|
||






* Craniofacial Developmental Biology and Regeneration Branch, National Institute of Dental and Craniofacial Research,
National Institutes of Health, Bethesda, Maryland 20892;
Laboratory of Biochemistry, Division of Applied Life Science, Kyoto
University, Kyoto 606-01, Japan; § Laboratory of Molecular Carcinogenesis, National Institute of Environmental Health Science,
Research Triangle Park, North Carolina 27709; and
Biomolecular Engineering Research Institute, Osaka 565-0874, Japan
| |
Abstract |
|---|
|
|
|---|
Using the yeast two-hybrid system and an in
vitro binding assay, we have identified a novel protein
termed vinexin as a vinculin-binding protein. By Northern blotting, we identified two types of vinexin mRNA
that were 3 and 2 kb in length. Screening for full-length cDNA clones and sequencing indicated that the two
mRNA encode 82- and 37-kD polypeptides termed vinexin
and
, respectively. Both forms of vinexin share
a common carboxyl-terminal sequence containing three
SH3 domains. The larger vinexin
contains an additional amino-terminal sequence. The interaction between vinexin and vinculin was mediated by two SH3
domains of vinexin and the proline-rich region of vinculin. When expressed, vinexin
and
localized to focal
adhesions in NIH 3T3 fibroblasts, and to cell-cell junctions in epithelial LLC-PK1 cells. Furthermore, expression of vinexin increased focal adhesion size. Vinexin
also promoted upregulation of actin stress fiber formation. In addition, cell lines stably expressing vinexin
showed enhanced cell spreading on fibronectin. These
data identify vinexin as a novel focal adhesion and cell-
cell adhesion protein that binds via SH3 domains to the
hinge region of vinculin, which can enhance actin cytoskeletal organization and cell spreading.
| |
Introduction |
|---|
|
|
|---|
VINCULIN is an abundant cytoskeletal protein found
in integrin-mediated cell-substrate adhesion sites
(focal adhesions) and also in cadherin-mediated
cell-cell adhesions (adherens junctions). Vinculin binds in
vitro to cytoskeletal proteins such as talin, paxillin,
-actinin,
and F-actin. By complex formation with these cytoskeletal
proteins, vinculin is thought to contribute to organization of the actin cytoskeleton induced by integrin-meditated
cell adhesion (Jockusch et al., 1995
; Yamada and Geiger,
1997
). Indeed, elevation or knock out of vinculin expression results in substantial alteration of cell adhesivity and
motility (Rodríguez Fernández et al., 1993; Varnum-Finney
and Reichardt, 1994
; Coll et al., 1995
; Goldmann et al.,
1995
; Volberg et al., 1995
).
From studies with proteolytic fragments of vinculin and
electron microscopy, vinculin appears to be composed of a
large globular "head" domain and a rod-like "tail" domain
(Milam, 1985
; Molony and Burridge, 1985
). The head domain binds to
-actinin and to talin, whereas the tail domain binds to F-actin and to the vinculin tail domain itself
in an intermolecular interaction (for a review, see Jockusch et al., 1995
). In the hinge region between the head and tail domains, vinculin has a short proline-rich sequence.
To date, many cytoskeletal proteins have been identified in focal adhesion and adherens junctions. Although
numerous studies have elucidated the functions of these
proteins and their interactions, little is known about the
regulation of the topology of these interactions. Interestingly, the intramolecular interaction between the head
and tail domain of vinculin has been suggested to modulate its interaction with the other cytoskeletal proteins,
talin (Johnson and Craig, 1994
),
-actinin (Kroemker et
al., 1994
), and F-actin (Johnson and Craig, 1995
), as well
as serine/threonine phosphorylation (Schwienbacher et
al., 1996
). Furthermore, phosphatidylinositol-4,5-bisphosphate (PIP2) has been found to dissociate vinculin's head-
tail interaction, unmasking its talin- and actin-binding sites
(Gilmore and Burridge, 1996
; Weekes et al., 1996
). Therefore, alteration of the conformation of vinculin is a potential regulatory mechanism for actin cytoskeletal changes.
Because of the potentially important location of the proline-rich region of vinculin and a high degree of sequence conservation of this region from Caenorhabditis elegans to
human, we screened for binding proteins to this region using the yeast two-hybrid system. Here we report the identification and characterization of a novel vinculin-binding
protein designated as vinexin.
| |
Materials and Methods |
|---|
|
|
|---|
Screening for a Vinculin-binding Protein
Two bait plasmids used for two-hybrid screening (Fields and Song, 1989
;
Chien et al., 1991
), pGB410 and pGB411, contained the proline-rich region of chicken vinculin (see Fig. 1) fused with the GAL4 DNA-binding
domain of pGBT9 (Clontech). The proline-rich region was amplified by
PCR with primer pairs 409 (5'GCCGAATTCCAGCCTCAGGAGCCAGACTTTC3') and 410 (5'GAAGTCGACTAATTGCTAGCTTCTCCTGCTTTC3'), 409 and 411 (5'CCCGTCGACTACTTGCTAGACCATTTCCGAGC3'), using a chicken vinculin cDNA clone as the template
(kindly provided by Dr. Benjamin Geiger, The Weizmann Institute, Rehovot, Israel). The resulting PCR fragments were cut with EcoRI and
SalI, and cloned into pGBT9.
