|
||


* Center for Neuronal Survival and
Brain Tumor Center, Montreal Neurological Institute, McGill University, Montreal,
Quebec, Canada H3A 2B4
| |
Abstract |
|---|
|
|
|---|
Naturally occurring sympathetic neuron
death is the result of two apoptotic signaling events:
one normally suppressed by NGF/TrkA survival signals, and a second activated by the p75 neurotrophin receptor. Here we demonstrate that the p53 tumor suppressor protein, likely as induced by the MEKK-JNK
pathway, is an essential component of both of these
apoptotic signaling cascades. In cultured neonatal sympathetic neurons, p53 protein levels are elevated in
response to both NGF withdrawal and p75NTR activation. NGF withdrawal also results in elevation of a
known p53 target, the apoptotic protein Bax. Functional ablation of p53 using the adenovirus E1B55K
protein inhibits neuronal apoptosis as induced by either
NGF withdrawal or p75 activation. Direct stimulation
of the MEKK-JNK pathway using activated MEKK1
has similar effects; p53 and Bax are increased and the
subsequent neuronal apoptosis can be rescued by
E1B55K. Expression of p53 in sympathetic neurons indicates that p53 functions downstream of JNK and upstream of Bax. Finally, when p53 levels are reduced or
absent in p53+/
or p53
/
mice, naturally occurring sympathetic neuron death is inhibited. Thus, p53 is an
essential common component of two receptor-mediated signal transduction cascades that converge on the
MEKK-JNK pathway to regulate the developmental
death of sympathetic neurons.
| |
Introduction |
|---|
|
|
|---|
NATURALLY occurring neuronal death is an essential
component of neural development in which <50%
of any given neuronal population is lost as a
mechanism for establishing appropriate neuron:target cell
connections (reviewed in Oppenheim, 1991
). Sympathetic
neurons of the peripheral nervous system, which require
NGF for their survival (reviewed in Levi-Montalcini,
1987
), have been a prototype for analysis of the mechanisms regulating this event. During the first two postnatal
weeks, sympathetic neurons compete for limiting amounts
of target-derived NGF, which binds to and activates TrkA tyrosine kinase receptors (Kaplan et al., 1991a
,b; Klein et al., 1991
) on neuronal teminals, thereby mediating a retrograde neuronal survival signal (Campenot et al., 1982; Riccio et al., 1997
; Senger et al., 1997). Traditionally, it has
been thought that the absence of such a TrkA retrograde
signal was sufficient to cause rapid neuronal apoptosis
during developmental death. However, we have recently
shown that the lack of such a NGF/TrkA-mediated survival signal is, of itself, insufficient for appropriate sympathetic neuron death. Instead, a second neurotrophin
receptor, p75NTR (Johnson et al., 1986
; Radeke et al.,
1987
), is required for this process; in the absence of
p75NTR, sympathetic neuron apoptosis is delayed both in
culture and in vivo (Bamji et al., 1998
). Moreover, ligand-mediated activation of p75NTR is sufficient to cause sympathetic neuron apoptosis (Bamji et al., 1998
). Thus, appropriate developmental sympathetic neuron death occurs
when p75NTR is activated coincident with suboptimal
NGF/TrkA survival signals (reviewed in Miller and Kaplan, 1998
). This convergent regulation of neuronal apoptosis provides a mechanism whereby sympathetic neurons
are able to recognize not only whether they are receiving
adequate amounts of NGF, but also whether or not they
are exposed to "inappropriate" neurotrophins, potentially
as a function of late or inappropriate target innervation.
The intracellular mechanisms responsible for transducing these receptor-mediated apoptotic cascades in sympathetic neurons remain ill-defined, although activation of
the JNK pathway occurs after both p75NTR activation
(Casaccia-Bonnefil et al., 1996
; Bamji et al., 1998
) and
NGF withdrawal (Estus et al., 1994
; Ham et al., 1995
) and,
in the case of NGF withdrawal, is a necessary early event
in the apoptotic pathway. Moreover, Bax is essential for
sympathetic neuron apoptosis both in culture and during
naturally occurring death in vivo (Deckwerth et al., 1996
;
Easton et al., 1997
). One protein that is known to regulate
transcription of Bax (Miyashita and Reed, 1995
) and that
has been implicated in cellular apoptosis is the p53 tumor
suppressor protein (reviewed in Hainut, 1995
; Jacks and
Weinberg, 1996
; Levine, 1997
). However, although p53
has been implicated in neuronal death in response to
DNA damage or cellular stress (Li et al., 1994
; Sakhi et al., 1994
; Wood and Youle, 1995
; Morrison et al., 1996
; Xiang
et al., 1998
), this protein has not previously been thought
to play a role in naturally occurring cell death nor has it
been shown to act downstream of death receptor activation or of the MEKK-JNK pathway.
In this regard, we have previously demonstrated that increased expression of p53 was sufficient to cause sympathetic neuron apoptosis in the presence of NGF (Slack et al.,
1996
). On the basis of this observation, together with the
fact that Bax is essential for naturally occurring sympathetic neuron death (Deckwerth et al., 1996
; Easton et al.,
1997
), we hypothesized that p53 was an essential component of the signaling pathways causing sympathetic neuron
apoptosis either in response to NGF withdrawal and/or to p75NTR activation. In this paper, we test this hypothesis,
and demonstrate that both p75NTR activation and NGF
withdrawal cause increased expression of p53, likely as a
consequence of activation of the MEKK-JNK (Derijard
et al., 1994
; Yan et al., 1994
) pathway, and that this convergent regulation of p53 is essential for normal naturally occurring sympathetic neuron death.
| |
Materials and Methods |
|---|
|
|
|---|
Primary Neuronal Cultures
Mass cultures of pure sympathetic neurons from the superior cervical ganglion (SCG)1 of postnatal day 1 rats were prepared as previously described (Belliveau et al., 1997
; Bamji et al., 1998
). Neurons were plated on
rat tail collagen coated tissue culture dishes; 6-well plates for biochemistry, and 48-well plates for survival assays. Low density SCG cultures were
used for all of the survival assays; for the survival assays in NGF withdrawal and p75 activation experiments, neurons were used at densities of
4,000-6,000 and 2,000-4,000 neurons per well of a 48-well plate, respectively. For biochemistry, ~40,000-50,000 neurons were plated per well of
a 6-well dish. For all experiments not involving viral infection, neurons
were initially cultured for 5 d in the presence of 50 ng/ml NGF. At the end
of this 5 day selection, neurons were washed several times in neurotrophin-free media before addition of the new neurotrophin- or KCL-containing media.
NGF for these experiments was purified from mouse salivary glands
(CedarLane, Hornby, ON). Two sources of recombinant human BDNF
(Amgen, Thousand Oaks, CA; Preprotech, Rocky Hill, NJ) were used for
these experiments; similar results were obtained with both, as discussed
previously (Bamji et al., 1998
).
Virus Infections and Survival Assays
Six different recombinant adenoviruses were used for these experiments.
Two, those expressing E1B55K, the E1B55K mutant A262 (Yew et al.,
1990
), and p53 (Slack et al., 1996
) have been previously constructed and
described. We also constructed adenoviruses (Massie et al., 1995
) expressing activated MEKK1 (Eilers et al., 1998
), and Bcl-xl (Boise et al., 1993
) in
the Ad5 backbone (Bett et al., 1994
), which drives expression from the
CMV promoter. As a control for these viruses, we used a recombinant adenovirus in the same Ad5 backbone expressing E. coli
-galactosidase, as
we have previously described (Slack et al., 1996
; gift of Dr. Frank Graham, McMaster University, Hamilton, Ontario).
All recombinant adenoviruses were purified on CsCl gradients, as we
have previously described (Slack et al., 1996
). Infectious titer was determined by plaque assay on 293 cells (Graham and Prevec, 1991
).
For the experiments involving E1B55K rescue from NGF withdrawal, neurons were cultured for 3-4 d in 50 ng/ml NGF, and then were infected overnight with various mois of recombinant adenovirus in serum-free media containing 50 ng/ml NGF. The next day, the virus was removed, and the cells were fed with fresh media containing 10 ng/ml NGF. The following day, cells were washed free of NGF with 3-h-long washes in serum-free, NGF-free media, and then were switched to media with or without 10 ng/ml NGF. 2 d later, neuronal survival was assessed. For the p75 activation experiments, the protocol was similar with the exception that, after the washes to remove NGF, neurons were switched to media containing 50 mM KCl with or without 100 ng/ml BDNF for 2 d.
For the experiments with the activated MEKK1 or p53 adenoviruses, neurons were plated at a density of 10,000-12,000 neurons/well in 48-well plates (Falcon Plastics, Cockeysville, MD) with 20 ng/ml NGF. On the fifth day of culture, medium was removed, the virus was added in a volume of 200 ul DMEM media (GIBCO-BRL, Gaithersburg, MD) containing 2 mM glutamine, 100 U/ml penicillin, 100 ug/ml streptomycin (all from BioWhittaker, Walkersville, MD), and 10% FBS. After 16-18 h of infection, the virus-containing media was removed and was replaced with Ultraculture media containing 2 mM glutamine, 100 U/ml penicillin, 100 µg/mlstreptomycin, and 20 ng/ml NGF. Cultures were maintained for 48 h, washed four times for one hour each with growth factor-free media, and then switched into the same media containing various concentrations of NGF.
