|
||

* Department of Anatomy and Cell Biology, University of Heidelberg, D-69120 Heidelberg, Germany;
Department of Cell
Biology and Neuroanatomy, University of Minnesota Medical School, Minneapolis, Minnesota 05545; and § Department of
Medicine and Department of Anatomy and Structural Biology, Albert Einstein College of Medicine, Bronx, New York 10461
| |
Abstract |
|---|
|
|
|---|
Podocytes are unique cells that are decisively involved in glomerular filtration. They are equipped with a complex process system consisting of major processes and foot processes whose function is insufficiently understood (Mundel, P., and W. Kriz. 1995. Anat. Embryol. 192:385-397). The major processes of podocytes contain a microtubular cytoskeleton. Taking advantage of a recently established cell culture system for podocytes with preserved ability to form processes (Mundel, P., J. Reiser, A. Zúñiga Mejía Borja, H. Pavenstädt, G.R. Davidson, W. Kriz, and R. Zeller. 1997b. Exp. Cell Res. 36:248-258), we studied the functional significance of the microtubular system in major processes. The following data were obtained: (a) Microtubules (MTs) in podocytes show a nonuniform polarity as revealed by hook-decoration. (b) CHO1/ MKLP1, a kinesin-like motor protein, is associated with MTs in podocytes. (c) Treatment of differentiating podocytes with CHO1/MKLP1 antisense oligonucleotides abolished the formation of processes and the nonuniform polarity of MTs. (d) During the recovery from taxol treatment, taxol-stabilized (nocodazole- resistant) MT fragments were distributed in the cell periphery along newly assembled nocodazole-sensitive MTs. A similar distribution pattern of CHO1/MKLP1 was found under these circumstances, indicating its association with MTs. (e) In the recovery phase after complete depolymerization, MTs reassembled exclusively at centrosomes. Taken together, these findings lead to the conclusion that the nonuniform MT polarity in podocytes established by CHO1/MKLP1 is necessary for process formation.
Key words: glomerular podocyte; process formation; microtubular polarity; CHO1/MKLP1; microtubule-organizing center| |
Introduction |
|---|
|
|
|---|
PODOCYTES are highly organized cells with thick major processes and delicate foot processes (Mundel
and Kriz, 1995
; Kobayashi and Mundel, 1998
). The
major processes contain a well-developed cytoskeleton
composed of microtubules (MTs)1 and intermediate filaments (IFs), while foot processes contain a core cytoskeleton
of actin filaments (AFs). A recently established cell culture
model of conditionally immortalized podocytes allows process formation to be analyzed in an inducible system (Mundel et al., 1997a
,b). The mechanism(s) governing process
formation have so far been studied mainly in neurons,
where MTs and their associated proteins play a crucial
role in the development and maintenance of cell processes.
In nonneuronal cells, including podocytes, the functional
relevance of the microtubular cytoskeleton during process
formation remains to be elucidated (Kobayashi and Mundel, 1998
).
MTs are polarized polymers of tubulin heterodimers
with fast-growing plus ends and slow-growing minus ends.
Under physiological conditions, the microtubule-organizing center (MTOC) is necessary to initiate nucleation of
MTs. The
-isoform of tubulin appears to be necessary for
MT nucleation (Joshi et al., 1992
; Moritz et al., 1995
); so
far, the centrosome is accepted as the most significant
-tubulin-containing MTOC in mammalian cells. MTs are
generally nucleated at the centrosome, which also serves
as the MTOC during interphase (Pereira and Schiebel,
1997
; Hyman and Karsenti, 1998
). The MT nucleation activity of the centrosome can determine the polarity of
MTs; a uniform arrangement of MTs can be established by
nucleation of MTs from the perinuclear centrosome, leading to the generation of a plus end-distal polarity of MTs. However, in dendrites (Baas et al., 1988
, 1989
; Wang et al.,
1996
) and in glial cell processes (Kidd et al., 1994
; Lunn et
al., 1997
), the polarity of MTs is nonuniform. MTs are oriented both in plus end-distal and minus end-distal fashions. The generation of this mixed MT polarity requires
an additional mechanism, since MTOCs other than centrosomes are unlikely to exist in neurons (Baas and Joshi,
1992
; Yu et al., 1993
). Currently, the most likely hypothesis explaining the nonuniform orientation of dendritic MTs
is as follows: after assembly at centrosomes, MTs are released from centrosomes and transported in an antiparallel (i.e., minus end-distal fashion) along preexisting plus
end-distal MTs (Baas, 1997
). This hypothesis requires a
motor protein that mediates the antiparallel transport of
MTs; conventional MT-associated proteins establish only
uniform MT polarity in a plus end-distal fashion (Baas et al.,
1991
; Chen et al., 1992
; Takemura et al., 1995
).
CHO1/MKLP1 was originally defined by a monoclonal
antibody called "CHO1," which stained the midbody of
mitotic spindles in CHO cells (Selitto and Kuriyama, 1988).
Later, it was characterized as a plus end-directed motor
protein enabling antiparallel sliding of MTs (Nislow et al.,
1992
). Molecular cloning of CHO1/MKLP1 revealed that
it is a member of the kinesin superfamily (Nislow et al.,
1992
). Recent evidence suggests that CHO1/MKLP1 motor has a dual function: force generation in mitosis (Nislow
et al., 1990
, 1992
) and transport of MTs in dendrites
(Sharp et al., 1997
; Yu et al., 1997
). The latter function implies that CHO1/MKLP1 conveys MTs in a minus end-distal fashion along preexisting plus end-distal MTs to establish the nonuniform polarity of MTs.
