|
||

* Department of Molecular Biology, Sciences II, University of Geneva, CH-1211 Geneva 4, Switzerland; and
Max-Planck-Institut für Biologie, Abteilung Membranbiochemie, D-72076 Tübingen, Germany
| |
Abstract |
|---|
|
|
|---|
Nek2 (for NIMA-related kinase 2) is a mammalian cell cycle-regulated kinase structurally related to the mitotic regulator NIMA of Aspergillus nidulans. In human cells, Nek2 associates with centrosomes, and overexpression of active Nek2 has drastic consequences for centrosome structure. Here, we describe the molecular characterization of a novel human centrosomal protein, C-Nap1 (for centrosomal Nek2-associated protein 1), first identified as a Nek2-interacting protein in a yeast two-hybrid screen. Antibodies raised against recombinant C-Nap1 produced strong labeling of centrosomes by immunofluorescence, and immunoelectron microscopy revealed that C-Nap1 is associated specifically with the proximal ends of both mother and daughter centrioles. On Western blots, anti-C-Nap1 antibodies recognized a large protein (>250 kD) that was highly enriched in centrosome preparations. Sequencing of overlapping cDNAs showed that C-Nap1 has a calculated molecular mass of 281 kD and comprises extended domains of predicted coiled-coil structure. Whereas C-Nap1 was concentrated at centrosomes in all interphase cells, immunoreactivity at mitotic spindle poles was strongly diminished. Finally, the COOH-terminal domain of C-Nap1 could readily be phosphorylated by Nek2 in vitro, as well as after coexpression of the two proteins in vivo. Based on these findings, we propose a model implicating both Nek2 and C-Nap1 in the regulation of centriole-centriole cohesion during the cell cycle.
| |
Introduction |
|---|
|
|
|---|
THE serine/threonine kinase NIMA of Aspergillus
nidulans is considered the founding member of a
family of protein kinases with a possible role in cell
cycle regulation (for reviews see Fry and Nigg, 1995
; Lu
and Hunter, 1995a
; Osmani and Ye, 1996
). In A. nidulans,
NIMA clearly cooperates with the Cdc2 protein kinase to
promote progression into mitosis (Osmani et al., 1991
), and overexpression of NIMA in a variety of heterologous
species promotes a premature onset of chromosome condensation (O'Connell et al., 1994
; Lu and Hunter, 1995b
).
This has been interpreted to suggest evolutionary conservation of a pathway involving NIMA-related kinases (for
review see Lu and Hunter, 1995a
). Indeed, kinases structurally related to NIMA are present in many species (Fry and Nigg, 1997
). However, the only bona fide functional
homologue of NIMA so far isolated stems from another
filamentous fungus, Neurospora crassa (Pu et al., 1995
),
and the functional relationship between vertebrate NIMA-related kinases and fungal NIMA remains uncertain.
The closest known mammalian relative to NIMA is a kinase termed Nek2 (for NIMA-related kinase 2)1 (Fry and
Nigg, 1997
). This kinase undergoes cell cycle-dependent changes in abundance and activity, reminiscent of NIMA
(Schultz et al., 1994
; Fry et al., 1995
). It is highly expressed
in male germ cells (Rhee and Wolgemuth, 1997
; Tanaka
et al., 1997
), and data have been reported consistent with a
role for Nek2 in meiotic chromosome condensation (Rhee
and Wolgemuth, 1997
). However, overexpression of active
Nek2 in somatic cells has no obvious effect on chromosome condensation; instead, it induces striking alterations
in the structure of the centrosome, the principal microtubule-organizing center of mammalian cells (Fry et al.,
1998
). Furthermore, immunofluorescence microscopy and
subcellular fractionation concur to demonstrate that endogenous Nek2 associates with centrosomes, strongly suggesting that one physiological function of this kinase may
relate to the centrosome cycle (Fry et al., 1998
).
The mammalian centrosome is an organelle of about 1 µm
in diameter. It comprises two barrel-shaped centrioles that
are made of nine short triplet microtubules and are surrounded by an amorphous matrix known as the pericentriolar material (PCM) (for review see Brinkley, 1985
;
Vorobjev and Nadehzdina, 1987
; Kimble and Kuriyama,
1992
; Kalt and Schliwa, 1993
; Kellogg et al., 1994
; Lange
and Gull, 1996
). Major progress has recently been made
with the demonstration that microtubules are nucleated
from
-tubulin-containing ring complexes (
-TuRCs), which
are concentrated within the PCM (Moritz et al., 1995
;
Zheng et al., 1995
).
-Tubulin forms complexes with
Spc97/98, two evolutionarily conserved proteins first identified in budding yeast spindle pole bodies (Geissler et al.,
1996
; Knop et al., 1997
; Stearns and Winey, 1997
), and
there is also evidence for an important role of pericentrin
and other coiled-coil proteins in organizing
-TuRCs into
higher order lattice structures (Doxsey et al., 1994
; Dictenberg et al., 1998
). However, in spite of this recent progress,
it is clear that the inventory of centrosome components is
far from complete.
Centrosome structure and function is regulated in a cell
cycle-dependent manner (for reviews see Mazia, 1987
;
Kellogg et al., 1994
; Tournier and Bornens, 1994
). Once in
every cell cycle, and beginning around the G1/S transition,
centrioles are duplicated (e.g., Kuriyama and Borisy,
1981a
; Vorobjev and Chentsov, 1982
; Kochanski and
Borisy, 1990
; Chrétien et al., 1997
). Late in G2, centrosomes then grow in size (a process referred to as maturation) through the recruitment of additional PCM proteins (Rieder and Borisy, 1982
; Kalt and Schliwa, 1993
;
Lange and Gull, 1995
). At the G2/M transition, the duplicated centrosomes separate and migrate to opposite ends
of the nucleus. Concomitantly, their microtubule-nucleating activities increase dramatically in preparation for spindle formation (McGill and Brinkley, 1975
; Snyder and
McIntosh, 1975
; Gould and Borisy, 1977
; Kuriyama and
Borisy, 1981b
; for reviews see Brinkley, 1985
; Vorobjev
and Nadehzdina, 1987
; Karsenti, 1991
). By what mechanisms these events are controlled remains largely unknown, but data obtained using phosphoepitope-specific
antibodies strongly suggest that phosphorylation of centrosomal proteins plays a major role (Vandré et al., 1984
,
1986
; Centonze and Borisy, 1990
). More direct support for
this view stems from the observation that cyclin-dependent kinases (CDKs) enhance the microtubule-nucleation activity of centrosomes at the G2/M transition (Verde et
al., 1990
, 1992
; Buendia et al., 1992
) and are involved in
promoting centrosome separation (Blangy et al., 1995
;
Sawin and Mitchison, 1995
). Similarly, polo-like kinase 1, a cell cycle regulatory kinase structurally distinct from
CDKs, has recently been implicated in centrosome maturation (Lane and Nigg, 1996
).
