|
||

* Howard Hughes Medical Institute and Department of Cell Biology, Duke University Medical Center, Durham, North Carolina
27710;
Department of Cell Biology, University of Massachusetts Medical School, Worcester, Massachusetts 01545; and § Department of Physiology, University of Minnesota Medical School, Minneapolis, Minnesota 55455
| |
Abstract |
|---|
|
|
|---|
Voltage-gated sodium channels (NaCh) are colocalized with isoforms of the membrane-skeletal protein ankyrinG at axon initial segments, nodes of Ranvier, and postsynaptic folds of the mammalian neuromuscular junction. The role of ankyrinG in directing NaCh localization to axon initial segments was evaluated by region-specific knockout of ankyrinG in the mouse cerebellum. Mutant mice exhibited a progressive ataxia beginning around postnatal day P16 and subsequent loss of Purkinje neurons. In mutant mouse cerebella, NaCh were absent from axon initial segments of granule cell neurons, and Purkinje cells showed deficiencies in their ability to initiate action potentials and support rapid, repetitive firing. Neurofascin, a member of the L1CAM family of ankyrin-binding cell adhesion molecules, also exhibited impaired localization to initial segments of Purkinje cell neurons. These results demonstrate that ankyrinG is essential for clustering NaCh and neurofascin at axon initial segments and is required for physiological levels of sodium channel activity.
Key words: ankyrinG; sodium channel; neurofascin; clustering; action potential| |
Introduction |
|---|
|
|
|---|
CLUSTERING of voltage-gated sodium channels (NaCh)1 at axon initial segments, nodes of Ranvier, and postsynaptic folds of the neuromuscular junction is vital for generating sufficient local current to overwhelm membrane capacitance and resistance, and to initiate and propagate a self-regenerating action potential. Understanding the mechanisms for formation and maintenance of these NaCh-enriched domains represents a challenge with important implications for the physiology of excitable membranes as well as general issues of cell polarity and membrane structure.
Initial clues regarding possible molecular neighbors of
the NaCh that could determine membrane localization
came from observations that the NaCh copurified with the
membrane skeletal protein ankyrin and associated with
ankyrin in in vitro assays (Srinivasan et al., 1988
). Ankyrin
subsequently was localized at axon initial segments and
nodes of Ranvier (Kordeli et al., 1990
; Kordeli and Bennett, 1991
), sites where the existence of a high density of NaCh has been well documented (Catterall, 1981
; Ellisman and Levinson, 1982
; Wollner and Catterall, 1986
).
Ankyrin also was localized to the NaCh-enriched regions
of the neuromuscular junction (Flucher and Daniels,
1989
). The isoforms of ankyrin localized at nodes of Ranvier, and axon initial segments have been identified as 480- and 270-kD alternatively spliced variants of ankyrinG
(Kordeli et al., 1995
). AnkyrinG is present in the postsynaptic folds of the neuromuscular junction (Kordeli et al.,
1998
; Wood and Slater, 1998
) and is associated with NaCh
at early stages in morphogenesis of the node of Ranvier
(Lambert et al., 1997
). AnkyrinG also is associated with
NaCh clusters in the dystrophic mouse in regions lacking
myelination (Deerinck et al., 1997
), as well as clusters of
NaCh induced in cultured retinal ganglion neurons
(Kaplan et al., 1997
). Together, these results provide circumstantial evidence for a role of ankyrinG in the clustering of NaCh to specific membrane regions.
The ankyrins are a family of spectrin-binding proteins
associated with the cytoplasmic surface of the plasma
membrane in many cell types. Ankyrins associate via their
membrane-binding domains with several ion channels in
addition to the voltage-gated Na channel, as well as calcium release channels and the L1CAM family of cell adhesion molecules (Bennett et al., 1997
). The nodal/initial segment ankyrinG isoforms are distinguished by a serine/
threonine-rich domain glycosylated with O-GlucNAc residues (Zhang and Bennett, 1996
) and also contain an
extended tail domain (Chan et al., 1993
; Kordeli et al.,
1995
). The membrane-binding domain of ankyrins contains four subdomains, each composed of six ankyrin repeats (Michaely and Bennett, 1993
). Biochemical studies
(Michaely and Bennett, 1995a
,b) suggest that ankyrin is
multivalent and could form lateral homo- and/or heterocomplexes between integral membrane proteins.
Isoforms of neurofascin and NrCAM, members of the
L1CAM family of ankyrin-binding cell adhesion molecules (Hortsch, 1996
), are colocalized with ankyrinG at the
nodes of Ranvier in peripheral nerve and axon initial segments of Purkinje cell neurons (Davis et al., 1993
, 1996
).
Clustering of neurofascin and NrCAM precedes redistribution of ankyrinG 480/270 kD and the NaCh during development of the node of Ranvier, which has prompted
the hypothesis that these cell adhesion molecules may define the initial site for subsequent assembly of ankyrinG
and the NaCh (Lambert et al., 1997
).
