|
||
1


* Department of Pathology, University of Geneva, 1211 Geneva 4, Switzerland; and
Cell Biology Laboratory,
Istituto Nazionale per la Ricerca sul Cancro, 16132 Genova, Italy
| |
Abstract |
|---|
|
|
|---|
Transforming growth factor-
1 (TGF
1), a
major promoter of myofibroblast differentiation, induces
-smooth muscle (sn) actin, modulates the expression of adhesive receptors, and enhances the synthesis of
extracellular matrix (ECM) molecules including ED-A fibronectin (FN), an isoform de novo expressed during
wound healing and fibrotic changes. We report here
that ED-A FN deposition precedes
-SM actin expression by fibroblasts during granulation tissue evolution
in vivo and after TGF
1 stimulation in vitro. Moreover, there is a correlation between in vitro expression of
-SM actin and ED-A FN in different fibroblastic populations. Seeding fibroblasts on ED-A FN does not elicit
per se
-SM actin expression; however, incubation of fibroblasts with the anti-ED-A monoclonal antibody IST-9 specifically blocks the TGF
1-triggered enhancement of
-SM actin and collagen type I, but not that of
plasminogen activator inhibitor-1 mRNA. Interestingly, the same inhibiting action is exerted by the soluble recombinant domain ED-A, but neither of these inhibitory agents alter FN matrix assembly. Our findings indicate that ED-A-containing polymerized FN is necessary for the induction of the myofibroblastic phenotype by TGF
1 and identify a hitherto unknown mechanism of cytokine-determined gene stimulation based on
the generation of an ECM-derived permissive outside in signaling, under the control of the cytokine itself.
-SM actin;
extracellular
matrix;
wound healing;
fibrosis
| |
Introduction |
|---|
|
|
|---|
ACQUISITION of smooth muscle (SM)1 cell features by
fibroblastic cells is observed during morphogenetic processes, wound healing, organ fibrosis, and
stroma reaction to epithelial cancer (for review see Grinnell, 1994
; Desmoulière and Gabbiani, 1996
).
-SM actin-
expressing myofibroblasts have long been recognized as suppliers of the driving force for granulation tissue contraction (Gabbiani et al., 1972
), a mandatory function for
an efficient and rapid wound closure. Moreover, these
cells are involved in the pathogenesis of several fibrotic
diseases, being responsible for tissue retraction and overproduction of extracellular matrix (ECM) components,
such as collagen type I (Zhang et al., 1994
). During development and under normal conditions, myofibroblasts are
accountable for the generation of the structural and functional complexity of fundamental physiological units such
as the glomerulus (Soriano, 1994
) and the lung alveolar
sack (Boström et al., 1996
). In addition, myofibroblasts are
typical components of the stroma reaction to epithelial tumors where they secrete proteolytic enzymes and growth
factors which may activate cancer cell invasive behavior (for review see Rønnov-Jessen et al., 1996
). The role of factors regulating the generation of the myofibroblastic phenotype remains largely unknown. Transforming growth
factor-
1 (TGF
1) is the prototype of a large family of
cytokines that control cell proliferation, differentiation,
motility, and apoptosis, exerting their functions both during embryogenesis, in terms of pattern formation and tissue specification, and in the adult organism, where they
orchestrate complex phenomena such as inflammation, tissue repair, and neoplastic transformation (Roberts and
Sporn, 1993
; Kingsley, 1994
; Massagué et al., 1997
). It is
well accepted that TGF
1, which is known to stimulate
-SM actin synthesis by fibroblasts (Desmoulière et al.,
1993
; Rønnov-Jessen and Petersen, 1993
), upregulates
fibrillar collagen and fibronectin (FN) expression (Ignotz
and Massagué, 1986
; Roberts et al., 1986
).
FN, a 440-kD dimeric glycoprotein widely distributed in
plasma and in ECM, is expressed at high levels in healing
wounds (Kurkinen et al., 1980
). Each FN subunit is
formed by a series of repeating homologous modules and
contains binding sites for cell surface receptors and for
other ECM components. FN polymorphism is due to alternative splicing of the type III segments ED-A, ED-B, and IIICS. Recently, a novel splicing variant lacking the IIICS
region and the segments I-10 and III-15 has been characterized (MacLeod et al., 1996
). Two of these alternative
spliced segments, namely ED-A and ED-B, are included
in the so-called cellular FN (Hynes, 1990
; Kosmehl et al.,
1996
; MacLeod et al., 1996
). Previous in situ hybridization
studies have demonstrated that granulation tissue fibroblasts show a FN splicing pattern consisting of ED-A and
ED-B domains, similar to that found in the embryo
(ffrench-Constant et al., 1989
). In vitro, TGF
1 increases
total FN levels by preferentially promoting accumulation
of the ED-A FN isoform (Balza et al., 1988
; Borsi et al.,
1990
; Kocher et al., 1990
). For this reason we hypothesized that ED-A FN, interacting with a not yet characterized cell
surface receptor, could transduce signals initiated by
TGF
1 and/or synergize with them, behaving as a crucial
intermediary for the induction of myofibroblastic features,
such as
-SM actin and collagen type I expression. Moreover, it has been previously suggested that ED-A FN modulates hepatic stellate cells to
-SM actin-expressing myofibroblast-like cells (Jarnagin et al., 1994
).
It is well known that integrin-mediated adhesion to
ECM regulates transmission of activated growth factor receptor tyrosine kinases and that convergence of integrin
and growth factor-dependent pathways is required for the
proper stimulation of gene expression, cell growth and differentiation (Clarke and Brugge, 1995
; Schwartz, 1997
;
Schlaepfer and Hunter, 1998
). The TGF
serine/threonine kinase receptors signal from cell membrane to the nucleus
mainly through the SMAD family of signal transducers
(Heldin et al., 1997
). However, it is not yet known whether
and how ECM can influence TGF
effects on target cells.
Here we provide a molecular dissection of the ECM-generated pathway that needs to be activated for the induction of the myofibroblastic phenotype by TGF
.
| |
Materials and Methods |
|---|
|
|
|---|
Antibodies
We used an affinity-purified fibronectin polyclonal antibody recognizing
both cellular and plasma FN (Sigma Chemical Co., St. Louis, MO) and
three mouse IgG1 mAbs selectively raised against different domains of
FN isoforms (Borsi et al., 1987
; Carnemolla et al., 1987
, 1989
, 1992
): (a)
IST-4, to the fifth FN type III domain shared by cellular and plasma FN;
(b) IST-9, against the ED-A FN type III domain of cellular FN; and (c)
BC-1, recognizing a cryptic epitope within the seventh FN type III domain, which is unmasked only when the ED-B domain is included in the
cellular FN molecule. Anti-
SM-1, an IgG2a mAb, against
-SM actin
(Skalli et al., 1986
), and DIA-900, an IgG1 mAb, against the 6× His tag (Dianova, Hamburg, Germany), were also used. For control purposes, irrelevant antibodies of the same isotypes were used.
Purification of FNs and Production of Recombinant ED-A Domain
Plasma (ED-A
, ED-B
) and cellular (ED-A +, ED-B +) FNs were
purified from human plasma and from the conditioned medium of the SV-40-transformed embryonic human lung WI-38-VA cell line as previously
reported (Zardi et al., 1987). The presence or the absence of ED-A and
ED-B in purified FNs was further verified by Western blotting with IST-9
and BC-1 mAbs (Borsi et al., 1987
; Carnemolla et al., 1987
, 1989
).
