|
||



* Department of Human Anatomy and Cell Biology, University of Liverpool, Liverpool L69 3GE, United Kingdom;
Institute
for Biochemistry, University of Cologne, D-50931 Cologne, Germany; and § Department of Neurochemistry,
Max-Planck-Institute of Psychiatry, D-82152 Martinsried, Germany
| |
Abstract |
|---|
|
|
|---|
The LAMC1 gene coding for the laminin
1
subunit was targeted by homologous recombination in
mouse embryonic stem cells. Mice heterozygous for the
mutation had a normal phenotype and were fertile,
whereas homozygous mutant embryos did not survive
beyond day 5.5 post coitum. These embryos lacked
basement membranes and although the blastocysts had
expanded, primitive endoderm cells remained in the inner cell mass, and the parietal yolk sac did not develop.
Cultured embryonic stem cells appeared normal after targeting both LAMC1 genes, but the embryoid bodies
derived from them also lacked basement membranes,
having disorganized extracellular deposits of the basement membrane proteins collagen IV and perlecan, and
the cells failed to differentiate into stable myotubes. Secretion of the linking protein nidogen and a truncated
laminin
1 subunit did occur, but these were not deposited in the extracellular matrix. These results show that
the laminin
1 subunit is necessary for laminin assembly and that laminin is in turn essential for the organization of other basement membrane components in vivo
and in vitro. Surprisingly, basement membranes are not
necessary for the formation of the first epithelium to
develop during embryogenesis, but first become required for extra embryonic endoderm differentiation.
| |
Introduction |
|---|
|
|
|---|
ALTHOUGH basement membrane molecules have been
shown to affect the differentiation and survival of
cells (Streuli, 1996
), the mechanisms regulating
the assembly of basement membranes in vivo and the fundamental roles of basement membranes during embryogenesis are poorly defined. The best studied basement
membrane proteins are the laminins which constitute the
major noncollagenous basement membrane component
(Timpl, 1996
). Antibody inhibition of laminin binding to
its cellular receptors or to other basement membrane components has been shown to perturb both basement membrane deposition and also epithelial morphogenesis in
organ culture (Klein et al., 1988
; Sorokin et al., 1990
; Ekblom et al., 1994
; Kadoya et al., 1995
). However, it remains
to be established if basement membranes are an absolute
requirement for epithelial cell differentiation and at what
stages of development these fundamental extracellular matrix structures become essential.
All characterized laminin variants are heterotrimeric
molecules formed by the covalent bonding of one polypeptide from the
,
, and
laminin subunit families, each
of which comprises multiple members encoded by individual genes (Maurer and Engel, 1996
). Thus, many variant
laminin trimers may potentially be formed, depending on
differential subunit gene expression which occurs in a
time- and cell-specific manner (Paulsson, 1996
). Definitive evidence for the distinct roles of some laminin variants
in vivo has been provided by the phenotypes of mutations in
laminin subunit genes. For example, natural mutations in
any of the genes coding for subunits of laminin type-5
(kalinin) can result in junctional epidermolysis bullosa
(Burgeson, 1996
). Similarly, mutations of the
2 subunit
(merosin) can result in autosomal forms of muscular dystrophy (Helbling-Leclerc et al., 1995
), and targeted disruption of the laminin
2 chain (s-laminin) has been shown to
result in disruption of neuromuscular junction development and of kidney function (Noakes et al., 1995
). The
characteristic postnatal phenotypes of all of these mutations reflect the restricted expression and specific functions of the minor laminin subunits concerned.
Laminin
1 is one of the earliest expressed laminin subunits which, together with the
1 and
1 subunits of laminin type-1, is expressed in the preimplantation embryo
(Shim et al., 1996
) before the appearance of the first
basement membrane of the trophectodermal epithelium
(Dziadek and Timpl, 1985
; Thorsteinsdottir, 1992
). Furthermore,
1 is the most ubiquitously expressed laminin
subunit, being present in 10 of the 11 known laminin isoforms (Burgeson et al., 1994
; Miner et al., 1997
). Indeed,
the only isoform (type-5) shown to lack the
1 subunit has
instead the other known member of this subunit family,
2
(Kallunki et al., 1992
). However, the
2 subunit has a restricted distribution being associated with epithelial anchoring filaments rather than being a common component of basement membranes (Burgeson, 1996
). This is most
probably either because it has no nidogen binding domain
(Mayer et al., 1993
) or because it lacks the three self-interacting NH2-terminal globular domains necessary to link it
to the other basement membrane components (Champliaud et al., 1996
; Cheng et al., 1997
). We therefore decided
to use homologous recombination to target the mouse
LAMC1 gene because the resulting lack of the laminin
1
subunit would alter the formation of all known integral
basement membrane laminin isoforms. This would therefore be expected to affect the structure and function of
most if not all basement membranes. Analysis of the phenotype of this knockout thus defines the role of laminin in
basement membrane formation in vivo, and in this in turn
demonstrates the initial function of basement membranes
in tissue development during embryogenesis.
| |
Materials and Methods |
|---|
|
|
|---|
Production of Targeting Constructs
A Lambda FIX®II genomic library (Stratagene) of the 129SVJ mouse line
was screened using a PCR product comprising 372 bp of the 5' untranslated region and the first 128 bases of exon one of the LAMC1 gene
(Ogawa et al., 1988
). Six different clones representing this area were isolated and mapped. Targeting construct 1 was formed by cloning the 6-kb
HindIII fragment containing the first exon together with 2-kb upstream
sequence and 3.5 kb of intron 1 into pUC 19. The IRES
-Geo cassette
(Friedrich and Soriano, 1991
; Mountford et al., 1994
), which had a NotI
linker added to its 3' end was inserted into the unique NotI site in the first exon (see Fig. 1). The use of the cap-independent translation initiation sequence removed the need to place a Neo resistance cassette in frame to
obtain expression by the LAMC1 promoter.
|
Construct 2 was an EcoRI/SacI fragment of LAMC1 cloned into KSII
Bluescript (Stratagene). The sequence was interrupted at the NotI site by
the insertion of the phosphoglycerate kinase (pgk) promoter (Soriano
et al., 1991
) 5' to a hygromycin resistance cassette with poly A tail (Hygro). This divided the LAMC1 fragment into two arms with 6-kb homology in the 5' arm and 2.5-kb homology in the 3' arm (see Fig. 2).
|
LAMC1 Gene Targeting in Embryonic Stem Cells
R1 mouse embryonic stem (ES)1 cells were grown in standard ES conditions with DME supplemented with 15% (vol/vol) fetal bovine serum
(FBS), 0.1 mM
mercaptoethanol, and 1,000 U/ml of LIF (ESGRO; GIBCO BRL). 5 × 106 cells were transfected by electroporation with 25 µg of linearized construct 1 and colonies selected for resistance to G418 at
380 µg/ml in the culture medium. Surviving clones were picked, expanded, and then DNA extracted for Southern blotting. DNA from the cells digested with SacI was probed with an external 3' probe and an internal 5'
probe (see Fig. 1). In cases of correct integration, the wild-type 11-kb fragment was reduced to 7 kb when probed with the external probe and a 7.5-kb band was seen with the internal probe (see Fig. 1).