Survival assays were performed as previously described (Slack et al.,
1996
; Bamji et al., 1998
) using nonradioactive cell proliferation (MTT) assays (CellTitre 96; Promega Corp., Madison, WI). 50 µl of the MTT reagent was added to each well and left for 90 min followed by the addition
of 100 µl of solubilization solution to lyse the cells. Each condition was repeated in triplicate. In each assay, baseline (0% survival) was considered
to be 0 ng/ml NGF, and 10 ng/ml NGF was considered to be 100% survival, unless stated otherwise. All other conditions were related to these
values.
Western Blot Analysis
For biochemistry, sympathetic neurons were lysed in TBS lysis buffer
(Knusel et al., 1994
) containing 137 mM NaCl, 20 mM Tris (pH 8.0), 1%
(vol/vol) NP-40, 10% (vol/vol) glycerol, 1 mM PMSF, 10 µg/ml aprotinin,
0.2 µg/ml leupeptin, 1.5 mM sodium vanadate, and 0.1% SDS. Cells were
collected in cold PBS by gentle scraping to detach them from the collagen
substratum, were washed three times with the same buffer, and then were
resuspended in 50 to 100 µl of lysis buffer, followed by rocking for 10 min
at 4°C. After a 10 minute centrifugation, the lysates were normalized for
protein concentration using a BCA Protein Assay Reagent (Pierce Chemical Co., Rockford, IL). Equal amounts of protein (10-50 µg) were then
boiled in sample buffer for 5 minutes and separated by SDS-PAGE. After
electrophoresis, proteins were transferred to 0.2 µm nitrocellulose for 1.5 h
at 0.6 Amps, and the membrane was washed three times with TBS. For all
antibodies, the membranes were blocked in 3% nonfat milk in TBST
(blotto) for 1.5 h at room temperature. The membranes were then incubated overnight at 4°C with the primary antibodies in blotto: anti-p53
(Oncogene Neurosciences, Manhasset, NY), anti-p53 (Novacastra, Burlingame, CA), anti-p21 (Transduction Laboratories, Lexington, KY), anti-p27 (Transduction Laboratories), anti-Bad (Transduction Laboratories),
anti-Bcl2 (Transduction Laboratories), anti-Bclxl (Santa Cruz Biotechnology, Santa Cruz, CA), anti-Bax (Santa Cruz Biotechnology), anti-E1B55K antibody 2A6, anti-human c-myc (PharMingen, San Diego, CA), anti- phosphothr183/tyr184JNK (New England Biolabs, Boston, MA; Derijard et al., 1994
), anti-phosphoser473Akt (New England Biolabs), anti-phosphothr183/tyr185Erk (Promega Corp.), anti-TrkA (RTA; gift of Dr. L. Reichardt, University of California, San Francisco, CA; Weskamp and
Reichardt, 1991
), anti-tyrosine hydroxylase (Chemicon Laboratories, Temecula, CA), or anti-tubulin (Oncogene Neurosciences). After incubation
with the primary antibodies, membranes were washed four times with TBST over 40 min, and incubated with the secondary antibody for 1.5 h at
room temperature. The secondary antibodies (goat anti-mouse or goat
anti-rabbit HRP from Boehringer Mannheim GmhB, Mannheim, Germany) were used at 1/10,000 dilution. After three washes with TBST, detection was carried out using the ECL chemiluminescence reagent from
Amersham and XAR x-ray film from Kodak.
Analysis of p53
/
Mice
Mice heterozygous for a targeted mutation in the p53 gene (Donehower et
al., 1992
) were obtained from GenPharm International (Mountainview,
CA). p53
/
mice were maintained in a C57Bl/6 background, as homozygotes or heterozygotes. Progeny from p53
/
× p53+/
or from p53 heterozygote crosses were screened for the mutant allele(s) using PCR. To
amplify the mutant allele, PCR was conducted for 35 cycles (94°C for 30 s,
55°C for 60 s, 72°C for 90 s) using the following oligonucleotides: GTGGGAGGGACAAAAGTTCGAGGCC for the 5' end, and TTTACGGAGCCCTGGCGCTCGATGT for the 3' end. This results in a 200 nucleotide fragment in mutant mice and no product in wildtype mice. To
amplify the wild-type allele, the same oligonucleotide was used as the 5'
primer and ATGGGAGGCTGCCAGTCCTAACCC was used as the 3'
primer. This results in amplification of a 600 nucleotide fragment in heterozygote and wild-type mice, and no product in the p53
/
mice.
For morphometric analysis, the SCG were removed and immersion-fixed in 4% paraformaldehyde in phosphate buffer (PB) for 1 h to overnight at 4°C. Ganglia were cryoprotected in graded sucrose solutions,
7-µm-thick sections were serially cut on a cryostat, and every section was
collected and thaw-mounted onto chrom-alum subbed slides. Slides were
stained with cresyl violet and morphometric analyses were performed using a computer-based image analysis system (Biocom, Paris, France).
Neuronal numbers were determined by counting all neuronal profiles with
nucleoli on every third section, as per Coggeshall (1984)
. This sampling
frequency (every 21 µm) ensures that neurons are not double counted,
since the average neuronal diameter does not exceed 21 µm in any of the groups examined (Bamji et al., 1998
). This method does not correct for
split nucleoli. Statistical results were expressed as the mean ± SE of the
mean and were tested for significance by a one-tailed Student's t test.
For TUNEL analysis, SCGs were dissected from p53+/
and p53+/+
littermates at postnatal day 7. Ganglia were fixed for 30 min in 4%
paraformaldehyde, cryoprotected in graded sucrose solutions, and 7-µm-thick sections cut on a cryostat. Every third section was collected and
thaw-mounted onto chrom-alum subbed slides and TUNEL staining immediately performed using the Boehringer-Mannheim in situ cell death
detection kit. The number of TUNEL-positive cells on every third section
was determined by fluorescence microscopy, and these numbers were
used to determine the total number of TUNEL-positive cells per ganglia.
Results were tested for significance by a one-tailed Student's t test.
| |
Results |
|---|
|
|
|---|
p53 and Bax Are Elevated after NGF Withdrawal from Sympathetic Neurons
Previously, we have demonstrated that an increase in p53
levels is sufficient to cause sympathetic neuron apoptosis
in the presence of NGF (Slack et al., 1996
). To determine
whether endogenous p53 protein levels were ever similarly
elevated during sympathetic neuron apoptosis, we cultured sympathetic neurons from neonatal animals, a time
when developmental death of these neurons is ongoing. Initially, we examined p53 during sympathetic neuron
apoptosis induced by NGF withdrawal; this apoptosis is
relatively slow, taking ~48 h, and is transcription-dependent (Deckwerth and Johnson, 1993
; reviewed in Johnson
and Deckwerth, 1993
). Neurons were cultured for 5 d in
the presence of 50 ng/ml NGF, NGF was withdrawn, and then the cellular levels of p53 were quantitated using
Western blots with anti-p53 at various timepoints post-withdrawal (Fig. 1 A). This analysis revealed that p53 levels were elevated approximately threefold by 16 h after
NGF withdrawal (Fig. 1 A). Elevation of p53 protein was
first observed at 12 h (data not shown), and was maintained until at least 36 h post NGF-withdrawal (Fig. 1 A). Interestingly, this timecourse corresponds to the commitment point, after which NGF-withdrawn sympathetic neurons cannot be rescued from apoptotic death (Johnson
and Deckwerth, 1993
). Thus, NGF withdrawal leads to an
increase in p53 levels that correlates with the timecourse
of commitment to an apoptotic death.
|
To determine whether this increase in p53 had functional consequences, we examined the expression of a
well-characterized p53 transcriptional target, the cyclin-dependent kinase p21 (El-Diery et al., 1993). Western blot
analysis of equal amounts of protein from sympathetic
neurons at various timepoints after NGF withdrawal revealed that p21 levels were increased twofold by 16 h after NGF withdrawal, and that this increase was maintained
for at least 36 h (Fig. 1 B). This increase was not specific to
p21, since levels of p27, a second cyclin-dependent kinase
(Toyoshima and Hunter, 1994
), were also increased approximately twofold at 24 and 36 h after NGF withdrawal
(Fig. 1 C).
We next investigated the levels of Bax, another transcriptional target of p53 (Miyashita and Reed, 1995
) that is
known to be essential for naturally occurring sympathetic
neuron death (Deckwerth et al., 1996
; Easton et al., 1997
).
Western blot analysis revealed that, like p53, Bax levels
increased approximately twofold after NGF withdrawal
(Fig. 1 F). This increase was first observed at 16 h, and levels were maximal by 24 h (Fig. 1 F). Interestingly, Western
blot analysis revealed that a second proapoptotic member of this family, Bad (Yang et al., 1995
), was also increased
threefold after NGF withdrawal (Fig. 1 D). Like Bax, this
increase in Bad commenced at ~16 h after withdrawal, the
committment point for apoptosis. In contrast to Bad and
Bax, Western blot analysis for the anti-apoptotic protein
Bcl-2 (Hockenberry et al., 1990
) revealed that levels of
this protein were relatively constant over this timecourse,
decreasing slightly at 24 h and later. A similar decrease was observed for another prosurvival member of this family, Bcl-xl (Boise et al., 1993
), which was decreased by 36 h
after NGF withdrawal (Fig. 1 G). Thus, these data indicate
(a) that two transcriptional targets of p53, p21 and Bax,
are increased after NGF withdrawal, and (b) that the balance of proapoptotic to prosurvival members of the Bcl2
family is significantly shifted after removal of NGF.