The precise role of Nek2 at the centrosome remains to
be determined, but it is intriguing that overexpression of
this kinase in human cells causes a pronounced splitting of
centrosomes. This led us to propose that Nek2-dependent
phosphorylation of previously unidentified proteins may
cause a loss of centriole-centriole cohesion, and that this
event might represent an early step in centrosome separation at the G2/M transition (Fry et al., 1998
). With the aim
of identifying potential substrates (or regulators) of Nek2,
we have now performed a yeast two-hybrid screen, using full-length Nek2 as a bait. We report here the molecular
characterization of a novel coiled-coil protein that we call
C-Nap1 (for centrosomal Nek2-associated protein 1). C-Nap1
represents a core component of the mammalian centrosome and the first candidate substrate for a member of
the NIMA protein kinase family to be identified.
| |
Materials and Methods |
|---|
|
|
|---|
Two Hybrid Interaction Screening
A yeast two-hybrid screen was performed essentially as described previously (Durfee et al., 1993
; Harper et al., 1993
; Blangy et al., 1997
). In brief,
yeast strain Y190 expressing the fusion protein GAL4 DBD-Nek2 was
transformed with a human B cell cDNA library constructed in plasmid
pACT (Durfee et al., 1993
) and plated on selective medium (lacking tryptophan, leucine, and histidine) supplemented with 50 mM 3-aminotriazole. From 4 × 106 transformants, 43 His+ colonies were obtained, of which
18 were positive for lacZ expression. Bait loss through cycloheximide selection was only successful for 11 out of 18. Of these, eight remained lacZ
positive when mated with Y187 carrying DBD-Nek2, but were negative
when mated with Y187 carrying DBD-p53, -lamin, -cdk2, -SNF1, or -Eg5.
The library cDNAs in these eight positives were amplified by PCR, using
pACT2-specific primers (AATACCACTACAATGGATGATG and
GCTCTAGAGTTGAAGTGAACTTGCGGGG), and the PCR products were digested with the frequently cutting restriction endonuclease,
AluI, to determine the number of different clones. Three clones (2-6, 2-27, and 2-31) contained an identical 1.7-kb insert, while a fourth clone (2-2)
was slightly larger (1.9 kb) and yielded a very similar digestion pattern.
For subsequent analyses, the PCR products from clones 2-6 and 2-2 were
digested with EcoRI and XbaI and subcloned into the EcoRI-XbaI sites
of a pBlueScript-KS vector carrying the myc-epitope tag (Schmidt-Zachmann and Nigg, 1993
) to generate the plasmids pBSmyc:2-6 and pBSmyc: 2-2. To construct the eukaryotic expression plasmid pCMVmyc:2-6, the
myc:2-6 fusion was excised from pBSmyc:2-6 on a HindIII-XbaI fragment
and subcloned into the HindIII-XbaI sites of pRcCMV (Invitrogen Corp.,
Carlsbad, CA).
Antibody Production
To generate antibodies, a (His)6-tagged fusion protein of clone 2-6 was
made using the QIAexpress bacterial expression system (QIAGEN, Inc.,
Valencia, CA). The plasmid pQE10:2-6 was constructed by subcloning a
BamH1-XbaI (blunted with Klenow) fragment from pBSmyc:2-6 into the
pQE10 vector (QIAGEN) digested with BamHI and HindIII (blunted
with Klenow). Overexpression was found to be optimal in the Escherichia
coli strain M15[pREP4] using Super medium (25 g bacto-tryptone, 15 g
bacto-yeast extract, and 5 g NaCl per liter). Recombinant protein was expressed and purified under denaturing conditions as described by the manufacturer (QIAGEN), before concentrating on a Centricon-30 column
(Amicon, Inc., Beverly, MA) and further purification on a preparative
12% SDS-polyacrylamide gel as described in Fry et al. (1998)
. For immunizations, 500 µg of the purified (His)6:2-6 protein was injected subcutaneously into New Zealand white rabbits (Elevage Scientifique des Dombes, Chatillon sur Chalaronne, France) on days 1, 28, 56, and 84. Immune serum
was obtained on days 70 and 98. For affinity purification of antibodies, two
different methods were used. In the first, (His)6:2-6 protein was expressed
in E. coli, purified under native conditions and bound to a Ni2+-resin column as described in the QIAexpress protocol handbook. Crude serum was
applied to the column, and after washing, the antibody was eluted in 4 M
MgCl2 as described by Gu et al. (1994)
. The purified antibody was dialyzed
extensively against PBS before use. In the second approach, 1.0 mg of purified (His)6:2-6 protein was covalently coupled to 400 mg CNBr-activated
Sepharose 4B (Pharmacia Biotech, Piscataway, NJ) as recommended by
the manufacturer, and this affinity matrix was used to purify antibodies
from immune serum as described by Harlow and Lane (1988)
.
Cell Culture and Transfections
Human U2OS osteosarcoma and KE37 T-lymphoblastoid cells were
grown at 37°C in a 7% CO2 atmosphere in DME supplemented with 10%
heat-inactivated FCS and penicillin-streptomycin (100 IU/ml and 100 mg/ml,
respectively). Sf9 insect cells were grown in TC100 medium (GIBCO
BRL, Gaithersburg, MD), supplemented with 10% heat-inactivated FCS
and penicillin-streptomycin at 27°C. For transient transfection studies,
U2OS cells were seeded onto HCl-treated glass coverslips at a density of 1 × 105 cells per 35-mm dish and transfected with 10 µg of plasmid DNA, using calcium phosphate precipitates as previously described (Krek and
Nigg, 1991
).
Immunofluorescence and Immunoelectron Microscopy
Immunofluorescence microscopy on U2OS cells was performed as described in Fry et al. (1998)
, using a Zeiss Axioplan II microscope (Thornwood, NY) and 40 or 63× oil immersion objectives. Affinity-purified anti-
C-Nap1 antibodies (R62 and R63) were used at 1.0 µg/ml. Photographs
were taken using a Quantix 1400 CCD camera (Photometrics, Inc., Tuscon, AZ) and IP-Lab software, and the images were processed using
Adobe Photoshop (San Jose, CA).
Negative staining immunoelectron microscopy of isolated centrosomes
was performed by diluting centrosomes 1:10 in PBS before sedimentation
onto Pioloform and carbon-coated grids using an airfuge (65,000 g-av, 15 min; Beckman Instruments, Inc., Fullerton, CA). Grids were blocked with
0.1% gelatin in PBS, incubated with affinity-purified anti-C-Nap1 IgGs
(R63, 1 µg/ml in blocking buffer, 45 min) and protein A-6-nm gold (60 min; Slot and Geuze, 1985
). Grids were negatively stained with Nano-W
(Nanoprobes, Stony Brook, NY). For preembedding immunoelectron microscopy of whole cells, U2OS cells, grown on coverslips, were fixed with
3% paraformaldehyde/2% sucrose for 10 min, permeabilized with PBS + 0.5% Triton X-100 for 5 min, and blocked with PBS + 1% BSA for 5 min.
Cells were then labeled with either anti-C-Nap1 IgGs (R63, 1 µg/ml) or
anti-Nek2 IgGs (R40, 1 µg/ml) followed by goat anti-rabbit IgG-Nanogold (1:40; Nanoprobes). Cells were further fixed with 2.5% glutaraldehyde in PBS for 60 min, washed with distilled water, and silver enhanced for 26 min using silver lactate/gum arabicum (Stierhof et al., 1991
). After
thoroughly washing with distilled water, cells were postfixed with 1%
aqueous uranyl acetate, dehydrated in ethanol, and embedded in epoxy
resin (EPON®; Shell Chemical Co.). After polymerization, the EPON®
layer containing the cells was separated from the coverslip by dipping into
liquid nitrogen. Ultrathin sections were cut in parallel to the monolayer
and stained with aqueous uranyl acetate and lead citrate.