This study evaluates the cellular and physiological consequences of the knockout of a cerebellar isoform of ankyrinG in mice. In this mutant mouse, we studied the targeting of neurofascin and NaCh and the firing properties of Purkinje cells in cerebellar slices. Immunofluorescence evidence suggests that NaCh are absent from axon initial segments of granule cells of mutant mice. In addition, Purkinje cells demonstrate severe deficits in action potential firing in response to somatic current injection, suggesting a reduced density or impaired localization of NaCh in mice lacking cerebellar ankyrinG. Neurofascin also exhibited impaired targeting to initial segments of Purkinje cell neurons. Together, these results provide direct evidence for an essential physiological role of ankyrinG in the normal function of NaCh as well as targeting of NaCh and a companion cell adhesion molecule to axon initial segments.
| |
Materials and Methods |
|---|
|
|
|---|
Targeted Disruption of Exon1b Locus
A 14-kb genomic DNA covering exon1b and upstream promoter sequence was isolated from a mouse 129SvEV genomic library (Stratagene, La Jolla, CA) and subcloned into pBS vector (Stratagene). A Neo gene flanked with SpeI and ApaI sites was inserted into the SmaI site. The resulting DNA was ligated with the tk gene and subcloned into pGEM11Z (Promega Corp., Madison, WI), linearized with NotI, and electroporated into an R1 ES cell line. Among 200 clones selected by G418 (200 µg/ml) and ganciclovir (2 µM), six positive clones were identified by Southern blot. They were expanded and injected into blastocysts. Male chimeras were bred to C57BL/6J to generate F1 offsprings. Heterozygous F1 mice were bred to generate the homozygous mutant mice. The exon1b-null (mutant) mice were confirmed by standard Northern, Southern, and Western blots. To reduce the variability of the mutant mouse phenotypes caused by different genetic backgrounds, the mutant mice and their littermates were kept at 50% C57Bl/6 and 50% Sv129 genetic background. All of the six founders from six independent ES cells gave rise to mutant mice with a similar phenotype.
Northern, Southern, and Western Blots
Northern blots were performed as described (Kordeli et al., 1995
). The
multiple tissue blot was purchased from CLONTECH Laboratories, Inc.
(Palo Alto, CA). The blot shown in Fig. 2 was run according to the glyoxal/DMSO method outlined in Sambrook et al. (1989)
. The exon1b,
exon1e, and spectrin-binding domain (common) probes were generated
by PCR using the following primers: exon1e, sense, 5'GAATTCGGGCCGCTCGAC3', antisense, 5'GAATTCTTTTTTCCCTTTCCTCTT3'; exon1b, sense, 5'TGAGATCTGGCCCCTGCT3', antisense, 5'GACCGTTTGCGGTGTTT3'; common region probe, sense, 5'GTGAACCTGGTCTCAAGC3', antisense, 5'GCATATCAGCTCTCTGTA3'. The
blots were hybridized with the exon1b probe first and then stripped and
rehybridized with exon1e probe. The blot was stripped again and hybridized with a probe common to all the isoforms. The results were obtained
by 1-d exposure. After each strip, the blot was exposed for at least 2 d to
confirm the complete removal of the previous signal. Tail DNA was isolated for standard Southern blot as described (Sambrook et al., 1989
). The
Western blot procedure was as described previously (Lambert et al.,
1997
).
|
|
In Situ Hybridization
Whole brains from control or mutant mice were frozen on a piece of luminal foil on powdered dry ice and then processed for cryosectioning. The sections (15 µm) were collected on poly-L-lysine-coated slides and air-dried. After fixation in ice-cold 4% paraformaldehyde, the sections were stored in 95% ETOH at 4°C. The sections were prehybridized in "minilist" solution (50% formamide, 4× SSC, 10% dextran sulfate) and then hybridized overnight with 100 µl of minilist solution containing 50 pg of 33P-labeled probes per section at 42°C. The probes were synthetic 45-mer oligomers: exon1e, 5'CCT TGG GTA CCT CTA ATC AGG CAT AGG GCA GCA TAG CCC TCG CAG3'; exon1b, 5'CTT TCC TTG AGA TCA GGG GAG TTG AGA CGA GAC AGA AGA TCA CCT3'. They were freshly labeled before use with a tailing kit (Boehringer Mannheim Corp., Indianapolis, IN). The sections were then washed with 1× SSC at 60°C, dried, and exposed to Kodak XAR-5 film (Rochester, NY).
Immunocytochemistry
The immunofluorescence labeling was performed according to published
procedures (Lambert et al., 1997
). Polyclonal anti-sodium channel, neurofascin, and NrCAM antibodies were described elsewhere (Davis et al.,
1996
; Lambert et al., 1997
). A polyclonal anti-type II sodium channel
from Upstate Biotechnology (Lake Placid, NY) was used with similar results (data not shown). In addition, the following sodium channel antibodies were used: a polyclonal antibody against loopII of sodium channel and
a polyclonal antibody against the common epitope (TEEQKKYYNAMKKLGSKK) of type I and II NaCh generated in this laboratory, and
two type I NaCh-specific antibodies, two type II NaCh-specific antibodies, and two type I/type II shared epitope (same sequence as above) antibodies purchased from Upstate Biotechnology and Alomone Labs (Jerusalem, Israel), including the antisera originally designated anti-SP19
(Gordon et al., 1988
). Chicken anti-ankyrinG antibody is described elsewhere (Zhang and Bennett, 1996
). Monoclonal anticalbindin antibody was
purchased from Boehringer Mannheim Corp. Monoclonal antineurofilament antibody NN18 was from Sigma Chemical Co. (St. Louis, MO).
Electrophysiology
Parasagittal slices of cerebellar vermis were prepared from mice using
standard techniques (Edwards, 1995
). Mice (postnatal day [P]24-33) were
anesthetized by inhalation of methoxyflurane and decapitated. The brain
was immediately removed and immersed in ice-cold oxygenated artificial
cerebrospinal fluid (O2-ACSF) containing (in mM) 125 NaCl, 2.5 KCl, 2 CaCl2, 1 MgCl2, 1.25 NaH2PO4, 26 NaHCO3, 25 glucose, pH 7.4. Using a
vibratome, 300-µm parasagittal slices were cut and incubated for 1 h before experimentation in O2-ACSF at an elevated temperature (31-32°C),
after which the bath was allowed to cool to room temperature (~22-
23°C).