Since all cells with nonuniform MT polarity described so
far are arborized cells with prominent processes, we were
interested to see whether podocytes are equipped with
both plus and minus end-distal MTs, and if so, whether
this nonuniform MT polarity plays a role in process formation of these cells. To clarify this issue, we analyzed the polarity of MTs in a differentiated podocyte cell line and
revealed its nonuniformity. Next, we analyzed the expression of CHO1/MKLP1 motor protein in podocytes and its
relevance for the nonuniform polarity of MTs and process
formation. We also demonstrated that the centrosome is
the major
-tubulin-containing MTOC in cultured podocytes. Based on these findings, we discuss the mechanism
generating the nonuniform polarity of MTs and the functional significance of this mixed polarity for the process formation of podocytes.
| |
Materials and Methods |
|---|
|
|
|---|
Cell Culture of Mouse Podocytes
The generation and initial characterization of conditionally immortalized
mouse podocyte clones (hereafter referred to as "podocytes") has previously been described (Mundel et al., 1997b
). Podocytes were maintained
in RPMI 1640 medium (Life Technologies, Eggenstein, Germany) supplemented with 10% FCS (Boehringer Mannheim, Mannheim, Germany),
100 U/ml penicillin, and 100 µg/ml streptomycin (Life Technologies) in a
humid atmosphere with 5% CO2. To propagate podocytes, the culture
medium was supplemented with 10 U/ml recombinant mouse
-interferon
(Sigma, Munich, Germany) to enhance expression of T-antigen, and cells
were cultivated at 33°C (permissive conditions). To induce differentiation,
podocytes were cultured on type I-collagen (Biochrom, Berlin, Germany)
at 37°C without
-interferon (nonpermissive conditions). Since it takes at
least 10 d to induce differentiation, podocytes maintained for less than 1 wk
under nonpermissive conditions are referred to as "differentiating cells"
or "process-forming cells," while those cultivated for 2-3 wk at nonpermissive conditions were termed "differentiated cells" or "process-bearing
cells." In the present study, podocytes of clone 5 (MPC-5; Mundel et al., 1997b
) between passage 15 and 25 were used in all experiments.
Determination of Microtubular Polarity
The polarity of MTs in podocytes was determined by the "hook" decoration method (Heidemann, 1991
). MT proteins (C2S fraction) were enriched from porcine brains by two cycles of temperature-dependent depolymerization and polymerization in the presence of glycerol (Shelanski et al.,
1973
). Tubulin was purified from the C2S fraction by column chromatography (Vallee, 1986
). Differentiated podocytes that had been cultured for
2-3 wk under nonpermissive conditions were rinsed briefly with PBS and
permeabilized by incubation with prewarmed PEMG buffer (0.5 M Pipes,
pH 6.9, 1 mM EGTA, 1 mM MgCl2, and 1 mM GTP) containing 0.1% saponin (Sigma) and 2 mg/ml tubulin for 2 min. Subsequently, permeabilized cells were incubated with PEMG buffer containing 2 mg/ml tubulin,
but without saponin, at 37°C for 30 min. Both preparations, C2S fraction
and purified tubulin, gave identical results for hook decoration. Samples
were fixed with 4% glutaraldehyde in PBS and further processed for transmission electron microscopy (TEM). Sequences of serial ultrathin sections, including the profiles of centrosomes, were obtained to confirm
the proximal-distal axis of examined podocytes and observed by TEM.
The polarity of each MT (either plus end- or minus end-distal) was determined by "hook-handedness" as described by Heidemann (1991)
. Viewed
from the cell periphery, MTs with clockwise hooks were judged as plus
end-distal, whereas MTs with counterclockwise hooks were judged as minus end-distal. This evaluation was done in two series of ultrathin sections, each containing part of a cell starting at the centrosome and extending into the periphery of a process as reported previously (Takemura et al., 1995
). The numbers of MTs identified either as plus end- or as minus
end-distal on each electron micrograph were summarized among the sections selected from several independent sequences (Table I).
|
Immunocytochemistry
The characterization of the antibodies against CHO1/MKLP1 motor protein were previously reported (Sellitto and Kuriyama, 1988
; Nislow et al.,
1992
; Kuriyama et al., 1994
). Differentiated podocytes were fixed with absolute methanol at
20°C for 5 min and immunostained with polyclonal
CHO1/MKLP1 antibody at 1:50 dilution. In some experiments, double labeling immunofluorescence with polyclonal anti-CHO1/MKLP and monoclonal
-tubulin (Oncogene Science, Hamburg, Germany) was carried
out. Antigen-antibody complexes were visualized with fluorochrome
(Cy2, Cy3)-conjugated secondary antibodies (BioTrend, Cologne, Germany). CHO cells were used as a positive control of immunostaining.
Detection of CHO1/MKLP1 mRNA Expression by RT-PCR
Total RNA was isolated from differentiated and undifferentiated podocytes using the RNeasy kit (QIAGEN, Hilden Germany). Reverse transcription (RT) of cDNA and PCR were performed according to standard
protocols using the following two primers: GCACACCTGTCAATGTCACC (sense primer; nucleotide number +2213 to +2232 of hamster
CHO1/MKLP1 cDNA; Kuriyama et al., 1994
) and TGATCTACCCATCTGCTCCC (antisense primer; +2425 to +2444). These two primers are
identical between hamster and mouse CHO1/MKLP1. After 40 cycles
of amplification, PCR products were analyzed by agarose gel electrophoresis.
Inhibition of CHO1/MKLP1 Expression by Antisense Oligonucleotides
Based on the cDNA sequence of CHO1/MKLP1, two antisense (AS)
and two corresponding sense (S) oligonucleotides (AS1:CAGGTTTCCTGGGCATCTT, AS2:AGCTTTCGCTGGTTTCATG, S1:AAGATGCCCAGGAAACCTG, and S2:CATGAAACCAGCGAAAGCT) were
designed as described previously (Sharp et al., 1997
; Yu et al., 1997
). AS1
corresponds to the sequence between +19 and +37 of the hamster CHO1/
MKLP1 cDNA, and AS2 corresponds to the sequence between
1 and
+18; S1 and S2 are the inverse complements of AS1 and AS2, respectively. Purified phosphorothioated oligonucleotides (Research Genetics
Inc., Huntsville, AL) were resolved in serum-free medium and kept at
80°C until use. Podocytes were cultured for 4 d under nonpermissive
conditions before they were plated onto collagen-coated coverslips; these
postmitotic podocytes begin to develop processes (Mundel et al., 1997b
).
