredith et al., 1993
; Re et al., 1994
).
We now show that ECM may also play a role in cell survival under conditions of serum deprivation. Rat aortic endothelial cells were plated in serum-containing medium
and allowed to spread for ~2 h. Immediately after spreading, the media was changed to serum-free media, and nuclei were scored for fragmentation 48 h after plating. As
shown in Fig. 1, cells plated on osteopontin-coated surfaces showed a minimal (<5%) rate of cell death after
growth factor withdrawal (Fig. 1). In contrast, cells plated
on uncoated surfaces showed 30% cell death. 30% cell death was also observed when cells were plated on a form
of osteopontin carrying an inactivating mutation at the
RGD sequence, suggesting an integrin-mediated mechanism. Similar results were obtained using human microvascular endothelial cells (data not shown).
|
We then asked if other ECM molecules would promote
endothelial cell survival in the same system. We tested vitronectin, fibronectin, laminin, and collagen type I, and all
were able to protect endothelial cells from growth factor
withdrawal-induced death (data not shown). Since laminin and collagen type I primarily interact with
1-containing integrins, these results suggest that different integrin
dimers are able to protect from serum deprivation-induced
apoptosis.
The condensed and fragmented nuclear morphology of
the cells scored as dead suggested apoptosis as the mechanism of cell death (Fig. 2, A and B). To obtain a more
quantitative assessment of cell death and to verify that apoptosis was indeed the mechanism of cell death, we took several approaches. First, fluorescently labeled AnnexinV
(PharMingen, San Diego, CA) was used. AnnexinV binds
to the membrane lipid phosphatidylserine, which is translocated to the outer layer of the plasma membrane in cells
undergoing apoptosis (Vermes et al., 1995
). The results
summarized in Table I show a time-dependent increase in
AnnexinV binding when cells were plated on polylysine,
but not on osteopontin, confirming that the ECM molecule
osteopontin promotes endothelial cell survival. Second,
we confirmed that caspases were involved in endothelial apoptosis in the absence of serum. The poly (ADP-ribose)
polymerase PARP, an enzyme that facilitates repair of DNA
strand breaks, is a substrate for caspases. When caspases
are active, PARP is cleaved in a typical pattern (Tewari et
al., 1995
). As shown in Fig. 2, C and D, cells plated on osteopontin demonstrated less PARP cleavage than cells
plated on polylysine. These findings strongly suggest that
caspase-dependent apoptosis after serum deprivation is
the mechanism of death.
|
|
3-containing Integrin Mediates
Osteopontin-induced Survival
We previously showed that the
v
3 integrin mediates endothelial cell adhesion and migration to osteopontin (Liaw
et al., 1995
). To examine if
v
3 was involved in osteopontin's survival function, endothelial cells were plated in serum-free medium on an osteopontin-coated surface, and
were allowed to adhere and spread. Cells were then challenged with either neutralizing integrin subunit antibodies
or nonimmune IgG. As shown in Fig. 3 A, treatment with
the anti-
3 integrin antibody (F11) caused time-dependent endothelial cell death. The level and the time course of cell death were comparable to those of cells plated on polylysine alone (data not shown). In contrast, cells treated
with a nonimmune mIgG or an anti-
1 neutralizing antibody (Ha2/5; data not shown) were fully protected by osteopontin. The F11 antibody used in this study is directed
against the
3-integrin subunit. Since no known integrin
subunit other than
v can dimerize with
3 in nucleated
cells, it is likely that this integrin subunit is heterodimerized to
v. This fact suggests that osteopontin's protective
effect was mediated by
v
3. To confirm this finding, we
asked whether
3 ligation and clustering by surface-immobilized F11 could prevent cell death. As shown in Fig. 3 B,
F11 was as effective as osteopontin in promoting cell survival, thus strongly suggesting that signaling through
v
3
receptor was involved.
|
To determine whether
v
3 was involved in the protective effects of other ECM proteins, we used vitronectin, fibronectin, and laminin as substrates in a second set of similar experiments. As expected, treatment with F11 antibody
induced cell death when endothelial cells were plated on
vitronectin, but not when cells were plated on fibronectin
and laminin (data not shown). Ha2/5 antibody was able to
inhibit laminin-induced cell survival, but the combination
of the two neutralizing antibodies was necessary in order
to inhibit fibronectin-induced survival (data not shown). These findings suggest that the
v
3 integrin is involved in
osteopontin and vitronectin-mediated endothelial cell survival, that a
1-containing integrin-mediated laminin induced cell survival, and finally that fibronectin was able to
use both a
v
3- or
1-containing integrin receptor to signal survival.
Endothelial Cell Adherence to Osteopontin Induces
NF-
B Activation
The p65 subunit of the NF-
B transcription factor has
been shown recently to be necessary for cell survival (Beg
and Baltimore, 1996
; Liu et al., 1996
; Van Antwerp et al.,
1996
; Wang et al., 1996
). We hypothesized that adhesion
of endothelial cells to an ECM substrate was capable of
activating the NF-
B pathway, thereby activating a protective pathway in the cell. To test this hypothesis, we used
three different approaches. First, endothelial cells were plated on osteopontin or polylysine-coated surfaces. Nuclear extracts were prepared at various time points, and
NF-
B activity was examined by EMSA. As shown in Fig.