|
The yeast strain HF7c (MATa, ura3-52, his3-200, ade2-101, lys2-801,
trp-1-901, leu2-3, 112, gal4-542, gal80-538, LYS2::GAL1UAS-GAL1TATA-HIS3, URA3::GAL417mers(x3)-CYC1TATA-lacZ) was transformed first with the bait plasmid, pGB410, and subsequently with a human placenta cDNA library (Clontech) fused to the GAL4 transcription-activating domain. Histidine autotrophic colonies were selected after incubation for 7 d
on media plates lacking histidine, lysed in liquid nitrogen, and then assayed for
galactosidase activity on filters. The prey plasmids were recovered from the positive colonies and reintroduced into HF7c with pGB410,
pGB411, or a control plasmid pLAM5', which carries a human lamin C/
GAL4 DNA binding domain hybrid in pGBT9 to exclude false positives.
To isolate full-length vinexin cDNA, a human HeLa 5'-stretch plus cDNA library (Clontech) and a mouse 13.5-d embryo cDNA library (kindly provided by Dr. Yoshihiko Yamada, National Institutes of Health [NIH], Bethesda, MD) were screened by plaque hybridization using the insert of the positive clone as a probe. The probe was labeled with 32P using a randomly primed DNA labeling kit (Boehringer Mannheim).
Mapping of the Vinculin Binding Site
To map the vinculin binding site in the vinexin sequence, the yeast two-hybrid system was used to detect interactions between deletion mutants of vinexin and vinculin proline-rich regions. Primer pairs N1 (5'AATGAATTCGCCGCCAGGCTCAAGTTT3') and C1 (5'AATGTCGACGGGCAGCACCTCCACATA3'), N2 (5'GAAGAATTCGAGGTTGTGGCCCAGT3'), and C2 (5'TATGTCGACTTCACGAGACACCTGC3'), and N1 and C2 were used for PCR to construct the plasmids pGAD1stSH3, pGAD2ndSH3, and pGAD1st2ndSH3, respectively. The resulting PCR products were digested with EcoRI and SalI and ligated into pGAD424 and sequenced. PCR was also used to amplify the deleted vinculin proline-rich region, pGB410d1 and pGB410d2, with primer pairs 729A (5'GCCGAATTCCATCTCCATCTGACTGATG3') and 410, and 729B (5'AGAGAATTCCCAGAAGGTGAGGTTCCC3') and 410, respectively. The PCR products were digested with EcoRI and SalI and subcloned into pGBT9.
After cotransformation of HF7c with the vinculin proline-rich region in
pGBT9 and the vinexin deletion mutants in pGAD424, transformants
were assayed for
galactosidase activity on filters or in solution.
In Vitro Binding Assay Using Affinity Precipitation
For an in vitro binding assay, various glutathione S-transferase (GST)1 fusion proteins were expressed in Escherichia coli using the inserts of pGAD424 plasmids described above and GST expression plasmid pGEX-4T-1 (Pharmacia Fine Chemicals). To construct a GST fusion protein containing the first SH3 domain and a linker region between the two SH3 domains (clone pGAD1stSH3L), primer pairs N1 and CL (5'AATGTCGACTCCATACTCCAGCACCTG3') were used for PCR, and the product was subcloned into pGEX-4T-1. GST fusion proteins were expressed in E. coli and purified with glutathione Sepharose 4B (Pharmacia Fine Chemicals) according to the supplier's instructions. Cultured human foreskin fibroblasts (kindly provided by Susan Yamada, NIH) were washed twice with PBS and lysed in NP-40 lysis buffer (0.5% NP-40, 100 µg/ml PMSF, 10 µg/ml aprotinin, 0.1 mM sodium orthovanadate). The lysate containing 400 µg total protein as estimated by microBCA assay (Pierce Chemical Co.) was incubated with 5 µg each of GST fusion protein and glutathione-Sepharose 4B at 4°C for 16 h. After four washes with lysis buffer, proteins were extracted from the Sepharose beads by boiling in loading buffer, resolved by 8% SDS-PAGE, and transferred to an Immobilon-P membrane (Millipore Corp.). Coprecipitated vinculin was detected by Western blotting using anti-human vinculin monoclonal antibody VII-F9 (a kind gift of Dr. Victor Koteliansky, Biogen, Inc., Cambridge, MA).
Northern Blotting
The cDNA of vinexin was labeled as described above and used to probe the human multiple tissue Northern blot (Clontech) containing 2 µg of polyA+ RNA.