Starting 1 d after plating, podocytes were cultivated for up to 7 d in the
presence of oligonucleotides at 0.5-10 µM by daily renewal of oligonucleotide-containing medium and observed by phase contrast microscopy.
Cells were immunostained for CHO1/MKLP1 and MTs or processed for
hook decoration. In some experiments, podocytes were further cultured in
the absence of oligonucleotides after antisense treatment to confirm the
reversibility of the observed effects.
Visualization of Taxol-stabilized Microtubules during Process Formation
Podocytes cultured for 4 d under nonpermissive conditions were plated
onto collagen-coated coverslips. 6 h after plating, cells were treated with
0.1-10 µM taxol (paclitaxel; Sigma) for 3 d and immunostained for MTs
and AFs as described above. After taxol treatment, podocytes were further cultured for 3 d in the absence of taxol to permit recovery of MT arrays, followed by immunostaining for
-tubulin and CHO1/MKLP1. Some
cells recovering from taxol treatment were treated with 10 µM nocodazole
for 2 h before immunostaining.
Localization of the MTOC
The MTOC was visualized by observation of MT arrays along the time
course during recovery from nocodazole treatment (Takemura et al.,
1995
). Differentiated podocytes were incubated with 10 µM nocodazole
(methyl[5-(2-thienylcarbonyl)-1H-benzeimidazol-2yl]carbamate; Sigma) for
2 h; afterwards, nocodazole was washed out with normal medium. At several time points during the recovery phase (0, 1, 2, 5, 10, 30, 60, and 120 min), cells were fixed with a prewarmed (37°C) MT-stabilizing fixative
(0.1 M Pipes, pH 6.9, 5 mM EGTA, 1 mM MgCl2, 4% polyethylene glycol
6000, 0.5% Triton X-100, 2% paraformaldehyde, and 4% sucrose). This
fixative extracts free tubulin subunits but leaves polymerized MTs intact
(Okabe and Hirokawa, 1988
). Immunostaining of paraformaldehyde-fixed cells was performed as previously described (Mundel et al., 1997b
)
using
-tubulin mAb and fluorochrome-conjugated phalloidin (Sigma). Some cells were stained with vimentin polyclonal antibody (ProGen, Heidelberg, Germany) to visualize the distribution of IFs. To label centrosomes, podocytes were fixed in the recovery phase after nocodazole
treatment with methanol at
20°C for 5 min, rinsed with PBS, and stained
with affinity-purified
-tubulin antiserum raised against a Xenopus
-tubulin fusion protein (Stearns et al., 1991
; Reinsch and Karsenti, 1994
; courtesy of S. Reinsch, EMBL, Heidelberg, Germany).
| |
Results |
|---|
|
|
|---|
The Polarity of Microtubules in Podocytes Is Nonuniform
To characterize the MT arrays of cultured podocytes, we
first examined their intracellular distribution and polarity.
Differentiated podocytes possess prominent cell processes
containing MTs that radiate from the perinuclear region
into the cell periphery (Fig. 1, a and b). By applying the
hook decoration technique in a series of ultrathin sections,
the polarity of MTs in differentiated podocytes was determined. When tracing MTs from their distal end, clockwise hooks show their plus end-distal polarity, whereas counterclockwise hooks indicate their minus end-distal polarity (Heidemann, 1991
). The results from two independent
sets of ultrathin serial sections are shown in Table I. The
analysis of cross-cut MT profiles of 15 sections from the
two series revealed that 36% of MTs showed minus end-
distal polarity with counterclockwise hooks (Table I). Heidemann (1991)
reported that the rate of mismatching between the handedness of hooks and the polarity of MTs is
less than 10%, i.e., if all MTs are oriented in a uniform
plus end-distal fashion, then the percentage of counterclockwise hooks is less than 10%, e.g., 1-6% in mature
neuronal axons where MTs are uniformly oriented (Baas
et al., 1989
). Therefore, our data show that podocytes contain minus end-distal MTs resulting in the nonuniform
(mixed) polarity of MTs. The observed efficiency of ~80%
for hook decoration of MTs (the ratio of hook-decorated
MTs among all MTs) in the present study was similar to
levels of hook decoration observed in previous reports
(Baas et al., 1989
; Takemura et al., 1995
). The frequency of minus end-distal MTs varied not only among different
MT bundles but also within individual MT bundles. A
given region of an MT bundle could contain up to 50% minus end-distal MTs, while a different region of the same
bundle could contain only a few of them. Along the proximal-distal axis of one cell, the percentage of minus end-
distal MTs per section was 43, 31, 20, 40, 33, 0, 17, 10, 20, 43, 50, and 20% from the proximal to distal sites. In other words, the percentage of minus end-distal MTs varied randomly along the proximal-distal axis.
|
CHO1/MKLP1 Motor Protein Is Found along Microtubules in Podocytes
Since the nonuniform polarity of MTs in podocytes could
be achieved by motor-dependent assembly, we next examined the expression of CHO1/MKLP1. Differentiated podocytes showed CHO1/MKLP1 immunolabeling in a punctated pattern in the cytoplasm (Fig. 2). Double staining with
-tubulin showed that CHO1/MKLP1 was localized
in a punctated pattern on MTs, indicating the association
of CHO1/MKLP1 with MTs in podocyte processes (Fig. 2
c). To confirm the immunocytochemical results, we analyzed the expression of CHO1/MKLP1 by RT-PCR using RNA from undifferentiated and differentiated podocytes.