We also examined signaling proteins that are activated
in response to TrkA receptor activation, including the
ERKs (Virdee and Tolkovsky, 1995
; Creedon et al., 1996
)
and Akt, a serine/threonine kinase thought to play a key
role in promoting NGF-dependent sympathetic neuron
survival (Crowder and Freeman, 1998
). Western blot analysis with an antibody specific to the phosphorylated form
of the serine/threonine kinase Akt revealed that, 12 h after
NGF withdrawal, phosphorylation of Akt was greatly reduced (Fig. 1 H). Western blot analysis with an antibody
specific to the phosphorylated form of the ERKs revealed a similar decrease in the phosphorylation of these proteins
after NGF withdrawal (Fig. 1 H). Thus, NGF withdrawal
leads to a decrease in signaling via these TrkA-regulated
prosurvival pathways coincident with induction of potentially proaptotic pathways.
Elevated p53 is Necessary for Sympathetic Neuron Apoptosis in Response to NGF Withdrawal
To determine whether this increase in p53 protein levels
was an essential component of the apoptotic cascade that
follows NGF withdrawal, we took advantage of the adenoviral E1B55K protein, which functionally ablates p53
(Yew et al., 1992). Specifically, neonatal sympathetic neurons were cultured for 3-4 d in 50 ng/ml NGF, and then
were infected with one of two recombinant, replication-defective adenoviruses; one of these adenoviruses expressed E1B55K while the second expressed a mutant
E1B55K protein (A262) that is defective in its ability to
bind and ablate p53 (Yew et al., 1990
). As a further control, neurons were infected with a similar moi of recombinant adenovirus expressing
-galactosidase (Slack et al.,
1996
). 2 d after viral infection, neurons were washed free
of NGF and 2 d later, neuronal survival was measured using MTT assays (Fig. 2 A). These experiments demonstrated that E1B55K, but not the E1B55K mutant A262 or
-galactosidase, was able to rescue sympathetic neurons
from apoptosis. In 5 independent experiments, E1B55K
rescued 49% (100 moi) and 63% (500 moi) of the neurons
relative to those kept alive in 10 ng/ml NGF, increases
which were highly significant (P < 0.005 in both cases). In
none of these experiments did either the A262 or
-galactosidase virus have a significant effect on neuronal survival
(Fig. 2 A).
|
To ensure that the effects of E1B55K were being mediated via p53, we examined levels of p53 in NGF-withdrawn sympathetic neurons after viral infection; the vector
used not only ablates p53 through the actions of E1B55K,
but also targets p53 for degradation through the adenoviral E4orf6 product (Yew and Berk, 1992
; Querido et al.,
1997
; Teodoro and Branton, 1997
). For these experiments, sympathetic neurons were initially selected in 50 ng/ml
NGF for 3 d, were infected with the adenoviruses expressing E1B55K or the mutant E1B55K, and 2 d later were
withdrawn from NGF. As a control, neurons were not infected or were infected with the
-galactosidase virus.
Analysis of p53 protein levels 36 h after this treatment revealed that levels of p53 protein were similarly elevated in NGF-withdrawn neurons that were uninfected, or that
were expressing either
-galactosidase or the mutant
E1B55K (Fig. 3 A). In contrast, p53 protein levels were
significantly reduced in the neurons expressing E1B55K,
as predicted. Reprobing of the same blot with an antibody specific for the cytoskeletal protein tubulin confirmed that
equal amounts of protein were present in all of the samples (Fig. 3 B). Moreover, the differential effect of E1B55K
versus the A262 mutant was not due to a difference in levels of expression of these two proteins, since the A262 protein was expressed at higher levels than E1B55K (Fig. 3
C). These experiments therefore indicate that elevated
p53 protein levels are essential for NGF-withdrawal induced apoptosis of sympathetic neurons.
|
p53 is Downstream of p75NTR and is Essential for p75NTR-mediated Neuronal Apoptosis
We have previously demonstrated that the immediate
early protein, c-jun, is hyperphosphorylated in sympathetic neurons after p75NTR activation (Bamji et al.,
1998
) as it is after NGF withdrawal (Estus et al., 1994
;
Ham et al., 1995
). To determine whether p53 elevation
was also a common downstream component of these two apoptotic signaling cascades, we examined p53 levels in
sympathetic neurons in conditions where p75NTR activation leads to apoptosis. Specifically, for these experiments,
sympathetic neurons were cultured for 5 d in 50 ng/ml
NGF and then were switched to KCl, which maintains
sympathetic neuron survival in the absence of TrkA activation (Franklin et al., 1995
). We then added the neurotrophin BDNF, which selectively binds p75NTR but not Trk
receptors on sympathetic neurons (Bamji et al., 1998
), and
determined cellular p53 levels (Fig. 4 A). As seen with
NGF withdrawal, p53 levels were increased at 24 and 36 h
in neurons maintained in KCl plus BDNF relative to those
in KCl alone. Reprobing of the same blot with an antibody
to tyrosine hydroxylase revealed that equal amounts of
protein were present in all of the samples (Fig. 4 B). This increase was already apparent at 12 h, a timepoint when
p53 levels were only first starting to increase after NGF
withdrawal (data not shown). Thus, p53 elevation is downstream of both p75NTR activation and NGF withdrawal.
|
To determine whether this increased p53 was essential
for p75NTR-mediated apoptosis, we performed rescue experiments using the E1B55K adenovirus. Specifically, neurons were cultured in 50 ng/ml NGF for 3-4 d, were infected overnight with recombinant adenovirus, and 2 d
later were switched to media containing 50 mM KCl plus
or minus 100 ng/ml BDNF. Neuronal survival was then measured after 48 h using MTT assays (Fig. 2 B). As we
have previously reported (Bamji et al., 1998
), the addition
of BDNF to 50 mM KCl caused a decrease in sympathetic
neuron survival of ~54% (Fig. 2 B). Expression of the mutant E1B55K had no significant effect on this decrease (P =0.11). In contrast, expression of E1B55K rescued 100% of
the p75NTR-driven apoptosis (P = 0.012; Fig. 2 B), a rescue similar to that observed for NGF-withdrawal induced apoptosis. Thus, p53 elevation was an essential component
of the apoptotic cascades induced in cultured sympathetic
neurons by both NGF withdrawal and p75NTR activation.
p53 is Downstream of the MEKK-JNK Pathway, and Is Essential for MEKK-mediated Neuronal Apoptosis
These results indicated that the apoptotic cascades originating from NGF withdrawal and p75NTR activation
share two common components; hyperphosphorylation of
c-jun and p53 elevation. On the basis of these findings, we
hypothesized that p53 was downstream of the MEKK-JNK pathway, which leads to c-jun hyperphosphorylation (Derijard et al., 1994
; Yan et al., 1994
). To test this hypothesis, we generated a recombinant adenovirus expressing
an activated form of MEKK1 which has previously been
shown to cause sympathetic neuron apoptosis and c-jun
hyperphosphorylation (Eilers et al., 1998
). We first confirmed that this virus expressed the recombinant myc
epitope-tagged MEKK1 protein, and that it was capable of
activating the MEKK1 downstream target, JNK (Yan et
al., 1994
), in sympathetic neurons. Specifically, sympathetic neurons were grown in 20 ng/ml NGF for 4 d, were
infected with 20 moi of recombinant virus expressing activated MEKK1 or
-galactosidase, and then were analyzed
2 d later for expression of the myc-tagged MEKK1 on
Western blots with anti-myc (Fig. 5 A). Analysis of equal
amounts of protein from
-galactosidase versus MEKK1-infected sympathetic neurons revealed the presence of a
myc-immunoreactive protein of the appropriate size, 35 kD,
in the MEKK1-infected neurons (Fig. 5 A). To confirm that virally expressed MEKK1 was capable of activating
JNK, we performed similar experiments and then analyzed the lysates for phosphorylation of JNK using a phospho-JNK antibody (Fig. 5 B). In this experiment, we compared MEKK1-infected sympathetic neurons to sympathetic
neurons withdrawn from NGF, where JNK is known to be
activated (Eilers et al., 1998
). Western blot analysis revealed that the activated MEKK1 adenovirus caused
phosphorylation of JNK to the same level as did NGF
withdrawal, relative to neurons maintained in 10 ng/ml
NGF alone (Fig. 5 B).
|
We next determined whether adenovirus-mediated expression of activated MEKK1 was sufficient to cause sympathetic neuron apoptosis, as was previously reported with
microinjection (Eilers et al., 1998
). Specifically, neurons
were selected in 20 ng/ml NGF for 5 d, infected with various concentrations of recombinant virus expressing activated MEKK1 or
-galactosidase, maintained in 20 ng/ml
NGF for a further 4 d, and then assayed for neuronal survival. Results from four separate experiments revealed
that activated MEKK1 led to neuronal apoptosis; at 20, 50, or 100 moi, sympathetic neuron survival was decreased to
52, 54, and 44%, respectively, relative to neurons infected
with the same concentration of
-galactosidase virus (Fig.