4 A, nuclear extract prepared from endothelial cells plated
on osteopontin contained significant levels of NF-
B consensus oligomer-binding activity. In contrast, control cells showed very little activity (Fig. 4 A). The DNA-protein
complex formed in cells adherent to osteopontin was specific, since excess unlabeled NF-
B consensus oligomer inhibited, whereas an unrelated sequence had no effect (Fig.
4 A). In contrast, the pure
1-integrin ligand, collagen type
I, did not induce NF-
B binding activity, as shown in Fig. 4
B. As expected, the mixed ligand fibronectin, which can
interact with both
3 and
1 integrins, was able to induce
NF-
B binding activity (Fig. 4 B). Finally, the osteopontin-induced NF-
B-binding activity was sustained up to 8 h
(Fig. 4 C).
|
The transcription factor Rel family of genes is composed
of several NF-
B protein subunits (p65 or RelA, p50/p105
or NF-
B1, p52/p100 or NF-
B2, RelB, and the protooncogene c-rel; Baldwin, 1996
). To establish the composition
of the band that was shifted, we performed super-shift
EMSA using direct antibodies against the p65, p50, p52,
and c-rel subunits. As shown in Fig. 5, the shifted complex
formed when the cells were plated on an osteopontin-coated surface was composed of the p65 and p50 NF-
B
subunits, since the combination of these antibodies completely ablated the primary band. Antibodies directed
against the p52 and c-rel subunits did not affect the primary band (data not shown). Second, we used a reporter
construct containing two NF-
B consensus binding sites in
the promoter in order to verify that NF-
B was transcriptionally active. A fourfold induction of the reporter construct was observed when cells were plated on osteopontin
and fibronectin compared with control polylysine (Fig. 6).
In contrast, no reporter induction was seen when cells
were plated on collagen type I (Fig. 6). Finally, we observed nuclear translocation of the p65 subunit when endothelial cells were plated on osteopontin. As shown in
Fig. 7 A, most of the p65 NF-
B subunit was localized in
the nucleus when endothelial cells were plated on osteopontin. On the contrary, the staining remained localized to the cytoplasm when cells were plated on polylysine
(Fig. 7 B). No staining was observed when nonimmune antibody was used (Fig. 7 C). These data suggest that osteopontin is able to activate NF-
B activity in endothelial
cells.
|
|
|
Osteopontin Induction of NF-
B is
v
3-dependent
We then asked if osteopontin-induced NF-
B activity was
v
3-dependent. Endothelial cells plated on osteopontin
were treated with F11 or a control antibody. As shown in
Fig. 8 A, when cells were treated for 8 h with F11 antibody,
NF-
B activity was markedly reduced compared with control treatment. This result suggests that the
v
3 integrin
mediated osteopontin-induced NF-
B activity. We next
explored whether endothelial cell adhesion to immobilized F11 was able to similarly regulate NF-
B. Fig. 8 B
shows that endothelial cells plated on surface-immobilized
F11 showed a considerably higher binding activity than
control cells. These results show that
v
3 ligation alone is
sufficient to induce NF-
B activity.
|
Inhibition of NF-
B Activity Abolishes
Osteopontin-mediated Survival
To determine if nuclear translocation of the NF-
B heterodimer was necessary for
v
3-mediated survival function, we overexpressed a nondegradable form of I
B
in
endothelial cells. Overexpression of a mutant form of
I
B
, in which the two serines (S 32 and 36) critical for
phosphorylation and subsequent degradation were mutated to alanines, has been recently successfully used to inhibit NF-
B nuclear translocation (Brockman et al., 1995
).
We generated a murine I
B
deletion construct where the
first 37 amino acids were deleted, thereby eliminating both
Ser 32 and Ser 36. This cDNA was cloned in MRE-pNeo
expression vector (Searle et al., 1985
) downstream of a
synthetic, Zn-inducible promoter. We then transfected endothelial cells and generated stable cell lines. NF-
B
inducibility was lost in two clones (RAEC
N2 and
RAEC
N5) upon treatment with 100 µM ZnSO4 for 16 h,
followed by treatment with IL1-
as measured by reporter
assay (Fig. 9 A). 100 µM of ZnSO4 was chosen since this
concentration gave maximal expression of the I
B
mutant in serum-containing medium as determined by Western blot analysis (data not shown).
|
We then asked whether overexpression of the mutant
I
B
and subsequent inhibition of NF-
B translocation
could abolish osteopontin-induced survival upon growth
factor withdrawal. To test this hypothesis, RAEC
N2
cells were plated in serum-free medium on osteopontin-coated surface, and were treated either with vehicle or 20 µM ZnSO4. In serum-free medium, 20 µM ZnSO4 was sufficient to induce maximal expression of the I
B
mutant
(data not shown). As shown in Fig. 9 B, upon treatment
the osteopontin protective effect was completely abolished, strongly suggesting that NF-
B activation by osteopontin is necessary for endothelial cell survival. Cells
that were transfected with vector alone did not show any
appreciable cell death when plated on osteopontin and
treated with vehicle or 20 µM ZnSO4 (data not shown),
thus confirming the specificity of the effect seen with the
mutant I
B
construct.
In a similar set of experiments, we tested whether inhibition of NF-
B translocation could abolish the protective
effect observed with other integrin ligands. As shown in
Fig. 9 C, only the protective effects of vitronectin and
immobilized
3 antibody were abolished. In contrast,
RAEC
N2 cells plated on fibronectin, laminin, and collagen type I continued to be protected (Fig. 9 C). Thus,
these results indicate that NF-
B activation is necessary
for
v
3-mediated endothelial cell survival, but a different
and at the moment unknown survival pathway is engaged
by
1-containing integrins.