Attempts using increased G418 concentrations up to 1.5 mg/ml failed to
produce ES cells in which both the LAMC1 alleles had been targeted
(Mortensen et al., 1992
). Therefore, the second targeting construct was
used for disruption of the second LAMC1 allele in ES cells previously targeted with construct 1 (see Fig. 2 A). After correct targeting, Southern
blot hybridization of SacI genomic DNA digests with probe 1 resulted in
the wild-type band being lost, whereas a 5.5-kb band appeared (see Fig. 2
B). Clones so targeted were checked for the absence of expression of the
LAMC1 gene by Northern hybridization of mRNA with a probe of
LAMC1 cDNA.
Production of Mice Lacking the LAMC1 Gene
Two independent ES cells lines were used to generate germ line chimeras.
Blastocysts were isolated from C57Bl/6 mice 3.5 d post coitum (pc) (plug
date = 0.5 d pc) and were injected with five to seven +/
ES cells. Blastocysts were then transferred into the uteri of pseudopregnant CD1 foster
mothers. Chimeric male progeny were mated to C57Bl/6 females and offspring were tested for germline transmission by Southern blots of DNA
extracted from tail biopsies. Heterozygous animals were mated together
to obtain homozygous embryos.
Immuno- and Fragmented DNA Staining
The rabbit polyclonal primary antibodies used were: anti-laminin
1
raised against recombinant domain IVa (Schulze et al., 1996
); anti-laminin
1 raised against recombinant domain III LE3-5 (Mayer et al., 1993
); anti-EHS laminin which recognizes all three subunits of laminin (Kücherer-Ehret et al., 1990
); anti-nidogen raised against recombinant nidogen (Fox
et al., 1991
); and anti-perlecan raised against recombinant domain III3
(Schulze et al., 1995
). Rabbit polyclonal antibodies against von Willebrand factor, the 200-kD neurofilament subunit, and skeletal myosin were
obtained from Sigma.
Embryos were washed in phosphate buffered saline (PBS) before embedding and freezing in Tissue-Tek (Sakura Finetek Europe). Cryostat sections were fixed with 0.5% (wt/vol) paraformaldehyde in PBS for 10 min, washed with PBS, and then blocked with 5% (vol/vol) goat serum in PBS/0.1% (vol/vol) Tween 20. The primary antibodies (see below) and goat-anti rabbit Cy3 conjugate secondary antibodies (Jackson Immunodiagnostics) were used in the same solution before washing the sections in PBS and mounting in fluorescent mounting medium (Dako).
For visualization of fragmented nuclear DNA in situ, serial cryosections were fixed for 20 min in 4% (wt/vol) paraformaldehyde in PBS before staining by a modification of the terminal dUTP-biotin nick end labeling (TUNEL) method (Gavrieli et al., 1992
). A TACS apoptosis
detection kitTM (Trevigen) was used according to the manufacturer's
instructions, fragmented DNA being end labeled with biotinylated nucleotides using the Klenow fragment, followed by detection with streptavidin-horseradish peroxidase conjugates. The sections were then counterstained with eosin.
Embryo Culture
Embryos were isolated from heterozygous matings by flushing the uterus with M2 medium and the blastocysts were cultured in M16 medium at 37°C in 5% CO2 until they had fully expanded or hatched. Where present, the zona pellucida was removed from the expanded blastocysts by a short incubation in acid tyrode solution and the blastocysts washed in PBS before fixation in 1% (wt/vol) paraformaldehyde for 10 min at room temperature. The blastocysts were permeabilized in PBS/0.02% (vol/vol) Triton X-100 containing 2% (wt/vol) bovine serum albumin for 30 min before incubation with antibodies and subsequent fluorescence microscopy.
Embryoid Bodies
Undifferentiated ES cells were trypsinized, triturated, and then resuspended in DME 10% FBS at a dilution of 1,000 cells/µl. The cells were
then placed in hanging drops of 20 µl on the lower surface of the lids of
plastic Petri dishes containing PBS (Wobus et al., 1991
). After 24 h of culture as hanging drops, the cell aggregates were plated into plastic Petri
dishes and the embryoid bodies were fixed with 4% (wt/vol) paraformaldehyde after varying culture periods before sectioning and immunostaining as described above. Frozen sections were also stained for lacZ expression as previously described (Beddington and Lawson, 1990
).
To monitor cell phenotypes of differentiating ES cells after formation
in hanging drops, the embryoid bodies were allowed to attach to tissue
culture plastic and cultured in the above medium for 21 d. Preliminary experiments showed that under these conditions small numbers of myotubes
differentiated (Kuang et al., 1998
). The cultures were then fixed in 4%
(wt/vol) paraformaldehyde and immunostained as above.