The 270-bp cDNA sequence coding for the complete amino acid sequence of the ED-A domain (Kornblihtt et al., 1984
) was generated by
PCR amplification starting from the full-length cellular FN cDNA clone
pFH111 (gift of F.E. Baralle, International Centre for Genetic Engineering and Biotechnology, Trieste, Italy) and using Pwo Pyrococcus woesei
DNA polymerase (Boehringer Mannheim, Mannheim, Germany) and the
following primers: (a) 5' CTCGGATCCAACATTGATCGCCCTAAA 3',
which covers a FN sequence from base 5084 to base 5101 and includes the
underlined BamHI restriction site, and (b) 5' CTCGGATCCAATAGCTGTGGACTGGGT 3', which covers a FN sequence from base 5342 to base
5359 and includes the underlined BamHI restriction site. PCR product was isolated, digested with BamHI restriction enzymes, and then cloned in the
pQE-12 expression vector with a 3' 6× His tag (QIAGEN Inc., Santa
Clarita, CA). Escherichia coli were transformed with this construct and
the 6× His COOH-terminal-tagged recombinant ED-A (rED-A) protein
was purified using a Ni-NTA resin column (QIAGEN Inc.) according to
the manufacturer. 6× His-tagged rED-A was then dialyzed against PBS
and sterilized through a 0.22-µm filter. After filtration, protein concentration was established by analyzing absorbance at a 280-nm wavelength.
Protein purity and size were verified by Coomassie blue staining after
SDS-PAGE on a 10% polyacrylamide gel. Immunological protein reactivity was investigated by Western blotting with mAb IST-9.
In Vivo Experimental Procedures
Excisional wound granulation tissue was generated as previously described (Darby et al., 1990
). In brief, on day 0, eight-week-old female
Wistar rats were anaesthetized and a 2 × 2-cm skin wound was made on
the middorsal surface. Granulation tissue samples were collected at 4, 7, and 12 d after wounding.
All procedures involving animals were reviewed and approved by the Animal Care Committee at the University of Geneva. These procedures conform the guidelines as established in the Guide for the Care and Use of Laboratory Animals and Public Health Service Policy on Human Care and Use of Laboratory Animals.
Double Indirect Immunofluorescence and Confocal Laser Scanning Microscopy Analysis
Tissue samples were embedded in OCT 4583 (Miles Scientific, Naperville,
IL) and snap frozen in precooled liquid isopentane. 4-µm serial sections
were fixed for 5 min in acetone at
20°C, air dried for 2 h at room temperature, sequentially incubated with anti-
SM-1, revealed by a TRITC-tagged goat anti-mouse IgG2a (Jackson ImmunoResearch Labs, Inc.,
West Grove, PA), and then with IST-9, followed by a dichlorotriazinyl
amino fluorescein-labeled goat anti-mouse IgG1 (Jackson ImmunoResearch Labs, Inc.).
For the qualitative FN matrix assembly assay, after in vitro blocking experiments with the IST-9 mAb or the rED-A fragment (see below), cultured fibroblastic cells were rinsed in PBS, fixed in 4% paraformaldehyde for 15 min at room temperature, permeabilized with 0.1% Triton-X 100 for 5 min at room temperature, rinsed in PBS, and then stained in immunofluorescence. The primary monoclonal antibodies used were the affinity-purified rabbit polyclonal anti-FN antibody (Sigma Chemical Co.) alone or combined with DIA-900 (Dianova), and then revealed by a TRITC-tagged goat anti-rabbit and a dichlorotriazinyl amino fluorescein-labeled goat anti-mouse (both from Jackson ImmunoResearch Labs, Inc.), respectively.
Specimens were observed with a confocal laser scan fluorescence inverted microscope (model LSM 410; Carl Zeiss, Oberkochen, Germany) equipped with two lasers used simultaneously: (a) a helium laser (excitation wavelength at 543 nm) and (b) an argon-neon laser (excitation wavelength 488 nm). The appropriate combination of filters was used to separate excitation and emission spectra. The objective used was an immersion oil plan-neofluar 63×/1.4. Images of 512 × 512 pixels were stored on an erasable optical disk (Sony Corp., Tokyo, Japan) and then printed with a Kodak XLS8600 printer (Eastman Kodak Co., Rochester, NY) by means of dye thermic sublimation technique.
Cell Culture and Treatment
Passage 5 human fibroblasts obtained from explants of breast skin, palmar
fascia, or Dupuytren's nodules were plated on Petri dishes containing Eagle's minimum essential medium (MEM; GIBCO AG, Basel, Switzerland)
supplemented with Monomed (a defined serum-free medium containing
insulin, transferrin, sodium selenite, 2-mercaptoethanol, 2-aminoethanol,
sodium pyruvate, glutamine, and a BSA-oleic acid complex; Commonwealth Serum Laboratories, Melbourne, Australia), 100 U/ml penicillin,
100 mg/ml streptomycin, and 2 mM L-glutamine. Cell density was ~1.5 × 104 cells/cm2. They were maintained at 37°C in a humid atmosphere of 5%
CO2 and 95% air. Medium was removed 24 h after plating and fibroblasts were incubated for 1-6 d in MEM plus Monomed alone or containing 10 ng/ml of TGF
1 (gift of A. Roberts, National Institutes of Health,
Bethesda, MD, and purchased from Sigma Chemical Co.), or TGF
2 (gift
of A. Cox, Novartis, Basel, Switzerland). Passage 5 rat fibroblasts obtained
from explants of subcutaneous tissue, lung, and dermis were plated on Petri
dishes (1.5 × 104 cells/cm2) containing MEM (GIBCO AG) supplemented
with Monomed (Commonwealth Serum Laboratories) and were cultured at
37°C in a humid atmosphere of 5% CO2 and 95% air for 4 d.
In blocking experiments with mAbs, 50, 150, or 300 µg of each anti-FN
mAb were diluted in 1 ml of 2% gelatin (Sigma Chemical Co.) and then
coated onto 6-cm Petri dishes; coatings of the same volume of 2% gelatin
alone or containing equal amounts of irrelevant mAbs were used as controls. In blocking experiments with rED-A domain 50, 150, or 300 µg of
this fragment were diluted in 1 ml of 2% gelatin (Sigma Chemical Co.)
and then coated onto 6-cm Petri dishes. Cells were then plated on precoated Petri dishes containing MEM supplemented with Monomed (Commonwealth Serum Laboratories). Cell density and culture conditions were
the same as above. Medium was removed 24 h after plating and fibroblasts
were incubated for 24 h (extraction of total RNA) or for 3 d (extraction of
proteins) in MEM plus Monomed alone or containing 10 ng/ml of TGF
1
or TGF
2.
The effects of cell adhesion on plasma and cellular FN were investigated as follows. 6-cm Petri dishes were coated with increasing concentrations of plasma FN or cellular FN (25, 50, and 100 µg/ml in PBS, pH 7.4). Proteins were allowed to bind overnight at 4°C. In some experiments the Petri dishes were rinsed and blocked for 2 h at 37°C with 3% heat-denatured BSA (RIA grade; Sigma Chemical Co.) in PBS, pH 7.4. In another set of experiments, the blocking step was omitted. Passage 5 human fibroblasts were resuspended in MEM (GIBCO AG) supplemented with Monomed (Commonwealth Serum Laboratories), 100 U/ml penicillin, 100 mg/ml streptomycin, and 2 mM L-glutamine, and then plated (1.5 × 104 cells/cm2) on Petri dishes precoated with plasma FN or cellular FN. They were maintained at 37°C in a humid atmosphere of 5% CO2 and 95% air for 1-4 d in MEM plus Monomed. All experiments were repeated at least five times and results were similar with all tested fibroblasts.
Western Blot Analysis
Cells were harvested and then extracted, or directly extracted on the dish
with a buffer containing 1% SDS (Bio-Rad Laboratories AG, Glattbrugg,
Switzerland), 1% dithiothreitol (Fluka Chemie AG, Buchs, Switzerland),
1 mM PMSF, 1 mM N
-p-tosyl-L-arginine methyl ester (Sigma Chemical Co.)
in 0.4 M Tris-HCl, pH 6.8, immediately sonicated, boiled for 5 min, and then
centrifuged at 10,000 g for 20 min (model 5415C; Eppendorf Scientific, Inc.,
Hamburg, Germany). Protein content was determined according to Bradford (1976)
. Equal amounts of total proteins (15 µg for actin analysis and 50 µg for
FN analysis) were fractionated by SDS-PAGE in acrylamide gels (5-20%
gradient for actin analysis and 6% for FN analysis) and transferred to nitrocellulose filters (0.45 µm; Schleicher & Schuell, Dassel, Germany) as previously described (Serini and Gabbiani, 1996
). Filters were then probed with
mAbs IST-9, BC-1, anti-
SM-1, or the affinity-purified rabbit polyclonal
anti-FN antibody (Sigma Chemical Co.). The secondary antibodies were
either a goat anti-mouse IgG or a goat anti-rabbit IgG both conjugated with
alkaline phosphatase (Promega Corp., Madison, WI). Specific binding was
detected by the Problot Western Blot AP system (Promega Corp.).