Ras and Src, but not MEK and PI3-Kinase, Mediate
NF-
B Induction by Osteopontin
In an effort to identify membrane proximal signal by
which
v
3 integrin ligation leads to NF-
B activation,
dominant negative constructs for the GTP-binding protein
Ras (Ras-N17), for the kinase Src (kinase dead), and a
vector control were cotransfected with the NF-
B reporter
construct. As shown in Fig. 10 A, osteopontin-induced NF-
B activity was completely inhibited by expression of
Ras-N17 and Src dominant negative constructs. In contrast, the specific MEK inhibitor PD58095 and the specific
PI3-kinase inhibitor LY-294002 did not effect osteopontin-mediated NF-
B activity (Fig. 10 B). These inhibitors
were shown to be effective by Western blot (data not
shown). These results suggest that Ras and Src are proximal mediators of
v
3-induced NF-
B activation.
|
| |
Discussion |
|---|
|
|
|---|
We have investigated the ability of ECM proteins to protect endothelial cells against apoptosis induced by serum
withdrawal. We found that different ECM molecules
played a role in cell survival under conditions of serum
withdrawal, suggesting that different classes of integrins
(
1 and
3) could mediate this function. In addition, we
were able to show that a neutralizing
3 integrin antibody
induced rounding and apoptosis when added in soluble form to cells plated on osteopontin, a known
v
3 ligand.
In contrast, a neutralizing
1 antibody had no effect. These
data support the hypothesis that osteopontin promotes endothelial cell survival uniquely via the
v
3 integrin. To explore the downstream mechanism of protection, we examined the activity of NF-
B, a recently described cell
survival factor (Beg and Baltimore, 1996
; Liu et al., 1996
;
Van Antwerp et al., 1996
; Wang et al., 1996
). We found
that integrin receptor ligation resulted in rapid NF-
B activation in endothelial cells. Furthermore, we give functional evidence that NF-
B nuclear translocation was required for osteopontin-induced endothelial cell survival,
but not for
1 integrin-mediated survival. Finally, we provide evidence that the small GTP-binding protein Ras and
the tyrosine kinase Src are required for osteopontin-induced NF-
B activity. These results define a novel integrin-mediated survival pathway leading from
v
3 integrin
through Ras and Src to NF-
B in endothelial cells.
In vivo, inhibition of the
v
3 integrin in angiogenic
vessels causes endothelial cell apoptosis (Brooks et al.,
1994b
), suggesting that a specific interaction between endothelial cells and an
v
3 ligand(s) is required for survival. Here we show that
v
3 ligands also protect endothelial cells from apoptosis induced by serum withdrawal
in vitro. Osteopontin, vitronectin, and fibronectin were all
able to promote endothelial cell survival after serum withdrawal. Moreover, the
1 ligands fibronectin, laminin, and
collagen type I were also able to protect against apoptosis
induced by serum deprivation, consistent with previous studies in which apoptosis was induced by suspension
(Meredith et al., 1993
; Re et al., 1994
). Thus, different
classes of integrins and ligands are able to facilitate endothelial survival under diverse conditions.
The mechanism by which integrin ligation leads to cell
survival is under intense investigation. It has been proposed that integrin regulation of bcl2-family members
(Stromblad et al., 1996
; Zhang et al., 1995
), the PI3-kinase/
Akt pathway (Khwaja et al., 1997
), and the MEKK-1/JNK
pathway (Cardone et al., 1997
) may be important for cell
protective effects. Moreover, Day et al. (1997)
suggest that
the activity of the tumor suppressor Rb is required for induction of apoptosis in cells maintained in suspension
(anoikis), and some evidence suggests that
v
3 integrin ligation in endothelial cells suppresses p53 binding activity
(Stromblad et al., 1996
). These findings suggest that multiple and potentially overlapping integrin-mediated survival pathways exist.
Recently, several groups have suggested a key role of
NF-
B p65 in apoptosis inhibition (Beg and Baltimore,
1996
; Liu et al., 1996
; Van Antwerp et al., 1996
; Wang et al.,
1996
). In the p65 knockout mouse, embryonic lethality is
seen, and is most likely due to extensive apoptosis and necrosis of the liver (Beg et al., 1995
). In addition, cells with
functionally inactive NF-
B undergo apoptosis when challenged with TNF
(Beg and Baltimore, 1996
; Liu et al.,
1996
; Van Antwerp et al., 1996
; Wang et al., 1996
). However, the potential role of NF-
B in integrin-mediated survival has not previously been reported. In the present
studies, we observed a rapid and sustained activation of
NF-
B when endothelial cells were plated on osteopontin,
as measured by EMSA, nuclear translocation of the p65
subunit, and luciferase reporter assay. We also determined
that
v
3 was required for osteopontin-induced NF-
B
activity, since adding F11 antibody to endothelial cells spread on osteopontin inhibited this activity, and cells
plated on immobilized F11 showed elevated NF-
B activity. This result correlated with the observation that soluble
3 antagonist inhibited osteopontin-induced endothelial
cell survival. Indeed, NF-
B activity was required for osteopontin-induced survival, since inhibition of NF-
B nuclear translocation by the nonphosphorylatable I
B
completely blocked the protective effect of osteopontin. While several previous studies have correlated NF-
B activation
with integrin ligation (McGilvray et al., 1997
; Qwarnstrom
et al., 1994
; Rosales and Juliano, 1996
), ours is the first to
demonstrate a functional role for integrin-induced NF-
B
in cell survival.