2 C). Similar results were obtained with neurons maintained in 10 ng/ml and 50 ng/ml NGF (data not shown).
We next determined whether activation of the MEKK-JNK pathway caused elevation of p53 levels, as we had hypothesized. Specifically, sympathetic neurons were maintained in 20 ng/ml NGF for 4 d, were infected with 20 or 50 moi of the activated MEKK1 adenovirus, and were then
maintained in 10 ng/ml NGF for a further 2 d before analysis. To ensure that viral infection itself did not induce p53,
we infected sister cultures with the
-galactosidase adenovirus. Western blot analysis of equal amounts of protein
revealed that p53 levels were increased when sympathetic
neurons were infected with 20 or 50 moi of MEKK1 adenovirus, and that the magnitude of this increase was similar
to that observed after NGF withdrawal for 48 h (Fig. 5 C).
In contrast, no increase in p53 levels was seen upon infection with similar mois of the
-galactosidase adenovirus (data not shown), consistent with the observation that this
latter virus had little or no effect on neuronal survival (Fig.
2 C). Thus, activation of the MEKK-JNK pathway led to
increased levels of p53 in the presence of NGF.
To determine whether p53 was an essential component of the MEKK1-induced apoptotic signaling cascade, we asked whether the E1B55K adenovirus could rescue the apoptotic effects of activated MEKK1. To perform these experiments, sympathetic neurons were cultured for 5 d in 20 ng/ml NGF, and were infected with 50 moi of the MEKK1 virus plus or minus 500 moi of the E1B55K virus. As a baseline for this study, we first determined whether coinfection with E1B55K reduced the p53 levels induced by activated MEKK1 alone (Fig. 3 D). Western blot analysis of sympathetic neurons infected for 2 d revealed that p53 protein levels were reduced in neurons expressing E1B55K plus activated MEKK1 relative to those expressing MEKK1 alone (Fig. 3 D). Reprobing of the same blot with an antibody specific for TrkA confirmed that equal amounts of protein were present in all of the samples (Fig. 3 E).
To determine whether this reduction in p53 levels mediated by E1B55K rescued sympathetic neurons from apoptosis induced by activated MEKK1, we performed similar
experiments and, 4 d after infection, MTT assays were performed. As negative controls in this experiment, we used
adenoviruses expressing the mutant A262 protein or
-galactosidase. Results of three separate experiments indicated that the E1B55K adenovirus was able to significantly rescue MEKK1-induced neuronal apoptosis (Fig. 2
D) relative to MEKK1 alone, or relative to MEKK1 plus
the
-galactosidase or A262 adenovirus (P < 0.005 for
E1B55K in all cases; Fig. 2 D). Thus, elevation of p53 protein levels is necessary for sympathetic neuron apoptosis
after activation of the MEKK-JNK pathway.
One potential downstream candidate for the apoptotic effects of p53 in sympathetic neurons after MEKK-JNK pathway activation is the proapoptotic protein Bax. To determine whether Bax levels were increased in response to the MEKK1 adenovirus as they were after NGF withdrawal (Fig. 1 F), we selected sympathetic neurons for 4 d in 20 ng/ml NGF, infected them with 50 moi of the MEKK1 adenovirus, switched them into 10 ng/ml NGF and 2 d later performed Western blots with anti-Bax. This analysis revealed that Bax levels were increased approximately twofold in sympathetic neurons expressing activated MEKK1 (Fig. 5 D), an increase similar in magnitude to that seen after NGF withdrawal (Fig. 1 F).
Previous studies have demonstrated that Bax is necessary for sympathetic neuron apoptosis after NGF withdrawal (Deckwerth et al., 1996
). To determine whether
proapoptotic proteins like Bax are also necessary for sympathetic neuron apoptosis after activation of the MEKK-JNK pathway, we generated a recombinant adenovirus expressing a prosurvival member of this pathway, Bcl-xl (Boise et al., 1993
). Using this adenovirus, we then asked
whether altering the balance between prosurvival versus
proapoptotic members of this family could rescue MEKK1-
induced apoptosis. Specifically, sympathetic neurons were
cultured for 5 d, and were infected with 50 moi of the
MEKK1 adenovirus plus or minus various concentrations of Bcl-xl virus. For comparison, neurons were infected
with 50 moi of MEKK1 virus plus 500 moi E1B55K or
A262. Neurons were then maintained in 20 ng/ml NGF for
four additional days before measuring survival using MTT
assays. This analysis revealed that the Bcl-xl adenovirus
was able to rescue the apoptotic effects of activated MEKK1 at 20 (data not shown) or 50 moi (Fig. 2 E). A
similar rescue was observed with the E1B55K virus (Fig. 2
E), while no rescue was observed with the A262 virus (Fig.
2 E). Similar results were obtained when the MEKK1 adenovirus was used at 100 moi, although the magnitude of
the rescue effect with lower concentrations of Bcl-xl was
decreased (data not shown).
p53 Is Upstream of Bax and Downstream of JNK
These experiments demonstrated that JNK, p53 and Bax
are all downstream of activated MEKK, and that elevated
p53 is essential for MEKK-induced apoptosis. To determine whether p53 is downstream of JNK and upstream of
Bax, as we had hypothesized, we took advantage of a recombinant adenovirus expressing human p53 (previously
described in Slack et al., 1996
). Specifically, sympathetic
neurons were cultured for 4 d in 20 ng/ml NGF, were infected with 20 moi of p53-expressing adenovirus and 48 h
later, cell lysates were analyzed by Western blots with
anti-p53, anti-phosphoJNK or anti-Bax. This analysis revealed that the p53 adenovirus increased expression of p53
to levels similar to those observed after NGF withdrawal (Fig. 5 G), but that this elevated expression of p53 had no
effect on JNK phosphorylation in sympathetic neurons
maintained in 20 ng/ml NGF (Fig. 5 E). In contrast, infection with the p53 virus caused an increase in the levels of
Bax protein (Fig. 5 F) that was similar in magnitude to that
observed after NGF withdrawal (Fig. 1 F) or after infection with the activated MEKK1 adenovirus (Fig. 5 D).
Together with the previous experiments with activated MEKK1, these experiments indicate that MEKK and JNK
are upstream of p53, while Bax is downstream (Fig. 7).
|
p53 is Essential for Naturally Occurring Sympathetic Neuron Death In Vivo
Our previous work indicates that naturally occurring sympathetic neuron death is a result both of suboptimal activation of the TrkA receptor and of coincident activation
of p75NTR (Bamji et al., 1998
). Since, in culture, both of
these types of neuronal apoptosis require p53, we hypothesized that p53 would also be essential for sympathetic
neuron death in vivo. To test this hypothesis, we examined
the SCG of transgenic mice in which the p53 gene was deleted by homologous recombination (Donehower et al.,
1992
). In control mice, the SCG contains ~20,000-25,000
neurons at birth, depending on the genetic background.
Over the ensuing two weeks approximately half of these
neurons are lost so that by P15, control SCGs contain
~13,000 neurons (Bamji et al., 1998
). We therefore chose
to analyze the SCG from p53+/+, p53+/
and p53
/
mice at two timepoints; postnatal days 1 and 15, timepoints immediately preceding and after the normal period
of naturally occurring cell death (Fig. 6, A and D).
|
Analysis of the SCG at postnatal day 1 revealed that
sympathetic neuron numbers before the period of naturally occurring death were similar regardless of the presence or absence of p53 (Fig. 6 D). The SCG of p53+/+ animals contained 23,976 ± 2764 neurons (n = 3), a number
similar to mice of other genetic backgrounds (Bamji et al.,
1998
), while those from p53+/
and p53
/
animals contained 20,537 ± 2514 (n = 5) and 19016 ± 2675 (n = 3), respectively (Fig. 6 D). All of these numbers were statistically similar (P > 0.1 for all comparisons). However,
analysis of the SCG from animals of these same genotypes
at P15 (Fig. 6, A and D), after the period of naturally occurring death, revealed significant differences. In control
p53+/+ animals the P15 SCG contained 13,163 ± 875 neurons (n = 5; Fig. 6 D). In contrast, the SCG of p53+/
animals contained 20,352 ± 944 neurons (n = 6), and that of
p53
/
mice contained 20,600 ± 1709 neurons (n = 3),
statistically significant increases of 55 and 56%, respectively (P < 0.005 in both cases). A comparison within the
same genotype from P1 to P15 revealed that while the
p53+/+ ganglia lost ~45% of its sympathetic neurons over this timeframe (P < 0.05; Fig. 6 D), there was no significant loss of sympathetic neurons in either the p53+/
or p53
/
SCG over the same period (Fig. 6 D; P > 0.3).