Cell Extracts, Immunoblotting, and Phosphorylation Assays
To prepare cell extracts for immunoblotting, cells were harvested and
washed once in PBS + 1 mM PMSF before resuspending in extraction
buffer (50 mM Tris-HCl, pH 7.5, 1% Triton X-100, 150 mM NaCl, 5 mM
EDTA, 1 mM PMSF, 1 µg/ml aprotinin, 1 µg/ml leupeptin, 1 µg/ml pepstatin A, 20 mM
-glycerophosphate) to give 104 cells/µl. Extracts were
left 30 min on ice, passed 10 times through a 27-g needle, and centrifuged
at full speed in a microfuge at 4°C for 10 min. One volume of protein sample buffer was added to the supernatant, and the sample was heated to
95°C for 3 min before analysis by SDS-PAGE. Immunoblotting was performed by electrophoretic transfer onto nitrocellulose membranes using a
Semi-Phor blotting apparatus (Hoefer Scientific Instruments, San Francisco, CA). Proteins were visualized by Ponceau S staining, before blocking the membranes with blocking buffer (5% low-fat dried milk in 1× PBS + 0.1% Tween-20). All antibody incubations were carried out in blocking
buffer, and bound IgGs were visualized using alkaline phosphatase-conjugated anti-rabbit IgG secondary antibodies (Promega Corp., Madison, WI).
For in vitro phosphorylation of the COOH-terminal domain of C-Nap1,
the myc:2-6 protein was in vitro translated from the pBSmyc:2-6 plasmid
using a T3 polymerase with the TNT Coupled Reticulocyte Lysate System
(Promega Corp.) in the presence of [35S]methionine (Amersham Corp.,
Arlington Heights, IL). 10 µl of the in vitro translation reaction was then
mixed with 50 µl of Nek2 kinase buffer (Fry and Nigg, 1997
), in the presence or absence of [32P-
]ATP, and added to baculovirus-expressed wild-type or catalytically inactive Nek2 immunoprecipitates prepared as described in Fry and Nigg (1997)
. Samples were incubated at 30°C for 20 min, diluted 1:5 with NEB buffer (Fry and Nigg, 1997
), and spun briefly in a microfuge, and the supernatant was recovered. For immunoprecipitation of myc-tagged proteins, samples were precleared for 1 h with protein G-Sepharose beads (Pharmacia Biotech) and then incubated for 1 h at
4°C with protein G-Sepharose beads previously coupled with anti-myc
monoclonal antibody 9E10. Immunoprecipitates were finally washed four
times in NEB buffer, resuspended in 50 µl of protein sample buffer, and
analyzed by SDS-PAGE.
cDNA Library Screening and Sequence Analysis
Overlapping cDNA clones spanning the entire coding sequence of C-Nap1 were isolated from a human placenta 5'-STRETCH PLUS cDNA library (CLONTECH Laboratories, Palo Alto, CA). DNA probes were labeled with 32P using either the random-primed DNA labeling kit (Boehringer Mannheim, Mannheim, Germany) for larger DNA fragments or polynucleotide kinase (Biofinex, Praroman, Switzerland) for oligonucleotide probes. Positive phages were purified, lambda DNA was prepared from agarose plate lysates using the QIAGEN Lambda Kit, and inserts were excised and subcloned into the NotI site of a pBlueScript-KS vector. DNA sequencing in both directions was carried out using a 377 DNA Automated Sequencer (Perkin-Elmer Corp., Norwalk, CT).
Miscellaneous Techniques
Isolation of human centrosomes from the human T-lymphoblastic cell line
KE37 was carried out as described previously (Moudjou and Bornens,
1994
). Treatment of asynchronously growing U2OS cells with nocodazole
or taxol was as described in Fry et al. (1998)
, while cold treatment was performed by placing the tissue culture dishes on ice for 30 min. RNA purification from mouse organs and RNase protection assays were performed
as described in Tanaka et al. (1997)
. To prepare an antisense RNA probe
for mouse C-Nap1, the transcript complementary to the intranuclear matrix
protein (INMP) cDNA sequence (sequence data available from GenBank/EMBL/DDBJ under accession number U33198, nucleotides 1105-
1733) was synthesized on an INMP cDNA fragment with T7 RNA polymerase (Promega Corp.) in the presence of 11.25 µM [
32P]UTP (90 Ci/
mmol, DuPont-NEN, Boston, MA). The template cDNA fragment was
isolated by performing a reverse-transcriptase reaction on mouse testis
RNA, followed by PCR amplification with specific primers corresponding
to the 3' and 5' region of the published INMP sequence (Menz et al.,
1996
). For normalization, a transcript complementary to the mouse NF-Ya
mRNA sequence was used (Tanaka et al., 1997
).
For chromosomal mapping, two specific primers (AGCCACAGCCAGGAGCACACAGAC and AGAGGCAGTACATGTCCCTCAGCC) were used to amplify a 265-bp PCR fragment in the 3' UTR of C-Nap1 using the Genbridge 4 Radiation Hybrid DNA panel (HGMP Resource Centre, UK). PCR products were analyzed by Southern blotting with a hybridization probe generated by PCR on the C-Nap1 cDNA, using the above oligonucleotides. The results were analyzed at http://www.genome.wi.mit.edu.
| |
Results |
|---|
|
|
|---|
Identification of a Centrosomal Protein through Two-Hybrid Interaction with Nek2
To identify cellular proteins that might interact with Nek2,
a yeast two-hybrid screen was performed (Fields and
Song, 1989
; Durfee et al., 1993
) using the full-length Nek2
as a bait. A human cDNA library was screened, and library clones able to activate both the auxotrophic selection marker His3 and the lacZ reporter gene specifically in
the presence of the bait were selected. Among the clones
showing a specific interaction with Nek2, three (designated 2-6, 2-27, and 2-31) were found to contain identical
inserts of 1.7 kb, while a fourth (2-2) encoded a slightly
longer version (1.9 kb) of the same cDNA. To determine
which domains of Nek2 were required for the observed interactions, clones 2-6 and 2-2 were tested in the yeast two-hybrid assay against different Nek2 constructs (data not
shown): both clones interacted strongly with full-length
wild-type Nek2, a catalytically inactive mutant of Nek2
(Nek2-K37R; Fry et al., 1995
), and the COOH-terminal
noncatalytic domain of Nek2. There was also a significant
interaction, albeit slightly less strong, with the NH2-terminal catalytic domain of Nek2, suggesting that these clones
were binding both the catalytic and noncatalytic domains
of Nek2. The COOH-terminal noncatalytic domain contains a leucine zipper motif that is implicated in Nek2 homodimerization (Fry, A.M., L. Arnaud, and E.A. Nigg,
manuscript in preparation). Deletion of this leucine zipper
did not reduce the strength of the association between
Nek2 and clones 2-6 or 2-2, indicating that this motif was
not by itself responsible for the observed interaction.
As a first approach to assess the significance of this interaction, the subcellular localization of the protein encoded by clone 2-6 was examined by transfecting a myc-tagged version of this cDNA into human tissue culture
cells. Immunofluorescence microscopy revealed that ectopically expressed myc:2-6 protein localized primarily to
the centrosome, as demonstrated by colocalization of anti-myc antibodies with antibodies for the centrosomal marker
-tubulin (Fig. 1 A, a and b). In weakly expressing cells,
the myc:2-6 protein appeared to be exclusively associated
with the centrosome, but in cells expressing higher levels,
myc:2-6 could also be seen in the cytoplasm (Fig. 1 A, a).