Production of Polyclonal Antibody
Rabbit antiserum was raised against a recombinant vinexin fragment expressed by histidine-tagged bacterial expression vector pET22a (Novagen, Madison, WI) containing the vinexin cDNA insert of the clone (pVBP) isolated by the yeast two-hybrid screening. Polyclonal antibodies were affinity-purified using the recombinant protein covalently conjugated to Affigel 10 (Bio-Rad Laboratories). The bound antibodies were subsequently passed through an Affigel 10 column conjugated with E. coli whole protein extract to remove nonspecific antibodies.
Cell Lines
NIH 3T3, HeLa, C2C12, and LLC-PK1 cells were originally obtained
from American Type Culture Collection and maintained in our laboratory. Mouse myoblastic C2C12 cells (Yaffe and Saxel, 1977
) were induced
to differentiate to myotubes by culturing with 10% horse serum for 6 d.
Porcine kidney epithelial LLC-PK1 cells (Tanigawara et al., 1992
) form a
highly polarized monolayer, and were used to test vinexin localization in
an epithelial cell.
Western Blotting
Cells were extracted with lysis buffer (1.0% Triton X-100, 1.0% sodium deoxycholate, 0.1% SDS) containing 100 µg/ml PMSF, 10 µg/ml aprotinin, 10 µg/ml leupeptin, and 2.5 mM EGTA. Extracted proteins (80 µg) were boiled in loading buffer for 3 min, resolved by 8% SDS-PAGE, and transferred to an Immobilon-P membrane. The filter was blocked with Block Ace (Dainippon Pharmaceutical), incubated with 0.66 µg/ml affinity-purified anti-vinexin antibody for 1 h, rinsed in TBS (100 mM Tris, pH 7.5, 150 mM NaCl) containing 0.1% Tween 20. Immune complexes were visualized with goat anti-rabbit IgG horseradish peroxidase-conjugated secondary antibody (Bio-Rad Laboratories) and developed using the ECL kit (Amersham International).
Subcellular Localization of Vinexin
Mouse vinexin
and
were tagged with Green Fluorescent Protein
(GFP) or FLAG epitope (Eastman Kodak Co.) at the amino termini using
the expression plasmids pGZ21 or p401F, respectively. pGZ21 contains a
cytomegalovirus promoter and a GFP coding sequence with three amino
acid residue substitutions (S65A, V68L, and S72A) to increase its fluorescence in mammalian cells (Cormack et al., 1996
). Plasmid p401F is similar
to pGZ21, but contains the FLAG epitope instead of GFP, and a neomycin-resistance gene for G418 selection. To construct the expression plasmid for the GFP-tagged amino-terminal half of vinexin
(pGFPVxH), an
internal AccI restriction site was used to delete the carboxy-terminal half
of vinexin
. PCR was used to amplify the DNA fragment for the third
SH3 domain to construct pGFP3rdSH3.
NIH 3T3 cells were plated on coverslips 24 h after transfection of the expression plasmids using LipofectAMINE (Life Technologies, Inc.). We routinely observed that ~10-40% of the treated cells expressed vinexin or its fragments directed by each respective expression plasmid. After 24 h further incubation, the cells were fixed in 4% paraformaldehyde and 5% sucrose in PBS+ (PBS with 0.87 mM CaCl2, 0.49 mM MgCl2) for 30 min, and permeabilized for 5 min in 0.4% Triton X-100 in PBS+. The cells were blocked with 10% goat serum in PBS+ for 1 h, followed by incubation with antivinculin antibody. The cells were then stained with Texas Red-labeled sheep anti-mouse IgG anti-body (Amersham International) for 1 h. For F-actin staining, rhodamine-phalloidin (Molecular Probes, Inc.) was used. The fluorescence images were photographed by an Axiovert fluorescent microscope equipped with epifluorescence (Carl Zeiss Jena). For observing GFP fluorescence, a filter set for FITC supplied by Carl Zeiss Jena was used. The confocal microscope images were obtained using a Fluoview Confocal Laser Scanning microscope (Olympus Corp.).
Cell-spreading Assay
FLAG-tagged vinexin expression plasmids were constructed using the
vector p401F described above. Geneticin at 800 µg/ml (Life Technologies,
Inc.) was added to C2C12 cells 48 h after transfection with expression
plasmids for FLAG-tagged vinexin
, vinexin
, or p401F alone. Geneticin-resistant clones expressing vinexin were selected and assayed by Western blotting. In a cell-spreading assay (Aota et al., 1994
), cells were allowed to adhere and spread for 1 h on human plasma fibronectin coated at
1 µg/ml.
| |
Results |
|---|
|
|
|---|
Cloning and the Tissue Distribution of Vinexin
We used the proline-rich region of chicken vinculin for bait plasmids in the yeast two-hybrid method (Fig. 1), and screened a cDNA library constructed from human placenta polyA+ RNA. Four positive clones were isolated from 2 × 106 transformants. All four clones had an identical 1 kb cDNA fragment, and were designated pVBP. The insert of the clone contained two SH3 domains. We used the insert of pVBP as a probe for further screening to isolate full length cDNA clones, and for Northern blotting.