Whole-cell patch clamp recordings were performed using minor modifications of standard methods (Konnerth et al., 1990
). A cerebellar slice
was submerged in a recording chamber and held in place under a grid of
nylon threads glued to a U-shaped platinum frame. The slice was perfused
with room temperature O2-ACSF (with 10 µM bicuculline added) at 1-2
ml/min, and Purkinje cells were visually identified with a 40× ceramic-coated water immersion objective. Recordings in the current clamp mode
were made using a patch pipette (1.6-2.6 M
) filled through the tip with
(in mM) 140 KCl, 8 NaCl, 10 Hepes, 0.5 EGTA and backfilled with the addition of 4 MgATP, 0.3 TrisGTP. Using a Dagan 3900 amplifier equipped with a 3911A Whole Cell Expander, data were filtered at 5 kHz and acquired (3.3-50 kHz) using pCLAMP software (Axon Instruments, Inc.,
Foster City, CA).
| |
Results |
|---|
|
|
|---|
Cerebellum-specific Knockout of AnkyrinG in Mouse Brain
AnkyrinG cDNAs isolated from human brain (Kordeli et
al., 1995
) and mouse kidney (Peters et al., 1995
) have distinct NH2-terminal amino acid sequences immediately
preceding the ankyrin repeats (Fig. 1 A). A cDNA isolated
from rat brain has an NH2-terminal sequence nearly identical to that of the isoform isolated from mouse kidney
(Fig. 1 A). These considerations combined with genomic sequence data suggested the possibility of two classes of
ankyrinG transcripts, each with distinct promoter elements
(data not shown). Northern blot analysis confirmed that
one exon (exon1b) is expressed only in mouse brain, while
the other exon (exon1e) is expressed in brain as well as
heart, skeletal muscle, and kidney (Fig. 1 B, left and middle). AnkyrinG transcripts from lung and some isoforms in
heart and kidney did not hybridize with exon1b or exon1e,
suggesting the existence of a third set of transcripts and
possibly an additional promoter (Fig. 1 B, right).
In situ hybridization using probes specific to exon1b and exon1e revealed selective expression of the two exons in adult mouse brain (Fig. 1 C). Exon1e-containing ankyrinG transcripts are expressed throughout the frontal brain with elevated levels in hippocampus, caudate putamen, and frontal cortex. Exon1b, in contrast, is most strongly expressed in cerebellum, but it is also detectable in the brain stem and thalamus at low levels. Developmental patterns of expression of these transcripts have not yet been examined.
The selective expression of exon1b in the cerebellum
suggested a strategy for targeted gene disruption resulting
in preferential loss of cerebellar ankyrinG, while maintaining ankyrinG expression in other tissues as well as other regions of the nervous system. We produced mutant mice
with a neomycin gene incorporated in reverse orientation
into the brain-specific exon1b by homologous recombination (Fig. 2 A). The success of the targeted disruption was
confirmed by Southern blot (Fig. 2 B). The specific knockout of exon1b-containing ankyrinG transcripts in homozygous mutant mice was confirmed by Northern blot with
probes specific for exon1b and exon1e (Fig. 2 C). No
exon1b-containing transcripts were detected in the mutant mice, whereas the level of expression of exon1e-containing
transcripts was unaffected (Fig. 2 C, middle). In situ hybridization performed on mutant mouse brain sections revealed no compensation of the exon1e-containing ankyrinG transcripts in cerebellum, while exon1b-containing ankyrinG transcripts were undetectable (data not shown).
Immunoblots using an antibody to the tail domain of ankyrinG (anti-270/480 ankyrinG; Zhang and Bennett, 1996
),
which recognizes proteins derived from both classes of
transcripts, revealed almost complete absence of ankyrinG
protein in cerebellum of the mutant mouse (Fig. 2 D).
Similar data were obtained using an antibody to the spectrin-binding domain of ankyrinG (data not shown). The
mutant mouse forebrain exhibited only a moderate reduction of ankyrinG, suggesting that the alternative, exon1e-containing isoforms are normally expressed in forebrain.
The region-specific knockout of ankyrinG was further confirmed by immunofluorescence labeling (Fig. 3). AnkyrinG was almost completely missing in mutant mouse cerebellum (Fig. 3 A). Some ankyrinG immunoreactivity in the white matter of mutant mouse cerebellum was still detectable, suggesting that these fibers contain exon1e-ankyrinG. The expression of ankyrinG in hippocampal neurons of mutant mice was unaffected compared with the wild-type control mouse, indicating that these neurons also use exon1e-ankyrinG (Fig. 3, C and D).
|
Mutant Mice Develop Progressive Ataxia
Mice with the exon1b-ankyrinG
/
genotype (hereafter
referred to as mutant mice) were born in nearly Mendelian ratios (55/211) and had no obvious abnormality until
P16-17. Mutant mice then developed characteristic cerebellar defects with symptoms of abnormal gait and tremor
and reduced locomotion. When the mutant mice were prodded to walk, their hindlimbs were uncoordinated, and
they fell frequently (Fig. 4). This phenotype had a variable
time course of onset and severity but could generally easily be observed in mutant mice as young as P16. The ataxia
became more severe with increasing age. The mutant mice
are fertile but do not breed well. Some premature death of
mutant mice occurred between 4 and 6 mo and in some
cases was preceded by uncontrollable jumping and convulsions. Mice with the exon1b-ankyrinG +/
genotype (heterozygotes) were phenotypically normal and could not be
distinguished from wild-type mice (+/+ for exon1b-ankyrinG).