Several signaling pathways leading from integrin ligation
to cell function have been recently identified (Schlaepfer and
Hunter, 1996
). Engagement of integrins by the ECM
causes organization of a complex structure, termed focal
adhesion, on the cytoplasmic side of the plasma membrane
(Schwartz et al., 1995
). The tyrosine kinase FAK appears
to play a central role in integrin signal transduction. FAK
activation has been linked to cytoskeletal organization,
regulation of small GTP-binding proteins like Rho and
Ras, and interaction with intracellular proteins like c-Src
and c-Fyn, Grb2/Sos, and PI-3 kinase. These data suggest
that FAK and its downstream targets are important relays
in integrin-mediated signaling (Schaller and Parsons, 1994
).
Our studies indicate that both Ras and Src are required
for
v
3-mediated NF-
B activation in endothelial cells.
Overexpression of Ras and Src dominant negative mutants specifically inhibited osteopontin-induced NF-
B activation. In contrast, inhibitors of PI-3 kinase and MEK,
which were previously shown to block suspension-induced death (Khwaja et al., 1997
; Wary et al., 1996
), failed to
block osteopontin-induced NF-
B activation. These data
suggest that the survival pathway initiated by
v
3 is distinct from those previously identified (Khwaja et al., 1997
;
Wary et al., 1996
). In addition, in the present studies,
1 ligation was unable to induce NF-
B activation, and the
protective effect of
1 ligands was not blocked when NF-
B
was inhibited by nonphosphorylatable I
B
. These findings indicate that at least two distinct ECM-mediated protective pathways exist in endothelial cells: one mediated
by
3 integrins, and another mediated by
1 integrins.
Our studies are consistent with previous studies showing
that overexpression of Ras induced activation of NF-
B in
NIH3T3 fibroblasts and Jurkat T-lymphoma cells (Perona
et al., 1997
). However, overexpression of activated Ras
and Src appeared to inhibit
1 ligation-induced NF-
B activation in human monocytic cells (Rosales and Juliano,
1996
), and MAPK appeared to mediate
4
1-induced NF-
B
activation in the same cell type (McGilvray et al., 1997
).
Thus, the effect of integrins on NF-
B activation and the
signaling pathways involved may be cell type-specific.
Our studies support the hypothesis that intracellular signaling initiated by ligating
v
3 leads to NF-
B activation.
NF-
B normally exists in an inactive form in the cytoplasm complexed to its inhibitor, I
B, a family of related
ankyrin-containing proteins. Phosphorylation of I
B promotes its ubiquitination and subsequent degradation by
the proteosome machinery, thereby unmasking the NF-
B
nuclear targeting sequence. It is likely that
v
3 integrin ligation indirectly regulates I
B phosphorylation. Several
kinases have been shown potentially to regulate IkB phosphorylation: protein kinase C, MEKK1, NIK (a member
of the MAPK family; Baldwin, 1996
; Lee et al., 1997
; Malinin et al., 1997
), and the recently identified IKK-1 and
IKK-2 (Mercurio et al., 1997
). Which, if any, of these kinases is involved in NF-
B activation in our system is currently under investigation.
How might NF-
B regulate cell survival? Previous studies showing that cells lacking NF-
B become sensitive to
TNF
treatment suggest that NF-
B may regulate antiapototic genes. TNF
regulates many genes, and some of
them are known to suppress apoptosis like the endothelial-specific bcl-2 homolog A1 (Karsan et al., 1996
). Indeed, Karsan et al. (1996)
showed that A1 inhibits not only
TNF
-induced endothelial cell death, but also ceramide-induced endothelial cell apoptosis. At the moment, we do
not know if A1 or other antiapoptotic bcl-2 family members are regulated by NF-
B, but it is a possibility since integrin ligation correlates with their upregulation (Stromblad et al., 1996
; Zhang et al., 1995
). Another candidate is
manganous superoxide dismutase. This enzyme has been
shown to be antiapoptotic and TNF
-induced (Liu et al.,
1996
). Interestingly, MnSOD Drosophila homolog has
been shown to have NF-
B-like sites in the 5'-untranslated region (Duttaroy et al., 1997
). Baculovirus inhibitors
of apoptosis mammalian homologs (cIAPs) are also candidates (Uren et al., 1996
). cIAPs are caspase inhibitors
probably by directly binding and inactivating these enzymes (Deveraux et al., 1997
). Recently, cIAP1 has been
shown to be NF-
B inducible (Chu et al., 1997
). Finally, a
new class of molecules (casper/I-FLICE/cFlip) containing
caspase and death effector domain has been described recently (Hu et al., 1997
; Irmler et al., 1997
; Shu et al., 1997
).
It appears that different splice variants of these molecules can either inhibit or stimulate apoptosis. Nothing is known
about the regulation casper/I-FLICE/cFlip; therefore, it
will be a challenge to explore a possible NF-
B involvement.