As shown in Fig. 2, we detected two types of mRNA molecules by Northern blotting that were 3 and 2 kb in length. The two mRNA species showed varying levels of expression in different human tissues. The 2-kb mRNA molecule was generally expressed at higher levels than the 3-kb molecule, and an especially high expression level was detected in heart for the 2-kb molecule. In contrast, a high expression level of the 3-kb molecule was observed in skeletal muscle. Interestingly, vinculin expression levels roughly correlated with the combined expression levels of the two types of vinexin mRNA molecule (Fig. 2).
|
When cDNA library screening was performed with
pVBP as the probe, we were able to isolate only the 2-kb
type of cDNA from HeLa cells. This result was consistent
with the results of Northern blotting, where the 3-kb type
of vinexin was not detected in HeLa cells (data not
shown). We isolated 3-kb-type cDNA clones from a
mouse embryo cDNA library. A schematic representation
of these clones is shown in Fig. 3 A. The longer clone,
p3A9, encodes an open reading frame of 82 kD, whereas
the protein size predicted from the 2-kb-type cDNA
clones is 37 kD. We designated these two proteins vinexin
and
, respectively. Vinexin
corresponds to the carboxyl-terminal half of vinexin
(Fig. 3 B). Since the 5' end
of the untranslated region of the cDNA clones from HeLa cells has a unique sequence not found so far in vinexin
cDNA clones, it is likely that two distinct alternative promoters give rise to the two different mRNA molecules.
|
To confirm that vinexin was actually expressed as expected, cultured cell lines were extracted with RIPA
buffer, and Western blotting was performed with antivinexin polyclonal antibody. In NIH 3T3, HeLa, and LLC-PK1 cells, a protein band with an estimated mol wt of 38 kD
was detected, suggesting that vinexin
is the major form
in these cells (Fig. 4). In mouse myoblastic C2C12 cells,
both vinexin
and
were detected. Interestingly, downregulation of vinexin
was detected after induction of
C2C12 differentiation. In HeLa and differentiated C2C12
cells, additional bands of ~30 and 75 kD were detected,
indicating that there may be additional subtypes of vinexin, or, less likely, protein degradation.
|
Mapping of Vinculin Binding Site of Vinexin
Vinexin
and
share a common carboxyl-terminal sequence that contains the three SH3 domains. Clone pVBP
isolated by the yeast two-hybrid screening contains the
first and second SH3 domains (Fig. 3). To map the region
for vinculin binding, various segments of vinexin were
fused with the GAL4 activation domain in the plasmid pGAD424 (Fig. 5 A). They were introduced into the yeast
strain HF7c with plasmid pGB410, which contains the proline-rich region of vinculin fused with the GAL4 DNA-binding domain. The results of
galactosidase activity assays for each clone are shown in Fig. 5 B. Vinculin binding
was not detected with either the first or second SH3 domain alone, whereas the clone with the first two SH3 domains showed vinculin binding.
|
The results of the two-hybrid assays were consistent with the results from an in vitro binding assay using GST fusion proteins. In this experiment, various parts of vinexin were expressed in E. coli as GST fusion proteins and were then bound to glutathione beads. The beads were incubated with cell lysate, washed, and then eluted fractions were analyzed by Western blotting using antivinculin antibody. As shown in Fig. 6, the first or the second SH3 domain alone, or the first SH3 domain with linker region (1stSH3L, Fig. 5 A) could not bind vinculin, whereas the clone containing the two SH3 domains bound vinculin in vitro. Thus, the minimal vinculin binding site was mapped to a region extending from the first to the second SH3 domain of vinexin. The binding activity of this minimal region was less than that of pVBP. One possible explanation is that the 5' end region of pVBP may have an additional activity (discussed later), and another is that the GAL4 DNA-binding domain or GST is fused too close to the first SH3 domain in these clones.
|
Mapping of Vinexin-binding Site
To map the vinexin-binding site within the proline-rich region of vinculin more precisely, new bait plasmids with various parts of the proline-rich region were constructed (Fig. 7 A). The amino acid sequence from the 849th to 893rd amino acid residues of chicken vinculin (pGB410d1) showed vinexin binding in this experiment, but residues 866-893 (pGB410d2) did not (Fig. 7 B). Thus, the vinexin-binding site is within residues 849-893. This vinexin-binding region is especially well conserved from C. elegans to human (48% identity, Fig. 1).
|
Expression of Vinexin
To determine the subcellular localization of vinexin, GFP-tagged vinexin
and
(Fig. 8) were transfected into NIH
3T3 cells. The subcellular localization of vinexin was observed by GFP fluorescence, and the same cells were also
stained with antivinculin monoclonal antibody VII-F9 and
a Texas Red-labeled second antibody (Fig. 9). Both GFP-fused vinexin isoforms were predominantly localized at focal adhesions, and both colocalized with endogenous vinculin, although vinexin
was also found in the cytoplasm
and sometimes in the nucleus. In NIH 3T3 cells highly expressing GFP-vinexin
, we sometimes observed vinculin-free dot-like GFP fluorescence, which is apparently aggregation of overexpressed GFP-vinexin
fusion protein
(Fig. 9, A and B). FLAG-tagged vinexin
and vinexin
also localized to focal adhesions, and nontagged vinexin
(expressed using clone p3A9) was also detected at focal
adhesions by indirect immunostaining with antivinexin
polyclonal antibody (data not shown). Thus, vinexin is a
novel focal adhesion protein, and it colocalizes with vinculin. Interestingly, increased vinculin staining in focal adhesions was observed in the cells expressing vinexin
(Fig. 9,
A and B). This finding may indicate the ability of vinexin
to recruit vinculin from the diffuse pool to focal adhesions, or to stabilize vinculin in focal adhesions.
