|
||
The Burnham Institute, La Jolla, California 92037
| |
Abstract |
|---|
|
|
|---|
Dendritic spines are small protrusions that receive synapses, and changes in spine morphology are thought to be the structural basis for learning and memory. We demonstrate that the cell surface heparan sulfate proteoglycan syndecan-2 plays a critical role in spine development. Syndecan-2 is concentrated at the synapses, specifically on the dendritic spines of cultured hippocampal neurons, and its accumulation occurs concomitant with the morphological maturation of spines from long thin protrusions to stubby and headed shapes. Early introduction of syndecan-2 cDNA into immature hippocampal neurons, by transient transfection, accelerates spine formation from dendritic protrusions. Deletion of the COOH-terminal EFYA motif of syndecan-2, the binding site for PDZ domain proteins, abrogates the spine-promoting activity of syndecan-2. Syndecan-2 clustering on dendritic protrusions does not require the PDZ domain-binding motif, but another portion of the cytoplasmic domain which includes a protein kinase C phosphorylation site. Our results indicate that syndecan-2 plays a direct role in the development of postsynaptic specialization through its interactions with PDZ domain proteins.
Key words: syndecan-2; heparan sulfate proteoglycan; dendritic spines; hippocampal neurons| |
Introduction |
|---|
|
|
|---|
THE importance of structural elements in learning
and memory has long been recognized (Hebb, 1949
;
Edwards, 1995
; reviewed in Milner et al., 1998
).
Structural modifications of synapses play a critical role in
regulating the plasticity underlying learning and memory
(Calverley and Jones, 1990
; Yuste and Denk, 1995
). Dendritic spines are small protrusions on the surface of dendrites that receive the majority of excitatory synapses
(Harris and Kater, 1994
). Several studies have shown that
morphological changes to dendritic spines occur during
long-term potentiation, sensory deprivation, and the rearing of animals in enriched environments (Fifkova, 1985
;
Lund et al., 1991
; Wallace et al., 1991
; Rollenhagen and
Bischof, 1994
; Buchs and Muller, 1996
; Comery et al.,
1996
; Durand et al., 1996
). Abnormal spine morphologies
have been shown to be associated with some forms of
mental retardation and autism, including fragile X syndrome (Rudelli et al., 1985
; Hinton et al., 1991
; Comery et
al., 1997
). Elucidation of the molecular mechanism for
spine development is key for understanding the mechanisms involved in learning and memory, as well as mental retardation.
Cell adhesion has been implicated in the structural modification of synapses (Lüthi et al., 1994
; Spacek and Harris,
1998
; reviewed in Rose, 1995
; Colman, 1997
; Serafini,
1997
; Hagler and Goda, 1998
). Among different classes
of molecules involved in cell-matrix adhesion, heparan
sulfate proteoglycans (HSPGs)1 have been shown to be
present in neuromuscular junctions (Eldridge et al., 1986
;
Cole and Halfter, 1996
; Meier et al., 1998
) and proposed to
be key molecules of adhesion-induced synaptic modifications (Schubert, 1991
). The functional relationships
between classic cell adhesion molecules, like cadherins,
IgCAMs, integrins, and functionally ambiguous proteoglycan-related molecules in synaptic junctions still remain to
be determined.
Syndecans are a major class of cell surface HSPGs (reviewed in Bernfield et al., 1992
; Couchman and Woods,
1996
; Carey, 1997
). Four members of the syndecan family,
syndecan-1, -2, -3, and -4, have been cloned from mammalian species. The core proteins of syndecans consist of a
structurally diverse extracellular domain, highly conserved
transmembrane, and cytoplasmic domains. The extracellular domain carries several heparan sulfate chains, which
bind a number of heparin-binding molecules, including
growth factors, extracellular matrix, and cell adhesion proteins (reviewed in Couchman and Woods, 1996
; Carey,
1997
).