In both samples, a PCR product with the expected length
of 232 bp was amplified (Fig. 2 d). These findings corroborate the expression of CHO1/MKLP1 in podocytes during
proliferation and after differentiation.
|
Inhibition of CHO1/MKLP1 Expression Abolished Process Formation of Podocytes
To establish a functional role of CHO1/MKLP1 in podocytes, expression of CHO1/MKLP1 was inhibited by AS
oligonucleotide treatment of process-forming podocytes
(for details see Materials and Methods). Treatment of differentiating cells with AS oligonucleotides for 7 d abolished
process formation of podocytes; cell bodies remained small, and only a few short processes developed (Fig. 3 a,
compare with Figs. 3 b and 1 a). The effects of AS oligonucleotides were dose dependent; cells treated with 3 µM
were smaller in size than those treated with 1 µM. In all
subsequent experiments, podocytes were treated with 3 µM oligonucleotides. In AS-treated cells, cytoplasmic expression of CHO1/MKLP1 was absent. Only a perinuclear, nonspecific background staining was found in these
cells (Fig. 3 c). In contrast, S-treated cells showed a normal
punctated distribution pattern CHO1/MKLP1 (Fig. 3 d,
compare with Fig. 2 a). Hook decoration revealed that in
AS-treated podocytes, MT polarity was almost uniform
(Fig. 3 e). 83% of MTs showed plus end-distal polarity, which is significantly higher than those in control cells (Table I). In contrast, S oligonucleotide-treated cells contained MTs with nonuniform polarity in usual frequency
(Fig. 3 f), proving that CHO1/MKLP1 is required for the
generation of nonuniform MT polarity in podocytes. The
antisense treatment was not accompanied by a reduction
of polymerized MTs (data not shown). However, the cytoplasm of AS-treated cells contained less membrane-bounded organelles (Fig. 3 e) as compared with S-treated
(Fig. 3 f) or nontreated cells (Fig. 1, c and d). In addition,
AS-treated cells sometimes contained abnormally clustered organelles in their cell bodies (data not shown).
These observations suggest an impaired transport of membrane bounded in AS-treated podocytes. In some experiments, cells were treated with AS oligonucleotides for 7 d
and then further incubated for 7 d in the absence of AS
oligonucleotides. In these cells, the effects of AS oligonucleotides were fully reversible; after 4 d without AS oligonucleotides, process formation and cytoplasmic expression of CHO1/MKLP1 were completely restored, and cells
were indistinguishable from S-treated or untreated cells (data not shown). Treatment with S oligonucleotides did
not interfere with process formation or normal expression
of CHO1/MKLP1, with this clearly ruling out possible toxicity of oligonucleotides per se. These observations demonstrate that cytoplasmic expression of CHO1/MKLP1
along MTs is required for normal process formation of
podocytes. When proliferating podocytes were treated
with AS oligonucleotides, their proliferation rate was
markedly reduced. In AS-treated cells, no mitotic spindles
were found, while in S-treated or untreated preparations
dividing cells with spindle formation were frequently seen
(data not shown). This inhibition of podocyte cell division
is consistent with previous reports describing CHO1/
MKLP1 as a mitotic motor (Selitto and Kuriyama, 1988;
Nislow et al., 1990
, 1992
).
|
Taxol-stabilized Microtubules Are Redistributed from the Perinuclear Region into the Cell Periphery
To study the course of MT rearrangement in podocytes, MT arrays were disrupted and then allowed to recover. The application of taxol to podocytes before process formation induced strong perinuclear clustering of MTs and inhibition of process formation (Fig. 4 a). After removal of taxol, cell bodies increased in size and processes developed. During the recovery phase, strongly labeled MT fragments (probably representing taxol-stabilized remnants) were detected along weakly labeled MTs in the cell body and in processes (Fig. 4 b). The amount of MTs continuously running from the centrosomal region to the cell periphery was much lower in cells recovering from taxol treatment (Fig. 4 b) than in normal podocytes (Fig. 1 b). Treatment of these cells with 10 µM nocodazole for 2 h allowed us to distinguish two populations of MTs: weakly stained MTs susceptible to nocodazole treatment and strongly labeled MT fragments resistant to nocodazole treatment (Fig. 4 c). Such strongly stained MT fragments were preferentially observed after taxol treatment and subsequent nocodazole treatment. These findings indicate that taxol-stabilized MT fragments became resistent to nocodazole treatment (de Brabander et al., 1981), while MTs assembled de novo after taxol treatment were sensitive to nocodazole. Furthermore, during recovery of normal podocyte morphogenesis after taxol removal, MT fragments were redistributed from perinuclear MT clusters to the cell periphery in a punctated pattern along newly assembled MTs. The punctated distribution pattern of CHO1/MKLP1 in these cells was quite similar to that of nocodazole-resistent MT fragments (Fig. 4, b and d). The association of CHO1/MKLP1 with MTs was confirmed in double labeling experiments (data not shown).
|
The Centrosome Is the
-Tubulin-expressing
MTOC in Podocytes
To determine whether MT nucleation also plays a role in
the arrangement of minus end-distal MTs, MT nucleation
sites were visualized in podocytes. Treatment with nocodazole for 2 h caused complete disassembly of MTs in
differentiated podocytes (Fig. 5, a and b). In nocodazole-treated cells, tubulin staining was diffuse around nuclei or
almost absent (Fig. 5 a, compare with Fig. 1 b) since free
tubulin subunits had been extracted by detergent treatment during fixation (for details see Materials and Methods). After complete depolymerization of MTs with nocodazole, recovery of MT arrays started immediately after
removal of nocodazole. Nucleation of MTs was first observed at
-tubulin-containing perinuclear foci (Fig. 5, c-e)
representing centrosomes (Stearns et al., 1991
; Baas and
Joshi, 1992
). These results show that the
-tubulin-expressing centrosome is the major MTOC in podocytes. Within
5 min after removal of nocodazole, MTs nucleated in an
asterisk-like pattern from centrosomes (Fig. 5, c-e). MTs
continued to elongate into the periphery over the next 30 min, and after 60 min almost the entire cytoplasm was
filled with MTs (Fig. 5, f and g). At 1-2 h of recovery, MTs
were aggregated into discrete bundles, leaving in between
regions largely devoid of MTs (Fig. 5 h). Such regions of
MT-depleted cytoplasm were also found in nontreated
control cells (Fig. 1 b). During the early stages of recovery,
in addition to MTs emerging from centrosomes, short MT
fragments were observed in cell bodies and processes (Fig.