|
|
Since vinculin can be found in cell-cell adhesions, vinexin localization in the porcine epithelial cell line LLC-PK1 was examined. As shown in Fig. 9, G and I, vinexin
and
were detected at cell-cell adhesions. For unknown
reasons, the fluorescence levels of diffuse vinexin
and
were high, and vinexin
was often aggregated in LLC-PK1 cells.
Vinexin
-expressing cells also showed unusually strong
rhodamine-phalloidin staining at focal adhesions, so that
the actin stress fibers had swollen ends in these cells. This
effect was particularly clearly observed by confocal microscopy, as shown in Fig. 10. The actin stress fibers in vinexin
-expressing cells were often stained strongly with
rhodamine-phalloidin, though it was difficult to quantitate. In vinexin
-expressing cells, modest increases in size
of focal adhesions were also observed (Fig. 10, G-I). Similar results were obtained with FLAG-tagged vinexin
and
(data not shown). In cells that expressed vinexin at high
levels, aggregations of GFP fluorescence or FLAG indirect immunostaining were sometimes observed that lacked
colocalized actin (Fig. 10, D and F).
|
Since vinexin may have several structural domains, various parts of vinexin were expressed separately (Fig. 8) and
examined for subcellular localization (Fig. 11). As expected, the GFP-fused insert of pVBP containing the two
SH3 domains required for vinculin binding localized to focal adhesions. GFP-fused minimal vinculin binding domain (pGFP1st2ndSH3) showed similar localization (data not shown). In contrast, the carboxyl-terminal SH3 domain (pGFP3rdSH3) showed a diffuse pattern of localization. Interestingly, the amino-terminal half of vinexin
(pGFPVxH) was also localized in focal adhesions in NIH
3T3 cells (Fig. 11), indicating the existence of focal adhesion-binding activity in this domain. In contrast to vinexin
, expression of the amino-terminal half of vinexin
did not change actin cytoskeletal organization (data not
shown).
|
Expression of Vinexin Enhances Cell Spreading
Since vinexin appeared to be a novel protein of focal adhesions, we examined the effect of vinexin expression on cell
spreading on a fibronectin substrate. Two stably expressing clones of C2C12 cells with vinexin
were isolated and
assayed for cell-spreading activity. As shown in Fig. 12,
vinexin
-expressing cells showed enhanced cell spreading
on fibronectin substrates compared with mock transfectants and untreated C2C12 cells. For unknown reasons, we
have not yet been able to isolate stable vinexin
-expressing C2C12 cells, or vinexin
- and
-expressing NIH 3T3
cells.
|
| |
Discussion |
|---|
|
|
|---|
We have identified and characterized a novel SH3 domain-containing protein termed vinexin. The vinculin-binding sequence of vinexin was mapped within the region
extending from the first SH3 domain to the second using
the yeast two-hybrid system and an in vitro binding assay.
This mapping result was consistent with the results obtained in the vinexin-expression experiments, in which vinexin
and
and the vinculin-binding region were expressed in NIH 3T3 cells: all resulted in localizations at
focal adhesions. They also localized to cell-cell adhesions
in epithelial LLC-PK1 cells. Expression of vinexin
also
promoted an increase in vinculin staining at focal adhesions. These results were consistent with the notion that
vinexin binds to vinculin in vivo. Thus, we propose that
vinexin is a novel vinculin-binding protein and also a novel
component in focal adhesion and cell-cell adhesion.
We identified a novel binding sequence in the primary
structure of vinculin. This vinexin-binding sequence was
mapped within residues 849-893 of chicken vinculin. It is
now well established that SH3 domains bind to proline-rich sequences of which the core sequence is "PXXP,"
where "P" is a proline residue and "X" for any amino acid
other than cysteine (Cohen et al., 1995
). As shown in Fig. 7
A, it is possible to assign a pair of putative PXXP motifs in
the vinexin-binding region. Exact mapping of the vinexin-binding site remains to be determined. It is also noteworthy that a high level of sequence conservation throughout
evolution of the vinexin-binding site of vinculin implies
the importance of the interaction between vinculin and vinexin.