From this study, a pathway linking
v
3 integrin ligation,
NF-
B, and endothelial cell survival has emerged. This
pathway may be important in the angiogenesis process
since the
v
3 integrin is expressed in proliferating angiogenic endothelial cell, and is required for their survival
(Brooks et al., 1994a
; Brooks et al., 1994b
). Moreover,
v
3
antagonists prevent vessel maturation in developing quail
(Drake et al., 1995
). While it is not yet clear if NF-
B is
generally important in angiogenesis in vivo, NF-
B activation has been described in regenerating rat aortic endothelial cells in vivo (Lindner and Collins, 1996
), and nuclear
NF-
B was detected in activated endothelial cells overlying atherosclerotic plaques (Brand et al., 1996
). Furthermore, in vitro studies support a role for NF-
B in angiogenic processes. Both capillary tube formation and NF-
B activity were induced by 12(R)-HETrE in cultured rabbit
coronary microvascular endothelial cells. Moreover, inhibition of NF-
B activation in these cells resulted in inhibition of 12(R)-HETrE-induced tube formation (Stoltz et al.,
1996
). Similarly, human microvascular endothelial cells
were shown to undergo both NF-
B activation and tubular
morphogenesis in response to hydrogen peroxide treatment, and NF-
B antisense oligonucleotides completely blocked hydrogen peroxide-induced tube formation (Shono
et al., 1996
).
Osteopontin and its interactions with endothelial cells
via the
v
3 integrin are of particular interest since we recently identified osteopontin as an endothelial cell product
in a subset of vasa vasorum in the human atherosclerotic
plaque and granulation tissue (O'Brien et al., 1994
).
v
3
was also expressed in the same type of vessels (Hoshiga et
al., 1995
). We have also shown that osteopontin synthesis
was dramatically increased in regenerating large vessel endothelium in vivo, and the
3 integrin subunit was coordinately upregulated (Liaw et al., 1995
). As mentioned
above, nuclear translocation of the NF-
B p65 subunit was
recently observed in regenerating endothelial cells using
the same animal model (Lindner and Collins, 1996
).
In conclusion, we have provided evidence that osteopontin mediates endothelial cell survival uniquely via
the
v
3 integrin. Furthermore, we have presented functional evidence that the NF-
B pathway is fundamental
for
3-mediated inhibition of apoptosis. Given the critical
role of
v
3 integrin during the angiogenesis process
(Brooks et al., 1994a
; Brooks et al., 1994b
; Brooks et al.,
1995
; Drake et al., 1995
; Friedlander et al., 1996
), it is tempting to speculate that osteopontin may act as one of
the endogenous ligands for
v
3 integrin during angiogenesis. Finally, we have demonstrated that
1 ligand-mediated endothelial survival is not NF-
B dependent, suggesting that distinct
3 and
1-mediated survival pathways
exists.
| |
Footnotes |
|---|
.
Address all correspondence to Marta Scatena, Department of Pathology, University of Washington, Box 357335, Seattle, WA. Tel.: 206 685 4288; Fax: 206 685 3662; E-mail: mscatena{at}u.washington.eduThis study was supported by National Institutes of Health grants HL-18645 and DK-47659 (to C.M. Giachelli), HL-52585 (to R.F. Nicosia), by the National Science Foundation grant EEC9529161 (to C.M. Giachelli), and by the National Cancer Institute grant CA-70131 (to N. Fausto). Michelle Chaisson was supported by the National Cancer Institute training grant CA-09437. Dr. Giachelli is an established investigator of the American Heart Association.
| |
Abbreviations used in the paper |
|---|
cIAP, baculovirus inhibitors of apoptosis mammalian homologs;
ECM, extracellular matrix;
EMSA, electrophoretic mobility shift assay;
FAK, focal adhesion kinase;
NF-
B, nuclear
factor-kappa B;
PARP, poly(ADP-ribose) polymerase;
PI3, phosphotidylinositol 3;
RAEC, rat aortic endothelial cells.
| |
References |
|---|
|
|
|---|
| 1. | Baldwin, A.S. Jr.. 1996. The NF-kappa B and I kappa B proteins: new discoveries and insights. Annu. Rev. Immunol. 14: 649-683 [Medline]. |
| 2. |
Beg, A.A., and
D. Baltimore.
1996.
An essential role for NF-kappaB in preventing TNF-alpha-induced cell death.
Science.
274:
782-784
|
| 3. | Beg, A.A., W.C. Sha, R.T. Bronson, S. Ghosh, and D. Baltimore. 1995. Embryonic lethality and liver degeneration in mice lacking the RelA component of NF-kappa B. Nature. 376: 167-170 [Medline]. |
| 4. |
Boudreau, N.,
Z. Werb, and
M.J. Bissell.
1996.
Suppression of apoptosis by
basement membrane requires three-dimensional tissue organization and
withdrawal from the cell cycle.
Proc. Natl. Acad. Sci. USA.
93:
3509-3513
|
| 5. | Brand, K., S. Page, G. Rogler, A. Bartsch, R. Brandl, R. Knuechel, M. Page, C. Kaltschmidt, P.A. Baeuerle, and D. Neumeier. 1996. Activated transcription factor nuclear factor-kappa B is present in the atherosclerotic lesion. J. Clin. Invest. 97: 1715-1722 [Medline]. |
| 6. | Brockman, J.A., D.C. Scherer, T.A. McKinsey, S.M. Hall, X. Qi, W.Y. Lee, and D.W. Ballard. 1995. Coupling of a signal response domain in I kappa B alpha to multiple pathways for NF-kappa B activation. Mol. Cell. Biol. 15: 2809-2818 [Abstract]. |
| 7. |
Brooks, P.C.,
R.A. Clark, and
D.A. Cheresh.