5 e). During the later stages of recovery, all MTs emerged
from the centrosome (Fig. 5, g and h).
|
To determine the contribution of other cytoskeletal elements to MT organization, we examined the distribution
of AFs and IFs during elongation of MT arrays. The distribution of AFs was not affected by nocodazole treatment.
During recovery from nocodazole treatment, no spatial relationship between MT nucleation sites and AF foci was
found (data not shown). In contrast, vimentin IFs lost their
fibrillar distribution and collapsed in the perinuclear region after nocodazole treatment. The reassembly of MTs
was accompanied by a restoration of the normal IF distribution pattern (data not shown). These findings suggest an
interaction between MTs and IFs as reported for other
cells (Virtanen et al., 1980
; Celis et al., 1984
). Moreover,
time course analysis revealed that the recovery of MT arrays preceded that of IFs. Therefore, we conclude that neither AFs nor IFs are important for the recovery of MT arrays after nocodazole treatment.
| |
Discussion |
|---|
|
|
|---|
The present study shows that podocytes exhibit a nonuniform MT polarity. Since direct formation of minus end-
distal MTs is not possible at centrosomes (Pereira and
Schiebel, 1997
), two hypotheses were proposed for establishing the nonuniform MT-polarity (Baas, 1997
; Kobayashi and Mundel, 1998
): (a) short plus end-distal MTs are
released from the centrosome and transported in antiparallel orientation into the cell periphery along preexisting
plus end-distal MTs; or (b) minus end-distal MTs are assembled at MTOCs other than the centrosome. The data
from the present study support the first hypothesis. Suppression of CHO1/MKLP1 expression with AS oligonucleotides showed that CHO1/MKLP1 is necessary for the development of nonuniform polarity in podocytes (Fig. 3).
CHO1/MKLP1 is located in a punctated pattern along
MTs in podocytes (Fig. 2). This pattern is similar to the
distribution of CHO1/MKLP1 in neuronal dendrites, where
transport of minus end-distal MTs was also described
(Sharp et al., 1997
). These data suggest that minus end-
distal MTs are transported by CHO1/MKLP1 motor proteins along plus end-distal MTs in podocytes. The alternative hypothesis, i.e., the presence of MTOCs other than
the centrosome, which plays a crucial role in the assembly
of MTs (Joshi et al., 1992
; Moritz et al., 1995
), does not receive any support from the present study since
-tubulin was exclusively found at centrosomes (Fig. 5). Apart from
a transient centrosome-independent reassembly of MTs
during the early stages of recovery from nocodazole
treatment, reassembly of MTs exclusively occurred at centrosomes. (Fig. 5). The transient reassembly of MTs probably represented polymerization without any MTOC
activity. As suggested by previous works, after complete
depolymerization of MTs, the concentration of free tubulin subunits may be higher than the critical assembly concentration, allowing MTs to spontaneously assemble in the
absence of MTOCs (Stearns et al., 1991
). Therefore, it is
reasonable to conclude that the
-tubulin-expressing centrosome represents the only regular MT assembly site in
podocytes. In neuronal cells, the centrosome is the major
MTOC, as shown by the same experimental approach
used in the present study (Baas and Joshi, 1992
; Yu et al.,
1993
). Although it has recently become clear that MTs can
be polymerized by centrosome-free nucleation (Hyman
and Karsenti, 1998
), the generation of minus end-distal MTs in podocytes by centrosome-free nucleation was ruled
out by the AS experiments. These experiments clearly
showed that the mixed polarity of MTs, which is independent of MT nucleation (Baas, 1997
), depends on the expression of CHO1/MKLP1 (Fig. 3).
CHO1/MKLP1 is a member of the kinesin superfamily
of motor proteins as shown by sequence analysis and in
vitro motility analysis (Nislow et al., 1992
). When overexpressed, CHO1/MKLP1 induces bundling of MTs in a
nonuniform orientation, indicating that CHO1/MKLP1 is
associated with MTs rather than with membranous organelles (Kuriyama et al., 1994
; Sharp et al., 1996
). During mitosis, CHO1/MKLP1 causes antiparallel sliding between nonuniformly arranged MTs, accounting for the
elongation of mitotic spindles (Nislow et al., 1992
). Actually, AS oligonucleotides for CHO1/MKLP1 inhibited cell
division of proliferating podocytes (the present study) and neuroblastoma cells (Yu et al., 1997
). In addition, reduced
expression of CHO1/MKLP1 is accompanied by a uniform
plus end-distal microtubular polarity in neuronal cells
(Sharp et al., 1997
; Yu et al., 1997
). These findings suggest
that CHO1/MKLP1 acts as a motor protein transporting
minus end-distal MTs in dendrites. Our data in podocytes provide further evidence for a role of CHO1/MKLP1 as a
transporter of minus end-distal MTs. These minus end-
distal MTs are short and colocalize with CHO1/MKLP1 in
a punctated pattern along MTs. The MT transport hypothesis is further supported by the similar distribution of
taxol-stabilized MT fragments and CHO1/MKLP1 during recovery from taxol treatment (Fig. 4), strongly suggesting
that taxol-stabilized MT fragments are transported along
MTs by CHO1/MKLP1.
The present study clearly demonstrated the redistribution of taxol-stabilized MT fragments into the cell periphery. Interestingly, process formation of podocytes was restored after removal of taxol, although it had previously
been reported that taxol remained in the cytoplasm even
after removal from the culture medium (Jordan et al.,
1996
). Thus, taxol retained on MTs may continue to stabilize MT fragments in taxol-treated podocytes. The inability to demonstrate short MT fragments without taxol
treatment (Figs. 1 b and 5, g and h) may simply be due to
the fact that immunofluorescence microscopy is not sensitive enough to discriminate between short transported MT
fragments and long stationary MTs.