To verify this localization, two rabbit antisera (R62 and
R63) were raised against bacterially expressed, polyhistidine-tagged 2-6 protein. When used for immunofluorescent staining of human tissue culture cells, both antibodies
produced highly specific staining of the centrosome (Fig. 1
B, b and c), whereas no such staining was observed with
the corresponding preimmune sera (Fig. 1 B, a and data
not shown). The identity of the stained organelles was confirmed by performing double labeling experiments, using
R62 in combination with a monoclonal antibody against
p150Glued, a component of the dynactin complex that is
known to concentrate at the centrosome (e.g., Blangy et
al., 1997
; Fig. 1 B, d). From these results, we conclude that
the protein encoded by cDNA 2-6 is a novel component of
the centrosome. Hence, in the following we refer to this
protein as C-Nap1.
|
C-Nap1 Is a High Molecular Mass Coiled-Coil Protein
To determine the size of the endogenous C-Nap1 protein,
the anti-C-Nap1 antibodies (R62 and R63) were used for
Western blotting. On total extracts of U2OS cells, both
anti-C-Nap1 antibodies consistently identified a protein
migrating at ~250 kD that was not detected by the corresponding preimmune sera (Fig. 2, lanes 2 and 1, respectively, and data not shown). When similar immunoblots
were performed on total extracts prepared from the KE37
T-lymphoblastic cell line, both anti-C-Nap1 antibodies
again recognized a protein migrating at 250 kD (Fig. 2,
lane 3 and data not shown), and importantly, this protein
was substantially enriched in centrosome preparations isolated from these cells (Fig. 2, lane 4). Indeed, the level of
enrichment of C-Nap1 in purified centrosomes was very
similar to that observed for Nek2, previously determined
to be in the order of 100-fold (Fig. 2, lanes 5 and 6; and see
Fry et al., 1998
). Extrapolating from Nek2, this result also
implies that the existence of a noncentrosomal pool of
C-Nap1 is to be expected. Interestingly, both C-Nap1 antibodies also recognized a band at ~190 kD in KE37 total
cell extracts and centrosomal preparations (Fig. 2, lanes 3 and 4). As this band showed a similar degree of enrichment in centrosome preparations as the full-length C-Nap1 protein, we believe that it may be structurally related (e.g., either represent a breakdown product of C-Nap1 or an alternatively spliced form; see legend to Fig. 3).
|
|
The above data strongly suggested that the C-Nap1 protein isolated originally by two-hybrid interaction with Nek2 represents a COOH-terminal fragment of a much larger protein. To obtain the full-length sequence, we screened a human placenta cDNA library with the available C-Nap1 probe, and after repeated rounds of screening, isolated several overlapping cDNAs spanning a total of 8,347 nucleotides (Fig. 3 A). Conceptual translation of these cDNAs revealed the presence of a continuous open reading frame coding for a protein of 2,442 amino acids, with a calculated molecular mass of 281 kD (Fig. 3 B). Although we have been unable to determine the size of the C-Nap1 mRNA by Northern blot analysis, presumably because of the low abundance of this transcript (see below), we are confident that the isolated cDNAs encompass the complete protein. In fact, the putative initiator methionine is preceded by several stop codons, and the 3' ends of some cDNAs include a polyadenylation signal and a polyA tail. Taken together with the results of our immunochemical data, these cDNA sequence analyses indicate that C-Nap1 is a novel, high molecular mass component of the mammalian centrosome. The C-Nap1 gene was mapped by radiation hybrid mapping close to the centromeric region of human chromosome 20, between the framework markers WI-6874 and AFMA152YG1. This places C-Nap1 between the genetic markers D20S195 and D20S908 at approximately 20q11.2.
Examination of the predicted C-Nap1 protein sequence
indicates that this protein is likely to form extended
coiled-coil domains, with a possible kink or hinge region
near the center (Fig. 3 C). Database searches revealed that
the COOH terminus of C-Nap1 is almost identical to a previously described mouse protein, termed INMP (see Discussion). Furthermore, while this manuscript was in preparation, a human cDNA corresponding to the first 5 kb of the C-Nap1 sequence reported here was deposited in the
Genbank database (under accession number AFO22655).
In keeping with our results, this independently isolated
cDNA was identified with the aid of human autoimmune
sera reactive against centrosomal antigens (Mack et al.,
1998
). Beyond these matches, however, no obvious close
relatives of C-Nap1 could be identified in any species, apart
from weak similarities to many coiled-coil proteins.
C-Nap1 Is a Low Abundance Ubiquitous Protein
Recent studies on the expression of Nek2 have shown that
this kinase is highly abundant in testis, and detailed in situ
hybridization analyses revealed a stage-specific expression
pattern during spermatogenesis (Rhee and Wolgemuth,
1997
; Tanaka et al., 1997
). To investigate whether C-Nap1
might show a similar tissue-specific expression, we have
isolated a cDNA coding for murine C-Nap1 and performed RNase protection experiments. As shown in Fig. 4,
C-Nap1 was expressed ubiquitously and at comparable
levels in all tissues analyzed, including testis. Thus, there is
presently no evidence for a specialized function of C-Nap1
in meiotic processes. It is noteworthy, however, that the
intensities of the signals observed with the C-Nap1 probe were similar to those obtained with a control probe for the
ubiquitous transcription factor NF-Ya, labeled to a comparable specific activity (Fig. 4). As it has been calculated
previously that there are only about 10 copies of the
NF-Ya mRNA per cell (Schmidt and Schibler, 1995
), our
results would indicate that the level of C-Nap1 mRNA may be similarly low.
|
C-Nap1 Is a Centriole-associated Core Component of the Centrosome
To determine whether the centrosomal association of C-Nap1
was dependent upon the presence of microtubules, immunostaining on cells was performed under conditions that
perturb the microtubule network. In cells incubated at 4°C
for 30 min or treated with nocodazole for 4 h, interphase
microtubules were completely depolymerized (Fig. 5, b
and c). Yet, in comparison to untreated cells (Fig. 5, a and
e), there was no observable decrease in the concentration of C-Nap1 at the centrosome after cold or nocodazole
treatment (Fig. 5, f and g). In cells incubated with taxol, on
the other hand, the microtubules appeared as dense bundles, which in many interphase cells were detached from
the centrosome (Fig. 5 d). In such cells, C-Nap1 was
clearly still associated with the centrosome and not with
the microtubule bundles (Fig. 5 h). Thus, C-Nap1, like
Nek2, associates with centrosomes independently of microtubules, and by this criterion, should be considered as a
bona fide component of the core centrosome (Oegema
et al., 1995
).
|
To examine the localization of C-Nap1 at the ultrastructural level, immunoelectron microscopy (IEM) was performed, initially using anti-C-Nap1 antibodies on isolated
centrosomes. After negative staining IEM, gold particles
were specifically found at one end of the centriole (Fig. 6
a). Whenever a pair of centrioles was visible, gold particles
were consistently present at the proximal ends of each
centriole (data not shown). Next, preembedding IEM was
carried out, using anti-C-Nap1 antibodies on U2OS human osteosarcoma cells (Fig. 6, b-g). Again, the bulk of
gold particles was tightly associated with the proximal
ends of the centrioles. There were very few gold particles
located elsewhere in the PCM, and little penetration into
the lumen of the centriole barrel could be observed. In
many sections, one centriole was more heavily labeled
than the other; however, when serial sections through a
pair of centrioles were compared, both centrioles showed
proximal end labeling, suggesting that mother and daughter centrioles were labeled to a similar extent (Fig. 6, b and
c). We have also performed preembedding IEM, using
anti-Nek2 antibodies on U2OS cells. In this case, we observed a pattern of staining remarkably similar to that
seen with anti-C-Nap1 antibodies, with a concentration of
Nek2 also at the proximal ends of centrioles (Fig. 6, h-k).