1994a.
Requirement of vascular
integrin alpha v beta 3 for angiogenesis.
Science
264:
569-571
|
| 8. | Brooks, P.C., A.M. Montgomery, M. Rosenfeld, R.A. Reisfeld, T. Hu, G. Klier, and D.A. Cheresh. 1994b. Integrin alpha v beta 3 antagonists promote tumor regression by inducing apoptosis of angiogenic blood vessels. Cell 79: 1157-1164 [Medline]. |
| 9. | Brooks, P.C., S. Stromblad, R. Klemke, D. Visscher, F.H. Sarkar, and D.A. Cheresh. 1995. Antiintegrin alpha v beta 3 blocks human breast cancer growth and angiogenesis in human skin. J. Clin. Invest. 96: 1815-1822 . |
| 10. | Cardone, M.H., G.S. Salvesen, C. Widmann, G. Johnson, and S.M. Frisch. 1997. The regulation of anoikis: MEKK-1 activation requires cleavage by caspases. Cell. 9: 315-323 . |
| 11. |
Chu, Z.L.,
T.A. McKinsey,
L. Liu,
J.J. Gentry,
M.H. Malim, and
D.W. Ballard.
1997.
Suppression of tumor necrosis factor-induced cell death by inhibitor of
apoptosis c-IAP2 is under NF-kappaB control.
Proc. Natl. Acad. Sci. USA.
94:
10057-10062
|
| 12. |
Day, M.L.,
R.G. Foster,
K.C. Day,
P. Humphrey,
P. Swamson,
A.A. Postigo,
S.H. Zhang, and
D.C. Dean.
1997.
Cell anchorage regulates apoptosis
through the retinoblastoma tumor suppressor/E2F pathway.
J. Biol. Chem.
272:
8125-8128
|
| 13. | Deveraux, Q.L., R. Takahashi, G.S. Salvesen, and J.C. Reed. 1997. X-linked IAP is a direct inhibitor of cell-death proteases. Nature. 388: 300-304 [Medline]. |
| 14. | Drake, C.J., D.A. Cheresh, and C.D. Little. 1995. An antagonist of integrin alpha v beta 3 prevents maturation of blood vessels during embryonic neovascularization. J. Cell. Sci. 108: 2655-2661 [Abstract]. |
| 15. | Duttaroy, A., T. Parkes, P. Emtage, K. Kirby, G.L. Boulianne, X.D. Wang, A.J. Hilliker, and J.P. Phillips. 1997. The manganese superoxide dismutase gene of Drosophila: structure, expression, and evidence for regulation by MAP kinase. DNA Cell Biol. 16: 391-399 [Medline]. |
| 16. | Fang, F., G. Orend, N. Watanabe, T. Hunter, and E. Ruoslahti. 1996. Dependence of cyclin E-CDK2 kinase activity on cell anchorage. Science. 271: 499-502 [Abstract]. |
| 17. |
Friedlander, M.,
C.L. Theesfeld,
M. Sugita,
M. Fruttiger,
M.A. Thomas,
S. Chang, and
D.A. Cheresh.
1996.
Involvement of integrins alpha(v)beta(3)
and alpha(v)beta(5) in ocular neovascular diseases.
Proc. Natl. Acad. Sci.
USA.
93:
9764-9769
|
| 18. |
Frisch, S.M., and
H. Francis.
1994.
Disruption of epithelial cell-matrix interactions induces apoptosis.
J. Cell Biol.
124:
619-626
|
| 19. |
Frisch, S.M.,
K. Vuori,
D. Kelaita, and
S. Sicks.
1996a.
A role for Jun-N-Terminal kinase in anoikis: suppression by bcl-2 and crmA.
J. Cell Biol.
135:
1377-1382
|
| 20. |
Frisch, S.M.,
K. Vuori,
E. Ruoslahti, and
P.Y. ChanHui.
1996b.
Control of adhesion-dependent cell survival by focal adhesion kinase.
J. Cell Biol.
134:
793-799
|
| 21. | Guo, X., Y.P. Zhang, D.A. Mitchell, D.T. Denhardt, and A.F. Chambers. 1995. Identification of a ras-activated enhancer in the mouse osteopontin promoter and its interaction with a putative ETS-related transcription factor whose activity correlates with the metastatic potential of the cell. Mol. Cell. Biol. 15: 476-487 [Abstract]. |
| 22. |
Hoshiga, M.,
C.E. Alpers,
L.L. Smith,
C.M. Giachelli, and
S.M. Schwartz.
1995.
Alpha-v beta-3 integrin expression in normal and atherosclerotic artery.
Circ. Res.
77:
1129-1135
|
| 23. | Howlett, A.R., and M.J. Bissell. 1993. The influence of tissue microenvironment (stroma and extracellular matrix) on the development and function of mammary epithelium. Epithelial Cell Biol. 2: 79-89 [Medline]. |
| 24. |
Hu, S.M.,
C. Vincenz,
J. Ni,
R. Gentz, and
V.M. Dixit.
1997.
I-FLICE, a novel
inhibitor of tumor necrosis factor receptor-1- and CD-95-induced apoptosis.