Northern Blots
Wild-type ES cells, and those heterozygous and homozygous for mutations in the LAMC1 alleles, were preplated in tissue culture dishes for 10 min to deplete them of the embryonic fibroblast feeder cells. The nonadherent ES cells were isolated and cultured on a gelatin-coated plate in ES
media with LIF for two or three days until almost confluent. The cells
were lysed and RNA extracted with guanidinium isothiocyanate (Chomczynski and Sacchi, 1987
). 10 µg of total RNA was separated on a denaturing formaldehyde gel of 1% agarose and transferred by vacuum blotting
to a nylon membrane (Hybond N; Amersham). After UV cross-linking of
the RNA to the membrane, it was prehybridized with a 50% formamide
containing buffer and hybridized against cDNA probes for laminin
1,
1,
1,
2, and glyceraldehyde-3-phosphate dehydrogenase (GADPH) mRNAs. After high stringency washing, the blots were exposed to autoradiographic film. The probe for the laminin
1 mRNA was a BamHI-EcoRI
fragment between bases 2,959 and 4,163 in the protein coding area (Sasaki and Yamada, 1987
), whereas
2 was a BamHI fragment spanning nucleotides 1,509-2,120 of the protein coding region (Sugiyama et al., 1995
). The probe for the
1 chain was a PCR-generated fragment using GCGCATCAGAACACTCAACG (sense) and CAAGGGTGGTCATCATAAGG (antisense) primers amplifying between bases 708 and 1,203 of
the protein coding region (Sasaki et al., 1988
). The probe for the
1 chain was a PCR product using primers GATAACTGTCAGCACAACACC
(sense) and GTGAAGTAGTAACCGGACTCC (antisense) giving a
probe between bases 1,231 and 1,794 of the protein coding region (Sasaki
et al., 1987
).
Metabolic Labeling and Immunoprecipitation
Embryoid bodies were produced from 5 × 103 ES cells incubated in hanging drops for 2 d (Wobus et al., 1991
). About 10 embryoid bodies were
then cultured in 500 µl DME without methionine, supplemented with 1%
FBS and 200 µCi/ml [35S]methionine (specific activity >1,000 Ci/mmol;
Amersham). Labeling was carried out overnight. The medium was then
collected, centrifuged, and then supernatants were stored at
70°C. Cells
were washed with complete DME supplemented FBS and lysed in 50 mM
Tris HCl, pH 7.5, containing 1% (vol/vol) Triton X-100, 10 mM EDTA,
0.10 M NaCl, and protease inhibitors. After trituration, insoluble material
was removed by centrifugation and the supernatants were stored at
70°C.
Immunoprecipitations were carried out in the extraction buffer using Pansorbin (Calbiochem-Novabiochem) to precipitate the antibody-antigen complexes. Proteins bound to the Pansorbin were removed using boiling SDS gel electrophoresis sample buffer. Proteins were fractionated by SDS-PAGE on 5% gels under reducing conditions or on 3 and 5% gels under nonreducing conditions before fluorography.
For immunoblot analysis, embryoid bodies were cultured as above but using complete DME supplemented with 10% FBS. Cell extracts and media were concentrated by immunoprecipitation with antilaminin antiserum before SDS-PAGE under reducing conditions. After electroblotting onto nitrocellulose, the membrane was incubated with the primary antibodies which were detected using goat anti-rabbit antibodies conjugated with horseradish peroxidase (Dako). The enzymatic activity was visualized using 4-chloro-1-naphthol.
| |
Results |
|---|
|
|
|---|
Targeted Disruption of LAMC1 Genes in ES Cells
A diagram of the initial targeting of the LAMC1 gene is
shown in Fig. 1 A. Of the 50 G418-resistant ES cell clones
expanded and analyzed on Southern blots by hybridization with probe 1, 17 had undergone recombination at the
LAMC1 gene, as shown by the appearance of a band of
the expected size of 7 kb and of equal intensity to the remaining wild-type 1-kb band (Fig. 1 B). A single insertion
was demonstrated by the internal probe 2 which hybridized to the expected 7.5-kb band (Fig. 1 C). Although expression of the neomycin resistance-lacZ fusion cassette
was dependent on the laminin promoter (Ogawa et al.,
1988
) present in the targeting vector, the high frequency of
homologous recombination (>30% of all G418-resistant
clones) suggests that the regulatory elements needed for
full expression of the LAMC1 gene in ES cells were lacking in the construct. This agrees with the recent demonstration of a strong enhancer element in the first intron of
LAMC1, which was absent from our targeting construct
(Chang et al., 1996
). As expected, the frequency of the second targeting event with the hygromycin resistance cassette (Fig. 2 A) was much lower than that of the first: out
of 200 clones, 12 had undergone the second homologous
recombination shown by replacement of the wild-type LAMC1 band by a 5-kb fragment (Fig. 2 B).
Northern blotting showed the absence of laminin
1
subunit mRNA in
/
ES cells, and the amount of
LAMC1 mRNA was reduced in +/
cells relative to the
wild type (Fig. 2 C). However, levels of the mRNAs coding for laminin
1 and
1 subunits were the same in undifferentiated +/+, +/
, and
/
cells (Fig. 2 C). The expression of LAMC2 remained below the level of detection
in all cases (data not shown).
Consequences of LAMC1 Disruption In Vivo
LAMC1 +/
animals were phenotypically normal and
have been intercrossed for at least seven generations and
have also been bred into a C57Bl/6 background. More
than 200 heterozygous matings produced no progeny homozygous for the mutation that were either born or found
in utero after day 8.5 pc, indicating early embryonic lethality (Fig. 1 D). Day 3.5 pc preimplantation blastocysts from these matings were immunostained with polyclonal antibodies specific for the laminin
1 subunit (Fig. 3 A) and
also with antibodies against laminin-1 which recognize the
1 and
1 subunits as well as
1 (Kücherer-Ehret et al.,
1990
). The majority of blastocysts showed the reported
pattern of immunostaining for laminin-1 (Thorsteinsdottir, 1992
): the trophectodermal basement membrane was
stained together with apparently intracellular staining of
cells throughout the blastocyst (Fig. 3 D). However, about
one-quarter of the expanded and hatched embryos showed
no immunostaining for the laminin
1 subunit (Fig. 3, B
and C) and displayed only intracellular staining using the
laminin-1 antibodies (Fig. 3 D).
|
The embryos found in decidua at day 4.5 pc appeared
histologically normal (Fig. 4, A and F). However, eight
out of the 40 embryos sectioned and stained did not display laminin
1 subunit immunoreactivity, although as expected there was immunoreactivity in the stroma and epithelial lining of maternal decidua (Fig. 4 J), which also
stained with the other antibodies used (Fig. 4, G-I). Embryos negative for
1 immunoreactivity demonstrated the
absence of any extracellular laminin when stained with
laminin-1 antibodies, although there was an accumulation
of cells with intense laminin immunoreactivity in the inner
cell mass (Fig. 4 G, inset). Very limited patchy deposits of
nidogen and collagen type IV were seen under the trophectodermal epithelium but there was no continuous sheet
characteristic of the trophectodermal basement membrane (Fig. 4, H and I).