Syndecans are known to be concentrated at specific sites
on the cell surface (reviewed in Couchman and Woods,
1996
; Carey, 1997
). It has been shown that syndecan-1
colocalizes with actin filaments in areas of cell-matrix
adhesion (Carey et al., 1994
), syndecan-2 is expressed at
sites of cell-cell and cell-matrix interactions (David et
al., 1993
), and syndecan-4 is localized to focal adhesions
(Woods and Couchman, 1994
). Mechanisms for the targeting of syndecans toward specific membrane sites are not completely understood, although phosphorylation and
molecular interactions of their cytoplasmic domains are
thought to play roles in these processes. The cytoplasmic
domains of syndecans contain several potential phosphorylation sites. There are four tyrosine residues conserved
among all members of the family, including invertebrate
syndecans. In addition, syndecan-2 has a unique serine phosphorylation site for protein kinase C (PKC). It has
been shown that syndecan-2 can be serine phosphorylated
by Ca2+-dependent or conventional isoforms of PKC
,
,
and
, and that phosphorylation is dependent on the oligomerization of its cytoplasmic domain (Itano et al., 1996
;
Oh et al., 1997
). The cytoplasmic domain of syndecan-1 is
required for its colocalization with actin filaments (Carey
et al., 1994
, 1996
). Moreover, the COOH-terminal EFYA
motif of syndecan-2, identical in all members of the syndecan's family, can interact with PDZ domain proteins, such
as syntenin (Grootjans et al., 1997
) and the postsynaptic
protein CASK (Cohen et al., 1998
; Hsueh et al., 1998
).
PDZ domain proteins are thought to play critical roles in
the organization of postsynaptic specializations (Craven
and Bredt, 1998
). Thus, syndecans could provide a molecular link between intracellular cytoskeleton/signaling complex and the extracellular environment at specific sites on
the cell surface.
In this paper, we present evidence indicating that syndecan-2 plays a critical role in the maturation of dendritic spines. Syndecan-2 is highly concentrated on the spines of mature hippocampal neurons in culture, and its clustering occurs concomitant with the morphological maturation of spines. Most importantly, we demonstrate that forced expression of syndecan-2 in young neurons, by transient transfection, causes early transformation of immature dendritic protrusions into morphologically mature spine-like structures. Moreover, by introducing syndecan-2 deletion mutants, we demonstrate that the interaction of syndecan-2 with PDZ domain proteins is involved in the morphological maturation of dendritic spines. However, deletion of the PDZ domain binding site of syndecan-2 did not affect the spine-specific targeting and clustering of syndecan-2, suggesting that these processes require other parts of the cytoplasmic domain, that include potential serine and tyrosine phosphorylation sites. Thus, we show a direct functional role for syndecan-2 in spine development, and suggest that the cell surface HSPG syndecan-2 is involved in molecular interactions underlying postsynaptic modifications.
| |
Materials and Methods |
|---|
|
|
|---|
RNA Purification and Reverse Transcriptase-PCR
Total RNA was extracted from cultures of rat hippocampal neurons at different time points by using Triazol reagents (Life Technologies, Inc.). Reverse transcriptase PCR (RT-PCR) was performed with 2 µg of total
RNA as described previously (Watanabe and Yamaguchi, 1996
) with the
following primer pairs (forward and backward, respectively): syndecan-1
CCCAAGCTTGGGATGACTCTGACAACTTC and GGTATAGCATGAAAGCCACCAGACGTCAA; syndecan-2 CGGAATTCTCAACCCATCGGCTGCTTGCTT and GCTCTAGACCTTAGTGGGTGCCTTCTGGTA; syndecan-3 CCCAAGCTTAGCGAGCGAACGAA-CGAGCGA and CGGGATCCTGAACCGCATGGCTGTCTCAAG; syndecan-4 CGGAATTCATGAAGACGCTGGGGGCCTTGA and
CGGGATCCAATCCTCAACTCCTCTCCCCATGA; glypican-1 CCCAAGCTTTCGGCTTTTGTTGTCTCCGCCTCC and CGGGATCC-AAGGCCCGAGTGTTCTGCGTGTAC; glypican-2 CCCAAGCTTTGTTCAGTTTTGGGGGGGACGCT and CGGGATCCGGGAATAC- AGGCGACCATAGGAAT; perlecan CCCAAGCTTGGACTTTCAGATGGTTTATTTCCG and CGGGATCCCCGCTGGAAATGACTGTGTGCA; agrin CGGAATTCACTCCATAAGAACTCCCACACAC and GCTCTAGATGGCACAGGCATGACTAAGCAG. Each set of
primers was designed from rat cDNA sequences. PCR products were analyzed on agarose gel and purified using Qiagen spin columns. All positive
PCR products were isolated from the gel and confirmed to be the authentic fragments by sequencing.