|
Loss of Targeting of NaCh to Axon Initial Segments of Neurons in Mutant Mouse Cerebellum
At least three types of NaCh are expressed by neurons of
mouse cerebellum (Westenbroek et al., 1989
, 1992
; De Miera et al., 1997
). The type II NaCh is the major NaCh expressed by granule cells (De Miera et al., 1997
), while
NaCh6/Scn8a/CerIII (Burgess et al., 1995
; Schaller et al.,
1995
; De Miera et al., 1997
) is expressed in Purkinje cells
and is likely one of the contributors to the generation of
Purkinje cell action potentials (Raman et al., 1997
). Type I
NaCh are expressed in Purkinje neurons (Westenbroek et al., 1989
; De Miera et al., 1997
) but are not concentrated at axon initial segments (data not shown). Our NaCh antibodies were raised against peptides shared by type I and II
NaCh (Lambert et al., 1997
) and reacted with NaCh at
nodes of Ranvier of peripheral nerve (Lambert et al.,
1997
) and axon initial segments of granule cells on tissue
sections (Fig. 5 D). In addition, the molecular layer, which
is composed of unmyelinated axons of granule cell neurons, was also labeled with this antibody, as previously reported (Westenbroek et al., 1989
, 1992
).
|
AnkyrinG is confined to initial segments of axons of
granule cells (Fig. 3 B) as well as Purkinje neurons (see below), as previously reported (Kordeli et al., 1995
). AnkyrinG at axon initial segments is clearly resolved in cultured
granule cells (data not shown). This distribution pattern is
also true in cerebellum sections (Fig. 5 B), where sodium
channels colocalized with ankyrinG at the initial segments
of granule cells (Fig. 5 F, see the enlarged view in the inset).
Immunofluorescence indicates that NaCh were not concentrated at initial segments of granule cells from mutant
mice (Fig. 5 C), while NaCh were highly concentrated at
granule cell initial segments and colocalized with ankyrinG
in wild-type mice (Fig. 5 D). Mutant mouse cerebella retain strong labeling of NaCh in the molecular layer, where
no ankyrinG is present, even in normal mice. Immunoblot
data indicated the levels of NaCh protein detected by this
antibody were the same in the mutant and control mouse cerebella of animals less than 40 d (data not shown).
Although ankyrinG is absent from the molecular layer,
ankyrinB is highly expressed in this region (Kunimoto et
al., 1991
), and this or some other protein such as syntrophin (Gee et al., 1998
) could interact with NaCh in the unmyelinated granule cell axons. NaCh could not be consistently visualized in Purkinje cell initial segments with our
antibody or with eight other antibodies (see Materials and
Methods). These negative results suggest either that the
NaCh did not react strongly with antibody because of problems with fixation or some other experimental parameter, or that axon initial segments of these neurons have a
specialized NaCh isoform that is not recognized by available antibodies. However, the electrophysiological data
presented below strongly support the conclusion that the
density of NaCh in Purkinje neuron initial segments is dramatically reduced in the mutant mice.
Abnormal Physiology of Purkinje Cells of Mutant Mice
We studied the ability of Purkinje cells to fire action potentials upon injection of current at the soma in whole-cell
patch-clamp recordings from cerebellar slices. Experiments were done blind to genotype, although the motor
phenotype of each mouse was obvious. After analysis, the
genotype of each animal was determined by Southern blot
from tail-snip specimens. Wild-type (+/+) and heterozygote (+/
) mice could not be distinguished by cage behavior nor electrophysiological properties and were thus combined for data analysis as normal mice. Purkinje cells in
cerebellar slices from mutant mice (
/
) were, however,
impaired in their ability to fire action potentials. Three
features were notable. Purkinje cells from mutant mice
had a higher threshold to initiate action potentials, did not
always fire an action potential in response to a short, 1-ms
current injection, and showed a slower rate of maximal firing of multiple action potentials in response to long current injections. In Purkinje cells from normal mice, a single, "all-or-nothing" action potential (Fig 6 A, left) could
always be elicited from a 1-ms pulse (10/10 cells from 7 animals). In contrast, most cells from mutant mice showed
only passive membrane responses and were unable to initiate an action potential in response to the same magnitude 1-ms current injections (Fig. 6 B, left; 4/7 cells from 5 animals). In three cells from two mutant animals, an action
potential could be initiated with a 1-ms current injection,
but only when the stimulus intensity was increased compared with normal cells, indicating a higher threshold
to initiate the action potential in mutant cells. Normal Purkinje cells always fired multiple action potentials in response to long (50-100 ms) current injections (Fig. 6 A,
right). Although Purkinje cells in mutant mice could fire
action potentials with long current injections (Fig. 6 B,
right), the maximal firing rate was less than one half that of
the normal cells (Fig. 6 C). The threshold to fire action potentials was also significantly higher in the Purkinje cells
from mutant mice (Fig. 6 D). The action potentials in
Purkinje cells from mutant mice were due to NaCh currents because they could be reversibly blocked by 1 µM
TTX (data not shown). Purkinje cells from mutant and
normal mice did not differ in their initial resting potential
in whole-cell current clamp (
58 ± 3.0 mV for mutants,
n = 7;
57 ± 2.9 mV for normals, n = 10) or resting input
resistance (80 ± 16 M
for mutants, 125 ± 28 M
for normals).
|
Thus, although the molecular species of NaCh expressed by the mouse Purkinje cells cannot be demonstrated by immunocytochemistry (see above), the physiological data strongly support the idea that NaCh localization to the initial segment is impaired and/or NaCh density is reduced because of the knockout of a cerebellar isoform of ankyrinG. This is consistent with the immunofluorescence evidence for reduced localization of NaCh in cerebellar granule cell initial segments (Fig. 5) and neurofascin in Purkinje cell initial segments (Fig. 7, below).
|
Reduced Concentration of Neurofascin at Axon Initial Segments of Purkinje Neurons
Neurofascin and NrCAM colocalized with ankyrinG at initial segments of Purkinje neuron axons and the nodes of
Ranvier of peripheral nerve (Davis et al., 1996
; Lambert
et al., 1997
). The L1CAM family member(s) targeted to
granule cell neuron initial segments has not been defined.