Northern Blot Analysis
Total RNA was isolated from cultured cells by TRI REAGENT (Molecular Research Center, Inc., Cincinnati, OH), according to the manufacturer's instructions. 25 µg of total RNA per lane were denatured by glyoxal/DMSO treatment, separated by electrophoresis on a 1% agarose gel,
and then transferred overnight onto an Electran nylon membrane (BDH,
Poole, UK). RNA was immobilized on membrane by cross-linking in a
Stratalinker UV light box (Stratagene, La Jolla, CA). To verify correct
loading and transfer, filters were stained with 0.04% methylene blue in
0.5 M Na-acetate. Filters were then processed for hybridization with three
different probes: (a) a 120-bp
-SM actin cDNA derived from the rat
-SM actin 3'-untranslated region and recognizing the human
-SM actin
mRNA in one band at 1.7 kb (prepared in our laboratory by P. Neuville
and T. Christen), (b) a 1,600-bp rat
1(I) collagen cDNA recognizing the
human
1(I) collagen mRNA in two typical bands, one at 5.8 kb and the
other one at 4.7 kb (Genovese et al., 1984
), and (c) a 600-bp bovine plasminogen activator inhibitor type 1 (PAI-1) cDNA (gift of M.S. Pepper,
Department of Morphology, University of Geneva, Switzerland) recognizing the human PAI-1 mRNA in two typical bands, one at 2.6 kb and the
other one at 3.6 kb (Cicila et al., 1989
). Probes were labeled by random
priming using the MEGAPRIME DNA labeling system RPN 1606 (Amersham, Little Chalfont, UK). Prehybridization and hybridization were
performed for 4 and 16 h, respectively, at 55°C in 5× standard saline citrate, 5× Denhardt's solution, 0.01% SDS, and 400 µg/ml denatured
salmon sperm DNA. After hybridization, filters were washed twice for 15 min at 55°C in 5× standard saline citrate and 0.1% SDS. Northern blots
were then exposed on Kodak film at
70°C (X-Omat SO-282).
Quantitation and Statistical Analysis
For quantitation, membranes and films corresponding to each Western
and Northern blot experiment were scanned with an Arcus II scanner
(Agfa, Mortsel, Belgium) and analyzed with the ImageQuant Software
Version 3.3 (Molecular Dynamics, Sunnyvale, CA) obtaining the sum of
the pixel values of band areas, as previously described (Bochaton-Piallat
et al., 1998
). Depending on the experiment, densitometric analysis results
were presented as fold increase, percentage of the corresponding control,
or percentage of induction inhibition (see Results) and expressed as arithmetical mean of all experiments performed ± SEM. For statistical evaluation, results were analyzed with Student's t test.
| |
Results |
|---|
|
|
|---|
ED-A FN Deposition Precedes
-SM Actin Expression
during Granulation Tissue Evolution
To assess the potential role of ED-A FN as an in vivo inducer of
-SM actin, first we have investigated both spatial
and temporal relationships between ED-A FN and
-SM
actin expression in a rat excisional model of wound repair.
As previously reported (ffrench-Constant et al., 1989
) ED-A
FN was not present in fibroblasts of normal dermis under
our conditions (data not shown). Fibroblastic cells containing cytoplasmic actin but not
-SM actin (Fig. 1, a and b) were abundant within the 4-d-old granulation tissue. At
this time, ED-A FN was already expressed in huge
amounts around them (Fig. 1 b). Only after this early ED-A
FN deposition did
-SM actin start accumulating, evident
around the seventh day (Fig. 1 c), and reached a maximal
peak at the twelfth day (Fig. 1 d). Hence, during wound repair ED-A FN appearance precedes
-SM actin expression by fibroblastic cells.
|
Levels of ED-A FN and
-SM Actin Expression
Are Related in Different Fibroblastic Populations;
ED-A Precedes
-SM Actin Induction by TGF
1
Although cultured fibroblastic cells from different origins
display a roughly uniform morphology, they are heterogeneous in terms of growth, gene expression, and cell behavior (for review see Sappino et al., 1990
). Indeed, when
grown in vitro, fibroblasts from diverse organs can express
different levels of
-SM actin (Desmoulière et al., 1992
;
Xu et al., 1997; Dugina et al., 1998
). Therefore, we compared the expression of ED-A FN with that of
-SM actin
in rat fibroblasts cultured from different tissues. Densitometric scanning of Western blots showed that
-SM actin content was similar in subcutaneous and dermal fibroblasts (Fig. 2) and was 11.3-fold higher in lung fibroblasts.
Quantitative changes of ED-A FN expressed by fibroblastic populations from different organs mirrored
-SM actin
expression pattern (Fig. 2), being similar in subcutaneous
and dermal fibroblasts and 6.9-fold higher in lung fibroblasts. Thus, the ability to synthesize different amounts of
ED-A FN by fibroblastic populations isolated from various tissues is proportional to their degree of myofibroblastic differentiation.
|
We have previously shown (Desmoulière et al., 1993
)
that one-week stimulation with TGF
1 (10 ng/ml) induces
a two- to threefold increase of
-SM actin expression in cultured fibroblasts. By a more precise time course analysis
(Fig. 3), we revealed a 2.3-fold increase in
-SM actin only
after 72 h of TGF
1 treatment and a plateau (2.6-fold) at
the fourth day. Similar profiles were obtained in time-
dependent increase of
-SM actin transcript (data not
shown). These data suggest that
-SM actin upregulation by TGF
1 could be the result of an indirect or synergizing
effect, mediated by one or more intermediary molecules
induced by TGF
1 itself, such as ED-A FN. Indeed, continue fibroblast stimulation with TGF
1 caused a fivefold
ED-A FN increase within the first 24 h and a further increase (6.5-fold) after 48-72 h (Fig. 3). Therefore, during
TGF
1 treatment of cultured fibroblastic cells, the rise of
ED-A FN precedes and then parallels
-SM actin increase. All together, these data are compatible with a role
for ED-A FN as intermediary between
-SM actin and its
positive regulator TGF
1.
|
TGF
1 Induction of Myofibroblastic
Phenotype Requires a Permissive ED-A FN-derived
Outside In Signaling
To directly investigate the role of ED-A FN as intermediary between
-SM actin and TGF
1, we stimulated with
TGF
1 fibroblastic cells plated on gelatin containing specific blocking mAbs raised against different type III domains of FN (Borsi et al., 1987
; Carnemolla et al., 1989
,
1992
). When examined after 72 h of TGF
1 treatment
(densitometric analysis values being expressed as percentages of the corresponding control), fibroblasts seeded on
gelatin showed the expected
-SM actin increase (217 ± 32%) compared with control cells. Plating fibroblasts on
gelatin containing IST-9, an IgG1 against the ED-A domain of cellular FN, led to a complete inhibition of
-SM
actin induction (77 ± 13%, P < 0.001), whereas neither BC-1 (an IgG1 against the ED-B containing FN isoform),
nor IST-4 (an IgG1 against the fifth type III domain of
both cellular and plasma FN) were active in this regard
(220 ± 29% and 221 ± 26%, respectively; Fig. 4). Similar
results were obtained by stimulating cells with TGF
2
(data not shown), which is as effective as TGF
1 in upregulating
-SM actin both in vivo and in vitro (Serini and Gabbiani, 1996
). The action of IST-9 was dose dependent
(50-300 µg/ml; Fig. 5). Densitometric analysis revealed
that the percentage of inhibition of
-SM actin induction
by TGF
1 was 25 ± 5% for 50 µg/ml, 59 ± 8% for 150 µg/ml,
and 96 ± 15% for 300 µg/ml. It is known that TGF
secreted and proteolytically activated by cultured fibroblasts
induces a limited myofibroblastic differentiation (Masur
et al., 1996
); seeding cells on gelatin containing only IST-9
resulted in a slight lowering of the basal
-SM actin expression levels (data not shown). As previously described
TGF
1 is able to induce the insertion within FN not only
of the ED-A, but also of the ED-B domain (Balza et al.,
1988
). Indeed, Western blot analysis revealed that treatment of fibroblasts with TGF
1 induced an increase of
both ED-A (3.5 ± 0.3-fold) and ED-B (7.3 ± 0.5-fold) FN
isoforms (Fig. 6). This, together with our blocking experiment data, further confirms the role played by ED-A FN
during myofibroblast formation.