|
Of the 80 decidua examined at 5.5 d pc from heterozygous matings, 28 contained laminin
1-negative accumulations of cells, none of which conformed to any recognizable embryonic structures (Fig. 5, B and C), whereas out
of the 40 decidua examined from heterozygous/wild-type
matings, only five contained no recognizable embryo. Detection of fragmented nuclear DNA by TUNEL staining of serial sections revealed very few stained cells in any embryos before 5.5 d pc (data not shown). However, at 5.5 d
pc we detected low numbers of stained nuclei in the
1-positive embryos (Fig. 5 D), and the laminin
1-negative
embryos displayed either increased numbers of TUNEL-positive cells (Fig. 5 E) or very intense labeling, indicative
of extensive DNA fragmentation (Fig. 5 F).
|
Analysis of LAMC1 Disruption In Vitro
After 48 h of suspension culture, the differentiating +/
and
/
ES cells at the periphery of developing embryoid
bodies began to display intense lacZ staining (Fig. 6), indicating the expression of the LAMC1 gene. This reflects
the differentiation of these cells into primitive endoderm-like cells with high levels of laminin expression (Doetschman et al., 1985
). The deposition of a continuous basement
membrane-like sheet of laminin, nidogen, perlecan, and
collagen type IV immunoreactivity was observed towards the periphery of +/
embryoid bodies after 7 d of culture
(Fig. 7, A, C, E, and G). Outside this basement membrane,
there was a sheet some one to three cells thick displaying
laminin immunoreactivity (Fig. 7 A). No differences in
these were observed between +/+ and +/
embryoid
bodies (data not shown). In contrast, in addition to the expected lack of
1 immunoreactivity in the
/
embryoid bodies (data not shown), no deposition of basement membranes was detected when they were stained with any of
the above antibodies: although there were patchy extracellular deposits of perlecan and collagen type IV, these molecules were not deposited in a continuous basement membrane-like sheet (Fig. 7, F and H). Although there was no
obvious extracellular laminin staining, polyclonal antibodies to laminin-1 showed immunoreactivity to be accumulated mainly in the cells at the surface of the
/
embryoid bodies (Fig. 7 B). Staining with antibodies specific to
1 and
1 showed the same patterns of distribution as that
detected with the polyclonal antibodies to laminin 1 (data
not shown). Little if any intracellular or extracellular nidogen immunoreactivity was detectable in the
/
embryoid bodies (Fig. 7 D) although it was present as expected in the basement membranes of +/+ and +/
embryoid bodies (Fig. 7 C).
|
|
To determine if the differentiation of ES cells was affected by the absence of the
1 subunit, embryoid bodies
were allowed to attach to tissue culture plastic and cultured for up to 3 wk. At this time, the LAMC1 +/
cells
displayed basement membrane-like sheets of laminin immunoreactivity (Fig. 8 A), small numbers of isolated von
Willebrand-positive cells were seen (Fig. 8 C) and neurofilament-positive cell bodies and neurites were identified (Fig. 8 E). Furthermore, the cultures contained low
numbers of myotubes that stained with antibodies to skeletal myosin (Fig. 8 G). As expected from Fig. 7, the
LAMC1
/
cells did not deposit basement membranes
although individual permeabilized cells displayed intense
laminin immunoreactivity (Fig. 8 B). Although no differences from controls were seen in the von Willebrand- and
neurofilament-positive cells (Fig. 8, D and F, respectively),
no normal myotubes were observed, myosin-positive cells
being present in large aggregates which extended thin processes (Fig. 8 H).
|
After overnight [35S]methionine metabolic labeling, a
band of ~800 kD on nonreducing SDS-PAGE was immunoprecipitated with laminin-1 antibodies from both culture medium and extracts of the +/+ and +/
embryoid
bodies (Fig. 9 A, lanes 1-4). This corresponds to the expected size of laminin type 1. In contrast, neither the cell
extracts nor the culture medium from the
/
embryoid
bodies contained detectable laminin of 800 kD, although
lower molecular weight bands were immunoprecipitated
(Fig. 9 A, lanes 5 and 6).
|
To better characterize these bands, electrophoresis was
performed on higher percentage SDS-polyacrylamide gels
under nonreducing and reducing conditions. The pattern
of reduced protein bands immunoprecipitated from the
media of the
/
embryoid bodies differed from that of
the
/
embryoid body cell extracts (Fig. 9 B, lanes 7 and
8), whereas the patterns were the same from the +/
embryoid body cell extracts and media (Fig. 9 B, lanes 5 and
6). These differences are consistent with the observation
that most of the laminin immunoreactivity of +/+ and +/
embryoid bodies was seen in a basement membrane and
hence extracellular (Fig. 6 A), whereas that seen in the
/
embryoid bodies appeared to be intracellular (Fig. 6 B).
Although a nidogen band of 150 kD was present in the medium of these cells (Fig. 9 B, lanes 4 and 8; Fig. 9 C, lane 3), there was little or no nidogen detectable in the
/
embryoid body extracts under both nonreducing (Fig. 9 B,
lane 3) and reducing conditions (Fig. 9 B, lane 7). Thus,
the lack of nidogen immunoreactivity in
/
embryoid
bodies (Fig. 9 D) is not due to lack of nidogen synthesis,
but rather results from nidogen being lost from the embryoid bodies into the medium (Fig. 9 B, lanes 4 and 8).
The nonreduced extracts of +/
and
/
embryoid
bodies were similar in that they contained a prominent
band of ~200 kD (Fig. 9 B, lanes 1 and 3). However, a
novel strong band of ~300 kD under both non-reducing
and reducing conditions was immunoprecipitated from
/
embryoid body medium (Fig. 9 B, lanes 4 and 8), indicating that this secreted protein was not disulfide-bonded to
other laminin subunits. To identify the novel band, immunoprecipitation and immunoblotting experiments were
performed with laminin
1 subunit-specific antibodies directed against the IVa domain. In addition to the 400-kD
1 chain, an equally strong band corresponding to the 300-kD protein was also found in
/
cell extracts (Fig. 9 D,
lane 2), and this band alone was detected in the
/
medium (Fig. 9 D, lane 3) although it was absent from the +/
medium (Fig. 9 D, lane 1). Immunoprecipitation of this
band from the
/
cell medium with antibodies to the
laminin
1 subunit also coprecipitated a band of 200 kD
but no nidogen was detected (Fig. 9 C, lane 4). Conversely,
immunoprecipitation of nidogen from
/
cell medium with antibodies against nidogen failed to precipitate any
laminin subunits (Fig. 9 C, lane 3). Thus although the
/
ES cells secrete a modified laminin
1 subunit and nidogen, they are not associated as normal (Fig. 9 C, lanes 1 and 2), consistent with the absence of the laminin
1 subunit in the
/
ES cells.