Hence, C-Nap1 and Nek2 demonstrate a striking colocalization within the substructure of the centrosome. Attesting to the specificity of these results, antibodies against
-tubulin produced a much more diffuse labeling throughout the PCM (data not shown), in agreement with previously published results (Fuller et al., 1995
; Moudjou et al.,
1996
). Also, no centrosome-specific staining was observed
when using the immunogold-labeled secondary antibodies
alone (data not shown).
|
Loss of C-Nap1 Staining on Mitotic Spindle Poles
The intensity of centrosome staining by anti-C-Nap1 antibodies showed little if any variation during interphase
stages of the cell cycle, and fairly uniform staining was also
observed when anti-C-Nap1 antibodies were used to stain
centrosomes isolated from exponentially growing KE37
cells (data not shown). In striking contrast, however, mitotic spindle poles were poorly labeled by anti-C-Nap1 antibodies, and in some mitotic cells staining of spindle poles
was undetectable altogether (Fig. 7). Diminished C-Nap1
staining could be detected at the onset of prophase, concomitant with centrosome separation, increased microtubule-nucleating activity, and chromosome condensation
(Fig. 7 A, a-c), and it persisted throughout the remainder
of mitosis (e.g., anaphase cell in Fig. 7 A, d and e). The apparent loss of C-Nap1 from mitotic spindle poles is in
marked contrast to what is seen with many other centrosomal components, such as
-tubulin, which show an increased accumulation at the spindle poles as a result of
centrosome maturation in late G2 (Fig. 7 B, compare a-d
with e-h). The most straightforward interpretation of
these results is that the observed loss of C-Nap1 staining
during mitosis reflects a significant reduction in the amount
of C-Nap1 protein at mitotic spindle poles. However, we cannot rigorously exclude cell cycle-dependent epitope
masking as an alternative explanation.
|
Phosphorylation of C-Nap1 by Nek2
The observed interaction between the COOH-terminal
fragment of C-Nap1 and Nek2 raised the possibility that
C-Nap1 might be a substrate of Nek2. To examine this
possibility, the myc-tagged C-Nap1 clone 2-6 (i.e., the
COOH-terminal 53 kD of C-Nap1) was transcribed and
translated in a rabbit reticulocyte lysate and incubated in
the presence of recombinant Nek2 proteins immunoprecipitated from baculovirus-infected insect cells. In the
presence of active Nek2, the myc:2-6 protein showed a
drastic reduction in electrophoretic mobility (Fig. 8 A,
lane 1) and could be radiolabeled by incubation with [32P-
]ATP (Fig. 8 A, lane 3), whereas neither of these results
was observed in the presence of the catalytically inactive
Nek2 mutant (Fig. 8 A, lanes 2 and 4). Hence, Nek2 could
readily phosphorylate the COOH-terminal fragment of
C-Nap1 in vitro. To determine whether this was also the
case in vivo, the C-Nap1 clone myc:2-6 was cotransfected with either active or inactive Nek2 into U2OS cells. 24 h
after transfection, cells were lysed directly into hot sample
buffer to prevent reactions proceeding during extraction,
and the electrophoretic mobility of the myc:2-6 protein
was examined by immunoblotting with anti-myc antibodies. Consistent with the data obtained in vitro, myc:2-6
showed a conspicuously reduced gel mobility when coexpressed with active Nek2 (Fig. 8 B, lane 3), but not when expressed alone (Fig. 8 B, lane 2) or in combination with
the catalytically inactive Nek2 (Fig. 8 B, lane 4). Thus, under the conditions used here, the COOH-terminal fragment of C-Nap1 behaves as a good substrate for Nek2
both in vitro and in living cells.
|
| |
Discussion |
|---|
|
|
|---|
Studies on the mammalian centrosome began more than a
hundred years ago, yet many of its components still await
identification, and the mechanisms regulating centrosome
function during the cell cycle remain largely unknown. By
combining genomic sequence information with analytical
mass spectrometry, rapid progress is currently being made
on the identification of proteins present in spindle pole
bodies (SPBs) purified from the yeast Saccharomyces cerevisiae (Rout and Kilmartin, 1990
; Wigge et al., 1998
). However, although many yeast SPB components may have
been conserved during evolution, the substantial morphological differences between fungal SPBs and higher eukaryotic centrosomes suggest that this approach is unlikely
to yield a complete inventory of the mammalian centrosome. Thus, complementary approaches for identifying
novel centrosome components are needed. One straightforward strategy consists of the search for proteins that are
able to interact with already known centrosomal proteins.
Here, we have applied this strategy, using the centrosome-associated protein kinase Nek2 as a bait in a yeast two-
hybrid screen. Through this approach, we have identified
C-Nap1, a novel high molecular mass component of the centrosome. C-Nap1 not only colocalizes with Nek2 at the
centrosome, but it also represents the first candidate
physiological substrate of this cell cycle-regulated protein
kinase.
Both immunocytological studies and biochemical analyses of purified centrosomes demonstrate that C-Nap1 is a
bona fide component of the core centrosome. Furthermore, ultrastructural analyses using antibodies raised against
the COOH terminus of C-Nap1 revealed a highly concentrated localization of the corresponding epitopes to the
proximal ends of both mother and daughter centrioles. Although antigen accessibility is a general concern with
preembedding IEM, this strikingly restricted localization
is remarkable, as other centrosomal proteins show very
different distributions within the centrosome: centrin was
reported to be concentrated at the distal ends of centrioles, as well as within their lumen (Paoletti et al., 1996
),
whereas
-tubulin has a broader distribution, localizing to
the periphery of the PCM, to pericentriolar satellites and to the ends of centriolar and procentriolar microtubules
(Fuller et al., 1995
; Moudjou et al., 1996
). Of those centrosomal proteins whose localization has been determined
by electron microscopy, only a vertebrate Spc110p-related
protein shows a localization somewhat similar to that described here for C-Nap1 (Tassin et al., 1997
). However,
while the Spc110p-related protein was reported to be associated preferentially with the mother centriole (Tassin et al.,
1997
), no biased distribution between mother and daughter centrioles could be detected in the case of C-Nap1, regardless of whether isolated centrosomes were analyzed or
centrosomes in situ.
Cloning and sequencing of several overlapping cDNAs
revealed that human C-Nap1 is a protein with a predicted
molecular mass of 281 kD. The COOH terminus of C-Nap1
is very closely related to a previously described putative
nuclear matrix protein, termed INMP, that was isolated by
expression cloning using a monoclonal antibody raised to
a nuclear matrix preparation (Menz et al., 1996
). Based on
cDNA sequencing, mouse INMP was reported to comprise 446 residues. However, our sequencing of C-Nap1
cDNAs isolated from both human placenta and mouse testis (Tanaka, K., T. Mayor, and E.A. Nigg, unpublished results) libraries revealed that an open reading frame extends throughout the alleged 5' untranslated region of
INMP. Thus, we believe that INMP most likely represents a COOH-terminal fragment of a mouse C-Nap1 homologue. It would be premature to exclude the existence of
C-Nap1-related proteins within the nucleus, but our localization studies provide no evidence for a nuclear localization of the C-Nap1 protein described here. Additional support that C-Nap1 is a bona fide centrosomal protein stems
from the independent identification of the same protein in
a study on the characterization of human autoimmune
sera with centrosomal reactivity (Mack et al., 1998
).