|
|
|
We then tested whether TGF
-regulated genes other
than
-SM actin are dependent on the ED-A FN-driven
signaling. First, we selected collagen type I because its production represents a hallmark of myofibroblastic transition and a key pathogenetic event in the progression of fibrotic diseases (Border and Noble, 1994
; Zhang et al.,
1994
). Northern blot analysis revealed that as expected, IST-9 treatment inhibited the TGF
1-induced increase of
-SM actin at the mRNA level by 68 ± 12% (P < 0.001;
Fig. 7); moreover, IST-9 mAb inhibited by 95 ± 17% the
TGF
1 stimulation of collagen type I mRNA (P < 0.001;
Fig. 7). Hence, collagen type I mRNA induction by TGF
requires a functionally active ED-A domain within the cellular FN molecule, similar to
-SM actin. The next gene
analyzed was the PAI-1 which plays a crucial role both in
the regulation of extracellular matrix-degrading enzymes
and in the production of active TGF
1 (Lund et al., 1987
;
Keski-Oja et al., 1988
). Blocking the ED-A domain with
IST-9 mAb did not counteract significantly the increase of
PAI-1 mRNA level induced by TGF
1 (Fig. 7). Thus, TGF
1 regulation of PAI-1 expression differs from that of
the two main myofibroblastic markers,
-SM actin and
collagen type I.
|
To investigate whether ED-A FN is not only necessary
for TGF
1 activity on fibroblasts, but also sufficient to
cause their modulation to
-SM actin expressing myofibroblasts, cells were plated on Petri dishes precoated with
increasing amounts of ED-A-negative plasma FN or
ED-A-containing cellular FN (refer to Materials and Methods). 1-4 d after plating, no changes in
-SM actin expression were noted at any dose used (data not shown). Hence,
ED-A FN does not directly stimulate the conversion of
cultured fibroblasts to myofibroblasts. Next, we studied
the influence of soluble ED-A FN on fibroblast modulation into
-SM actin-expressing myofibroblasts. For this
purpose we used the isolated human rED-A domain (refer to Materials and Methods). Cells were plated on gelatin
containing carrier solution or rED-A domain and stimulated with TGF
1. After 72 h of TGF
1 treatment, fibroblasts seeded on gelatin-containing carrier solution
showed the usual upregulation in
-SM actin expression compared with control cells (Fig. 8). Plating fibroblasts on
gelatin-containing rED-A domain resulted in a slight decrease (15 ± 3%, P < 0.001) of
-SM actin basal expression levels and in a clear-cut inhibition (61 ± 5%, P < 0.001) of
-SM actin induction by TGF
1 (Fig. 8). The effects exerted by the rED-A domain mimicked the results
obtained using the mAb IST-9 (data not shown; refer to
Fig. 4), suggesting that these two approaches affect the
same biological mechanism. These results can be interpreted in different ways. One is that the exogenous ED-A
domain interferes with cellular FN matrix assembly. Indeed, FN matrix assembly can be disrupted using FN fragments containing critical domains (e.g., III-1 domain or
5
1-binding domain) or antibodies against these domains (McDonald, 1994
). Moreover, TGF
1 is known to
increase the assembly of FN by human fibroblasts (Allen-Hoffmann et al., 1988
). To test this hypothesis, we monitored TGF
1-induced FN matrix assembly by cultured
fibroblasts in the presence of IST-9 mAb or rED-A fragment (as described above) by means of double immunofluorescence staining, using the polyclonal FN antibody,
IST-9 mAb, or the antibody against the 6× His tag of
rED-A. As expected, TGF
1 increased the expression and
assembly of cellular FN when compared with control (Fig.
9, a and b); however, neither IST-9 mAb (Fig. 9 c) nor
rED-A (data not shown) blocked basal and TGF
1-stimulated FN matrix expression and assembly (Fig. 9, a and b).
Interestingly, whereas IST-9 mAb colocalized with FN
fibrils within the assembled matrix, rED-A did not, as revealed by a monoclonal directed against its 6× His tag
(data not shown). These results indicate that the inhibition
of the TGF
1 induction of the myofibroblastic phenotype
by IST-9 mAb and rED-A domain is not due to an inhibition or a perturbation of FN matrix assembly. Our data are
compatible with the possibility that IST-9 mAb acts by
preventing the ED-A domain to interact with a hypothetical receptor. Soluble rED-A domain would compete for
the binding of the same receptor. In any event, our results
suggest that in order to be permissive for the action of
TGF
1, the ED-A domain should be incorporated within
the assembled and polymerized FN molecule.
|
|
| |
Discussion |
|---|
|
|
|---|
TGF
1 is presently considered as the main inducer of the
myofibroblastic phenotype, being able to upregulate
-SM
actin as well as collagen expression in fibroblasts both in
vitro and in vivo (Border and Ruoslahti, 1992
; Sporn and
Roberts, 1992
; Desmoulière et al., 1993
; Rønnov-Jessen
and Petersen, 1993
; Zhang et al., 1994
). Many data point to
TGF
as a key cytokine in controlling tissue repair, and
disregulation of its production may be a cause of tissue fibrosis (Border and Ruoslahti, 1992
; Sporn and Roberts, 1992
; Border and Noble, 1994
). When compared with
other cytokines, a distinctive feature of TGF
is the ability
to control cell adhesion and migration by modulating the
adhesion molecule repertoire (Zambruno et al., 1995
) as
well as the synthesis of ECM components such as FN and
collagen (Ignotz and Massagué, 1986
; Roberts et al., 1986
).
Furthermore, expression of TGF
1 gene has been shown
to be influenced by ECM molecules (Streuli et al., 1986),
suggesting a feedback loop in vivo. However, the mechanisms by which ECM influences TGF
effects on target
cells are not yet fully characterized.
We demonstrate here that ED-A FN deposition precedes
-SM actin expression both in vivo, during granulation tissue evolution, and in vitro, during TGF
1 fibroblast stimulation. Moreover, the degree of myofibroblastic
differentiation exhibited by fibroblasts cultured from different organs is proportional to the different amounts of
ED-A FN they produce. Furthermore, selectively blocking the ED-A domain of cellular FN by IST-9 mAb inhibits
-SM actin and collagen type I mRNA induction by TGF
1
in cultured fibroblasts. In contrast, TGF
1 upregulation of
PAI-1 is not influenced by ED-A FN, indicating that the
PAI-1 gene is regulated differently than
-SM actin and
collagen type I. Interestingly, it has been shown that the
increase of collagen type I and actin mRNA induced by
TGF
1 is dependent on protein synthesis, whereas the
induction of PAI-1 transcript is not (Lund et al., 1987
;
Keski-Oja et al., 1988
; Penttinen et al., 1988
). Hence, the
synthesis of an intermediary protein such as ED-A FN is
necessary for the stimulation by TGF
1 of at least some
morphofunctional genes, i.e.,
-SM actin and collagen
type I. Thus, it appears that TGF
1 regulates gene expression through different mechanisms, possibly according to
the biological functions exerted by the corresponding proteins.