To confirm that this difference in neuron number in the
SCG during the period of naturally occurring cell death reflected a deficit in apoptosis in the p53+/
and p53
/
mice, and was not due to an increase in the proliferation of
neuronal progenitors that occurs for a short period postnatally in the SCG (Hendry, 1977
), we analyzed the total
number of apoptotic cells in the SCG at postnatal day 7, when sympathetic neuron apoptosis is ongoing. To perform this analysis, SCG from p53+/
and p53+/+ littermates were sectioned, and every third section was analyzed by in situ TUNEL-labeling. This analysis revealed
that TUNEL-positive cells were detected in the ganglia of
both p53+/
and p53+/+ animals (Fig. 6 B), but that the
total number of apoptotic nuclei was significantly decreased in the p53+/
ganglia (p53+/
SCG, mean = 661 ± 19,n = 5; p53+/+ SCG, mean = 1025 ± 155,n = 4;P = 0.016; Fig. 6 C). Thus, the magnitude of sympathetic
neuron apoptosis is decreased when p53 levels are decreased in vivo.
| |
Discussion |
|---|
|
|
|---|
In this study, we have examined the role of the p53 tumor
suppressor in naturally occurring sympathetic neuron
death. Our findings support an essential role for p53 in this
process and, more specifically, support the following conclusions. First, after NGF withdrawal of neonatal sympathetic neurons, p53 levels are increased with a timecourse
that is consistent with it playing a role in the "commitment" to apoptosis. The magnitude of this increase is similar to that required to induce sympathetic neuron apoptosis using adenovirus-mediated transduction of p53 (Slack et al., 1996
). Second, levels of two p53 transcriptional targets, p21 and Bax, are also increased; the latter of these
two, Bax, has already been shown to be essential for sympathetic neuron apoptosis after NGF withdrawal (Deckwerth et al., 1996
). Third, p53 levels are also increased when
sympathetic neuron apoptosis is induced by p75NTR activation, with a similar timecourse to that observed after
NGF withdrawal. Fourth, a decrease in levels of p53 mediated by the E1B55K protein is sufficient to inhibit sympathetic neuron apoptosis induced either by NGF withdrawal or by p75NTR activation, indicating that increased
p53 levels are both necessary and sufficient (Slack et al.,
1996
) for sympathetic neuron apoptosis. Fifth, NGF withdrawal and p75NTR activation may induce apoptosis via a
pathway involving MEKK-JNK-p53-Bax (Fig. 7) since (a)
expression of activated MEKK1, which is sufficient to
cause sympathetic neuron apoptosis, leads to elevated levels of p53 and Bax, (b) expression of p53 leads to elevated
Bax levels, but does not affect JNK activation, and (c) elevated p53 is essential for MEKK-induced apoptosis. Finally, the physiological relevance of these observations is
indicated by our findings that, when p53 is reduced or absent, naturally occurring sympathetic neuron death is inhibited in vivo. Thus, our data indicate that p53 is a common, essential target during developmental sympathetic
neuron death that is downstream of the MEKK-JNK pathway and that may well integrate apoptotic signals deriving
both from p75NTR activation and from a lack of NGF/
TrkA receptor activation.
The p53 tumor suppressor protein encodes a transcriptional regulator that functions to control cell proliferation
and apoptosis in a cell context-dependent fashion (reviewed in Levine, 1997
; Jacks and Weinberg, 1998). The
precise mechanism by which p53 mediates apoptosis is not
well understood, but it is believed to proceed by a number
of mechanisms including direct transactivation, transcriptional repression, and direct involvement in DNA cleavage (Lane, 1993
; Caelles et al., 1994
; Elledge and Lee,
1995
; Miyashita and Reed, 1995
). Within the nervous system, p53 is upregulated in neurons after a number of traumatic insults, including kainic acid and ischemia (Li et al.,
1994
; Sakhi et al., 1994
; Wood and Youle, 1995
), and is
necessary for excitotoxicity-induced apoptosis of hippocampal and cortical neurons (Morrison et al., 1996
; Xiang et al., 1998
). However, p53 has not been thought to be involved in naturally occurring neuronal cell death, nor has
it been thought to be an essential downstream effector of
death receptor activation. In particular, a number of previous studies have failed to implicate p53 in sympathetic
neuron death. In one study, Martinou et al. (1995)
demonstrated that microinjection of the adenoviral protein E1B19K, but not E1B55K, rescued sympathetic neurons
from apoptosis due to NGF withdrawal. The inability to
rescue sympathetic neuron apoptosis with microinjected
E1B55K as opposed to adenovirally expressed E1B55K is
likely due to the lower levels of expression obtained using
microinjection. In this regard, we have ourselves compared the rescue of sympathetic neurons using adenovirally expressed E1B19K versus E1B55K, and E1B19K was
able to rescue sympathetic neurons at titers ~10-fold
lower than those needed for E1B55K (Pacquet, L., F. Miller, and D. Kaplan, unpublished data). In a second set
of studies, cultured p53
/
sympathetic neurons died after NGF withdrawal, leading to the conclusion that p53
played no role in developmental sympathetic neuron
death (Davies and Rosenthal, 1994
; Sadoul et al., 1996
).
The studies presented here demonstrate that neurons with
lowered p53 levels still die in vivo, although the magnitude
of this death is significantly lower than in controls; these
results do not necessarily contradict the finding that
p53
/
neurons die in culture after NGF withdrawal. Moreover, results might also differ in response to acute
inhibition of p53 (as mediated via E1B55K) versus a
chronic loss of p53 (as in p53
/
mice). For example, the
developmental absence of p53 may well cause compensatory upregulation of parallel apoptotic pathways. Precedent for such compensation derives from our previous studies with another tumor suppressor protein, pRb. In
Rb
/
mice, cortical neurons are unable to differentiate
appropriately and, as a consequence, undergo neuronal
apoptosis in vivo (Slack et al., 1998
). However, when the
same Rb
/
cortical progenitors are cultured and undergo the transition to postmitotic neurons in vitro, they
differentiate normally and do not undergo apoptosis (Slack
et al., 1998
); this difference is explained by a selective upregulation of p107 and p130, two other Rb family members, in culture but not in vivo (Ruth Slack, personal communication). A similar explanation could be invoked for
cultured p53
/
neurons; sympathetic neurons express
p73 (Pozniak, C., and F. Miller, unpublished data), an
apoptotic p53 family member (Jost et al., 1997
; Kaghad et
al., 1997
) that might well compensate for the lack of p53 in a mutant p53 background.
What is the signal transduction pathway that derives either from p75NTR activation or from a lack of activation
of TrkA and that leads to increased p53? Our data implicate the MEKK-JNK pathway (Derijard et al., 1994
; Yan
et al., 1994
; Fig. 7). This pathway is activated in sympathetic neurons in response to either NGF withdrawal
(Ham et al., 1995
; Eilers et al., 1998
) or p75NTR activation (Bamji et al., 1998
), and the resultant hyperphosphorylation of c-jun is necessary for NGF-withdrawal induced
sympathetic neuron death (Estus et al., 1994
; Ham et al.,
1995
). The data presented here indicate that activation
of the MEKK-JNK pathway causes sympathetic neuron
death via a p53-dependent mechanism, thereby providing a potential direct link from p75 to p53. Moreover, our
finding that the stress-induced (Herdegen et al., 1997
)
MEKK-JNK pathway acts via p53 in neurons may explain
why excitotoxicity-induced death of CNS neurons can be
inhibited by deletion of either the JNK3 (Yang et al.,
1997
) or p53 genes (Morrison et al., 1996
; Xiang et al.,
1998
).
Are there other pathways that cause elevated p53 after
NGF withdrawal or p75NTR activation? A second candidate upstream pathway involves deregulation of the cell
cycle; in cycling cells, p53 is viewed as a "fail-safe" mechanism that causes cellular apoptosis when proliferative
mechanisms are deregulated (reviewed in Levine, 1997
;
Jacks and Weinberg, 1996
). Such cell cycle deregulation has been proposed to occur in sympathetic neurons after
NGF withdrawal (Rubin et al., 1993
; Freeman et al., 1994
;
Park et al., 1997). Therefore, it is possible that NGF withdrawal causes two different signals, MEKK-JNK activation and cell cycle deregulation, that together converge on
p53. Thus, p53 may function as a sensor to induce neuronal apoptosis when the sum of these upstream signals reaches a critical level.
What are the downstream events that are responsible
for p53-mediated neuronal apoptosis? One potential downstream mechanism involves the protein Bax, which is
known to be essential for sympathetic neuron apoptosis
(Deckwerth et al., 1996
), and for p53-dependent death of
cortical neurons (Xiang et al., 1998
). Data presented here
indicate that, after the commitment of sympathetic neurons to apoptosis, the balance of proapoptotic versus prosurvival members of the bcl-2 family is considerably
shifted to the proapoptotic, and that one of the changes
contributing to this shift is an increase in Bax protein levels. Moreover, we demonstrate that increased expression
of p53 alone is sufficient to cause increased Bax protein levels in sympathetic neurons. Since Bax is a direct transcriptional target of p53 (Miyashita and Reed, 1995
), we
propose that elevated p53 protein levels cause increased
p53-dependent transcription of Bax, and that this is sufficient to tip the balance towards neuronal apoptosis. In
support of this hypothesis, exogenous p53 is unable to mediate apoptosis of Bax
/
cortical neurons (Xiang et al.,
1998
), Bax
/
sympathetic neurons do not undergo apoptosis in response to NGF withdrawal (Deckwerth et al.,
1996
), and increased expression of Bcl2 or Bcl-xl (Garcia
et al., 1992
; Gonzalez-Garcia et al., 1995
) in sympathetic
neurons rescues NGF withdrawal induced cell death.