On the basis of primary structure analyses, C-Nap1 is
predicted to consist almost entirely of coiled-coil domains
(Lupas, 1996
). Several other recently described centrosomal proteins also contain predicted coiled-coils (for review
see Stearns and Winey, 1997
), suggesting that protein-protein interactions based on such domains may be ideally
suited for the maintenance of a dynamic centrosome structure. The only regions within C-Nap1 that contain clusters
of helix-breaking proline residues are located towards the
extreme NH2 and COOH termini, and intriguingly, near
the center of the protein. Thus, it is possible that C-Nap1
might contain a hinge or even fold back upon itself. Provided that recombinant C-Nap1 can be produced in a soluble form, it will be interesting to determine its shape. If
this 281-kD coiled-coil protein were to form a straight rod,
then its predicted length would be around 300 nm (comparable to the average intercentriolar distance; e.g., Chrétien
et al., 1997
). At present, we have no information about the
oligomerization state of C-Nap1 or its ability to interact with other coiled-coil proteins. However, electron-dense
filaments have been shown to extend between the proximal ends of the two centrioles (Bornens et al., 1987
; Paintrand et al., 1992
; and references therein), and it is attractive to speculate that C-Nap1 could be a component of a
structure connecting the proximal ends of centrioles to
each other (Fig. 9).
|
In this context, it is intriguing that Nek2 is able to phosphorylate the COOH-terminal domain of C-Nap1 both in
vitro and in vivo, suggesting that C-Nap1 may be a physiological substrate of Nek2. This invites speculations as to
the mechanisms by which overexpression of Nek2 disrupts
centrosome structure. In a previous study, we have shown
that overexpression of Nek2 in cultured cells produces a
striking splitting of centrosomes (Fry et al., 1998
). Since
this effect was strictly dependent on Nek2 activity, we have proposed that increased Nek2 activity may lead to
the degradation or disassembly of a molecular "glue" that
holds the two centrosomes in close apposition during most
stages of the cell cycle. In the simplest interpretation of
this model, the hypothetical glue would be composed of
structural proteins, at least one of which would be a direct
substrate of Nek2. Phosphorylation of this protein at the
appropriate stage of the cell cycle could then either target it for degradation or cause it to dissociate from centrosomes, with both processes leading to a weakening of
centriole-centriole cohesion. As C-Nap1 most likely fulfills a structural role and clearly can be phosphorylated by
Nek2, it would seem to qualify as a candidate component
of this hypothetical centrosomal glue (Fig. 9). We have observed that C-Nap1 immunoreactivity is severely diminished at the spindle poles of mitotic cells, consistent with the notion that the association of C-Nap1 with the centrosome may be cell cycle regulated. However, as yet we
have no information on either the timing or the molecular
consequences of C-Nap1 phosphorylation by Nek2, and
the model shown in Fig. 9 should therefore be considered as a working hypothesis. Testing of this model will require
a detailed analysis of C-Nap1 phosphorylation during the
cell cycle, and the mapping of Nek2-dependent phosphorylation sites. Such information may then set the stage for
directly testing the consequences of overexpressing wild-type and phosphorylation-site mutant versions of C-Nap1
in living cells.
| |
Footnotes |
|---|
Received for publication 17 February 1998 and in revised form 27 April 1998.
Address all correspondence to Erich A. Nigg, Department of Molecular Biology, Sciences II, University of Geneva, 30, Quai Ernest-Ansermet, CH-1211 Geneva 4, Switzerland. Tel.: +41 22 702 6127. Fax: +41 22 702 6868. E-mail: erich.nigg{at}molbio.unige.chWe thank S. Elledge (Baylor College, Houston, TX) for kindly providing plasmids and yeast strains for the yeast two-hybrid screening, Hamish Scott (University of Geneva, Switzerland) for advice and reagents concerning the chromosomal mapping, and N. Roggli (University of Geneva) for help with artwork. We also thank M. Bornens (Institut Curie, Paris, France) for critical comments on the manuscript and R. McIntosh (University of Colorado, Boulder, CO) for stimulating discussion. Finally, we thank L. Arnaud (University of Geneva) for help with setting up the two-hybrid system and all other members of our laboratory for many helpful discussions.
This work was supported by the Swiss National Science Foundation (31-50576.97), the Swiss Cancer Leagure (267-1-1996), and the Canton of Geneva.
| |
Abbreviations used in this paper |
|---|
CDK, cyclin-dependent kinase;
C-Nap1, centrosomal Nek2-associated protein 1;
IEM, immunoelectron microscopy;
INMP, intranuclear matrix protein;
Nek2, NIMA-related kinase 2;
PCM, pericentriolar material;
SPB, spindle pole body;
-TuRCs,
-tubulin-
containing ring complexes.
| |
References |
|---|
|
|
|---|
| 1. |
Blangy, A.,
L. Arnaud, and
E.A. Nigg.
1997.
Phosphorylation by p34cdc2 protein
kinase regulates binding of the kinesin-related motor HsEg5 to the dynactin
subunit p150Glued.
J. Biol. Chem.
272:
19418-19424
|
| 2. | Blangy, A., H.A. Lane, P. d'Heren, M. Harper, M. Kress, and E.A. Nigg. 1995. Phosphorylation by p34cdc2 regulates spindle association of human Eg5, a kinesin-related motor essential for bipolar spindle formation in vivo. Cell 83: 1159-1169 [Medline]. |
| 3. | Bornens, M., M. Paintrand, J. Berges, M.-C. Marty, and E. Karsenti. 1987. Structural and chemical characterization of isolated centrosomes. Cell Motil. Cytoskel. 8: 238-249 [Medline]. |
| 4. | Brinkley, B.R.. 1985. Microtubule organizing centers. Annu. Rev. Cell Biol. 1: 145-172 . |
| 5. |
Buendia, B.,
G. Draetta, and
E. Karsenti.
1992.
Regulation of the microtubule
nucleating activity of centrosomes in Xenopus egg extracts: role of cyclin
A-associated protein kinase.
J. Cell Biol.
116:
1431-1442
|
| 6. |
Centonze, V.E., and
G.G. Borisy.
1990.
Nucleation of microtubules from mitotic centrosomes is modulated by a phosphorylated epitope.
J. Cell Sci.
95:
405-411
|
| 7. | Chrétien, D., B. Buendia, S.D. Fuller, and E. Karsenti. 1997. Reconstruction of the centrosome cycle from cryoelectron micrographs. J. Struct. Biol. 120: 117-133 [Medline]. |
| 8. |
Dictenberg, J.B.,
W. Zimmerman,
C.A. Sparks,
A. Young,
C. Vidair,
Y. Zheng,
W. Carrington,
F.S. Fay, and
S.J. Doxsey.
1998.
Pericentrin and -tubulin
form a protein complex and are organized into a novel lattice at the centrosome.
J. Cell Biol.
141:
163-174
|
| 9. | Doxsey, S., P. Stein, L. Evans, P.D. Calarco, and M. Kirschner. 1994. Pericentrin, a highly conserved centrosome protein involved in microtubule organization. Cell 76: 639-650 [Medline]. |
| 10. |
Durfee, T.,
K. Becherer,
P.-L. Chen,
S.-H. Yeh,
Y. Yang,
A.E. Kilburn,
W.-H. Lee, and
S.J. Elledge.
1993.
The retinoblastoma protein associates with the
protein phosphatase type 1 catalytic subunit.