Primary Cultures of Rat Hippocampal Neurons
Hippocampal neurons were prepared from embryonic day (E) 17-18 rat
embryos and cultured according to Zafra et al. (1990)
with minor modifications. Briefly, after trypsinization and mechanical dissociation, hippocampal cells suspended in DME supplemented with 10% FCS were preplated on uncoated culture plates for 2 h to remove glial cells. Neurons
recovered as nonadherent cells were plated on coverslips coated with
poly-DL-ornithine (0.5 mg/ml) and laminin (5 µg/ml) at densities of 5 × 104
cells per coverslip. Neurons were cultured in serum-free DME supplemented with insulin (150 mg/ml) under 5% CO2/10% O2 atmosphere at
37°C (Brewer and Cotman, 1989
). Cultures were maintained up to 40 d.
Construction of Syndecan Deletion Mutants
Full-length and truncated rat syndecan-2 cDNAs were amplified by
RT-PCR from hippocampal neuron total RNA. The following pairs of
oligonucleotide primers were used. For full-length syndecan-2 cDNA:
forward, 5'-CGGAATTCTCAACCCATCGGCTGCTTGCTT; reverse,
5'-CTGGGCCCGTCATGCATAAAACTCCTTAGTGGGTGC. For
syndecan-2
cyto cDNA: forward, 5'-CGGAATTCTCAACCCATCGGCTGCTTGCTT; reverse 5'-CTGGGCCCGTCACCGCATGCGGTAC. Amplified cDNAs were ligated into EcoRI/ApaI-cut pEGFPN1
( Laboratories, Inc.). The syndecan-2
EFYA deletion mutant was generated by mutagenizing the glutamic acid and phenylalanine
residues of the full-length syndecan-2 construct into two stop codons by
using QuickChange Site-Directed Mutagenesis kit (Stratagene). All constructs were confirmed by sequencing.
Transfection of Hippocampal Neurons
Transient transfection of rat hippocampal neurons was performed at 1 day
in vitro (DIV) by the calcium phosphate coprecipitation method (Chen
and Okayama, 1987
). Briefly, 10:1 or 1:1 mixtures of various syndecan-2
expression constructs and pEGFPC1 (for green fluorescent protein, GFP,
expression) were precipitated in 400 µl of calcium-containing phosphate
buffer (MBS transfection kit; Stratagene) for 20 min at room temperature.
DNA precipitates diluted in complete medium were added to coverslips
of 1 DIV hippocampal neurons, plated at 2 × 105 per 12-mm coverslip and
cells were incubated for 6 h at 35°C under 3% CO2. The cells were washed
gently three times (15 min each) with culture media, and maintained under 5% CO2/10% O2 at 37°C. Transfected neurons have been shown to express significant levels of GFP for 8 d after transfection.