| |
Discussion |
|---|
|
|
|---|
We have used homologous recombination to target one or
both of the LAMC1 alleles coding for the laminin
1 subunit in mouse embryonic stem cells. By so doing, we have
disrupted the formation of all described laminin isoforms
with the exception of laminin 5. Although the null mutation resulted in the absence of basement membranes and
hence was an early embryonic lethal, surprisingly, preimplantation development appeared to be normal in that a
pumping trophectodermal epithelium allowed expansion
of the blastocysts. Basement membranes were first found
to be necessary for differentiation of primitive endodermal cells, in their absence Reichert's membrane failing to
form. In vitro analysis of the null mutation showed that the
laminin
1 subunit was necessary for the differentiation of
stable myotubes and for assembly of other covalently
bonded laminin subunits. In turn, the lack of intact laminin
deposition was necessary for the assimilation of other
components into a continuous basement membrane in
vitro, consistent with the disruption of formation of the
first basement membrane to be formed during development in vivo.
The LAMC1-null Mutation Causes Early Embryonic Lethality
Although mice heterozygous for the LAMC1 gene are
healthy and fertile, the analysis of different gestational
ages showed that LAMC1-null mutant embryos did not
survive later than day 5.5 pc. Immunostaining of pre- and
postimplantation embryos up to 4.5 d pc showed laminin
1-negative embryos to have an apparently normal morphology although they lacked basement membranes as defined by staining for other basement membrane components. Disruptions of cell-extracellular matrix interactions
in the developing lung, kidney, and salivary gland have
been shown to inhibit epithelial morphogenesis (Ekblom
et al., 1994
; Kadoya et al., 1997
; Klein et al., 1988
). However, the fact that the null mutant embryos described here
could develop a functional pumping trophectodermal epithelium means that a basement membrane is not an absolute requirement for the differentiation of epithelia. Although this result points to the primary importance of
cell-cell interactions in epithelial development (Watson
et al., 1990
), it does not rule out a role for basement membranes in the maintenance of specific epithelia or the differentiation of other epithelial cell properties. Indeed, although a decidual reaction occurred in the uterine wall
adjacent to
/
embryos, it may be that in the absence of
the trophectodermal basement membrane that the trophoblast was unable to successfully implant into the uterus.
Although both Reichert's membrane and underlying parietal endoderm cells were absent in the LAMC1-null embryos, cells staining strongly for intracellular laminin
1 or
1 subunits were seen in the inner cell mass, characteristic
of primitive endodermal cells (Doetschman et al., 1985
;
Dziadek and Timpl, 1985
). Thus, although these cells had
evidently started to differentiate along the extra-embryonic endodermal pathway, the absence of a trophectodermal basement membrane had prevented further development involving the migration of parietal endodermal cells
and/or the differentiation of primitive endodermal cells.
The need for cellular interactions with laminin at this stage
of development is consistent with the observation that embryos lacking the
1 integrin subunit or
-dystroglycan also die rapidly after day 4.5 pc (Fässler and Meyer, 1995
;
Stephens et al., 1995
). It has previously been shown that
the formation of the proamniotic cavity in the epiblast is
due to death of the cells unable to interact with the extracellular matrix via a
1-containing integrin receptor (Coucouvanis and Martin, 1995
). At 5.5 d pc we were unable to
find anything other than disrupted laminin
1-negative embryos, the cells of which displayed increased DNA fragmentation. The fact that the increased extent of DNA
fragmentation in these embryos varied widely is consistent
with a rapid onset of apoptotic cell death subsequent to
disruption of embryo structure.
The early embryonic lethality of the LAMC1 knockout
in vivo precludes an analysis of the roles of basement
membranes in subsequent postimplantation development.
However, by observing the differentiation of
/
ES cells
in culture we were able to see that developing myotubes
were affected. It has recently been shown that the stability of myotubes derived from LAM2A
/
ES cells is compromised (Kuang et al., 1998
). Taken together with our
observation of aggregates of myosin-positive LAMC1
/
cells with processes characteristic of retraction, these
results are consistent with the laminin
1 subunit being required for the formation of
2/
1-containing laminin isoforms that are necessary for the maintenance of myotubes.
Covalent Laminin Trimers Fail to Form in the Absence
of the
1 Subunit
In the absence of the
1 subunit, no covalently bonded
laminin subunits were produced by differentiating ES
cells. Previous studies have indicated that intracellular
laminin transport and secretion is limited by the assembly
of the
1 subunit to form a triple coiled-coil
-helix with
preassembled 
dimers (Peters et al., 1985
; Hunter et al.,
1990
; De Arcangelis et al., 1996
; Yurchenco et al., 1997
).
However, despite the lack of extracellular laminin deposition in the embryoid bodies, our immunoprecipitation experiments clearly showed that some laminin subunits were
secreted from the ES cells. However, the
1 chain had undergone cleavage to produce a fragment of ~300 kD that
was released into the medium. The size of this fragment is
consistent with cleavage occurring at or close to the terminal globular domain of the
1 subunit. A similar but incomplete cutting of the laminin
1 subunit upon secretion
from transfected cells has recently been demonstrated, and it was suggested that when unable to assemble into a
coiled-coil structure, the
1 subunit adopts a conformation
laying it open to cleavage (Yurchenco et al., 1997
). Although the truncated
1 subunit in the
/
ES cell medium described here was noncovalently associated with a
protein band of 200 kD, the fact that the
1 subunit was
cleaved to a 300-kD fragment indicates that it is also unlikely to have been associated with any other laminin subunits via a coiled-coil interaction.