J. Biol. Chem.
272:
17255-17257
|
| 25. | Ingber, D.E., D. Prusty, Z.Q. Sun, H. Betensky, and N. Wang. 1995. Cell shape, cytoskeletal mechanics, and cell cycle control in angiogenesis. J. Biomech. 28: 1471-1484 [Medline]. |
| 26. | Irmler, M., M. Thome, M. Hahne, P. Schneider, B. Hofmann, V. Steiner, J.L. Bodmer, M. Schroter, K. Burns, C. Mattmann, et al . 1997. Inhibition of death receptor signals by cellular FLIP. Nature 388: 190-195 [Medline]. |
| 27. |
Karsan, A.,
E. Yee,
K. Kaushansky, and
J.M. Harlan.
1996.
Cloning of human
Bcl-2 homologue: inflammatory cytokines induce human A1 in cultured endothelial cells.
Blood
87:
3089-3096
|
| 28. | Khwaja, A., P. Rodriguez, Viciana, S. Wennstrom, P.H. Warne, and J. Downward. 1997. Matrix adhesion and Ras transformation both activate a phosphoinositide 3-OH kinase and protein kinase B/Akt cellular survival pathway. EMBO (Eur. Mol. Biol. Organ.) J. 16: 2783-2793 [Medline]. |
| 29. | Lee, F.S., J. Hagler, Z.J. Chen, and T. Maniatis. 1997. Activation of the IkappaB alpha kinase complex by MEKK1, a kinase of the JNK pathway. Cell. 88: 213-222 [Medline]. |
| 30. | Lee, K.A., A. Bindereif, and M.R. Green. 1988. A small-scale procedure for preparation of nuclear extracts that support efficient transcription and pre-mRNA splicing. Gene Anal. Tech. 5: 22-31 [Medline]. |
| 31. |
Liaw, L.,
V. Lindner,
S.M. Schwartz,
A.F. Chambers, and
C.M. Giachelli.
1995.
Osteopontin and beta 3 integrin are coordinately expressed in regenerating
endothelium in vivo and stimulate Arg-Gly-Asp-dependent endothelial migration in vitro.
Circ. Res.
77:
665-672
|
| 32. | Lin, C.Q., and M.J. Bissell. 1993. Multi-faceted regulation of cell differentiation by extracellular matrix. FASEB J. 7: 737-743 [Abstract]. |
| 33. | Lindner, V., and T. Collins. 1996. Expression of NF-kappa B and I kappa B-alpha by aortic endothelium in an arterial injury model. Am. J. Pathol. 148: 427-438 [Abstract]. |
| 34. | Liu, Z.G., H. Hsu, D.V. Goeddel, and M. Karin. 1996. Dissection of TNF receptor 1 effector functions: JNK activation is not linked to apoptosis while NF-kappaB activation prevents cell death. Cell. 87: 565-576 [Medline]. |
| 35. | Malinin, N.L., M.P. Boldin, A.V. Kovalenko, and D. Wallach. 1997. MAP3K-related kinase involved in NF-kappa B induction by TNF, CD95 and IL-1. Nature 385: 540-544 [Medline]. |
| 36. |
McGilvray, I.D.,
Z. Lu,
R. Bitar,
A.P.B. Dackiw,
C.J. Davreux, and
O.D. Rotstein.
1997.
VLA-4 integrin cross-linking on human monocytic THP-1 cells
induces tissue factor expression by a mechanism involving mitogen-activated
protein kinase.
J. Biol. Chem.
272:
10287-10294
|
| 37. |
Mercurio, F.,
H. Zhu,
B.W. Murray,
A. Shevchenko,
B.L. Bennett,
J. Li,
D.B. Young,
M. Barbosa,
M. Mann,
A. Manning, and
A. Rao.
1997.
IKK-1 and
IKK-2: cytokine-activated IkappaB kinases essential for NF-kappaB activation.
Science.
278:
860-866
|
| 38. | Meredith, J.E. Jr., B. Fazeli, and M.A. Schwartz. 1993. The extracellular matrix as a cell survival factor. Mol. Biol. Cell. 4: 953-961 [Abstract]. |
| 39. | Nicosia, R.F., S. Villaschi, and M. Smith. 1994. Isolation and characterization of vasoformative endothelial cells from the rat aorta. In Vitro Cell. Dev. Biol. Anim. 6: 394-399 . |
| 40. |
O'Brien, E.R.,
M.R. Garvin,
D.K. Stewart,
T. Hinohara,
J.B. Simpson,
S.M. Schwartz, and
C.M. Giachelli.
1994.
Osteopontin is synthesized by macrophage, smooth muscle, and endothelial cells in primary and restenotic human coronary atherosclerotic plaques.
Arterioscler. Thromb.
14:
1648-1656
|
| 41. | Palombella, V.J., O.J. Rando, A.L. Goldberg, and T. Maniatis. 1994. The ubiquitin-proteasome pathway is required for processing the NF-kappa B1 precursor protein and the activation of NF-kappa B. Cell. 78: 773-785 [Medline]. |
| 42. |
Perona, R.,
S. Montaner,
L. Saniger,
I. Sánchez-Pérez,
R. Bravo, and
J.C. Lacal.
1997.
Activation of the nuclear factor-kappaB by Rho, CDC42, and Rac-1
proteins.
Genes Dev.