In control mouse cerebellum, ankyrinG and neurofascin are colocalized at the initial segments of Purkinje cell axons (Fig. 7 F), with low levels of neurofascin also localized
along the cell body plasma membrane, as previously reported (Davis et al., 1996
). In the mutant mouse cerebellum, however, neurofascin was uniformly distributed at
the plasma membrane of Purkinje neuron cell body and
axon initial segment (Fig. 7 E). Some elevation of neurofascin was found in the molecular layer of ankyrinG-deficient mice. The same observations were made with an antibody to NrCAM (data not shown).
Neuronal Degeneration in the Mutant Mouse Brain
The cerebella of adult mutant mice (>5 mo old) is substantially smaller than those of control littermates, but the frontal brains were similar in size (data not shown). The molecular layer of the adult mutant mouse cerebellum was reduced in thickness, and the number of Purkinje cells was reduced by 60% based on staining with neurofilament antibody, hematoxylin and eosin, or toluidine blue (data not shown, n = 6). An antibody to calbindin, a Purkinje cell marker, revealed large gaps in the molecular layer of mutant mice where cell bodies and dendritic arbors of Purkinje cells were absent (Fig. 8 A).
|
Purkinje cells of mutant mice are likely to provide ineffective or inappropriate signaling to their target neurons
because of an abnormal input from granule cells and from
their own deficiencies in action potential initiation and firing rates. A potential consequence of abnormal signaling
to the deep nuclei is that Purkinje cells would not receive
sufficient neurotrophic factors by retrograde transport.
These considerations may explain the progressive loss of
Purkinje neurons in ankyrinG mutant mice. Interestingly,
progressive, late-onset Purkinje cell loss was also found in
jolting mice with a mutation in the Scn8a NaCh expressed
in Purkinje cells (Boakes et al., 1984
; Dick et al., 1986
;
Kohrman et al., 1996
).
| |
Discussion |
|---|
|
|
|---|
This study demonstrates that ankyrinG is essential for normal targeting of NaCh to axon initial segments of granule cells and for normal firing properties in Purkinje cells. Targeted disruption of ankyrinG gene expression in the cerebellum results in progressive ataxia, abolishes targeting of voltage-gated NaCh to axon initial segments of granule cells, impairs action potential firing in Purkinje neurons, and results in progressive Purkinje neuron degeneration. Neurofascin and NrCAM, members of the L1CAM family of ankyrin-binding cell adhesion molecules, also exhibited reduced concentration at Purkinje cell axon initial segments in mutant mice. Although the molecular type of NaCh expressed by the Purkinje neurons could not be identified by immunocytochemistry, the physiological data (Fig. 6) strongly support the idea that NaCh localization to the initial segment is impaired and/or NaCh density is reduced because of the cerebellar knockout of ankyrinG. This is consistent with the immunocytochemical evidence for reduced targeting of NaCh in cerebellar granule cells (Fig. 5) and neurofascin in Purkinje cells (Fig 7).
The demonstration that ankyrinG is essential for clustering of sodium channels and neurofascin at the initial segments extends previous observations that ankyrinG coclusters with neurofascin and NaCh during morphogenesis of
nodes of Ranvier (Davis et al., 1996
; Lambert et al., 1997
).
The ankyrin membrane binding domain has distinct binding sites for the NaCh, located on subdomains 3 and 4 (Srinivasan et al., 1992
), and for neurofascin, located on
subdomains 2 and 3 as well as 3 and 4 (Michaely and
Bennett, 1995b
). Therefore, ankyrinG could form heterocomplexes between NaCh and neurofascin in vivo by directly binding to both proteins. A similar interaction between an ion channel and cell adhesion molecule has been
demonstrated at Drosophila neuromuscular junction, where
PDZ-containing protein Discs-Large (Dlg) interacts with Shaker potassium channel and Fasciclin II directly (Zito
et al., 1997
). In dlg mutants, the localization of both
Shaker channel and Fasciclin II to neuromuscular junction
was altered (Tejedor et al., 1997
; Zito et al., 1997
), much
like the altered localization of sodium channel and neurofascin in ankyrinG knockout mice. These observations suggest that heterocomplexes between ion channels and adhesion molecules mediated by cytoplasmic proteins may
be a general feature of specialized cell domains. Possible
physiological roles for such channel/adhesion molecule/
cytoplasmic protein complexes include directing extracellular interactions with adjacent cells to these sites, lateral
organization of ion channel assemblies, and polarized delivery of newly synthesized ion channels to specialized sites. A potential benefit of heterocomplexes mediated by
a cytoplasmic protein is that the interactions could be differentially regulated in response to cellular signals. For example, ankyrin association with neurofascin and other
L1CAM family members is abolished by tyrosine phosphorylation of FIGQY residues in the cytoplasmic domain
(Garver et al., 1997
).
The role of ankyrinG in assembly of NaCh at nodes of
Ranvier and the neuromuscular junction is not addressed
in this study because of the selective disruption of ankyrinG in the cerebellum and the lack of antibodies recognizing NaCh of Purkinje neurons. However, similarities
between initial segments and other sites of NaCh concentration support the prediction that ankyrinG is also required for restriction of NaCh at these domains. Nodes of
Ranvier, the neuromuscular junction, and axon initial segments each have specialized features as well. Thus NaCh/
ankyrinG assemblies are likely to include additional proteins that perform specific functions adapted to each cell
domain. Syntrophins, for example, associate with NaCh
and are concentrated at the neuromuscular junction (Gee
et al., 1998
; Shultz et al., 1998). The
subunits of NaCh
also are candidates to mediate important domain-specific interactions (Isom et al., 1995
; Isom and Catterall, 1996
).