The specificity of interaction between single SH3 domain and the proline-rich motif has been studied extensively. To our knowledge, this is the first demonstration
that a pair of SH3 domains is required for the specific interaction of two proteins, although a similar multivalency-dependent specificity has been proposed for the interaction between Sos and Grb2 (Lim, 1996
). In the case of the
SH2 domain, multivalency is known to raise the specificity of SH2 domain interactions of ZAP-70 (Hatada et al.,
1995
) and SH-PTP2 (Eck et al., 1996
). This vinexin-vinculin interaction may provide a valuable insight into the
specificity of molecular recognition of multiple binding modules.
The proline-rich region of vinculin has been examined
by several studies, and generally considered to be a hinge
between the head and tail domains (Jockusch et al., 1995
).
There are two sites near the vinexin-binding region where
V8 protease readily cleaves vinculin (Price et al., 1989
).
Thus, this region of vinculin is likely to be exposed on the
surface of the molecule. It has been shown that the cytoskeletal protein vasodilator-stimulated phosphoprotein (VASP) binds to the adjacent proline-rich stretch (residues 842-846) of vinculin in vitro (Brindle et al., 1996
;
Reinhard et al., 1996
). The binding site of VASP is therefore very close to, but not overlapping with, the vinexin
binding sequence (Fig. 7 A). It will be interesting to determine whether VASP and vinexin can access the proline-rich region of vinculin concurrently or exclusively of each other.
Expression of vinexin
resulted in a significant increase
in the size of focal adhesions and also an increase in actin
stress fiber formation. Since the effects of vinexin
expression on actin cytoskeleton was not as conspicuous as
vinexin
, the amino-terminal half of vinexin
(referred
to hereafter as VxH domain) was suggeted to play roles in
the upregulation of actin cytoskeletal organization. Our
results also indicated that the VxH domain can bind to focal adhesions, since it became localized to cell adhesions
when the domain alone was expressed in NIH 3T3 cells.
Therefore, vinexin
contains multiple interaction sites to
focal adhesion components, as summarized in Fig. 13. The
ligand(s) of the third SH3 domain is unknown at present.
In contrast to the conspicuous effects on focal adhesions
and stress fibers of vinexin
, expression of the VxH domain alone resulted in no apparent effect on focal adhesions and stress fibers. Thus, the VxH and the vinculin-binding domains may act cooperatively to upregulate actin
cytoskeletal organization, although the exact molecular
mechanism remains to be examined.
|
Our results indicate that vinexin is a novel component of
focal adhesions with a capacity to interact with vinculin.
Numerous studies have been focused on the assembly of
integrin receptors, focal adhesion components, and actin
microfilaments. Focal adhesions are large macromolecular
assemblies, consisting of many proteins including vinculin,
talin,
-actinin, paxillin, and actin. The interaction and assembly of the focal adhesion molecules are complex and
highly cooperative processes in which they are efficiently recruited from diffusible pools within the cell and bound
to each other to form multimolecular complexes linked to
the actin cytoskeleton (Geiger et al., 1992
; Jockusch et al.,
1995
; Yamada and Geiger, 1997
; Burridge et al., 1997
). At
present, it is difficult to determine how vinexin
enhances
these processes. It is, however, noteworthy that the effect
of vinculin overexpression (Geiger et al., 1992
) is similar
to that of vinexin
; i.e., a significant increase in the size of
focal adhesions and stress fibers. A possible cooperative recruitment of vinculin and vinexin
to focal adhesions,
or stabilization of vinculin, may play an important role,
since our results showed that vinculin staining at focal adhesions was markedly enhanced in vinexin
-expressing cells.
We found that the effect of vinexin
expression on actin cytoskeletal organization was less than that of vinexin
.
Nevertheless, when stably transfected cells were assayed for
cell-spreading activities on fibronectin, vinexin
-expressing clones showed significantly higher cell-spreading activities than did mock-transfected cell lines. Since conformational alteration of vinculin has been suggested as
a mechanism for the modulation of vinculin function (Johnson and Craig, 1994
, 1995
; Kroemker et al., 1994
;
Schwienbacher et al., 1996
), there is a possibility that vinexin
may enhance cell spreading by modulating vinculin conformation.
Homology searches of DNA and protein databases revealed two other structurally related proteins, CAP and
ArgBP2. CAP, also known as SH3P12, was originally isolated as a binding protein to proline-rich sequences in a
systematic screening experiment for SH3 domains (Sparks
et al., 1996
), and later as a binding protein to c-Cbl (Ribon et al., 1998b
). ArgBP2 was isolated by a two-hybrid
screening for Arg- and Abl-binding proteins (Wang et al.,
1997
). These two molecules and vinexin each contain three SH3 domains, and CAP and ArgBP2 are most related to
each other at the sequence level. There are sequence homologies found in ArgBP2 and CAP with some stretches
of amino acid sequence within the vinexin VxH domain. In
contrast to vinexin, both CAP and ArgBP2 have been reported to localize with actin stress fibers. Recently, expression of CAP was reported to enhance actin stress fiber formation and focal adhesions, and association of CAP with
cytoskeletal signaling molecules such as p125 FAK was
suggested (Ribon et al., 1998a
). These differences between
the two molecules and vinexin in subcellular localization
and association partners may indicate related but diverse
roles of these molecules.
| |
Footnotes |
|---|
Received for publication 26 May 1998 and in revised form 16 November 1998.