11:
463-475
|
| 43. |
Qwarnstrom, E.E.,
C.O. Ostberg,
G.L. Turk,
C.A. Richardson, and
K. Bomsztyk.
1994.
Fibronectin attachment activates the NF-kappa B p50/p65 heterodimer in fibroblasts and smooth muscle cells.
J. Biol. Chem.
269:
30765-30768
|
| 44. |
Re, F.,
A. Zanetti,
M. Sironi,
N. Polentarutti,
L. Lanfrancone,
E. Dejana, and
F. Colotta.
1994.
Inhibition of anchorage-dependent cell spreading triggers apoptosis in cultured human endothelial cells.
J. Cell Biol.
127:
537-546
|
| 45. |
Rosales, C., and
R. Juliano.
1996.
Integrin signaling to NF-kappa B in monocytic leukemia cells is blocked by activated oncogenes.
Cancer Res.
56:
2302-2305
|
| 46. | Schaller, M.D., and J.T. Parsons. 1994. Focal adhesion kinase and associated proteins. Curr. Opin. Cell Biol. 6: 705-710 [Medline]. |
| 47. | Schlaepfer, D.D., and T. Hunter. 1996. Signal transduction from the extracellular matrix--a role for the focal adhesion protein-tyrosine kinase FAK. Cell Struct. Funct. 21: 445-450 [Medline]. |
| 48. | Schwartz, M.A., M.D. Schaller, and M.H. Ginsberg. 1995. Integrins: emerging paradigms of signal transduction. Ann. Rev. Cell Dev. Biol. 11: 549-599 . [Medline] |
| 49. |
Searle, P.F.,
G.W. Stuart, and
R.D. Palmiter.
1985.
Building a metal-responsive
promoter with synthetic regulatory elements.
Mol. Cell. Biol.
5:
1480-1489
|
| 50. | Shono, T., M. Ono, H. Izumi, S.I. Jimi, K. Matsushima, T. Okamoto, K. Kohno, and M. Kuwano. 1996. Involvement of the transcription factor NF-kappaB in tubular morphogenesis of human microvascular endothelial cells by oxidative stress. Mol. Cell. Biol. 16: 4231-4239 [Abstract]. |
| 51. | Shu, H.B., D.R. Halpin, and D.V. Goeddel. 1997. Casper is a FADD- and caspase-related inducer of apoptosis. Immunity. 6: 751-763 [Medline]. |
| 52. |
Stoltz, R.A.,
N.G. Abraham,
M. Laniado, and
Schwartzman.
1996.
The role of
NF-kappaB in the angiogenic response of coronary microvessel endothelial
cells.
Proc. Natl. Acad. Sci. USA.
93:
2832-2837
|
| 53. | Stromblad, S., J.C. Becker, M. Yebra, P.C. Brooks, and D.A. Cheresh. 1996. Suppression of p53 activity and p21WAF1/CIP1 expression by vascular cell integrin alphaVbeta3 during angiogenesis. J. Clin. Invest. 98: 426-433 [Medline]. |
| 54. | Tewari, M., L.T. Quan, K. O'Rourke, S. Desnoyers, Z. Zeng, D.R. Beidler, G.G. Poirier, G.S. Salvesen, and V.M. Dixit. 1995. Yama/CPP32 beta, a mammalian homolog of CED-3, is a CrmA-inhibitable protease that cleaves the death substrate poly(ADP-ribose) polymerase. Cell 81: 801-809 [Medline]. |
| 55. |
Uren, A.G.,
M. Pakusch,
C.J. Hawkins,
K.L. Puls, and
D.L. Vaux.
1996.
Cloning and expression of apoptosis inhibitory protein homologs that function to
inhibit apoptosis and/or bind tumor necrosis factor receptor-associated factors.
Proc. Natl. Acad. Sci. USA.
93:
4974-4978
|
| 56. |
Van Antwerp, D.J.,
S.J. Martin,
T. Kafri,
D.R. Green, and
I.M. Verma.
1996.
Suppression of TNF-alpha-induced apoptosis by NF-kappaB.
Science.
274:
787-789
|
| 57. | Varner, J.A., and D.A. Cheresh. 1996. Integrins and cancer. Curr. Opin. Cell Biol. 8: 724-730 [Medline]. |
| 58. | Vermes, I., C. Haanen, H. Steffens, Nakken, and C. Reutelingsperger. 1995. A novel assay for apoptosis. Flow cytometric detection of phosphatidylserine expression on early apoptotic cells using fluorescein labeled Annexin V. J. Immunol. Methods. 184: 39-51 [Medline]. |
| 59. |
Wang, C.Y.,
M.W. Mayo, and
A.S. Baldwin Jr..
1996.
TNF- and cancer therapy-induced apoptosis: potentiation by inhibition of NF-kappaB.
Science.
274:
784-787
|
| 60. | Wary, K.K., F. Mainiero, S.J. Isakoff, E.E. Marcantonio, and F.G. Giancotti. 1996. The adaptor protein Shc couples a class of integrins to the control of cell cycle progression. Cell. 87: 733-743 [Medline]. |
| 61. |
Zhang, Z.,
K. Vuori,
J.C. Reed, and
E. Ruoslahti.
1995.
The alpha 5 beta 1 integrin supports survival of cells on fibronectin and up-regulates Bcl-2 expression.
Proc. Natl. Acad. Sci. USA.
92:
6161-6165
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|