Immunofluorescence
To localize heparan sulfate or syndecan-2 immunoreactivity in cultured
rat hippocampal neurons, cells were stained alive or fixed in ice-cold
methanol for 20 min at
20°C. Live staining was carried out at room temperature in DME containing 10% FCS. Cells were incubated for 1 h with
one of the following primary antibodies: anti-heparan sulfate mAb 10E4
(JgM; 1:50 dilution; Seikagaku America, Inc.) or anti-syndecan-2 polyclonal antibody (pAb) #903 (1:100 dilution; gift from Dr. Merton Bernfield). Fluorescein-conjugated goat anti-mouse IgM (1:50 dilution; Cappel
Laboratories) or rhodamine-conjugated anti-rabbit IgG (1:100 dilution;
Chemicon International, Inc.) was used for immunofluorescent staining of
heparan sulfate or syndecan-2, respectively. Then cells were processed for
double immunolabeling by fixation in 4% paraformaldehyde in PBS for
0.5 h at room temperature and blocking in 5% normal goat serum (NGS) for 1 h. After permeabilization in 0.2% Triton X-100/PBS for 10 min, cells
were washed with PBS containing 0.2% Tween 20 and 1% NGS and incubated with the following primary antibodies diluted in the washing solution: anti-NCAM pAb (IgG; 1:100; gift from Dr. Vladimir Berezin), anti-MAP2 mAb (IgG; 1:100; ); anti-synapsin I pAb (IgG;
1:100; gift from Dr. Andrew Czernik), and antisynaptophysin mAb (IgG;
1:100; ). Incubation with primary antibodies was performed at room temperature for 2 h. Bound antibodies were detected with
rhodamine-conjugated goat anti-mouse IgG (1:50 dilution; Cappel Laboratories), or rhodamine-conjugated anti-rabbit IgG (1:100 dilution;
Chemicon International), or fluorescein-conjugated anti-mouse IgG
(1:100 dilution; Chemicon International).
For double immunostaining with anti-postsynaptic density (PSD) 95 mAb (JgG; 1:100; clone 6G6, ) and anti-heparan sulfate or anti-syndecan-2 antibodies, cells were fixed in methanol for 20 min
at
20°C and further processed as described in Kornau et al. (1995)
.
For immunostaining of transfected hippocampal neurons with anti-syndecan-2 pAb neurons at 8 DIV were fixed in 4% paraformaldehyde in PBS for 0.5 h at room temperature, preblocked, and incubated with primary antibodies as described above. Bound antibodies were detected with rhodamine-conjugated secondary antibody. The cells were mounted using fluorescence H-1000 medium (Vector Labs) and analyzed by confocal microscopy.
Confocal Imaging
Immunofluorescent staining was analyzed using LSM-410 and BioRad MRC 1024 confocal laser scanning microscopes. Optical sections of the hippocampal neurons were taken at an interval of 0.3 µm in the X-Y plane. To make different experiments comparable, all pictures were taken under the same parameters. The maximal intensity three-dimensional images are the results of projection of the optical serial sections. For double immunofluorescent staining, identical section series were selected.
For the analysis of dendritic protrusions/spines, transiently transfected
GFP-positive or DiO-injected hippocampal neurons were analyzed using
an oil immersion, 100 × 1.4 NA objective. In the case of syndecan-2/GFP
double transfection, only those neurons that were immunopositive for
syndecan-2 or its deletion mutants were considered as syndecan-2 transfected or syndecan-2
EFYA transfected, correspondingly. Neurons that
were positive for GFP, but did not express syndecan-2 were considered as
control transfected. Serial optical sections were taken at an interval of
0.2 µm for each image with 4× zoom. For quantitative analysis, the numbers of protrusions/spines were counted in the proximal 50-µm segments
of dendrites. Hidden spines that protrude toward the back or front of the
viewing plane were not counted. Length of protrusions/spines was determined using MetaMorph software by measuring distance between its tip
and base. In each experiment, at least 200 spines were counted from >10
neurons. Statistical analyses was performed using Microsoft Excel. Groups
of spines were compared with Student's t test.