Address correspondence to Shin-ichi Aota, Biomolecular Engineering
Research Institute, Suita, 6-2-3 Furuedai, Osaka 565-0874, Japan. Tel.:
81-6-872-8208. Fax: 81-6-872-8219. E-mail: aota{at}beri.co.jp
We thank Drs. Mark De Nichilo, Benjamin Geiger, Victor Koteliansky, Yoshihiko Yamada, and Susan Yamada for providing valuable materials. We also thank Drs. Tohru Komano, Kazumitsu Ueda, and Yoshiro Shimura for helpful advice and support.
| |
Abbreviations used in this paper |
|---|
GFP, green fluorescent protein; GST, glutathione S-transferase; VASP, vasodilator-stimulated phosphoprotein.
| |
References |
|---|
|
|
|---|
| 1. |
Aota, S.,
M. Nomizu, and
K.M. Yamada.
1994.
The short amino acid sequence
Pro-His-Ser-Arg-Asn in human fibronectin enhances cell-adhesive function.
J. Biol. Chem.
269:
24756-24761
|
| 2. | Brindle, N.P., M.R. Holt, J.E. Davies, C.J. Price, and D.R. Critchley. 1996. The focal-adhesion vasodilator-stimulated phosphoprotein (VASP) binds to the proline-rich domain in vinculin. Biochem. J. 318: 753-757 . |
| 3. | Burridge, K., M. Chrzanowska-Wodnicka, and C. Zhong. 1997. Focal adhesion assembly. Trends Cell Biol. 7: 342-347 . [Medline] |
| 4. |
Chien, C.T.,
P.L. Bartel,
R. Sternglanz, and
S. Fields.
1991.
The two-hybrid system: a method to identify and clone genes for proteins that interact with a
protein of interest.
Proc. Natl. Acad. Sci. USA
88:
9578-9582
|
| 5. | Cohen, G.B., R. Ren, and D. Baltimore. 1995. Modular binding domains in signal transduction proteins. Cell. 80: 237-248 [Medline]. |
| 6. |
Coll, J.L.,
A. Ben-Ze'ev,
R.M. Ezzell,
J.L. Rodríguez,
Fernández,
H. Baribault,
R.G. Oshima, and
E.D. Adamson.
1995.
Targeted disruption of vinculin
genes in F9 and embryonic stem cells changes cell morphology, adhesion,
and locomotion.
Proc. Natl. Acad. Sci. USA.
92:
9161-9165
|
| 7. | Cormack, B.P., R.H. Valdivia, and S. Falkow. 1996. FACS-optimized mutants of the green fluorescent protein (GFP). Gene 173: 33-38 [Medline]. |
| 8. | Eck, M.J., S. Pluskey, T. Trub, S.C. Harrison, and S.E. Shoelson. 1996. Spatial constraints on the recognition of phosphoproteins by the tandem SH2 domains of the phosphatase SH-PTP2. Nature. 379: 277-280 [Medline]. |
| 9. | Fields, S., and O. Song. 1989. A novel genetic system to detect protein-protein interactions. Nature. 340: 245-246 [Medline]. |
| 10. |
Geiger, B.,
O. Ayalon,
D. Ginsberg,
T. Volberg,
J.L. Rodríguez,
Fernández,
Y. Yarden, and
A. Ben-Ze'ev.
1992.
Cytoplasmic control of cell adhesion.
Cold
Spring Harbor Symp. Quant. Biol.
57:
631-642
|
| 11. | Gilmore, A.P., and K. Burridge. 1996. Regulation of vinculin binding to talin and actin by phosphatidyl-inositol-4-5-bisphosphate. Nature. 381: 531-535 [Medline]. |
| 12. | Goldmann, W.H., M. Schindl, T.J. Cardozo, and R.M. Ezzell. 1995. Motility of vinculin-deficient F9 embryonic carcinoma cells analyzed by video, laser confocal, and reflection interference contrast microscopy. Exp. Cell Res. 221: 311-319 [Medline]. |
| 13. | Hatada, M.H., X. Lu, E.R. Laird, J. Green, J.P. Morgenstern, M. Lou, C.S. Marr, T.B. Phillips, M.K. Ram, K. Theriault, M.J. Zoller, and J.L. Karas. 1995. Molecular basis for interaction of the protein tyrosine kinase ZAP-70 with the T-cell receptor. Nature. 377: 32-38 [Medline]. |
| 14. | Jockusch, B.M., P. Bubeck, K. Giehl, M. Kroemker, J. Moschner, M. Rothkegel, M. Rudiger, K. Schluter, G. Stanke, and J. Winkler. 1995. The molecular architecture of focal adhesions. Annu. Rev. Cell Dev. Biol. 11: 379-416 . [Medline] |
| 15. |
Johnson, R.P., and
S.W. Craig.
1994.
An intramolecular association between
the head and tail domains of vinculin modulates talin binding.