The in vivo data presented here support a number of additional conclusions. First, our studies demonstrate that
the postnatal period of naturally occurring sympathetic
neuron death is inhibited, but not completely eliminated
when p53 levels are lowered, indicating that p53 is essential for normal apoptosis in the SCG, but also suggesting
that other, potentially parallel death pathways are important. Such pathways may involve other p53 family members such as p73 (Jost et al., 1997
; Kaghad et al., 1997
) or
p51 (Osada et al., 1998
; Trink et al., 1998
). Second, our
data showing decreased apoptosis in the p53+/
SCG
support the idea that it is not the presence or absence of
p53 that determines apoptosis, but it is instead the levels of
p53 that are important. Precedent for such a gene dosage
effect has been documented with regard to p53 and tumorigenesis (Donehower et al., 1992
; Harvey et al., 1993
).
Third, our in vivo data demonstrate that, although p53
may be essential embryonically for regulating the proliferation and survival of sympathetic neuroblasts (Vogel and
Parada, 1998
), that by birth any resultant deficits are not
obvious, since neuron numbers in the newborn p53+/+
versus p53
/
SCG are not significantly different.
What is the biological rationale for p53 acting as a
"threshold" to neuronal apoptosis? During the period of
naturally occurring death, sympathetic neurons compete
for limiting amounts of trophic support to ultimately ensure an appropriate target innervation density. The net result of this competition is a loss of ~40-50% of sympathetic neurons over the first 2 wk of postnatal life. Our
previous data indicate that both TrkA and p75NTR are required for this process (Bamji et al., 1998
). Moreover,
these same studies demonstrate that robust activation of
TrkA antagonizes p75NTR-derived apoptotic signals and
that, conversely, p75NTR can override TrkA-derived survival signals. On the basis of the current study, we propose that p53 is a convergent downstream target that "sums"
opposing signals deriving from TrkA versus p75NTR activation, and that apoptosis is triggered when the balance of
"death" signals deriving from p75NTR is greater than the
"survival" signals deriving from TrkA. In cellular terms,
this ensures that all neurons that are incapable of sequestering sufficient target-derived NGF are rapidly and efficiently eliminated from competition.
One final issue derives from the emerging similarities
between sympathetic neuron apoptosis as induced by
NGF withdrawal and p75NTR activation. In both cases,
the MEKK-JNK pathway is induced, and in both cases,
p53 is required for apoptosis. In the case of p75, while this
receptor has been demonstrated to signal via a number of
pathways, including ceramide production (Dobrowsky et al.,1994), JNK activation (Casaccia-Bonnefil et al., 1996
), c-jun hyperphosphorylation (Bamji et al., 1998
) and NFkB
activation (Carter et al., 1996
), the results presented here
are the first to identify a required component, p53, of the
p75NTR apoptotic pathway. Given the similarities between NGF withdrawal and p75NTR activation, we propose that NGF-withdrawal-induced apoptosis may be, to a
large extent, a p75NTR-mediated process. In particular, our previous work (Bamji et al., 1998
) indicates that NGF-withdrawal induced apoptosis of sympathetic neurons is
greatly delayed in the absence of p75NTR. We propose
that, during naturally occurring sympathetic neuron death,
p75NTR may well provide the basis for a constitutive
apoptotic signal in sympathetic neurons via one of two
different mechanisms. First, there may be an autocrine p75NTR-dependent apoptotic loop; sympathetic neurons
synthesize BDNF (Causing et al., 1997
) that they process
and secrete (Causing, C.G., R. Aloyz, and F.D. Miller, unpublished observations). Since BDNF can bind to p75NTR
to cause sympathetic neuron apoptosis (Bamji et al., 1998
),
and since BDNF is required in vivo for a portion of appropriate naturally occurring sympathetic neuron death
(Bamji et al., 1998
), then this may indicate the presence of
an ongoing autocrine BDNF:p75NTR death signal. A second possibility is that p75NTR functions to mediate a constitutive death signal in the absence of ligand, as previously suggested (Rabizadeh et al., 1993
). However, it is
clear that addition of exogenous BDNF is essential for a
maximal p75NTR-dependent apoptotic signal (Bamji et al.,
1998
), indicating that even if a constitutive death mechanism(s) is in place, activation of p75NTR by exogenous,
potentially target-derived, neurotrophins is likely to play a
key role. In either case, exposure to an appropriate neurotrophin, in this case NGF, would lead to TrkA activation, thereby providing a mechanism for overriding p75
and p53-mediated apoptosis.
| |
Footnotes |
|---|
Address correspondence to Dr. F.D. Miller, Center for Neuronal Survival, Montreal Neurological Institute, 3801 rue University, Montreal, Quebec, Canada H3A 2B4. Tel.: (514) 398-4261. Fax: (514) 398-1319. E-mail: mdfm @
Received for publication 17 July 1998 and in revised form 27 October 1998.
The first three authors contributed equally to this work.
We would like to thank Phil Branton for his generous gift of the E1B55K
and A262 adenoviruses, Pierre Laneuville for help in establishing the
p53
/
colony, Jonathan Ham for providing us with the activated
MEKK1 construct, Luc Paquet for performing the recombination of the
MEKK1 adenovirus, Farid Said for his advice and assistance with generation of recombinant adenovirus, and Christine Laliberte for excellent
technical assistance.
This study was supported by grants from the Canadian Medical Research Council (MRC) and the Canadian NeuroSciences Network to F.D. Miller and D.R. Kaplan. F.D. Miller is a Killam Scholar and D.R. Kaplan is a recipient of the Harold Johns and Canadian Cancer Society Research Scientist Award. During the course of this work, S.X. Bamji and C.D. Pozniak were funded by MRC studentships, and J. Atwal by a McGill Major studentship.
| |
Abbreviations used in this paper |
|---|
PB, phosphate buffer; moi, multiplicity of infection; SCG, superior cervical ganglion.
| |
References |
|---|
|
|
|---|
| 1. |
Bamji, S.X.,
M. Majdan,
C.D. Pozniak,
D.J. Belliveau,
R. Aloyz,
J. Kohn,
C.G. Causing, and
F.D. Miller.
1998.
The p75 neurotrophin receptor mediates
neuronal apoptosis and is essential for naturally occurring sympathetic neuron death.
J. Cell Biol.
140:
911-923
|
| 2. | Belliveau, D.J., I. Krivko, J. Kohn, C. Lachance, C. Pozniak, D. Rusakov, D. Kaplan, and F.D. Miller. 1997. NGF and NT-3 both activate TrkA on sympathetic neurons but differentially regulate survival and neuritogenesis. J. Cell Biol. 136: 374-388 . |
| 3. |
Bett, A.J.,
W. Haddara,
L. Prevec, and
F.L. Graham.
1994.
An efficient and
flexible system for construction of adenovirus vectors with insertions or deletions in early regions 1 and 3.
Proc. Natl. Acad. Sci. USA.
91:
8802-8806
|
| 4. | Boise, L.H., M. Gonzalez-Garcia, C.E. Postema, L. Ding, T. Lindstem, L.A. Turka, X. Mao, G. Nunez, and C.B. Thompson. 1993. Bcl-xl, a bcl-2 related gene that functions as a dominant regulator of apoptotic cell death. Cell. 74: 597-608 [Medline]. |
| 5. | Caelles, C., A. Helmberg, and M. Karin. 1994. p53-dependent apoptosis in the absence of transcriptional activation of p53 target genes. Nature. 370: 220-223 [Medline]. |
| 6. | Campenot, R.B.. 1982. Development of sympathetic neurons in compartmentalized cultures. 1. Local control of neurite growth by nerve growth factor. Dev. Biol. 93: 1-12 [Medline]. |
| 7. | Carter, B.D., C. Kaltschmidt, B. Kaltschmidt, N. Offenhauser, R. Bohm-Matthaei, P.A. Baeuerle, and Y.-A. Barde. 1996. Selective activation of NF-kappaB by nerve growth factor through the neurotrophin receptor p75. Science. 272: 542-545 [Abstract]. |
| 8. | Casaccia-Bonnefil, P., B.D. Carter, R.T. Dobrowsky, and M.V. Chao. 1996. Death of oligodendrocytes mediated by the interaction of nerve growth factors with its receptor p75. Nature. 383: 716-719 [Medline]. |
| 9. | Causing, C.G., A. Gloster, R. Aloyz, S.X. Bamji, E. Chang, J. Fawcett, G. Kuchel, and F.D. Miller. 1997. Synaptic innervation density is regulated by neuron-derived BDNF. Neuron. 18: 257-267 [Medline]. |
| 10. | Coggeshall, R.E.. 1984. An empirical method for converting nucleolar counts to neuronal numbers. J. Neurosci. Meth. 12: 125-132 [Medline]. |
| 11. |
Creedon, D.J.,
D.M. Johnson Jr., and
J.C. Lawrence Jr..
1996.