Hautmann and colleagues (1997) have identified a
TGF
response element in the
-SM actin promoter that
drives the stimulation of
-SM actin gene expression in
concert with two CArG elements in rat sn cells. We demonstrate here that, at least in fibroblastic cells, the presence of functional ED-A FN is mandatory for
-SM actin
induction by TGF
. The ED-A FN signaling is necessary
but not sufficient for
-SM actin-positive regulation by
TGF
. Taken together, these observations suggest that
TGF
activation of
-SM actin expression results from the
cooperation of two signal transduction pathways raised respectively by TGF
and ED-A FN.
The observation that treatment of fibroblasts with the
soluble rED-A domain inhibits TGF
1 induction of the
myofibroblastic phenotype without interfering with FN assembly (similar to treatment with IST-9 mAb) allows to
hypothesize the existence of an hitherto unknown specific
receptor interacting with the ED-A domain. It is worth
noting that a TGF
-dependent morphogenic process, i.e., the cellular condensation event that occurs during chondrogenesis (Leonard et al., 1991
), has been recently shown
to be spatiotemporally correlated to and to depend upon
the ED-A domain insertion in cellular FN; moreover, this
crucial step in skeletal pattern formation was similarly inhibited by the soluble rED-A domain and an anti-ED-A antibody (Gehris et al., 1997
). All together, these data suggest that the ED-A-dependent signaling described here is
a general mechanism used by TGF
to finely regulate the
correct execution of different morphogenetic programs.
Cell binding activity of FN was originally localized in the
tenth type III repeat to the amino acid sequence RGD
(Pytela et al., 1987
) and in the alternative spliced IIICS region to the amino acid sequence LDV (Humphries et al.,
1988
). The recent demonstrations that activated
1 integrins mediate cell adhesion and spreading on recombinant
FN type III repeats lacking RGD have expanded the possibility for integrin-dependent cell-ECM interactions
(Chi-Rosso et al., 1997
; Moyano et al., 1997
). Xia and Culp
(1994)
have shown that the isolated rED-A domain promotes cell adhesion, whereas Manabe et al. (1997)
have
demonstrated that cells adhere and migrate more actively
on the ED-A FN probably because ED-A induces a conformational change of FN, which in turn increases the accessibility of the RGD motif to integrin
5
1. We hypothesize that the ED-A domain interacting with its receptor
acts in conjunction with the integrin-binding sites of FN to
switch on a qualitatively different and more complex signaling. Moreover, we show here that to exert its permissive function on TGF
activity, the ED-A domain must be
presented within the proper molecular context, that is the
polymerized FN molecule; indeed isolated the rED-A domain inhibits this function. Thus, the ED-A receptor is
able to bind its domain independently of the molecular
context, but generates intracellular signals only in a conformationally sensitive manner. In this respect, two recent reports (Shrivastava et al., 1997
; Vogel et al., 1997
) outline an intriguing new paradigm for ECM signaling: the receptor tyrosine kinases DDR1 and DDR2 bind to and are activated by collagen in a conformation-dependent way. It is
proposed that signals generated by the activation of these
receptors act in concert with signals generated by binding
of ECM molecules to classical integrins. Further work
along these lines may help in identifying the hypothetical ED-A cell-surface receptor.
Unlike Jarnagin et al. (1994)
and Van De Water et al.
(Van De Water, L., C. Reimer, L. Plantefaber, R.O. Hynes,
and J.H. Peters. 1996. Abstract from Wound Repair in
Context, Keystone Symposia, Taos, NM), we were unable
to induce
-SM actin expression by simply plating cells on
ED-A-containing cellular FN. This discrepancy may be
related to the different cell types (hepatic stellate cells versus fibroblasts) or alternatively to the different sources of
FN the authors used in their assay system, e.g., endothelial cell-derived ECM and commercial FNs. Indeed, an increasing number of cytokines, including TGF
, have been
found associated with the ECM proteins and both latent
and active form of TGF
have been found to bind cellular
FN of many cell types, endothelial cells included (Taipale
and Keski-Oja, 1997
). Moreover, many commercial sources
of FN contain TGF
activity (Fava et al., 1987). Our data show that ED-A FN is necessary, but not sufficient, to induce myofibroblastic differentiation and that it exerts a
permissive effect on TGF
activity.
It is well accepted that ED-A FN is synthesized by mesenchymal cells which are driven toward an
-SM actin-
positive phenotype by TGF
in many physiological and
pathological settings, such as wound healing (Gabbiani et al.,
1972
; Darby et al., 1990
), Dupuytren's disease (Berndt et al.,
1995
), organ fibrosis (Schürch et al., 1992
), developing
aorta (Glukhova et al., 1990
), arterial intimal thickening
(Glukhova et al., 1989
), and stroma reaction to epithelial
cancers (Pujuguet et al., 1996
). Our results support that in
such different systems ED-A FN acts as a necessary ECM molecule that allows TGF
to induce SM differentiation.
Pathological deposition within tissues of ECM components results in fibrosis, which may alter irreversibly the
function of the involved organ. Recently it has been demonstrated that
-SM actin-expressing myofibroblasts are
the main collagen type I synthesizing cells during fibrosis
(Zhang et al., 1994
). Blocking TGF
1 with antibodies or
with decorin was therapeutic in many models of fibrotic disease (Border and Noble, 1994
) and, where investigated,
was associated to a significant attenuation of ED-A FN
deposition (Isaka et al., 1996
; Giri et al., 1997
). However,
extreme reduction of TGF
1 levels or mutation in its receptors could be unfavorable, causing autoimmune-like
disease (Shull et al., 1992
; Kulkarni et al., 1993
) and leading to malignant transformation (Marx, 1995
). ED-A FN
could be considered as a potential target for therapy since:
(a) it is an extracellular, easily reachable molecule; and (b)
in contrast to TGF
1, it drops to low levels in adult tissues
(Kornblihtt et al., 1996
) decreasing the probability that its
blocking results in side effects. Thus, the outside in signal described here represents another possible target for pharmacological studies on myofibroblastic activities during
developmental and pathological events. Notably, recent
studies support the feasibility of in vivo targeting alternatively spliced exons of FN present in pathological tissues
but not in their normal counterparts (Mariani et al.,
1997a
,b; Neri et al., 1997
).
| |
Footnotes |
|---|
Received for publication 1 May 1998 and in revised form 22 June 1988.
A. Roberts (National Institutes of Health, Bethesda, MD), D.A. Cox (Novartis, Basel, Switzerland), F.E. Baralle (International Centre for Genetic Engineering and Biotechnology, Trieste, Italy), and M.S. Pepper (University of Geneva, Geneva, Switzerland) are gratefully acknowledged for providing recombinant human TGF
1, recombinant human TGF
2, full-length cellular FN cDNA clone and PAI-1 cDNA probe, respectively. We
thank R.B. Low (University of Vermont, Burlington, VT) and L. Trusolino (University of Torino Medical School, Candiolo, Italy) for critically
reading this manuscript, F. Gabbiani for skillful technical assistance, J.C.
Rumbeli and E. Denkinger for photographic work, and M. Vitali for typing the manuscript (all four from University of Geneva).
| |
Abbreviations used in this paper |
|---|
ECM, extracellular matrix;
FN, fibronectin;
MEM, Eagle's minimum essential medium;
PAI-1, plasminogen activator inhibitor-1;
rED-A, recombinant ED-A;
SM, smooth muscle;
TGF
, transforming growth factor
.
| |
References |
|---|
|
|
|---|
| 1. |
Allen-Hoffmann, B.L.,
C.L. Crankshaw, and
D.F. Mosher.
1988.
Transforming
growth factor increases cell surface binding and assembly of exogenous
(plasma) fibronectin by normal human fibroblasts.
Mol. Cell. Biol.
8:
4234-4242
|
| 2. |
Balza, E.,
L. Borsi,
G. Allemmanni, and
L. Zardi.
1988.
Transforming Growth
Factor regulates the levels of different fibronectin isoforms in normal cultured fibroblasts.
FEBS (Fed. Eur. Biochem. Soc.) Lett.