For analysis of dendritic spine morphology in nontransfected cultures, 1-4 wk after plating cultures were fixed in 4% paraformaldehyde in PBS for 30 min, individual cells were microinjected with FAST DiO (D-3898; Molecular Probes, Inc.). Coverslips were placed at 4°C in 2% paraformaldehyde in PBS for an additional 24 h to allow dye to transport before confocal microscopy. Confocal microscopy was performed as described above.
| |
Results |
|---|
|
|
|---|
Localization of Heparan Sulfate in Hippocampal Neurons
Heparan sulfate immunoreactivity has been found previously in adult rat hippocampus (Goedert et al., 1996
; Fuxe
et al., 1997
). To define the precise localization of heparan
sulfate on neuronal cell surfaces, we used glia-free monolayer cultures of E 17-18 rat hippocampal neurons. In
these cultures, neurons form synapses and establish neuronal circuits in the course of 3-4 wk in vitro. Immunofluorescent staining for heparan sulfate was performed on these neurons at different stages in culture with the 10E4
mAb that recognizes intact heparan sulfate chains (David
et al., 1992
; Goedert et al., 1996
). The expression of heparan sulfate is weak and diffuse during the first 2 wk in
culture (Fig. 1, A and B), but then increases during the
following weeks. At 3 wk in vitro, heparan sulfate immunoreactivity was detectable as punctate signals distributed
on the cell bodies and dendrites (Fig. 1 C). The punctate staining became even stronger at 4 wk in vitro (Fig. 1, D
and F). This timing of heparan sulfate expression temporally coincided with the widespread formation of dendritic
spines (Fig. 1, E-H). At 1 wk in vitro, when the majority of
dendritic protrusions were long, thin filopodia (Fig. 1 G),
heparan sulfate immunostaining was very weak and did
not show any distinct pattern of distribution (Fig. 1 E). By
4 wk in vitro, the majority of postsynaptic sites developed
into stubby or mushroom-shaped mature spines (Fig. 1 H),
morphologically similar to the spines seen in vivo. At the same time, strong heparan sulfate immunoreactivity was
detected as puncta along the dendrites (Fig. 1 F). These results suggested that heparan sulfate may be associated
with dendritic spines.
|
To localize cell surface heparan sulfate immunoreactivity on hippocampal neurons at 30 DIV, cells were first
stained alive for heparan sulfate, with subsequent fixation
and double immunostaining for synapsin I, a specific
marker of presynaptic boutons. Confocal microscopy revealed close apposition of cell surface heparan sulfate and
synapsin I immunoreactivities (Fig. 2, A-E). Frequently
they showed partial, but not complete, overlap (Fig. 2, B
and C). This staining pattern suggests that cell surface
heparan sulfate is associated with the synaptic junctions of
cultured hippocampal neurons. Double labeling of methanol-fixed 30 DIV hippocampal neurons with antibodies to
heparan sulfate and PSD-95 further confirmed the synaptic localization of heparan sulfate. Punctate immunoreactivities of heparan sulfate and PSD-95 colocalized well on
dendrites (Fig. 2, F-I). There was some nonoverlapping
immunostaining for heparan sulfate in perikaryon and
proximal dendrites. This staining was not seen in the case
of immunolabeling of live cells (Fig. 2 D), suggesting that
some heparan sulfates are associated with intracellular
compartments. Double staining for heparan sulfate and either MAP2, a dendritic marker (Fig. 3, A-E), or NCAM
(Fig. 3, F-H) further demonstrated a punctate distribution
of cell surface heparan sulfate along the dendrites of hippocampal neurons. High-power confocal imaging revealed
the localization of heparan sulfate on small protrusions on
the shafts of dendrites (Fig. 3, D, E, and H). These results
strongly suggest that heparan sulfate is present in dendritic
spines. Interestingly, while pyramidal neurons, which comprise the majority of cells in these cultures, had these heparan sulfate-immunoreactive protrusions, we occasionally found neurons that were positive for MAP2 but negative for heparan sulfate (arrows in Fig. 3, A-C). These
neurons had smaller cell bodies and more satellite shapes
than pyramidal neurons, a morphology consistent with
that of local interneurons, that were present in these cultures as a minor population. It has been shown that local
interneurons tend to lack dendritic spines (Harris and
Kater, 1994
). Taken together, these results demonstrate
localization of cell surface heparan sulfate to the dendritic
spines of hippocampal pyramidal neurons.