The hypothesis that MTs are transported as preformed
segments was controversial with many investigators who
claimed that only the transport of tubulin subunits contributes to axonal flow of MTs (see for example Baas and
Brown, 1997
; Hirokawa et al., 1997
). In axons, MTs are
uniformly oriented in a plus end-distal fashion (Heidemann et al., 1981
, 1984
; Baas et al., 1988
), indicating that
axons lack a mechanism to arrange MTs in minus end-distal fashion and consistent with the observation that axons do not contain CHO1/MKLP1 (Sharp et al., 1997
b).
Therefore, organization of the microtubular system in axons is fundamentally different from that in podocytes and
dendrites. Interestingly, however, Ahmad et al. (1998)
recently reported that motor-driven transport of MTs is necessary for axonal elongation.
The present study suggests a mechanism for the generation of the nonuniform MT polarity in podocytes (summarized in Fig. 6). First, plus end-distal MTs, which serve as
rails for MT transport, nucleate at the centrosome. Second, short MT fragments are assembled at the centrosome
and then released from the centrosome (Fig. 6, 1 and 2).
Baas (1997)
proposed the MT-severing protein katanin (McNally et al. 1996
) as a candidate to release MT fragments from the centrosome. If the released MT fragments
are very short, their orientation may be reversed by thermodynamic movements. Third, minus end-distal MT fragments are connected to plus end-distal MTs via CHO1/
MKLP1 and then transported into developing processes (Fig. 6, 3 and 4). The results from the AS experiments
clearly show that the cytoplasmic expression of CHO1/
MKLP1 is crucial for process formation of podocytes (Fig.
3). Similar effects of antisense treatment were recently described in neuronal dendrites (Sharp et al., 1997
; Yu et al.,
1997
). These findings strongly suggest that minus end-distal MTs play a crucial role in process formation. Generally, process formation is dependent on a continuous flow
supplying growing processes with cytoskeletal elements as well as membrane precursors. Minus end-distal MTs may
support the transport of elements that are carried only by
minus end-directed motors into the cell periphery, e.g.,
components of the Golgi apparatus in dendrites (Baas et al.,
1989
), since distinct motor proteins selectively carry specific cargos (Hirokawa, 1997
). The problem arising from
this concept is that minus end-distal MTs do not form
continuous rails but are arranged in a discontinuous pattern along plus end-distal MTs. Therefore, an alternative
model would be that transported minus end-distal MT
fragments are connected with other cytoskeletal and/or
membranous elements without the interposition of another motor protein. The transport of these elements into
elongating processes may then be achieved together with
minus end-distal MT fragments transported by CHO1/
MKLP1.
|
Several transport studies clearly showed that membrane
traffic in neuronal dendrites, but not in axons, is driven by
a machinery similar to the "basolateral" membrane traffic
in polarized epithelia (de Hoop and Dotti, 1993
). The
present study revealed the role of nonuniform MT polarity
established by CHO1/MKLP1 in process formation of
podocytes, similar to that reported for dendrites (Sharp
et al., 1997
). It is tempting to speculate that the development of podocyte processes and neuronal dendrites is
driven by the "basolateral" transport machinery depending on nonuniformly oriented MTs. Membrane traffic of
neuronal dendrites and of epithelial basolateral membranes is regulated by the small GTPase Rab8 (Huber et al.,
1993a
,b). Transfection of a hyperactive mutant of Rab8 induces process formation in fibroblasts (Peränen et al.,
1996
), suggesting that Rab8 promotes process formation
via regulation of membrane traffic in process-bearing cells.
Rab6, another small GTPase, can interact with a kinesin-like motor protein with a high sequence homology to
CHO1/MKLP1 (Echard et al., 1998
). Therefore, small
GPTases may regulate process formation via their interaction with CHO1/MKLP1, although the underlying mechanism remains to be elucidated.
In summary, we have shown that expression of CHO1/
MKLP1 motor and nonuniform polarity of MTs are necessary for process formation of podocytes, indicating that
podocytes and dendrites share the same mechanism of
process formation. In contrast, the uniform MT polarity in
axons is achieved by dynein and dynactin-driven transport
of plus end-distal MTs (Ahmad et al., 1998
). The present study emphasizes that the transport of MT fragments by
motor proteins is a general mechanism for process formation in diverse cell types. Since MTs disassemble at minus
ends without protection by capping proteins (Keating et
al., 1997
; Pereira and Schiebel, 1997
), the identification of
factors preventing disassembly of MT fragments during
their transport awaits clarification.
| |
Footnotes |
|---|
Address correspondence to Dr. Peter Mundel, Division of Nephrology, Albert Einstein College of Medicine, 1300 Morris Park Avenue, Bronx, NY 10461. Tel.: (718) 430-3158. Fax: (718) 430-8963. E-mail: mundel @
Received for publication 8 June 1998 and in revised form 16 October 1998.
The present study was supported by a grant from the Deutsche Forschungsgemeinschaft (DFG) to W. Kriz and P. Mundel. N. Kobayashi was
a research fellow of the Alexander von Humboldt Foundation. P. Mundel
is a recipient of a "Heisenberg-Stipendium" of the DFG.
Naoto Kobayashi's current address is Department of Anatomy, School of
Medicine, University of Ehime, Ehime 791-0295, Japan.
We would like to thank Dr. Sigrid Reinsch (EMBL, Heidelberg, Germany) for providing the
-tubulin antibody and Dr. Kai Simons (EMBL)
for critical reading of the manuscript. We also thank Hiltraud Hosser and
Alexandra Zeller for excellent technical assistance as well as Rolf Nonnenmacher for graphic work.
| |
Abbreviations used in this paper |
|---|
AF, actin filament; AS, antisense; IF, intermediate filament; MT, microtubule; MTOC, microtubule-organizing center; RT-PCR, reverse transcription PCR; S, sense; TEM, transmission electron microscopy.
| |
References |
|---|
|
|
|---|
| 1. |
Ahmad, F.J.,
C.J. Jcheverri,
R.B. Vallee, and
P.W. Baas.
1998.
Cytoplasmic dynein and dynactin are required for the transport of microtubules into the
axon.