228:
42-44
.
|
| 3. |
Berndt, A.,
H. Kosmehl,
U. Mandel,
U. Gabler,
X. Luo,
D. Celada,
L. Zardi, and
D. Katenkamp.
1995.
TGF and bFGF synthesis and localization in Dupuytren's disease (nodular palmar fibrosis) relative to cellular activity, myofibroblast phenotype and oncofetal variants of fibronectin.
Histochemical J.
27:
1014-1020
[Medline].
|
| 4. |
Bochaton-Piallat, M.L.,
G. Gabbiani, and
M.S. Pepper.
1998.
Plasminogen activator expression in rat arterial smooth muscle cells depends on their phenotype and is modulated by cytokines.
Circ. Res.
82:
1086-1093
|
| 5. |
Border, W.A., and
E. Ruoslahti.
1992.
Transforming growth factor- in disease:
the dark side of tissue repair.
J. Clin. Invest.
90:
1-7
.
|
| 6. |
Border, W.A., and
N.A. Noble.
1994.
Transforming growth factor- in tissue fibrosis.
N. Engl. J. Med.
331:
1286-1292
|
| 7. |
Borsi, L.,
B. Carnemolla,
P. Castellani,
C. Rossellini,
D. Vecchio,
G. Allemmanni,
S.E. Chang,
J. Taylor-Papadimitriou,
H. Pande, and
L. Zardi.
1987.
Monoclonal antibodies in the analysis of fibronectin isoforms generated by
alternative splicing of mRNA precursors in normal and transformed human
cells.
J. Cell Biol.
104:
595-600
|
| 8. |
Borsi, L.,
P. Castellani,
A.M. Risso,
A. Leprini, and
L. Zardi.
1990.
Transforming growth factor regulates the splicing pattern of fibronectin messenger
RNA precursor.
FEBS (Fed. Eur. Biochem. Soc.) Lett.
261:
175-178
.
|
| 9. | Boström, H., K. Willetts, M. Pekny, P. Levéen, P. Lindahl, H. Hedstrand, M. Pekna, M. Hellström, S. Gebre-Medhin, M. Schalling, M. Nilsson, S. Kurland, J. Törnell, J.K. Heath, and C. Betsholtz. 1996. PDGF-A signaling is a critical event in lung alveolar myofibroblast development and alveogenesis Cell. 85: 863-873 [Medline]. |
| 10. | Bradford, M.M.. 1976. A rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye-binding. Anal. Biochem. 72: 248-254 [Medline]. |
| 11. | Carnemolla, B., L. Borsi, L. Zardi, R.J. Owens, and F.E. Baralle. 1987. Localization of the cellular-fibronectin-specific epitope recognized by the monoclonal antibody IST-9 using fusion proteins expressed in E. Coli. FEBS (Fed. Eur. Biochem. Soc.) Lett. 215: 269-273 . |
| 12. |
Carnemolla, B.,
E. Balza,
A. Siri,
L. Zardi,
M.R. Nicotra,
A. Bigotti, and
P.G. Natali.
1989.
A tumor-associated fibronectin isoform generated by alternative splicing of messenger RNA precursors.
J. Cell Biol.
108:
1139-1148
|
| 13. | Carnemolla, B., L. Borsi, L. Zardi, R.J. Owens, and F.E. Baralle. 1987. Localization of the cellular-fibronectin-specific epitope recognized by the monoclonal antibody IST-9 using fusion proteins expressed in E. Coli. FEBS (Fed. Eur. Biochem. Soc.) Lett. 215: 269-273 . |
| 14. |
Carnemolla, B.,
A. Leprini,
G. Allemanni,
M. Saginati, and
L. Zardi.
1992.
The
inclusion of the type III repeat ED-B in the fibronectin molecule generates
conformational modification that unmask a cryptic sequence
J. Biol. Chem.
267:
24689-24692
|
| 15. |
Chi-Rosso, G.,
P.J. Gotwals,
J. Yang,
L. Ling,
K. Jiang,
B. Chao,
D.P. Baker,
L.C. Burkly,
S.E. Fawell, and
V.E. Koteliansky.
1997.
Fibronectin type III
repeats mediate RGD-independent adhesion and signaling through activated 1 integrins.
J. Biol. Chem.
272:
31447-31452
|
| 16. |
Cicila, G.T.,
T.M. O'Connell,
W.C. Hahn, and
J.G. Rheinwald.
1989.
Cloned
cDNA sequence for the human mesothelial protein `mesosecrin' discloses its
identity as a plasminogen activator inhibitor (PAI-1) and a recent evolutionary change in transcript processing.
J. Cell Sci.
94:
1-10
|
| 17. |
Clarke, E.A., and
J.S. Brugge.
1995.
Integrins and signal transduction pathways:
the road taken.
Science.
268:
233-239
|
| 18. | Darby, I., O. Skalli, and G. Gabbiani. 1990. Alpha-smooth muscle actin is transiently expressed by myofibroblasts during experimental wound healing. Lab. Invest. 63: 21-29 [Medline]. |
| 19. | Desmoulière, A., L. Rubbia-Brandt, A. Abdiu, T. Walz, A. Macieira-Coelho, and G. Gabbiani. 1992. Alpha-smooth muscle actin is expressed in a subpopulation of cultured and cloned fibroblasts and is modulated by gamma-interferon. Exp. Cell Res. 201: 64-73 [Medline]. |
| 20. |
Desmoulière, A.,
A. Geinoz,
F. Gabbiani, and
G. Gabbiani.
1993.
Transforming
growth factor- 1 induces -smooth muscle actin expression in granulation
tissue myofibroblasts and in quiescent and growing cultured fibroblasts.
J.
Cell Biol.
122:
103-111
|
| 21. | Desmoulière, A., and G. Gabbiani. 1996. The role of the myofibroblast in wound healing and fibrocontractive diseases. In The Molecular and Cellular Biology of Wound Repair. R.A.F. Clark, editor. Plenum Press, New York. 391-423. |
| 22. | Dugina, V., A. Alexandrova, C. Chaponnier, J. Vasiliev, and G. Gabbiani. 1998. Rat fibroblasts cultured from various organs exhibit differences in alpha-smooth muscle actin expression, cytoskeletal pattern, and adhesive structure organization. Exp. Cell Res. 238: 481-490 [Medline]. |
| 23. | Fava, R.A., and D.B. McClure. 1987. Fibronectin-associated transforming growth factor. J. Cell Physiol. 131: 184-189 [Medline]. |
| 24. |
ffrench-Constant, C.,
L. Van De Water,
H.F. Dvorak, and
R.O. Hynes.
1989.
Reappearance of an embryonic of fibronectin splicing during wound healing
in the adult rat.
J. Cell Biol.
109:
903-914
|
| 25. | Gabbiani, G., B.J. Hirschel, G.B. Ryan, P.R. Statkov, and G. Majno. 1972. Granulation tissue as contractile organ. A study of structure and function. J. Exp. Med. 135: 719-734 [Abstract]. |
| 26. | Gehris, A.L., E. Stringa, J. Spina, M.E. Desmond, R.S. Tuan, and V.D. Bennett. 1997. The region encoded by the alternatively spliced exon IIIA in mesenchymal fibronectin appears essential for chondrogenesis at the level of cellular condensation. Dev. Biol. 190: 191-205 [Medline]. |
| 27. | Genovese, C., D. Rowe, and B. Kream. 1984. Construction of DNA sequences complementary to rat alpha 1 and alpha 2 collagen mRNA and their use in studying the regulation of type I collagen synthesis by 1,25-dihydroxyvitamin D. Biochemistry. 23: 6210-6216 [Medline]. |
| 28. | Giri, S.N., D.M. Hyde, R.K. Braun, W. Gaarde, J.R. Harper, and M.D. Pierschbacher. 1997. Antifibrotic effect of decorin in a bleomycin hamster model of lung fibrosis. Biochem. Pharmacol. 54: 1205-1216 [Medline]. |
| 29. |
Glukhova, M.A.,
M.G. Frid,
B.V. Shekhonin,
T.D. Vasilevskaya,
J. Grunwald,
M. Saginati, and
V.E. Koteliansky.