Mitogen-activated protein kinase-independent pathways mediate the effects of nerve
growth factor and cAMP on neuronal survival.
J. Biol. Chem.
271:
20713-20718
|
| 12. | Crowder, R.J., and R.S. Freeman. 1998. Phosphatidylinositol 3-kinase and Akt protein kinase are necessary and sufficient for the survival of nerve growth factor-dependent sympathetic neurons. J. Neurosci. 15: 2833-2843 . |
| 13. | Davies, A.M., and A. Rosenthal. 1994. Neurons from mouse embryos with a null mutation in the tumour suppressor gene p53 undergo normal cell death in the absence of neurotrophins. Neurosci. Lett. 182: 112-114 [Medline]. |
| 14. |
Deckwerth, T.L., and
E.M. Johnson Jr..
1993.
Temporal analysis of events associated with programmed cell death (apoptosis) of sympathetic neurons deprived of nerve growth factor.
J. Cell Biol.
123:
1207-1222
|
| 15. | Deckwerth, T.L., J.L. Elliott, C.M. Knudson, E.M. Johnson Jr., W.D. Snider, and S.J. Korsmeyer. 1996. Bax is required for neuronal death after trophic factor deprivation and during development. Neuron. 17: 401-411 [Medline]. |
| 16. | Derijard, B., M. Hibi, I.-H. Wu, T. Barrett, B. Su, T. Deng, M. Karin, and R.J. David. 1994. JNK1: a protein kinase stimulated by UV light and ha-ras that binds and phosphorylates the c-jun activation domain. Cell. 76: 1025-1037 [Medline]. |
| 17. |
Dobrowsky, R.T.,
G.M. Jenkins, and
Y.A. Hannun.
1995.
Neurotrophins induce sphingomyelin hydrolysis: modulation by co-expression of p75 with Trk
receptors.
J. Biol. Chem.
270:
22135-22142
|
| 18. | Donehower, L.A., M. Harvey, B.L. Slagle, M.J. McArthur, and C.A. Montgomery. 1992. Mice deficient for p53 are developmentally normal but susceptible to spontaneous tumors. Nature. 356: 215-221 [Medline]. |
| 19. |
Easton, R.M.,
T.L. Deckwerth,
A.S. Parsadanian, and
E.M. Johnson Jr..
1997.
Analysis of the mechanism of loss of trophic factor dependence associated
with neuronal maturation: a phenotype indistinguishable from Bax deletion.
J. Neurosci.
17:
9656-9666
|
| 20. |
Eilers, A.,
J. Whitfield,
C. Babij,
L.L. Rubin, and
J. Ham.
1998.
Role of the jun
kinase pathway in the regulation of c-Jun expression and apoptosis in sympathetic neurons.
J. Neurosci.
18:
1713-1724
|
| 21. | El-Deiry, W.S., T. Tokino, V.E. Velculescu, D.B. Levy, R. Parsons, J.M. Trent, D. Lin, E. Mercer, K.W. Kinzler, and B. Vogelstein. 1993. WAF1, a potential mediator of p53 tumor suppression. Cell. 72: 817-825 [Medline]. |
| 22. | Elledge, R.M., and W.-H. Lee. 1995. Life and death by p53. Bioessays. 17: 923-930 [Medline]. |
| 23. |
Estus, S.,
W.J. Zaks,
R.S. Freeman,
M. Gruda,
R. Bravo, and
E.M. Johnson Jr..
1994.
Altered gene expression in neurons during programmed cell death:
identification of c-jun as necessary for neuronal apoptosis.
J. Cell Biol.
127:
1717-1727
|
| 24. | Freeman, R.S., S. Estus, and E.M. Johnson Jr.. 1994. Analysis of cell-related gene expression in postmitotic neurons: selective induction of Cyclin D1 during programmed cell death. Neuron. 12: 343-355 [Medline]. |
| 25. | Franklin, J.L., C. Sans-Rodriguez, A. Juhasz, T.L. Deckwerth, and E.M. Johnson Jr.. 1995. Chronic depolarization prevents programmed death of sympathetic neurons in vitro but does not support growth: requirement for Ca2+ influx but not trk activation. J. Neurosci. 15: 643-664 [Abstract]. |
| 26. |
Garcia, I.,
I. Martinou,
Y. Tsujimoto, and
J.-C. Martinou.
1992.
Prevention of programmed cell death of sympathetic neurons by the Bcl2 protooncogene.
Science.
258:
302-304
|
| 27. |
Gonzalez-Garcia, M.,
I. Garcia,
L. Ding,
S. O'Shea,
L.H. Boise,
C.B. Thompson, and
G. Nunez.
1995.
Bcl-x is expressed in embryonic and postnatal neural tissues and functions to prevent neuronal cell death.
Proc. Natl. Acad.
Sci. USA.
92:
4304-4308
|
| 28. | Graham, F.L., and L. Prevec. 1991. Manipulation of adenovirus vectors in Methods in Molecular Biology, EJ Murray ed. The Humana Press, Totone, NJ. 109-128. |
| 29. | Hainut, P.. 1995. The tumor suppressor protein p53: a receptor to genotoxic stress that controls cell growth and survival. Curr. Opin. Oncol. 7: 76-82 [Medline]. |
| 30. | Ham, J., C. Babij, J. Whitfield, C.M. Pfarr, D. Lallemand, M. Yaniv, and L.L. Rubin. 1995. A c-jun dominant negative mutant protects sympathetic neurons against programmed cell death. Neuron. 14: 927-939 [Medline]. |
| 31. | Harvey, M., M.J. McArthur, C.A. Montgomery Jr., J.S. Butel, A. Bradley, and L.A. Donehower. 1993. Spontaneous and carcinogen-induced tumorigenesis in p53-deficient mice. Nat. Genet. 5: 225-229 [Medline]. |
| 32. | Hendry, I.A.. 1977. Cell division in the developing sympathetic nervous system. J. Neurocytol. 6: 299-309 [Medline]. |
| 33. | Herdegen, T., P. Skene, and M. Bahr. 1997. The c-Jun protein-transcriptional mediator of neuronal survival, regeneration and death. Trends Neurosci. 20: 227-231 [Medline]. |
| 34. | Hockenberry, D., G. Nunez, C.L. Milliman, R.D. Schreiber, and S.J. Korsmeyer. 1990. Bcl-2 is an inner mitochondrial membrane protein that blocks programmed cell death. Nature. 377: 695-701 . |
| 35. | Hu, M.C., W.R. Qiu, and Y.P. Wang. 1997. JNK1, JNK2, and JNK3 are p53 N-terminal serine 34 kinases. Oncogene. 15: 2277-2287 [Medline]. |
| 36. | Jacks, T., and R.A. Weinberg. 1996. Cell-cycle control and its watchman. Nature. 381: 643-644 [Medline]. |
| 37. | Johnson, D., A. Lanahan, C.R. Buck, A. Sehgal, C. Morgan, E. Mercer, M. Bothwell, and M. Chao. 1986. Expression and structure of the human NGF receptor. Cell. 47: 545-554 [Medline]. |
| 38. | Johnson, E.M. Jr., and T.L. Deckwerth. 1993. Molecular mechanisms of developmental neuronal death. Ann. Rev. Neurosci. 16: 31-46 [Medline]. |
| 39. | Jost, C.A., M.C. Marin, and W.G. Kaelin Jr.. 1997. p73 is a human p53-related protein that can induce apoptosis. Nature. 389: 191-194 [Medline]. |
| 40. | Kaghad, M., H. Bonnet, A. Yang, L. Creancier, J.C. Biscan, A. Valent, A. Minty, P. Chalon, J.M. Lelias, X. Dumont, et al . 1997. Monoallelically expressed gene related to p53 at 1p36, a region frequently deleted in neuroblastoma and other human cancers. Cell. 90: 809-819 [Medline]. |
| 41. |
Kaplan, D.R.,
B.L. Hempstead,
D. Martin-Zanca,
M.V. Chao, and
L.F. Parada.
1991a.
The trk proto-oncogene product: a signal transducing receptor for
nerve growth factor.
Science.
252:
554-558
|
| 42. | Kaplan, D.R., D. Martin-Zanca, and L.F. Parada. 1991b. Tryosine phosphorylation and tyrosine kinase activity of the trk proto-oncogene product induced by NGF. Nature. 350: 158-160 [Medline]. |
| 43. | Klein, R., S. Jing, V. Nanduri, E. O'Rourke, and M. Barbacid. 1991. The trk proto-oncogene encodes a receptor for nerve growth factor. Cell. 65: 189-197 [Medline]. |
| 44. | Knusel, B., S.J. Rabin, F. Hefti, and D.R. Kaplan. 1994. Regulated neurotrophin receptor responsiveness during neuronal migration and early differentiation. J. Neurosci. 14: 1542-1554 [Abstract]. |
| 45. | Lane, D.P.. 1993. A death in the life of p53. Nature. 362: 786-787 [Medline]. |
| 46. |
Levi-Montalcini, R..
1987.
The nerve growth factor 35 years later.
Science.