Basement Membrane Components Fail to Assemble in the Absence of Laminin
Experiments in vitro have shown that collagen type IV can
self-assemble into a characteristic chicken wire network
(Yurchenco and O'Rear, 1993
). Furthermore, there are reports of basement membrane-like structures lacking either
type IV collagen (Brauer and Keller, 1989
) or laminin
(Hahn et al., 1980
). However, the present work demonstrates in both embryos and embryoid bodies that laminin
is necessary for the incorporation of collagen type IV into
a continuous basement membrane. Although we cannot
rule out the hitherto undocumented existence of other
laminin
subunits, it is clear that the
1 isoform is a prerequisite for the formation of that laminin variant necessary for the assembly of the first basement membranes in
the preimplantation embryo. Furthermore, the available
data are consistent with that variant being laminin type-1,
the
1, and
1 subunits of which have also been shown to
be expressed in the preimplantation embryo (Shim et al.,
1996
). In the absence of the laminin, collagen IV and perlecan were seen in disorganized deposits within the embryoid bodies. However, little if any nidogen was deposited
with them, but instead it was released into the culture medium. Although nidogen has been shown to be able to
bind to both collagen IV and perlecan in solid-phase binding assays in vitro (Battaglia et al., 1992
; Dziadek et al., 1985
), the present experiments indicate that this apparently does not occur in the absence of laminin in embryoid
bodies. Clearly factors other than binding interactions between its individual components regulate basement membrane deposition in vivo. In this regard, it should be noted
that basement membrane organization is disrupted by targeted deletions of the
1 integrin subunit (Fässler and
Meyer, 1995
; Stephens et al., 1995
) or
-dystroglycan (Williamson et al., 1997
), pointing to the involvement of cellular receptors for laminin in basement membrane deposition.
Taken together, the present results show that other basement membrane components require laminin for their assembly into an organized basement membrane structure. Furthermore, although cell-cell contacts may be sufficient for epithelium formation during preimplantation development, these do not form a sufficient basis for postimplantation embryonic development when basement membranes are first required for endoderm differentiation.
| |
Footnotes |
|---|
Address correspondence to D. Edgar, Department of Human Anatomy and Cell Biology, Ashton Street, Liverpool L69 3GE, UK. Tel.: (44) 151-794-5508. Fax: (44) 151-794-5517. E-mail: dhedgar{at}liv.ac.uk
Received for publication 27 July 1998 and in revised form 19 November 1998.
We are greatly indebted to H. Thoenen (Max Planck Institute for Psychiatry, Munich, Germany) for providing encouragement, advice, and facilities for the initial stages of this work, to H. Thorun and B. Kunkel (both
from Max Planck Institute for Psychiatry) who provided skilled technical
assistance with tissue culture and microinjection, and to A. Fichard (Max
Planck Institute for Psychiatry) who was involved in preliminary experiments leading to this project. We thank U. Mayer and R. Timpl (both
from Max Planck Institute for Biochemistry) for generously making their antibodies available to us and also P. Soriano (Fred Hutchinson Cancer
Center Research Center, Seattle, WA) and A. Nagy (Samuel Lunenfeld
Research Institute, Mt. Sinai Hospital, Toronto, Canada) who provided
the IRES construct and R1 ES cells, respectively.
This work was supported by a European Union SCIENCE Programme Grant (SCC-CT90-0021) and Wellcome Trust grant to D. Edgar. N. Smyth, C. Frie, and M. Paulsson were supported by a grant from the Bundesministerium fuer Bildung und Forschung in the framework of the Centre for Molecular Medicine Cologne. P. Murray was supported by a postgraduate research studentship (G610/47) of the Medical Research Council.
| |
Abbreviations used in this paper |
|---|
ES, embryonic stem; pc, post coitum; TUNEL, terminal dUTP-biotin nick end labeling.
| |
References |
|---|
|
|
|---|
| 1. | Battaglia, C., U. Mayer, M. Aumailley, and R. Timpl. 1992. Basement membrane heparin sulfate proteoglycan binds to laminin by its heparan sulfate chains and to nidogen by its protein core. Eur. J. Biochem. 208: 359-366 [Medline]. |
| 2. | Beddington, R.S.P., and K.A. Lawson. 1990. Clonal analysis of cell lineages. In Postimplantation Mammalian Embryos: A Practical Approach. A.J. Copp and D.L. Cockroft, editors. IRL Press at Oxford University Press, London, UK. 267-292. |
| 3. | Brauer, P.R., and J.M. Keller. 1989. Ultrastructure of a model basement membrane lacking type IV collagen. Anat. Rec. 223: 376-383 [Medline]. |
| 4. | Burgeson, R.E. 1996. Laminins in epidermal structures. In The Laminins. P. Ekblom and R. Timpl, editors. Harwood Academic Publishers, Amsterdam, The Netherlands. 217-233. |
| 5. | Burgeson, R.E., M. Chiquet, R. Deutzmann, P. Ekblom, J. Engel, H.K. Kleinman, G.R. Martin, G. Meneguzzi, M. Paulsson, J.R. Sanes, R. Timpl, K. Tryggvason, Y. Yamada, and P.D. Yurchenco. 1994. A new nomenclature for the laminins. Matrix Biol. 14: 209-211 [Medline]. |
| 6. |
Champliaud, M.,
G.P. Lunstrum,
P. Rousselle,
T. Nishiyama,
D.R. Keene, and
R.E. Burgeson.
1996.
Human amnion contains a novel laminin variant, laminin 7, which like laminin 6, covalently associates with laminin 5 to promote
stable epithelial-stromal attachment.
J. Cell Biol.
132:
1189-1198
|
| 7. |
Chang, H.S.,
N.B. Kim, and
S.L. Phillips.
1996.
Positive elements in the laminin
gamma 1 gene synergize to activate high level transcription during cellular
differentiation.
Nucleic Acids Res.
24:
1360-1368
|
| 8. |
Cheng, Y.,
M. Champliaud,
R.E. Burgeson,
M.P. Marinkovich, and
P.D. Yurchenco.
1997.
Self-assembly of laminin isoforms.
J. Biol. Chem.
272:
31525-31532
|
| 9. | Chomczynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Analyt. Biochem. 162: 156-159 . |
| 10. | Coucouvanis, E., and G.R. Martin. 1995. Signals for death and survival a two-step mechanism for cavitation in the vertebrate embryo. Cell. 83: 279-287 [Medline]. |
| 11. |
De Arcangelis, A.,
P. Neuville,
R. Boukamel,
O. Lefebvre,
M. Kedinger, and
P. Simon-Assmann.
1996.
Inhibition of laminin alpha-1 chain expression leads
to alteration of basement membrane assembly and cell differentiation.
J.
Cell Biol.