Genes Dev
7:
555-569
|
| 11. | Fields, S., and O. Song. 1989. A novel genetic system to detect protein-protein interactions. Nature 340: 245-246 [Medline]. |
| 12. | Fry, A.M., and E.A. Nigg. 1995. Cell cycle. The NIMA kinase joins forces with Cdc2. Curr. Biol. 5: 1122-1125 [Medline]. |
| 13. | Fry, A.M., and E.A. Nigg. 1997. Characterization of mammalian NIMA-related kinases. Methods Enzymol. 283: 270-282 [Medline]. |
| 14. | Fry, A.M., S.J. Schultz, J. Bartek, and E.A. Nigg. 1995. Substrate specificity and cell cycle regulation of the Nek2 protein kinase, a potential human homolog of the mitotic regulator NIMA of Aspergillus nidulans. J. Biol. Chem. 2705: 12899-12905 . |
| 15. | Fry, A.M., P. Meraldi, and E.A. Nigg. 1998. A centrosomal function for the human Nek2 protein kinase, a member of the NIMA-family of cell cycle regulators. EMBO (Eur. Mol. Biol. Organ.) J. 17: 470-481 [Medline]. |
| 16. |
Fuller, S.D.,
B.E. Gowen,
S. Reinsch,
A. Sawyer,
B. Buendia,
R. Wepf, and
E. Karsenti.
1995.
The core of the mammalian centriole contains -tubulin.
Curr. Biol.
5:
1384-1393
[Medline].
|
| 17. |
Geissler, S.,
G. Pereira,
A. Spang,
M. Knop,
S. Soues,
J. Kilmartin, and
E. Schiebel.
1996.
The spindle pole body component Spc98p interacts with the
-tubulin-like Tub4p of Saccharomyces cerevisiae at the sites of microtubule
attachment.
EMBO (Eur. Mol. Biol. Organ.) J.
15:
3899-3911
[Medline].
|
| 18. |
Gould, R.R., and
G.G. Borisy.
1977.
The pericentriolar material in Chinese
hamster ovary cells nucleates microtubule formation.
J. Cell Biol.
73:
601-615
|
| 19. | Gu, J., C.G. Stephenson, and M.J. Iadarola. 1994. Affinity purification of antibodies using a 6xHis-tagged antigen immobilized on Ni-NTA. Biotechniques 17: 257-262 [Medline]. |
| 20. | Harlow, E., and D. Lane. 1988. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 313-315. |
| 21. | Harper, J.W., G.R. Adami, N. Wei, K. Keyomarsi, and S.J. Elledge. 1993. The p21 Cdk-interacting protein Cip1 is a potent inhibitor of G1 cyclin-dependent kinases. Cell 75: 805-816 [Medline]. |
| 22. | Kalt, A., and M. Schliwa. 1993. Molecular components of the centrosome. Trends Cell Biol. 3: 118-128 . [Medline] |
| 23. | Karsenti, E.. 1991. Mitotic spindle morphogenesis in animal cells. Semin. Cell Biol. 2: 251-260 [Medline]. |
| 24. | Kellogg, D.R., M. Moritz, and B.M. Alberts. 1994. The centrosome and cellular organization. Annu. Rev. Biochem. 63: 639-674 [Medline]. |
| 25. | Kimble, M., and R. Kuriyama. 1992. Functional components of microtubule-organizing centers. Int. Rev. Cytol. 136: 1-50 [Medline]. |
| 26. |
Knop, M.,
G. Pereira,
S. Geissler,
K. Grein, and
E. Schiebel.
1997.
The spindle
pole body component Spc97p interacts with the -tubulin of Saccharomyces
cerevisiae and functions in microtubule organization and spindle pole body
duplication.
EMBO (Eur. Mol. Biol. Organ.) J.
16:
1550-1564
[Medline].
|
| 27. |
Kochanski, R.S., and
G.G. Borisy.
1990.
Mode of centriole duplication and distribution.
J. Cell Biol.
110:
1599-1605
|
| 28. | Krek, W., and E.A. Nigg. 1991. Mutations of p34cdc2 phosphorylation sites induce premature mitotic events in HeLa cells: evidence for a double block to p34cdc2 kinase activation in vertebrates. EMBO (Eur. Mol. Biol. Organ.) J. 10: 3331-3341 [Medline]. |
| 29. |
Kuriyama, R., and
G.G. Borisy.
1981a.
Centriole cycle in Chinese hamster
ovary cells as determined by whole-mount electron microscopy.
J. Cell Biol.
91:
814-821
|
| 30. |
Kuriyama, R., and
G.G. Borisy.
1981b.
Microtubule-nucleating activity of centrosomes in Chinese hamster ovary cells is independent of the centriole cycle
but coupled to the mitotic cycle.
J. Cell Biol.
91:
822-826
|
| 31. |
Lane, H.A., and
E.A. Nigg.
1996.
Antibody microinjection reveals an essential
role for human polo-like kinase 1 (Plk1) in the functional maturation of mitotic centrosomes.
J. Cell Biol.
135:
1701-1713
|
| 32. |
Lange, B.M.H., and
K. Gull.
1995.
A molecular marker for centriole maturation
in the mammalian cycle.
J. Cell Biol.
130:
919-927
|
| 33. | Lange, B.M.H., and K. Gull. 1996. Structure and function of the centriole in animal cells: progress and questions. Trends Cell Biol. 6: 348-352 . [Medline] |
| 34. | Lu, K.P., and T. Hunter. 1995a. The NIMA kinase: a mitotic regulator in Aspergillus nidulans and vertebrate cells. In Progress in Cell Cycle Research. Vol. 1. L. Meijer, S. Guidet, and H.Y.L. Tung, editors. Plenum Press, NY. 187-205. |
| 35. | Lu, K.P., and T. Hunter. 1995b. Evidence for a NIMA-like mitotic pathway in vertebrate cells. Cell 81: 413-424 [Medline]. |
| 36. | Lupas, A.. 1996. Prediction and analysis of coiled-coil structures. Methods Enzymol. 266: 513-525 [Medline]. |
| 37. | Mack, G.J., J. Rees, O. Sandblom, R. Balczon, M.J. Fritzler, and J.B. Rattner. 1998. Autoantibodies to a group of centrosomal proteins in human autoimmune sera reactive with the centrosome. Arthritis Rheum. 41: 551-558 [Medline]. |
| 38. | Mazia, D.. 1987. The chromosome cycle and the centrosome cycle in the mitotic cycle. Int. Rev. Cytol. 100: 49-92 [Medline]. |
| 39. |
McGill, M., and
B.R. Brinkley.
1975.
Human chromosomes and centrioles act
as nucleating sites for the in vitro assembly of microtubules from bovine
brain tubulin.
J. Cell Biol.
67:
189-199
|
| 40. | Menz, K., N. Radomski, and E. Jost. 1996. INMP, a novel intranuclear matrix protein related to the family of intermediate filament-like proteins: molecular cloning and sequence analysis. Biochim. Biophys. Acta 1309: 14-20 [Medline]. |
| 41. |
Moritz, M.,
M.B. Braunfeld,
J.W. Sedat,
B. Alberts, and
D.A. Agard.
1995.
Microtubule nucleation by -tubulin-containing rings in the centrosome.
Nature
378:
638-640
[Medline].
|
| 42. | Moudjou, M., and M. Bornens. 1994. Isolation of centrosomes from cultured animal cells. In Cell Biology: A Laboratory Handbook. Vol. 1. J.E. Celis, editor. Academic Press, Inc., London. 595-604. |
| 43. |
Moudjou, M.,
N. Bordes,
M. Paintrand, and
M. Bornen.
1996.