J. Cell Biol
140:
391-401
|
| 2. | Baas, P.W.. 1997. Microtubules and axonal growth. Curr. Opin. Cell Biol 9: 29-36 [Medline]. |
| 3. | Baas, P.W., and A. Brown. 1997. Slow axonal transport: the polymer transport model. Trends Cell Biol 7: 380-384 . [Medline] |
| 4. |
Baas, P.W., and
H.C. Joshi.
1992.
-Tubulin distribution in the neuron: implications for the origins of neuritic microtubules.
J. Cell Biol.
119:
171-178
|
| 5. |
Baas, P.W.,
J.S. Deitch,
M.M. Black, and
G.A. Banker.
1988.
Polarity orientation of microtubules in hippocampal neurons: uniformity in the axon and
nonuniformity in the dendrites.
Proc. Natl. Acad. Sci. USA.
85:
8335-8339
|
| 6. |
Baas, P.W.,
M.M. Black, and
G.A. Banker.
1989.
Changes in microtubule polarity orientation during the development of hippocampal neurons in culture.
J.
Cell Biol.
109:
3085-3094
|
| 7. |
Baas, P.W.,
T.P. Pienkowski, and
K.S. Kosik.
1991.
Processes induced by tau
expression in Sf9 cells have an axon-like microtubule organization.
J. Cell
Biol.
115:
1333-1344
|
| 8. |
Celis, J.E.,
J.V. Small,
P.M. Larsen,
S.J. Fey,
J. De Mey, and
A. Celis.
1984.
Intermediate filaments in monkey kidney TC7 cells; focal centers and interrelationship with other cytoskeletal systems.
Proc. Natl. Acad. Sci. USA
81:
1117-1121
|
| 9. | Chen, J., Y. Kanai, N.J. Cowan, and N. Hirokawa. 1992. Projection domains of MAP2 and tau determine spacings between microtubules in dendrites and axons. Nature 360: 674-677 [Medline]. |
| 10. |
De Brabander, M.,
G. Geuens,
R. Nuydens,
R. Willebrords, and
J. De Mey.
1981.
Taxol induces the assembly of free microtubules in living cells and
blocks the organization capacity of the centrosomes and kinetochores.
Proc.
Natl. Acad. Sci. USA
78:
5608-5612
|
| 11. | de Hoop, M.J., and C.G. Dotti. 1993. Membrane traffic in polarized neurons in culture. J. Cell Sci. 17(Suppl.): 85-92 . |
| 12. |
Echard, A.,
F. Jollivet,
O. Martinez,
J.J. Lacapere,
A. Rousselet,
I. Janoueix-Lerosey, and
B. Goud.
1998.
Interaction of a Golgi-associated kinesin-like
protein with Rab6.
Science
279:
580-585
|
| 13. | Heidemann, S.R.. 1991. Microtubule polarity determination based on formation of protofilament hooks. Methods Enzymol. 196: 469-477 [Medline]. |
| 14. |
Heidemann, S.R.,
M.A. Hamborg,
S.J. Thomas,
B. Song,
S. Lindley, and
D. Chu.
1984.
Spatial organization of axonal microtubules.
J. Cell Biol.
99:
1289-1295
|
| 15. |
Heidemann, S.R.,
J.M. Landers, and
M.A. Mamborg.
1981.
Polarity orientation
of axonal microtubules.
J. Cell Biol.
91:
661-665
|
| 16. | Hirokawa, N.. 1997. The mechanism of fast and slow transport in neurons: identification and characterization of the new kinesin superfamily motors. Curr. Opin. Neurobiol. 7: 605-614 [Medline]. |
| 17. | Hirokawa, N., S. Terada, T. Funakoshi, and S. Takeda. 1997. Slow axonal transport: the subunit transport model. Trends Cell Biol. 7: 384-388 . [Medline] |
| 18. |
Huber, L.A.,
M.J. de Hoop,
P. Dipree,
M. Zerial,
K. Simons, and
C.G. Dotti.
1993a.
Protein transport to the dendritic plasma membrane of cultured neurons is regulated by rab8p.
J. Cell Biol.
123:
47-55
|
| 19. |
Huber, L.A.,
S. Pimplikar,
R.G. Parton,
H. Virta,
M. Zerial, and
K. Simons.
1993b.
Rab8, a small GTPase involved in vesicular traffic between the TGN
and the basolateral plasma membrane.
J. Cell Biol.
123:
35-45
|
| 20. | Hyman, A., and E. Karsenti. 1998. The role of nucleation in patterning microtubule networks. J. Cell Sci. 111: 2077-2083 [Abstract]. |
| 21. |
Jordan, M.A.,
K. Wendell,
S. Gardiner,
W.B. Derry,
H. Copp, and
L. Wilson.
1996.
Mitotic block induced in HeLa cells by low concentrations of paclitaxel
(Taxol) results in abnormal mitotic exit and apoptotic cell death.
Cancer Res.
56:
816-825
|
| 22. |
Joshi, H.C.,
M.J. Palacios,
L. McNamara, and
D.W. Cleveland.
1992.
-Tubulin
is a centrosomal protein required for cell cycle-dependent microtubule nucleation.
Nature
356:
80-83
[Medline].
|
| 23. |
Keating, T.J.,
J.G. Peloquin,
V.I. Rodionov,
D. Momcilovic, and
G.G. Borisy.
1997.
Microtubule release from the centrosome.
Proc. Natl. Acad. Sci. USA
94:
5078-5083
|
| 24. | Kidd, G.J., S.B. Andrews, and B.D. Trapp. 1994. Organization of microtubules in myelinating Schwann cells. J. Neurocytol. 23: 801-810 [Medline]. |
| 25. | Kobayashi, N., and P. Mundel. 1998. A role of microtubules in the formation of cell processes in neuronal and non-neuronal cells. Cell Tissue Res. 291: 163-174 [Medline]. |
| 26. | Kuriyama, R., S. Dragas-Granoic, T. Maekawa, A. Vassilev, A. Khodjakov, and H. Kobayashi. 1994. Heterogeneity and microtubule interaction of the CHO1 antigen, a mitosis-specific kinesin-like protein: analysis of subdomains expressed in insect sf9 cells. J. Cell Sci. 107: 3485-3499 [Abstract]. |
| 27. |
Lunn, K.F.,
P.W. Baas, and
I.D. Duncan.