237:
1154-1162
|
| 47. | Levine, A.J.. 1997. p53, the cellular gatekeeper for growth and division. Cell. 88: 323-331 [Medline]. |
| 48. | Li, Y., M. Chopp, Z.G. Zhang, C. Zaloga, L. Niewenhuis, and S. Gautam. 1994. p53-immunoreactive protein and p53 mRNA expression after transient middle cerebral artery occlusion in rats. Stroke. 25: 849-855 [Abstract]. |
| 49. |
Martinou, I.,
P.A. Fernandez,
M. Missotten,
E. White,
B. Allet,
R. Sadoul, and
J.C. Martinou.
1995.
Viral proteins E1B19K and p35 protect sympathetic
neurons from cell death induced by NGF deprivation.
J. Cell Biol.
128:
201-208
|
| 50. | Massie, B., J. Dionne, N. Lamarche, J. Fleurent, and Y. Langelier. 1995. Improved adenovirus vector provides herpes simplex virus ribonucleotide reductase R1 and R2 subunits very efficiently. Biotechnology. 13: 602-608 [Medline]. |
| 51. | Miller, F.D., and D.R. Kaplan. 1998. Life and death decisions: a biological role for the p75 neurotrophin receptor. Cell Death Differ. 5: 343-345 . [Medline] |
| 52. | Miyashita, T., and J.C. Reed. 1995. p53 is a direct transcriptional activator of the human Bax gene. Cell. 80: 293-299 [Medline]. |
| 53. |
Morrison, R.S.,
H.J. Wenzel,
Y. Kinoshita,
C.A. Robbins,
L.A. Donehower, and
P.A. Schwartzkroin.
1996.
Loss of the p53 tumor suppressor gene protects neurons from kainate-induced cell death.
J. Neurosci.
16:
1337-1345
|
| 54. | Oppenheim, R.W.. 1991. Cell death during development of the nervous system. Annu. Rev. Neurosci. 14: 453-501 [Medline]. |
| 55. | Osada, M., M. Ohba, C. Kawahara, C. Ishioka, R. Kanamaru, I. Katoh, Y. Ikawa, Y. Nimura, A. Nakagawara, M. Obinata, and S. Ikawa. 1998. Cloning and functional analysis of human p51, which structurally and functionally resembles p53. Nat. Med. 4: 839-843 [Medline]. |
| 56. |
Park, D.S.,
S.E. Farinelli, and
L.A. Greene.
1996.
Inhibitors of cycline-dependent kinases promote survival of postmitotic neuronally differentiated PC12
cells and sympathetic neurons.
J. Biol. Chem.
271:
8161-8169
|
| 57. | Polyak, K., Y. Xia, J.L. Zweier, K.W. Kinzler, and B. Vogelstein. 1997. A model for p53-induced apoptosis. Nature. 389: 300-305 [Medline]. |
| 58. | Querido, E., R.C. Marcellus, A. Lai, R. Charbonneau, J.G. Teodoro, G. Ketner, and P.L. Branton. 1997. Regulation of p53 levels by the E1B 55-Kilodalton protein and E4orf6 in adenovirus-infected cells. J. Virol. 71: 3788-3798 [Abstract]. |
| 59. |
Rabizadeh, S.,
J. Oh,
L.T. Zhong,
J. Yang,
C.M. Bitler,
L.L. Butcher, and
D.E. Bredesen.
1993.
Induction of apoptosis by the low-affinity NGF receptor.
Science.
261:
345-348
|
| 60. | Radeke, M.J., T.P. Misko, C. Hsu, L.A. Herzenberg, and E.M. Shooter. 1987. Gene transfer and molecular cloning of the rat nerve growth factor receptor. Nature. 325: 593-596 [Medline]. |
| 61. |
Riccio, A.,
B.A. Pierchala,
C.L. Ciarallo, and
D.D. Ginty.
1997.
An NGF-TrkA-mediated retrograde signal to transcription factor CREB in sympathetic neurons.
Science
277:
1097-1100
|
| 62. | Rubin, L.L., K.L. Philpott, and S.F. Brooks. 1993. The molecular mechanisms of neuronal apoptosis. Curr. Opin. Neurobiol. 3: 391-394 . |
| 63. | Sadoul, R., A.L. Quiquerez, I. Martinou, P.A. Fernandez, and J.C. Martinou. 1996. p53 protein in sympathetic neurons: cytoplasmic localization and no apparent function in apoptosis. J. Neurosci. Res. 43: 594-601 [Medline]. |
| 64. |
Sakhi, S.,
A. Bruce,
N. Sun,
G. Tocco,
M. Baudry, and
S.S. Schreiber.
1994.
p53
induction is associated with neuronal damage in the central nervous system.
Proc. Natl. Acad. Sci. USA.
91:
7525-7529
|
| 65. | Sanchez, I., R.T. Hughes, B.J. Mayer, K. Yee, J.R. Woodgett, J. Avruch, J.M. Kyriakis, and L.I. Zon. 1994. Role of SAPK/ERK kinase-1 in the stress-activated pathway regulating transcription factor c-Jun. Nature. 372: 794-798 [Medline]. |
| 66. |
Senger, D.L., and
R.B. Campenot.
1997.
Rapid retrograde tyrosine phosphorylation of trkA in response to NGF in rat sympathetic neurons.
J. Cell Biol.
138:
411-421
|
| 67. |
Slack, R.S.,
D.J. Belliveau,
M. Rosenberg,
J. Atwal,
H. Lochmuller,
R. Aloyz,
A. Haghighi,
B. Lach,
P. Seth,
E. Cooper, and
F.D. Miller.
1996.
Adenovirus-mediated gene transfer of the tumor suppressor, p53, induces apoptosis
in postmitotic neurons.
J. Cell Biol.
135:
1-12
|
| 68. |
Slack, R.S.,
H. El-Bizri,
J. Wong,
D.J. Belliveau, and
F.D. Miller.
1998.
A critical temporal requirement for the retinoblastoma protein family during neuronal determination.
J. Cell Biol.
140:
1497-1509
|
| 69. | Teodoro, J.G., and P.E. Branton. 1997. Regulation of p53-dependent apoptosis, transcriptional repression, and cell transformation by phosphorylation of the 55-kilodalton E1B protein of human adenovirus type 5. J. Virol. 71: 3620-3627 [Abstract]. |
| 70. | Toyoshima, H., and T. Hunter. 1994. p27, a novel inhibitor of G1 cyclin-Cdk protein kinase activity, is related to p21. Cell. 78: 67-74 [Medline]. |
| 71. | Trink, B., K. Okami, L. Wu, V. Sriuranpong, J. Jen, and D. Sidransky. 1998. A new human p53 homologue. Nat. Med. 4: 747-748 [Medline]. |
| 72. | Virdee, K., and A.M. Tolkovsky. 1995. Activation of p44 and p42 Map kinases is not essential for the survival of rat sympathetic neurons. Eur. J. Neurosci. 7: 2159-2169 [Medline]. |
| 73. | Vogel, K.S., and L.F. Parada. 1998. Sympathetic neuron survival and proliferation are prolonged by loss of p53 and neurofibromin. Mol. Cell. Neurosci. 11: 19-28 [Medline]. |
| 74. | Weskamp, G., and L.F. Reichardt. 1991. Evidence that biological activity of NGF is mediated through a novel subclass of high affinity receptors. Neuron. 6: 649-663 [Medline]. |
| 75. |
White, E..
1996.
Life, death, and the pursuit of apoptosis.
Genes Dev.
10:
1-15
|
| 76. | Wood, K.A., and R.J. Youle. 1995. The role of free radicals and p53 in neuron apoptosis in vivo. J. Neurosci. 15: 5851-5857 [Abstract]. |
| 77. |
Xiang, H.,
Y. Kinoshita,
C.M. Knudson,
S.J. Korsmeyer,
P.A. Schwartzkroin, and
R.S. Morrison.
1998.
Bax involvement in p53-mediated neuronal cell
death.
J. Neurosci.
18:
1363-1373
|
| 78. | Yan, M., T. Dai, J.C. Deak, J.M. Kyriakis, L.I. Zon, J.R. Woodgett, and D.J. Templeton. 1994. Activation of stress-activated protein kinase by MEKK1 phosphorylation of its activator SEK1. Nature. 372: 798-800 [Medline]. |
| 79. | Yang, E., J. Zha, E.J. Jockel, L.H. Boise, C.B. Thompson, and S.J. Korsmeyer. 1995. Bad, a heterodimeric partner for Bcl-xl and Bcl-2, displaces Bax and promotes cell death. Cell. 80: 285-291 [Medline]. |
| 80. | Yang, D., C.-Y. Kuan, A.J. Whitmarsh, M. Rincon, T.S. Zheng, R.J. Davis, P. Rakic, and R.A. Flavell. 1997. Absence of excitotoxicity-induced apoptosis in the hippocampus of mice lacking the JNK3 gene. Nature. 289: 865-870 . |
| 81. | Yew, P.R., C.C. Kao, and A.J. Berk. 1990. Dissection of functional domains in the adenovirus 2 early 1B 55K polypeptide by suppressor-linker insertional mutagenesis. Virology. 179: 795-805 [Medline]. |
| 82. | Yew, P.R., and A.J. Berk. 1992. Inhibition of p53 transactivation required for transformation by adenovirus early 1B protein. Nature. 337: 82-85 . |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|