-Tubulin in mammalian cells: the centrosomal and the cytosolic forms.
J. Cell Sci.
109:
875-887
[Abstract].
|
| 44. | O'Connell, M.J., C. Norbury, and P. Nurse. 1994. Premature chromatin condensation upon accumulation of NIMA. EMBO (Eur. Mol. Biol. Organ.) J. 13: 4926-4937 [Medline]. |
| 45. |
Oegema, K.,
W.G.F. Whitfield, and
B. Alberts.
1995.
The cell cycle-dependent
localization of the CP190 centrosomal protein is determined by the coordinate action of two separable domains.
J. Cell Biol.
131:
1261-1273
|
| 46. | Osmani, A.H., S.L. McGuire, and S.A. Osmani. 1991. Parallel activation of the NIMA and p34cdc2 cell cycle-regulated protein kinases is required to initiate mitosis in A. nidulans. Cell 67: 283-291 [Medline]. |
| 47. | Osmani, S.A., and X.S. Ye. 1996. Cell cycle regulation in Aspergillus by two protein kinases. Biochem. J. 317: 633-641 . |
| 48. | Paintrand, M., M. Moudjou, H. Delacroix, and M. Bornens. 1992. Centrosome organization and centriole architecture: their sensitivity to divalent cations. J. Struct. Biol. 108: 107-128 [Medline]. |
| 49. | Paoletti, A., M. Moudjou, M. Paintrand, J.L. Salisbury, and M. Bornens. 1996. Most of centrin in animal cells is not centrosome-associated and centrosomal centrin is confined to the distal lumen of centrioles. J. Cell Sci. 109: 3089-3102 [Abstract]. |
| 50. |
Pu, R.T.,
G. Xu,
L. Wu,
J. Vierula,
K. O'Donnell,
X.S. Ye, and
S.A. Osmani.
1995.
Isolation of a functional homolog of the cell cycle-specific NIMA protein kinase of Aspergillus nidulans and functional analysis of conserved residues.
J. Biol. Chem.
270:
18110-18116
|
| 51. | Rhee, K., and D.J. Wolgemuth. 1997. The NIMA-related kinase 2, Nek2, is expressed in specific stages of the meiotic cell cycle and associates with meiotic chromosomes. Development (Camb.) 124: 2167-2177 [Abstract]. |
| 52. | Rieder, C.L., and G.G. Borisy. 1982. The centrosome cycle in PtK2 cells: asymmetric distribution and structural changes in the pericentriolar material. Biol. Cell 44: 117-132 . |
| 53. |
Rout, M.P., and
J.V. Kilmartin.
1990.
Components of the yeast spindle pole
body.
J. Cell Biol.
111:
1913-1927
|
| 54. |
Sawin, K.E., and
T.J. Mitchison.
1995.
Mutations in the kinesin-like protein Eg5
disrupting localization to the mitotic spindle.
Proc. Natl. Acad. Sci. USA
92:
4289-4293
|
| 55. |
Schmidt, E.E., and
U. Schibler.
1995.
Cell size regulation, a mechanism that
controls cellular RNA accumulation: consequences on regulation of the
ubiquitous transcription factors Oct1 and NF-Y, and the liver-enriched transcription factor DBP.
J. Cell Biol.
128:
467-483
|
| 56. | Schmidt-Zachmann, M.S., and E.A. Nigg. 1993. Protein localization to the nucleolus: a search for targetting domains in nucleolin. J. Cell Sci. 105: 799-806 [Abstract]. |
| 57. | Schultz, S.J., A.M. Fry, C. Sütterlin, T. Ried, and E.A. Nigg. 1994. Cell cycle-dependent expression of Nek2, a novel human protein kinase related to the NIMA mitotic regulator of Aspergillus nidulans. Cell Growth Diff. 5: 625-635 [Abstract]. |
| 58. | Slot, J., and H.J. Geuze. 1985. A new method of preparing gold probes for multiple-labeling cytochemistry. Eur. J. Cell Biol. 38: 87-93 [Medline]. |
| 59. |
Snyder, J.A., and
J.R. McIntosh.
1975.
Initiation and growth of microtubules
from mitotic centers in lysed mammalian cells.
J. Cell Biol.
67:
744-760
|
| 60. | Stearns, T., and M. Winey. 1997. The cell center at 100. Cell 91: 303-309 [Medline]. |
| 61. | Stierhof, Y.-D., B.M. Humbel, and H. Schwarz. 1991. Suitability of different silver enhancement methods applied to 1 nm colloidal gold particles: an immunoelectron microscopic study. J. Electron Microsc. Tech. 17: 336-343 [Medline]. |
| 62. | Tanaka, K., M. Parvinen, and E.A. Nigg. 1997. The in vivo expression pattern of mouse Nek2, a NIMA-related kinase, indicates a role in both mitosis and meiosis. Exp. Cell Res. 237: 264-274 [Medline]. |
| 63. | Tassin, A.M., C. Celati, M. Paintrand, and M. Bornens. 1997. Identification of an Spc110p-related protein in vertebrates. J. Cell Sci 110: 2533-2545 [Abstract]. |
| 64. | Tournier, F., and M. Bornens. 1994. Cell cycle regulation of centrosome function. In Microtubules. Wiley-Liss, Inc., New York. 303-324. |
| 65. |
Vandré, D.D.,
F.M. Davis,
P.N. Rao, and
G.G. Borisy.
1984.
Phosphoproteins
are components of mitotic microtubule organising centers.
Proc. Natl. Acad.
Sci. USA.
81:
4439-4443
|
| 66. | Vandré, D.D., F.M. Davis, P.N. Rao, and G.G. Borisy. 1986. Distribution of cytoskeletal proteins sharing a conserved phosphorylated epitope. Eur. J. Cell Biol. 41: 72-81 [Medline]. |
| 67. | Verde, F., J.-C. Labbé, M. Dorée, and E. Karsenti. 1990. Regulation of microtubule dynamics by cdc2 protein kinase in cell-free extracts of Xenopus eggs. Nature 343: 233-238 [Medline]. |
| 68. |
Verde, F.,
M. Dogterom,
E. Stelzer,
E. Karsenti, and
S. Leibler.
1992.
Control
of microtubule dynamics and length by cyclin A- and B-dependent kinases
in Xenopus egg extracts.
J. Cell Biol.
118:
1097-1108
|
| 69. | Vorobjev, I.A., and Y.S. Chentsov. 1982. Centrioles in the cell cycle. I. Epithelial cells. J. Cell Biol. 98: 938-949 . |
| 70. | Vorobjev, I.A., and E.S. Nadehzdina. 1987. The centrosome and its role in the organization of microtubules. Int. Rev. Cytol. 106: 227-284 [Medline]. |
| 71. |
Wigge, P.A.,
O.N. Jensen,
S. Holmes,
S. Souès,
M. Mann, and
J.V. Kilmartin.
1998.
Analysis of the Saccharomyces spindle pole by matrix-assisted laser
desorption/ionization (MALDI) mass spectrometry.
J. Cell Biol.
141:
967-977
|
| 72. |
Zheng, Y.,
M.L. Wong,
B. Alberts, and
T. Mitchison.
1995.
Nucleation of microtubule assembly by a -tubulin-containing ring complex.
Nature
378:
578-583
[Medline].
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|