J. Biol. Chem.
269:
12611-12619
|
| 16. | Johnson, R.P., and S.W. Craig. 1995. F-actin binding site masked by the intramolecular association of vinculin head and tail domains. Nature. 373: 261-264 [Medline]. |
| 17. | Kroemker, M., A.H. Rudiger, B.M. Jockusch, and M. Rudiger. 1994. Intramolecular interactions in vinculin control alpha-actinin binding to the vinculin head. FEBS Lett. 355: 259-262 [Medline]. |
| 18. | Lim, W.A.. 1996. Reading between the lines: SH3 recognition of an intact protein. Structure. 4: 657-659 [Medline]. |
| 19. | Milam, L.M.. 1985. Electron microscopy of rotary shadowed vinculin and vinculin complexes. J. Mol. Biol. 184: 543-545 [Medline]. |
| 20. | Molony, L., and K. Burridge. 1985. Molecular shape and self-association of vinculin and metavinculin. J. Cell. Biochem. 29: 31-36 [Medline]. |
| 21. | Price, G.J., P. Jones, M.D. Davison, B. Patel, R. Bendori, B. Geiger, and D.R. Critchley. 1989. Primary sequence and domain structure of chicken vinculin. Biochem. J. 259: 453-461 [Medline]. |
| 22. | Reinhard, M., M. Rudiger, B.M. Jockusch, and U. Walter. 1996. VASP interaction with vinculin: a recurring theme of interactions with proline-rich motifs. FEBS Lett. 399: 103-107 [Medline]. |
| 23. |
Ribon, V.,
R. Herrera,
B.K. Kay, and
A.R. Saltiel.
1998a.
A role for CAP, a
novel, multifunctional Src Homology 3 domain-containing protein in formation of actin stress fibers and focal adhesions.
J. Biol. Chem
273:
4073-4080
|
| 24. |
Ribon, V.,
J.A. Printen,
N.G. Hoffman,
B.K. Kay, and
A.R. Saltiel.
1998b.
A
novel, multifunctional c-Cbl binding protein in insulin receptor signaling in
3T3-L1 adipocytes.
Mol. Cell. Biol.
18:
872-879
|
| 25. |
Rodríguez Fernández, J.L., B. Geiger, D. Salomon, and A. Ben-Ze'ev.
1993.
Suppression of vinculin expression by antisense transfection confers changes
in cell morphology, motility, and anchorage-dependent growth of 3T3 cells.
J. Cell Biol
122:
1285-1294
|
| 26. | Schwienbacher, C., B.M. Jockusch, and M. Rudiger. 1996. Intramolecular interactions regulate serine/threonine phosphorylation of vinculin. FEBS Lett. 384: 71-74 [Medline]. |
| 27. | Sparks, A.B., N.G. Hoffman, S.J. McConnell, D.M. Fowlkes, and B.K. Kay. 1996. Cloning of ligand targets: systematic cloning of functional SH3 domains. Nat. Biotechnol 14: 741-744 . [Medline] |
| 28. |
Tanigawara, Y.,
N. Okamura,
M. Hirai,
M. Yasuhara,
K. Ueda,
N. Kioka,
T. Komano, and
R. Hori.
1992.
Transport of digoxin by human P-glycoprotein
expressed in a porcine kidney epithelial cell line (LLC-PK1).
J. Pharmacol.
Exp. Ther.
263:
840-845
|
| 29. |
Varnum-Finney, B., and
L.F. Reichardt.
1994.
Vinculin-deficient PC12 cell
lines extend unstable lamellipodia and filopodia and have a reduced rate of
neurite outgrowth.
J. Cell Biol.
127:
1071-1084
|
| 30. | Volberg, T., B. Geiger, Z. Kam, R. Pankov, I. Simcha, H. Sabanay, J.L. Coll, E. Adamson, and A. Ben-Ze'ev. 1995. Focal adhesion formation by F9 embryonal carcinoma cells after vinculin gene disruption. J. Cell Sci 108: 2253-2260 [Abstract]. |
| 31. |
Wang, B.,
E.A. Golemis, and
G.D. Kruh.
1997.
ArgBP2, a multiple Src homology 3 domain-containing, Arg/Abl-interacting protein, is phosphorylated in
v-Abl-transformed cells and localized in stress fibers and cardiocyte Z-disks.
J. Biol. Chem
272:
17542-17550
|
| 32. | Weekes, J., S.T. Barry, and D.R. Critchley. 1996. Acidic phospholipids inhibit the intramolecular association between the N- and C-terminal regions of vinculin, exposing actin-binding and protein kinase C phosphorylation sites. Biochem. J 314: 827-832 . |
| 33. | Yaffe, D., and O. Saxel. 1977. Serial passaging and differentiation of myogenic cells isolated from dystrophic mouse muscle. Nature. 270: 725-727 [Medline]. |
| 34. | Yamada, K.M., and B. Geiger. 1997. Molecular interactions in cell adhesion complexes. Curr. Opin. Cell Biol. 9: 76-85 [Medline]. |
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|