1997.
Microtubule organization and
stability in the oligodendrocyte.
J. Neurosci.
17:
4921-4932
|
| 28. |
McNally, F.J.,
K. Okawa,
A. Iwamatsu, and
R.D. Vale.
1996.
Katanin, the microtubule-severing ATPase, is concentrated at centrosomes.
J. Cell Sci.
109:
561-567
|
| 29. |
Moritz, M.,
M.B. Braunfeld,
J.W. Sedat,
B. Alberts, and
D.A. Agard.
1995.
Microtubule nucleation by -tubulin-containing rings in the centrosome.
Nature
378:
638-640
[Medline].
|
| 30. | Mundel, P., and W. Kriz. 1995. Structure and function of podocytes: an update. Anat. Embryol. 192: 385-397 [Medline]. |
| 31. |
Mundel, P.,
H.W. Heid,
T.M. Mundel,
M. Krüger,
J. Reiser, and
W. Kriz.
1997a.
Synaptopodin, an actin-associated protein in telencephalic dendrites and in
renal podocytes.
J. Cell Biol.
139:
193-204
|
| 32. | Mundel, P., J. Reiser, A. Zúñiga, and Mejía Borja, H. Pavenstädt, G.R. Davidson, W. Kriz, and R. Zeller. . 1997b. Rearrangements of the cytoskeleton and cell contacts induce process formation during differentiation of conditionally immortalized mouse podocyte cell lines. Exp. Cell Res. 36: 248-258 . |
| 33. |
Nislow, S.,
C. Sellitto,
R. Kuriyama, and
J.R. McIntosh.
1990.
A monoclonal antibody to an mitotic microtubule-associated protein blocks mitotic progression.
J. Cell Biol.
111:
511-522
|
| 34. | Nislow, C., V.A. Lombillo, R. Kuriyama, and J.R. McIntosh. 1992. A plus-end-directed motor enzyme that moves antiparallel microtubules in vitro localizes to the interzone of mitotic spindles. Nature 359: 543-547 [Medline]. |
| 35. |
Okabe, S., and
N. Hirokawa.
1988.
Microtubule dynamics in nerve cells: analysis using microinjection of biotinylated tubulin into PC12 cells.
J. Cell Biol.
107:
651-664
|
| 36. |
Peränen, J.,
A. Petri,
V. Hilkka,
R. Wepf, and
K. Simons.
1996.
Rab8 promotes
polarized membrane transport through reorganization of actin and microtubules in fibroblasts.
J. Cell Biol.
135:
153-167
|
| 37. | Pereira, G., and E. Schiebel. 1997. Centrosome-microtubule nucleation. J. Cell Sci. 110: 295-300 [Abstract]. |
| 38. |
Reinsch, S., and
E. Karsenti.
1994.
Orientation of spindle axis and distribution
of plasma membrane proteins during cell division in polarized MDCKII
cells.
J. Cell Biol.
126:
1509-1526
|
| 39. |
Sellitto, C., and
R. Kuriyama.
1988.
Distribution of a matrix component of the
midbody during the cell cycle in Chinese hamster ovary cells.
J. Cell Biol.
106:
431-439
|
| 40. |
Sharp, D.J.,
R. Kuriyama, and
P.W. Baas.
1996.
Expression of a kinesin-related
motor protein induces Sf9 cells to form dendrite-like processes with nonuniform microtubule polarity orientation.
J. Neurosci.
16:
4370-4375
|
| 41. |
Sharp, D.J.,
W. Yu,
L. Ferhat,
R. Kuriyama,
D. Rueger, and
P.W. Baas.
1997.
Identification of a microtubule-associated motor protein essential for dendritic differentiation.
J. Cell Biol.
138:
833-843
|
| 42. |
Shelanski, M.L.,
F. Gaskin, and
C.R. Cantor.
1973.
Microtubule assembly in the
absence of added nucleotides.
Proc. Natl. Acad. Sci. USA
70:
765-768
|
| 43. |
Stearns, T.,
L. Evans, and
M. Kirschner.
1991.
tubulin is a highly conserved
component of the centrosome.
Cell.
65:
825-836
[Medline].
|
| 44. | Takemura, R., S. Okabe, T. Umeyama, and N. Hirokawa. 1995. Polarity orientation and assembly process of microtubule bundles in nocodazole-treated, MAP2c-transfected COS cells. Mol. Biol. Cell. 6: 981-996 [Abstract]. |
| 45. | Vallee, R.B.. 1986. Reversible assembly purification of microtubules without assembly-promoting agents and further purification of tubulin, microtubule-associated proteins, and MAP fragments. Methods Enzymol. 134: 89-104 [Medline]. |
| 46. | Virtanen, I., V.P. Lehto, E. Lehtonen, and R.A. Badley. 1980. Organization of intermediate filaments in cultured fibroblasts upon disruption of microtubules by cold treatment. Eur. J. Cell Biol. 23: 80-84 [Medline]. |
| 47. |
Wang, J.,
W. Yu,
P.W. Baas, and
M.M. Black.
1996.
Microtubule assembly in
growing dendrites.
J. Neurosci.
16:
6065-6078
|
| 48. |
Yu, W.,
V.E. Centonze,
F.J. Ahmad, and
P.W. Baas.
1993.
Microtubule nucleation and release from the neuronal centrosome.
J. Cell Biol.
122:
349-359
|
| 49. |
Yu, W.,
D.J. Sharp,
R. Kuriyama,
P. Mallik, and
P.W. Baas.
1997.
Inhibition of
a mitotic motor compromises the formation of dendrite-like processes from
neuroblastoma cells.
J. Cell Biol.
136:
659-668
|
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|