133:
417-430
|
| 12. | Doetschman, T.C., H. Eistetter, M. Katz, W. Schmidt, and R. Kemler. 1985. The in vitro development of blastocyst-derived embryonic stem cell lines formation of visceral yolk sac, blood islands and myocardium. J. Embryol. Exp. Morphol. 87: 27-45 [Medline]. |
| 13. | Dziadek, M., and R. Timpl. 1985. Expression of laminin and nidogen in basement membranes during mouse embryogenesis and in teratocarcinoma cells. Dev. Biol. 111: 372-382 [Medline]. |
| 14. | Dziadek, M., M. Paulsson, and R. Timpl. 1985. Identification and interaction repertoire of large forms of the basement membrane protein nidogen. EMBO (Eur. Mol. Biol. Organ.) J. 4: 2513-2518 [Medline]. |
| 15. | Ekblom, P., M. Ekblom, L. Fecker, G. Klein, H.Y. Zhang, Y. Kadoyz, M.L. Chu, U. Mayer, and R. Timpl. 1994. Role of mesenchymal nidogen for epithelial morphogenesis in vitro. Development (Camb.). 120: 2003-2014 [Abstract]. |
| 16. |
Fässler, R., and
M. Meyer.
1995.
Consequences of lack of 1 integrin gene expression in mice.
Genes Dev.
9:
1896-1908
|
| 17. | Fox, J.W., U. Mayer, R. Nischt, M. Aumailley, D. Reinhardt, H. Wiedemann, K. Mann, R. Timpl, T. Krieg, J. Engel, and M.-L. Chu. 1991. Recombinant nidogen consists of three globular domains and mediates binding of laminin to collagen type IV. EMBO (Eur. Mol. Biol. Organ.) J. 10: 3137-3146 [Medline]. |
| 18. |
Friedrich, G., and
P. Soriano.
1991.
Promoter traps in embryonic stem cells a
genetic screen to identify and mutate developmental genes in mice.
Genes
Dev.
5:
1513-1523
|
| 19. |
Gavrieli, Y.,
Y. Sherman, and
S.A. Bensasson.
1992.
Identification of programmed cell death in situ via specific labeling of nuclear DNA fragmentation.
J. Cell Biol.
119:
493-501
|
| 20. |
Hahn, E.,
G. Wick,
D. Pencev, and
R. Timpl.
1980.
Distribution of basement
membrane proteins in normal and fibrotic human liver collagen type IV,
laminin and fibronectin.
Gut.
21:
63-69
|
| 21. | Helbling-Leclerc, A., X. Zhang, H. Topaloglu, C. Cruaud, F. Tesson, J. Weissenbach, F.M. Tome, K. Schwartz, M. Fardeau, and K. Tryggvason. 1995. Mutations in the laminin alpha 2-chain gene (LAMA2) cause merosin-deficient congenital muscular dystrophy. Nature Genet. 11: 216-218 [Medline]. |
| 22. | Hunter, I., T. Schulthess, M. Bruch, K. Beck, and J. Engel. 1990. Evidence for a specific mechanism of laminin assembly. Eur. J. Biochem. 188: 205-211 [Medline]. |
| 23. |
Kadoya, Y.,
K. Kadoya,
M. Durbeej,
K. Holmvall,
L. Sorokin, and
P. Ekblom.
1995.
Antibodies against domain E3 of laminin-1 and integrin 6 subunit
perturb branching epithelial morphogenesis of submandibular gland, but by
different modes.
J. Cell. Biol.
129:
521-534
|
| 24. | Kadoya, Y., K. Salmivirta, J.F. Talts, K. Kadoya, U. Mayer, R. Timpl, and P. Ekblom. 1997. Importance of nidogen binding to laminin-1 for branching epithelial morphogenesis of the submandibular gland. Development (Camb.). 124: 683-691 [Abstract]. |
| 25. |
Kallunki, P.,
K. Sainio,
R. Eddy,
M. Byers,
T. Kallunki,
H. Sariola,
K. Beck,
H. Hirvonen,
T.B. Shows, and
K. Tryggvason.
1992.
A truncated laminin chain
homologous to the B2 chain: structure, spatial expression, and chromosomal
assignment.
J. Cell Biol.
119:
679-693
|
| 26. | Klein, G., M. Langegger, R. Timpl, and P. Ekblom. 1988. Role of laminin A chain in the development of epithelial cell polarity. Cell. 55: 331-341 [Medline]. |
| 27. | Kuang, W., H. Xu, P.H. Vachon, and E. Engvall. 1998. Disruption of the lama2 gene in embryonic stem cells: laminin alpha-2 is necessary for sustenance of mature muscle cells. Exp. Cell. Res. 241: 117-125 [Medline]. |
| 28. |
Kücherer-Ehret, A.,
J. Pottgiesser,
G.W. Kreutzberg,
H. Thoenen, and
D. Edgar.
1990.
Developmental loss of laminin from the interstitial extracellular matrix correlates with decreased laminin gene expression.
Development
(Camb.).
110:
1285-1293
|
| 29. | Maurer, P., and J. Engel. 1996. Structure of laminins and their chain assembly. In The Laminins. P. Ekblom and R. Timpl, editors. Harwood Academic Publishers, Amsterdam, The Netherlands. 27-50. |
| 30. | Mayer, U., R. Nischt, E. Poschl, K. Mann, K. Fukuda, M. Gerl, Y. Yamada, and R. Timpl. 1993. A single EGF-like motif of laminin is responsible for high affinity nidogen binding. EMBO (Eur. Mol. Biol. Organ.) J. 12: 1879-1885 [Medline]. |
| 31. |
Miner, J.H.,
B.L. Patton,
S.I. Lentz,
D.J. Gilbert,
N.A. Jenkins,
N.G. Copeland, and
J.R. Sanes.
1997.
The laminin alpha chains: expression, developmental
transitions, and chromosomal locations of alpha 1-5, identification of heterotrimeric laminins 8-11, and cloning of a novel alpha 3 isoform.
J. Cell
Biol.
137:
685-701
|
| 32. |
Mortensen, R.M.,
D.A. Conner,
S. Chao,
A.A. Geisterfer-Lowrance, and
J.G. Seidman.
1992.
Production of homozygous mutant ES cells with a single targeting construct.
Mol. Cell Biol.
12:
2391-2395
|
| 33. |
Mountford, P.,
B. Zevnik,
A. Duwel,
J. Nichols,
M. Li,
C. Dani,
M. Robertson,
I. Chambers, and
A. Smith.
1994.