The role of ankyrinG in molecular events leading to assembly of the specialized plasma membrane domain at
axon initial segments remains an important issue for future investigation. One conclusion from this study is that
signals for ankyrin-based targeting of NaCh to axon initial
segments are likely to involve additional interacting proteins that have yet to be identified. Neurofascin and NrCAM
have been proposed to direct assembly, first of ankyrin at
nodes of Ranvier and other sites, followed by the localization of NaCh (Lambert et al., 1997
). However, the finding
that neurofascin is not distributed normally in the absence
of ankyrinG (Fig. 7) suggests that ankyrinG is required for
the concentration of neurofascin as well as the NaCh, at
least at axon initial segments. It is of interest that restriction of 270-kD ankyrinG to axon initial segments of cultured dorsal root ganglion neurons requires multiple domains in addition to the membrane-binding domain
(Zhang and Bennett, 1998
). These findings imply the existence of unidentified ankyrin-binding protein(s) upstream
in the pathway to formation of the initial segment specialized domain.
The finding that ankyrinG is required for the normal
physiological function of NaCh is an example of a general
principle of the critical importance of spatial organization
of ion channels in cells of metazoan animals and the
requirement for cytoplasmic proteins for proper cellular
targeting. Other instances demonstrated in animal models
include the role of rapsyn in the organization of acetylcholine receptors at the neuromuscular junction of mice (Gautam et al., 1995
), and of the PDZ protein, Discs-Large (Dlg), in the organization of potassium channels
and Fasciculin II in neuromuscular junctions of Drosophila (Tejedor et al., 1997
; Zito et al., 1997
). Apparently,
evolution of mechanisms for spatial organization has proceeded through convergent pathways for different types of
channels, with the selective advantage of rapid and precise response to stimuli. Ion channels with polarized localization in cells that associate with ankyrin include the Na/K
ATPase (Nelson and Veshnock, 1987
) and Na/Ca exchanger (Li et al., 1993
). The Na/K ATPase requires
ankyrinG119 for delivery to the plasma membrane in cultured cells (Devarajan et al., 1997
) and may also require ankyrinG for targeting to basolateral domains of epithelial
cells in tissues. Voltage-gated NaCh are members of a super-family that also includes voltage-gated channels for
K+, and Ca2+ (Armstrong and Hille, 1998
). It will be of interest to determine if ankyrin-binding and ankyrin-dependent cellular targeting are features shared by other members of the voltage-gated channel family. Deciphering the
molecular code for cellular targeting of ion channels and
most likely other signaling molecules is an issue connecting the fields of cell biology and physiology and is equivalent in functional significance to understanding primary and tertiary structures of these proteins.
| |
Footnotes |
|---|
Received for publication 6 August 1998 and in revised form 16 October 1998.
Cheryl Bock is gratefully acknowledged for culture and transfection of ES
cells, as well as blastocyst injections. Paula Scotland is gratefully acknowledged for culture and identification of ES cells with homologous recombination.
This research was supported in part by a grant from the National Institutes of Health (V. Bennett), the McKnight Foundation (L.M. Boland)
and the Edward J. Mallinckrodt, Jr. Foundation (S. Lambert).
Address all correspondence to Vann Bennett, Howard Hughes Medical
Institute and Department of Cell Biology, Duke University Medical Center, Durham, NC 27710. Tel.: (919) 684-3105. Fax: (919) 684-3590. E-mail:
vbennett{at}acpub.duke.edu
| |
Abbreviations used in this paper |
|---|
NaCh, voltage-gated sodium channel(s); O2-ACSF, oxygenated artificial cerebrospinal fluid; P, postnatal day.
| |
References |
|---|
|
|
|---|
| 1. | Armstrong, C.M., and B. Hille. 1998. .Voltage-gated ion channels and electrical excitability. Neuron. 20: 371-380 [Medline]. |
| 2. | Bennett, V., S. Lambert, J.Q. Davis, and X. Zhang. 1997. Molecular architecture of the specialized axonal membrane at the node of Ranvier. Soc. Gen. Physiol. Ser. 52: 107-120 [Medline]. |
| 3. | Boakes, R.J., J.M. Candy, D.J. Dick, J.B. Harris, S. Pollard, and J. Thompson. 1984. Abnormal electrophysiological and anatomical characteristics of cerebellar Purkinje cells in the mutant mouse jolting. J. Physiol. (Lond.). 346: 27P . |
| 4. | Burgess, D.L., D.C. Kohrman, J. Galt, N.W. Plummer, J.M. Jones, B. Spear, and M.H. Meisler. 1995. Mutation of a new sodium channel gene, Scn8a, in the mouse mutant "motor endplate disease." Nat. Genet. 10: 461-465 [Medline]. |
| 5. | Catterall, W.A.. 1981. Localization of sodium channels in cultured neural cells. J. Neurosci 1: 777-783 [Abstract]. |
| 6. |
Chan, W.,
E. Kordeli, and
V. Bennett.
1993.
440-kD ankyrinB: structure of the
major developmentally regulated domain and selective localization in unmyelinated axons.
J. Cell Biol.
123:
1463-1473
|
| 7. |
Davis, J.Q.,
T. McLaughlin, and
V. Bennett.
1993.
Ankyrin-binding proteins related to nervous system cell adhesion molecules: candidates to provide transmembrane and intercellular connections in adult brain.
J. Cell Biol.
121:
121-133
|
| 8. |
Davis, J.Q.,
S. Lambert, and
V. Bennett.
1996.
Molecular composition of the
node of Ranvier: identification of ankyrin-binding cell adhesion molecules
neurofascin (mucin+/third FNIII domain ) and NrCAM at nodal axon segments.
J. Cell Biol.
135:
1355-1367
|
| 9. |
De Miera, E.V.S.,
B. Rudy,
M. Sugimori, and
R. Llinas.
1997.