1989.
Expression of extra domain-A fibronectin sequence in vascular smooth muscle cells is phenotype dependent
J. Cell Biol.
109:
357-366
|
| 30. | Glukhova, M.A., M.G. Frid, B.V. Shekhonin, Y.V. Balabanov, and V.E. Koteliansky. 1990. Expression of fibronectin variants in vascular and visceral smooth muscle cells in development. Dev. Biol. 141: 193-202 [Medline]. |
| 31. |
Grinnell, F..
1994.
Fibroblasts, myofibroblasts, and wound contraction.
J. Cell
Biol.
124:
401-404
|
| 32. |
Hautmann, M.B.,
C.S. Madsen, and
G.K. Owens.
1997.
A transforming growth
factor (TGF ) control element drives TGF -induced stimulation of
smooth muscle -actin gene expression in concert with two CArG elements.
J. Biol. Chem.
272:
10948-10956
|
| 33. |
Heldin, C.H.,
K. Miyazono, and
P. ten Dijke.
1997.
TGF signalling from cell
membrane to nucleus through SMAD proteins.
Nature.
390:
465-471
[Medline].
|
| 34. |
Humphries, M.J.,
S.K. Akiyama,
A. Komoriya,
K. Olden, and
K.M. Yamada.
1988.
Neurite extension of chicken peripheral nervous system neurons on fibronectin: relative importance of specific adhesion sites in the central cell-binding domain and the alternatively spliced type III connecting segment.
J.
Cell Biol.
106:
1289-1297
|
| 35. | Hynes, R.O. 1990. Fibronectins. In Springer's Series in Molecular Biology. A. Rich, editor. Springer-Verlag, Inc., New York. 546 pp. |
| 36. |
Ignotz, R.A., and
J. Massagué.
1986.
Transforming growth factor- stimulates
the expression of fibronectin and collagen and their incorporation into the
extracellular matrix.
J. Biol. Chem.
261:
4337-4345
|
| 37. | Isaka, Y., D.K. Brees, K. Ikegaya, Y. Kaneda, E. Imai, N.A. Noble, and W.A. Border. 1996. Gene therapy by skeletal muscle expression of decorin prevents fibrotic disease in rat kidney. Nature Med. 2: 418-423 [Medline]. |
| 38. |
Jarnagin, W.R.,
D.C. Rockey,
V.E Koteliansky,
S.S. Wang, and
D.M. Bissell.
1994.
Expression of variant fibronectin in wound healing: cellular source and
biological activity of the EIIIA fibronectin segment in rat hepatic fibrogenesis.
J. Cell Biol.
127:
2037-2048
|
| 39. |
Keski-Oja, J.,
R. Raghow,
M. Sawdey,
D.J. Loskutoff,
A.E. Postlethwaite,
A.H. Kang, and
H.L. Moses.
1988.
Regulation of mRNAs for type-1 plasminogen
activator inhibitor, fibronectin, and type I procollagen by transforming
growth factor-beta. Divergent responses in lung fibroblasts and carcinoma
cells.
J. Biol. Chem.
263:
3111-3115
|
| 40. |
Kingsley, D.M..
1994.
The TGF- superfamily: new members, new receptors,
and new genetic tests of function in different organisms.
Genes Dev.
8:
133-146
|
| 41. | Kocher, O., S.P. Kennedy, and J.A. Madri. 1990. Alternative splicing of endothelial cell fibronectin mRNA in the IIICS region. Am. J. Pathol. 137: 1509-1524 [Abstract]. |
| 42. |
Kornblihtt, A.R.,
K. Vibe-Pedersen, and
F.E. Baralle.
1984.
Human fibronectin: cell specific alternative mRNA splicing generates polypeptide chains differing in the number of internal repeats.
Nucleic Acids Res.
12:
5853-5868
|
| 43. | Kornblihtt, A.R., C.G. Pesce, C.R. Alonso, P. Cramer, A. Srebrow, S. Werbajh, and A.F. Muro. 1996. The fibronectin gene as a model for splicing and transcription studies. FASEB (Fed. Am. Soc. Exp. Biol.) J. 10: 248-257 [Abstract]. |
| 44. | Kosmehl, H., A. Berndt, and D. Katenkamp. 1996. Molecular variants of fibronectin and laminin: structure, physiological occurrence and histopathological aspects. Virchows Arch. 429: 311-322 [Medline]. |
| 45. |
Kulkarni, A.B.,
C.G. Huh,
D. Becker,
M. Lyght,
K.C. Flanders,
A.B. Roberts,
M.B. Sporn,
J.M. Ward, and
S. Karlsson.
1993.
Transforming growth factor
1 null mutation causes excessive inflammatory response and early death.
Proc. Natl. Acad. Sci. USA.
90:
770-774
|
| 46. | Kurkinen, M., A. Vaheri, P.J. Roberts, and S. Stenman. 1980. Sequential appearance of fibronectin and collagen in experimental granulation tissue. Lab. Invest. 43: 47-51 [Medline]. |
| 47. |
Leonard, C.M.,
H.M. Fuld,
D.A. Frenz,
S.A. Downie,
J. Massague, and
S.A. Newman.
1991.
Role of transforming growth factor-beta in chondrogenic
pattern formation in the embryonic limb: stimulation of mesenchymal condensation and fibronectin gene expression by exogenenous TGF- and evidence for endogenous TGF- -like activity.
Dev. Biol.
145:
99-109
[Medline].
|
| 48. |
Lund, L.R.,
A. Riccio,
P.A. Andreasen,
L.S. Nielsen,
P. Kristensen,
M. Laiho,
O. Saksela,
F. Blasi, and
K. Dano.
1987.
Transforming growth factor- is a
strong and fast acting positive regulator of the level of type-1 plasminogen
activator inhibitor mRNA in WI-38 human lung fibroblasts.
EMBO (Eur.
Mol. Biol. Organ.) J.
6:
1281-1286
[Medline].
|
| 49. |
MacLeod, J.N.,
N. Burton-Wurster,
D.N. Gu, and
G. Lust.
1996.
Fibronectin
mRNA splice variant in articular cartilage lacks bases encoding the V, III-15,
and I-10 protein segments.
J. Biol. Chem.
271:
18954-18960
|
| 50. |
Manabe, R.,
N. Oh-e,
T. Maeda,
T. Fukuda, and
K. Sekiguchi.
1997.
Modulation of cell-adhesive activity of fibronectin by the alternatively spliced EDA
segment.
J. Cell Biol.
139:
295-307
|
| 51. | Mariani, G., A. Lasku, E. Balza, B. Gaggero, C. Motta, L. Di Luca, A. Dorcaratto, G.A. Viale, D. Neri, and L. Zardi. 1997a. Tumor targeting potential of the monoclonal antibody BC-1 against oncofetal fibronectin in nude mice bearing human tumor implants. Cancer. 80: 2378-2384 [Medline]. |
| 52. | Mariani, G., A. Lasku, A. Pau, G. Villa, C. Motta, G. Calcagno, G.Z. Taddei, P. Castellani, K. Syrigos, A. Dorcaratto, A.A. Epenetos, L. Zardi, and G.A. Viale. 1997b. A pilot pharmacokinetic and immunoscintigraphic study with the technetium-99m-labeled monoclonal antibody BC-1 directed against oncofetal fibronectin in patients with brain tumors. Cancer. 80: 2484-2489 [Medline]. |
| 53. |
Marx, J..
1995.
DNA repair defect tied to mutated TGF- receptor gene.
Science.
268:
1276-1277
|
| 54. |
Massagué, J.,
A. Hata, and
F. Liu.
1997.
TGF- signalling through the Smad
pathway.
Trends Cell Biol.
7:
187-192
.
|
| 55. |
Masur, S.K.,
H.S. Dewal,
T.T. Dinh,
I. Erenburg, and
S. Petridou.
1996.
Myofibroblasts differentiate from fibroblasts when plated at low density.