Dicistronic targeting constructs: reporters
and modifiers of mammalian gene expression.
Proc. Natl. Acad. Sci. USA.
91:
4303-4307
|
| 34. | Noakes, P.G., M. Gautam, J. Mudd, J.R. Sanes, and J.P. Merlie. 1995. Aberrant differentiation of neuromuscular junctions in mice lacking s-laminin/laminin beta 2. Nature. 374: 258-262 [Medline]. |
| 35. |
Ogawa, K.,
P.D. Burbelo,
M. Sasaki, and
Y. Yamada.
1988.
The laminin B2
chain promoter contains unique repeat sequences and is active in transient
transfection.
J. Biol. Chem.
263:
8384-8389
|
| 36. | Paulsson, M. 1996. Biosynthesis, tissue distribution and isolation of laminins. In The Laminins. P. Ekblom and R. Timpl, editors. Harwood Academic Publishers, Amsterdam, The Netherlands. 217-233. |
| 37. |
Peters, B.P.,
R.J. Hartle,
R.F. Krzesick,
T.G. Kroll,
F.C. Perini,
J.E. Balun,
I.J. Goldstein, and
R.W. Ruddon.
1985.
The biosynthesis, processing and secretion of laminin by human choriocarcinoma cells.
J. Biol. Chem.
260:
14732-14742
|
| 38. | Sasaki, M., and Y. Yamada. 1987. Structure of the laminin B2 chain shows multidomain structures homologous to the B1 chain. J. Biol. Chem. 26211: 17111-17117 . |
| 39. |
Sasaki, M.,
S. Kato,
K. Kohno,
G.R. Martin, and
Y. Yamada.
1987.
Sequence of
cDNA encoding the laminin B1 chain reveals a multidomain protein containing cysteine-rich repeats.
Proc. Natl. Acad. Sci. USA.
84:
935-939
|
| 40. |
Sasaki, M.,
H.K. Kleinman,
H. Huber,
R. Deutzmann, and
Y. Yamada.
1988.
Laminin, a multidomain protein. The A chain has a unique globular domain
and homology with the basement membrane proteoglycan and the laminin B
chains.
J. Biol. Chem.
263:
16536-16544
|
| 41. | Schulze, B., K. Mann, R. Battistuta, H. Wiedemann, and R. Timpl. 1995. Structural properties of recombinant domain III-3 of perlecan containing a globular domain inserted into an EGF-like motif. Eur. J. Biochem. 231: 551-556 [Medline]. |
| 42. |
Schulze, B.,
K. Mann,
E. Pöschl,
Y. Yamada, and
R. Timpl.
1996.
Structural and
functional analysis of the globular domain IVa of the laminin 1 chain and
its impact on an adjacent RGD site.
Biochem. J.
314:
847-851
.
|
| 43. | Shim, C., H.B. Kwon, and K. Kim. 1996. Differential expression of laminin chain-specific mRNA transcripts during mouse preimplantation embryo development. Molec. Reproduct. Dev. 44: 44-55 . |
| 44. | Soriano, P., C. Montgomery, R. Geske, and A. Bradley. 1991. Targeted disruption of the c-src proto-oncogene leads to osteopetrosis in mice. Cell. 64: 693-702 [Medline]. |
| 45. |
Sorokin, L.,
A. Sonnenberg,
M. Aumailley,
R. Timpl, and
P. Ekblom.
1990.
Recognition of the laminin E8 cell-binding site by an integrin possessing the
6 subunit is essential for epithelial polarization in developing kidney tubules.
J. Cell Biol.
111:
1265-1273
|
| 46. |
Stephens, L.E.,
A.E. Sutherland,
I.V. Klimanskaya,
A. Andrieux,
J. Meneses,
R.A. Pedersen, and
C.H. Damsky.
1995.
Deletion of 1 integrins in mice results in inner cell mass failure and peri-implantation lethality.
Genes Dev.
9:
1883-1895
|
| 47. | Streuli, C.H. 1996. Basement membrane as a differentiation and survival factor. In The Laminins. P. Ekblom and R. Timpl, editors. Harwood Academic Publishers, Amsterdam, The Netherlands. 217-233. |
| 48. |
Sugiyama, S.,
A. Utani,
S. Yamada,
C.A. Kozak, and
Y. Yamada.
1995.
Cloning
and expression of the mouse laminin 2 (B2t) chain, a subunit of epithelial
cell laminin.
Eur. J. Biochem.
228:
120-128
[Medline].
|
| 49. | Thorsteinsdottir, S.. 1992. Basement membrane and fibronectin matrix are distinct entities in the developing mouse blastocyst. Anat. Rec. 232: 141-149 [Medline]. |
| 50. | Timpl, R.. 1996. Macromolecular assembly of basement membranes. Curr. Opin. Cell Biol. 8: 618-624 [Medline]. |
| 51. | Watson, A.J., C.H. Damsky, and G.M. Kidder. 1990. Differentiation of an epithelium factors affecting the polarized distribution of Na+, K+-ATPase in mouse trophectoderm. Dev. Biol. 141: 104-114 [Medline]. |
| 52. |
Williamson, R.A.,
M.D. Henry,
K.J. Daniels,
R.F. Hrstka,
J.C. Lee,
Y. Sunada,
O. Ibraghimov-Beskrovnaya, and
K.P. Campbell.
1997.
Dystroglycan is essential for early embryonic development disruption of Reichert's membrane
in Dag1-null mice.
Hum. Mol. Genet.
6:
831-841
|
| 53. | Wobus, A.M., G. Wallukat, and J. Hescheler. 1991. Pluripotent mouse embryonic stem-cells are able to differentiate into cardiomyocytes expressing chronotropic responses to adrenergic and cholinergic agents and Ca2+ channel blockers. Differentiation. 48: 173-182 [Medline]. |
| 54. | Yurchenco, P.D., and J.J. O'Rear. 1993. Supramolecular organization of basement membranes. In Molecular and Cellular Aspects of Basement Membranes. D.H. Rohrbach and R. Timpl, editors. Academic Press Inc., San Diego, CA. 19-47. |
| 55. |
Yurchenco, P.D.,
A. Quan,
H. Colognato,
T. Mathus,
D. Harrison,
Y. Yamada, and
J.J. O'Rear.
1997.
The chain of laminin-1 is independently secreted
and drives secretion of its and chain partners.
Proc. Natl. Acad. Sci. USA.
94:
10189-10194
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|