Molecular characterization of the sodium channel subunits expressed in mammalian cerebellar Purkinje cells.
Proc. Natl. Acad. Sci. USA
94:
7059-7064
|
| 10. |
Deerinck, T.J.,
S.R. Levinson,
G.V. Bennett, and
E.H. Ellisman.
1997.
Clustering of voltage-sensitive sodium channels on axons is independent of direct
Schwann cell contact in the dystrophic mouse.
J. Neurosci.
17:
5080-5088
|
| 11. |
Devarajan, P.,
P.R. Stabach,
M.A. De Matteis, and
J.S. Morrow.
1997.
Na,K-ATPase transport from endoplasmic reticulum to Golgi requires the Golgi
spectrin-ankyrin G119 skeleton in Madin Darby canine kidney cells.
Proc.
Natl. Acad. Sci. USA
94:
10711-10716
|
| 12. | Dick, D.J., P.J. Boakes, J.M. Candy, J.B. Harris, and M.J. Cullen. 1986. Cerebellar structure and function in the murine mutant "jolting." J. Neurolog. Sci. 76: 255-267 [Medline]. |
| 13. | Edwards, F.A. 1995. Patch clamp recording in brain slices. In Brain Slices in Basic and Clinical Research. A. Schurr and B.M. Rigor, editors. CRC Press, Boca Raton, FL. 99-116. |
| 14. |
Ellisman, M.H., and
S.R. Levinson.
1982.
Immunocytochemical localization of
sodium channel distributions in the excitable membranes of Electrophorus
electricus.
Proc. Natl. Acad. Sci. USA
79:
6707-6711
|
| 15. | Flucher, B.E., and M.P. Daniels. 1989. Distribution of Na+ channels and ankyrin in neuromuscular junctions is complementary to that of acetylcholine receptors and the 43 kD protein. Neuron 3: 163-175 [Medline]. |
| 16. |
Garver, T.,
Q. Ren,
S. Tuvia, and
V. Bennett.
1997.
Tyrosine phosphorylation
at a site highly conserved in the L1 family of cell adhesion molecules abolishes ankyrin binding and increases lateral mobility of neurofascin.
J. Cell
Biol.
137:
703-714
|
| 17. | Gautam, M., P.G. Noakes, J. Mudd, M. Nichol, G.C. Chu, J.R. Sanes, and J.P. Merlie. 1995. Failure of postsynaptic specialization to develop at neuromuscular junctions of rapsyn-deficient mice. Nature. 377: 232-236 [Medline]. |
| 18. |
Gee, S.H.,
R. Madhavan,
S.R. Levinson,
J.H. Caldwell,
R. Sealock, and
S.C. Froehner.
1998.
Interaction of muscle and brain sodium channels with multiple members of the syntrophin family of dystrophin-associated proteins.
J.
Neurosci
18:
128-137
|
| 19. | Gordon, D., D. Merrick, D.A. Wollner, and W.A. Catterall. 1988. Biochemical properties of sodium channels in a wide range of excitable tissues studied with site-directed antibodies. Biochemistry. 27: 7032-7038 [Medline]. |
| 20. | Hortsch, M.. 1996. The L1 family of neural cell adhesion molecules: old proteins performing new tricks. Neuron. 17: 587-593 [Medline]. |
| 21. |
Isom, L.L.,
D.S. Ragsdale,
K.S. De Jongh,
R.E. Westenbroek,
B.F. Reber,
T. Scheuer, and
W.A. Catterall.
1995.
Structure and function of the 2 subunit
of brain sodium channels, a transmembrane glycoprotein with a CAM motif.
Cell.
83:
433-442
[Medline].
|
| 22. | Isom, L.L., and W.A. Catterall. 1996. Na+ channel subunits and Ig domains. Nature. 383: 307-308 [Medline]. |
| 23. | Kaplan, M.R., A. Meyer-Franke, S. Lambert, V. Bennett, I.D. Duncan, S.R. Levinson, and B.A. Barres. 1997. Induction of sodium channel clustering by oligodendrocytes. Nature. 386: 724-728 [Medline]. |
| 24. |
Kohrman, D.C.,
M.R. Smith,
A.L. Goldin,
J. Harris, and
M.H. Meisler.
1996.
A
missense mutation in the sodium channel Scn8a is responsible for cerebellar
ataxia in the mouse mutant jolting.
J. Neurosci
16:
5993-5999
|
| 25. |
Konnerth, A.,
I. Llano, and
C.M. Armstrong.
1990.
Synaptic currents in currents in cerebellar Purkinje cells.
Proc. Natl. Acad. Sci. USA.
87:
2662-2665
|
| 26. |
Kordeli, E., and
V. Bennett.
1991.
Distinct ankyrin isoforms at neuron cell bodies and nodes of Ranvier resolved using erythrocyte ankyrin-deficient mice.
J. Cell Biol.
114:
1243-1259
|
| 27. |
Kordeli, E.,
J. Davis,
B. Trapp, and
V. Bennett.
1990.
An isoform of ankyrin is
localized at nodes of Ranvier in myelinated axons of central and peripheral
nerves.
J. Cell Biol
110:
1341-1352
|
| 28. |
Kordeli, E.,
S. Lambert, and
V. Bennett.
1995.
AnkyrinG. A new ankyrin gene
with neural-specific isoforms localized at the axonal initial segment and node
of Ranvier.
J. Biol. Chem.
270:
2352-2359
|
| 29. | Kordeli, E., M.A. Ludosky, C. Deprette, T. Frappier, and J. Cartaud. 1998. AnkyrinG is associated with the postsynaptic membrane and the sarcoplasmic reticulum in the skeletal muscle fiber. J. Cell Sci. 111: 2197-2207 [Abstract]. |
| 30. |
Kunimoto, M.,
E. Otto, and
V. Bennett.
1991.