Proc.
Natl. Acad. Sci. USA.
93:
4219-4223
|
| 56. | McDonald, J.A.. 1994. Extracellular matrix assembly. Methods Enzymol. 245: 518-531 [Medline]. |
| 57. |
Moyano, J.V.,
B. Carnemolla,
C. Dominguez-Jimenez,
M. Garcia-Gila,
J.P. Albar,
P. Sanchez-Aparicio,
A. Leprini,
G. Querze,
L. Zardi, and
A. Garcia-Pardo.
1997.
Fibronectin type III5 repeat contains a novel cell adhesion sequence, KLDAPT, which binds activated 4 1 and 4 7 integrins.
J. Biol.
Chem.
272:
24832-24836
|
| 58. | Neri, D., B. Carnemolla, A. Nissim, A. Leprini, G. Querze, E. Balza, A. Pini, L. Tarli, C. Halin, P. Neri, L. Zardi, and G. Winter. 1997. Targeting by affinity-matured recombinant antibody fragments of an angiogenesis associated fibronectin isoform. Nat. Biotechnol. 15: 1271-1275 . [Medline] |
| 59. |
Penttinen, R.P.,
S. Kobayashi, and
P. Bornstein.
1988.
Transforming growth factor
increases mRNA for matrix proteins both in the presence and in the absence
of changes in mRNA stability.
Proc. Natl. Acad. Sci. USA.
85:
1105-1108
|
| 60. | Pujuguet, P., A. Hammann, M. Moutet, J.L. Samuel, F. Martin, and M. Martin. 1996. Expression of fibronectin ED-A+ and ED-B+ isoforms by human and experimental colorectal cancer. Am. J. Pathol. 148: 579-592 [Abstract]. |
| 61. | Pytela, R., M.D. Pierschbacher, W.S. Argrves, S. Suzuki, and E. Ruoslahti. 1987. Arg-Gly-Asp adhesion receptors. Methods Enzymol. 144: 475-489 [Medline]. |
| 62. |
Roberts, A.B.,
M.B. Sporn,
A.K. Assoian,
J.M. Smith,
N.S. Roche,
L.M. Wakefield,
U.I. Heine,
L.A. Liotta,
V. Falanga,
J.H. Kehrl, and
A.S. Fauci.
1986.
Transforming growth factor type- : rapid induction of fibrosis and angiogenesis in vivo and stimulation of collagen formation in vitro.
Proc. Natl. Acad.
Sci. USA.
83:
4167-4171
|
| 63. |
Roberts, A.B., and
M.B. Sporn.
1993.
Physiological actions and clinical applications of transforming growth factor (TGF ).
Growth Factors.
8:
1-9
[Medline].
|
| 64. |
Rønnov-Jessen, L., and
O.W. Petersen.
1993.
Induction of -smooth muscle actin by transforming growth factor- 1 in quiescent human breast gland fibroblasts. Implications for myofibroblast generation in breast neoplasia.
Lab.
Invest.
68:
696-707
[Medline].
|
| 65. |
Rønnov-Jessen, L.,
O.W. Petersen, and
M.J. Bissell.
1996.
Cellular changes involved in conversion of normal to malignant breast: importance of the stromal reaction.
Physiol. Rev.
76:
69-125
|
| 66. | Sappino, A.P., W. Schurch, and G. Gabbiani. 1990. Differentiation repertoire of fibroblastic cells: expression of cytoskeletal proteins as marker of phenotypic modulations. Lab. Invest. 63: 144-161 [Medline]. |
| 67. | Schlaepfer, D.D., and T. Hunter. 1998. Integrin signalling and tyrosine phosphorylation: just the FAKs? Trends Cell Biol. 8: 151-157 . [Medline] |
| 68. |
Schwartz, M.A..
1997.
Integrins, oncogenes, and anchorage independence.
J.
Cell Biol.
139:
575-578
|
| 69. | Schürch, W., T.A. Seemayer, and G. Gabbiani. 1992. Myofibroblast. In Histology for Pathologists. S.S. Sternberg, editor. Raven Press, New York. 109-144. |
| 70. |
Serini, G., and
G. Gabbiani.
1996.
Modulation of -smooth muscle actin expression in fibroblasts by transforming growth factor- isoforms: an in vivo and
in vitro study.
Wound. Rep. Reg.
4:
278-287
.
[Medline] |
| 71. | Shrivastava, A., C. Radziejewski, E. Campbell, L. Kovac, M. McGlynn, T.E. Ryan, S. Davis, M.P. Goldfarb, D.J. Glass, G. Lemke, and G.D. Yancopoulos. 1997. An orphan receptor tyrosine kinase family whose members serve as nonintegrin collagen receptors. Mol. Cell. 1: 25-34 . [Medline] |
| 72. |
Shull, M.M.,
I. Ormsby,
A.B. Kier,
S. Pawlowski,
D.J. Diebold,
M. Yin,
R. Allen,
C. Sidman,
G. Proetzel,
D. Calvin,
N. Annunziata, and
T. Doetschman.
1992.
Targeted disruption of the mouse transforming growth factor- 1 gene results in multifocal inflammatory disease.
Nature.
359:
693-699
[Medline].
|
| 73. |
Skalli, O.,
P. Ropraz,
A. Trzeciak,
G. Benzonana,
D. Gillessen, and
G. Gabbiani.
1986.
A monoclonal antibody against -smooth muscle actin: a new
probe for smooth muscle differentiation.
J Cell. Biol.
103:
2787-2796
|
| 74. |
Soriano, P..
1994.
Abnormal kidney development and hematological disorders
in PDGF -receptor mutant mice.
Genes Dev.
8:
1888-1896
|
| 75. |
Sporn, M.B., and
A.B. Roberts.
1992.
Transforming growth factor : recent
progress and new challenges.
J. Cell Biol.
119:
1017-1021
|
| 76. |
Streuli, C.H.,
C. Schmidhauser,
M. Kobrin,
M.J. Bissel, and
R. Derynck.
1993.
Extracellular matrix regulates expression of the TGF 1 gene.
J. Cell Biol.
120:
253-260
|
| 77. | Taipale, J., and J. Keski-Oja. 1997. Growth factors in the extracellular matrix. FASEB (Fed. Am. Soc. Exp. Biol.)J. 11: 51-59 [Abstract]. |
| 78. | Vogel, W., G.D. Gish, F. Alves, and T. Pawson. 1997. The discoidin domain receptor tyrosine kinases are activated by collagen. Mol. Cell. 1: 13-23 . [Medline] |
| 79. | Xia, P., and L.A. Culp. 1994. Adhesion activity in fibronectin's alternatively spliced domain ED-A (EIIIA) and its neighboring type III repeats: oncogene-dependent regulation. Exp. Cell Res. 213: 253-265 [Medline]. |
| 80. | Xu, G., M. Redard, G. Gabbiani, P. Neuville. Cellular retinol-binding protein-1 is transiently expressed in granulation tissue fibroblasts and differentially expressed in fibroblasts cultured from different organs. Am. J. Pathol. 151: 1741-1749. |
| 81. |
Zambruno, G.,
P.C. Marchisio,
A. Marconi,
C. Vaschieri,
A. Melchiori,
A. Giannetti, and
M. De Luca.
1995.
Transforming growth factor- 1 modulates 1 and
5 integrin receptors and induces de novo expression v 6 heterodimer in
normal keratinocytes: implication for wound healing.
J. Cell Biol.
129:
853-865
|
| 82. | Zardi, L., A. Siri, B. Carnemolla, E. Cosulich, G. Viale, and L. Santi. 1980. A simplified procedure for the preparation of antibodies to serum fibronectin. J. Immunol. Methods 34: 155-165 [Medline]. |
| 83. | Zhang, K., M.D. Rekhter, D. Gordon, and S.H. Phan. 1994. Myofibroblasts and their role in lung collagen gene expression during pulmonary fibrosis. A combined immunohistochemical and in situ hybridization study. Am J. Pathol. 145: 114-125 [Abstract]. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|