A new 440-kD isoform is the major ankyrin in neonatal rat brain.
J. Cell Biol
115:
1319-1331
|
| 31. |
Lambert, S.,
J.Q. Davis, and
V. Bennett.
1997.
Morphogenesis of the node of
Ranvier: co-clusters of ankyrin and ankyrin-binding integral proteins define
early developmental intermediates.
J. Neurosci
17:
7025-7036
|
| 32. |
Li, Z.,
E.P. Burke,
J.S. Frank,
V. Bennett, and
K.D. Philipson.
1993.
The cardiac Na+-Ca2+ exchanger binds to the cytoskeletal protein ankyrin.
J. Biol.
Chem
268:
11489-11491
|
| 33. |
Michaely, P., and
V. Bennett.
1993.
The membrane-binding domain of ankyrin
contains four independently folded subdomains, each comprised of six
ankyrin repeats.
J. Biol. Chem.
268:
22703-22709
|
| 34. |
Michaely, P., and
V. Bennett.
1995a.
The ANK repeats of erythrocyte ankyrin
form two distinct but cooperative binding sites for the erythrocyte anion exchanger.
J. Biol. Chem
270:
22050-22057
|
| 35. |
Michaely, P., and
V. Bennett.
1995b.
Mechanism for binding site diversity on
ankyrin. Comparison of binding sites on ankyrin for neurofascin and the
Cl /HCO3 anion exchanger.
J. Biol. Chem
270:
31298-31302
|
| 36. | Nelson, W.J., and P.J. Veshnock. 1987. Ankyrin binding to (Na+ + K+)ATPase and implications for the organization of membrane domains in polarized cells. Nature. 328: 533-536 [Medline]. |
| 37. |
Peters, L.L.,
K.M. John,
F.M. Lu,
E.M. Eicher,
A. Higgins,
M. Yialamas,
L.C. Turtzo,
A.J. Otsuka, and
S.E. Lux.
1995.
Ank3 (epithelial ankyrin), a widely
distributed new member of the ankyrin gene family and the major ankyrin in
kidney, is expressed in alternatively spliced forms, including forms that lack
the repeat domain.
J. Cell Biol
130:
313-330
|
| 38. | Raman, I.M., L.K. Sprunger, M.H. Meisler, and B.P. Bean. 1997. Altered subthreshold sodium currents and disrupted firing patterns in Purkinje neurons of Scn8a mutant mice. Neuron 19: 881-891 [Medline]. |
| 39. | Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: A Laboratory Manual, 2nd edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 7.40-7.42. |
| 40. | Schaller, K.L., D.M. Krzemien, P.J. Yarowsky, B. Krueger, and J.H. Caldwell. 1995. A novel, abundant sodium channel expressed in neurons and glia. J. Neurosci 15: 3231-3242 [Abstract]. |
| 41. | Schultz, J., U. Hoffmuller, G. Krause, J. Ashurst, M.J. Macias, P. Schmieder, J. Schneider-Mergener, and H. Oschkinat. 1998. Specific interactions between the syntrophin PDZ domain and voltage-gated sodium channels. Nat. Struct. Biol. 5: 19-24 [Medline]. |
| 42. | Srinivasan, Y., L. Elmer, J. Davis, V. Bennett, and K. Angelides. 1988. Ankyrin and spectrin associate with voltage-dependent sodium channels in brain. Nature 333: 177-180 [Medline]. |
| 43. |
Srinivasan, Y.,
M. Lewallen, and
K. Angelides.
1992.
Mapping the binding site
on ankyrin for the voltage-dependent sodium channel from brain.
J. Biol.
Chem.
267:
7483-7489
|
| 44. |
Tejedor, F.J.,
A. Bokhari,
O. Rogero,
M. Gorczyca,
J. Zhang,
E. Kim,
M. Sheng, and
V. Budnik.
1997.
Essential role of dlg in synaptic clustering of
Shaker K+ channels in vivo.
J. Neurosci
17:
152-159
|
| 45. | Westenbroek, R.E., D.K. Merrick, and W.A. Catterall. 1989. Differential subcellular localization of the RI and RII Na+ channel subtypes in central neurons. Neuron. 3: 695-704 [Medline]. |
| 46. | Westenbroek, R.E., J.L. Noebels, and W.A. Catterall. 1992. Elevated expression of type II Na+ channels in hypomyelinated axons of shiverer mouse brain. J. Neurosci. 12: 2259-2267 [Abstract]. |
| 47. |
Wollner, D.A., and
W.A. Catterall.
1986.
Localization of sodium channels in
axon hillocks and initial segments of retinal ganglion cells.
Proc. Natl. Acad.
Sci. USA.
83:
8424-8428
|
| 48. |
Wood, S.J., and
C.R. Slater.
1998.
-Spectrin is colocalized with voltage-gated
sodium channels and ankyrinG at the adult rat neuromuscular junction.
J.
Cell Biol.
140:
675-684
|
| 49. |
Zhang, X., and
V. Bennett.
1996.
Identification of O-linked N-acetylglucosamine modification of ankyrinG isoforms targeted to nodes of Ranvier.
J.
Biol. Chem
271:
31391-31398
|
| 50. |
Zhang, X., and
V. Bennett.
1998.
Restriction of 480/270-kD ankyrin-G to axon
proximal segments requires multiple ankyrin-G-specific domains.
J. Cell
Biol.
142:
1571-1581
|
| 51. | Zito, K., R.D. Fetter, C.S. Goodman, and E.Y. Isacoff. 1997. Synaptic clustering of Fascilin II and Shaker: essential targeting sequences and role of Dlg. Neuron. 19: 1007-1016 [Medline]. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|