|
|
Temporal Expression of Different Heparan Sulfate Proteoglycans in Cultured Hippocampal Neurons
To identify the molecular species of HSPGs expressed in the dendritic spines, we performed RT-PCR analysis. Pairs of specific oligonucleotides were designed for eight different HSPGs known to be expressed in nervous tissues. Among the HSPGs examined, no expression of perlecan, agrin, or syndecan-3 was detected at any stage of culture (not shown). Syndecan-1, glypican-1, and glypican-2 (cerebroglycan) were detected in young cultures, but their expression decreased substantially as the neurons matured (Fig. 4 A). Only syndecan-2 and syndecan-4 showed temporal expression patterns consistent with the immunostaining results (Fig. 4 B). No syndecan-2 mRNA was detected at any time between plating and 8 DIV. Expression of syndecan-2 was first detectable at 9 DIV and then steadily increased to reach a plateau at 21 DIV, while syndecan-4 expression increased more abruptly at 30 DIV.
|
Syndecan-2 Localization in Dendritic Spines
To determine which syndecan is responsible for the spine-specific accumulation of heparan sulfate, hippocampal
neurons at 30 DIV were stained with pAbs to syndecan-2
and syndecan-4 (Kim et al., 1994
). This analysis revealed
that syndecan-4 is not expressed in neurons, but in astrocytes which were present as a minor population in older
cultures (data not shown). On the other hand, syndecan-2 is expressed in neurons in a time course and a pattern similar to those of heparan sulfate immunoreactivity. Syndecan-2 was localized on the surface of dendrites and cell
bodies of hippocampal pyramidal neurons in a punctate
pattern (Fig. 4, D-F). Syndecan-2 immunoreactivity was
first detected at 2 wk in vitro. Then punctate staining became even stronger at 3 and 4 wk in vitro (Fig. 4, E and F).
Double staining for synaptophysin, a presynaptic marker,
and syndecan-2 showed partially overlapping patterns of
staining, similar to the result of synapsin I/heparan sulfate
double staining (see Fig. 2, A-C). Double staining with
anti-syndecan-2 and anti-PSD-95 antibodies further confirmed a synaptic localization of syndecan-2 (Fig. 5, E-I).
Punctate immunoreactivity for syndecan-2 and PSD-95 showed significant overlap mostly along dendrites (Fig. 5,
E-G), although occasionally there were some PSD-95-
positive dots that were not positive for syndecan-2 (see arrows in Fig. 5 G). These puncta are likely to represent
PSD-95 at nonsynaptic sites on dendritic shafts (Aoki, C.,
Z. Shusterman, M. Kasat, M. Bak, L. Alexandre, and D.S.
Bredt. 1998. Society for Neuroscience Annual Meeting.
Abstract 713.11). Together, these results strongly suggest that syndecan-2 is the cell surface HSPG predominantly
localized on the dendritic spines of cultured hippocampal
neurons. In adult rat brain, syndecan-2 has been shown recently to be highly concentrated at asymmetric synapses
formed on the dendritic spines of pyramidal neurons in the
CA3 area of the hippocampus (Hsueh et al., 1998
). These
observations further support our finding that syndecan-2 is
one of the HSPGs responsible for the spine-specific accumulation of heparan sulfate on mature hippocampal neurons in vitro, though a contribution by unknown HSPGs
has not been ruled out.
|
Forced Expression of Syndecan-2 Induces Morphological Maturation of Dendritic Spines in Young Hippocampal Neurons
The highly specific localization of syndecan-2 on dendritic
spines and the timing of its appearance suggest that syndecan-2 may be functionally involved in the development
and maturation of dendritic spines. It has been shown that
mature dendritic spines develop from thin, filopodia-like
protrusions, and that this process is induced by the formation of contacts between the dendritic protrusions and
nearby axons (Ziv and Smith, 1996
). In cultured hippocampal neurons at 1 wk in vitro, the majority of dendritic protrusions are characterized as long, thin filopodia-like
structures (Fig. 6 D; also see Papa et al., 1995
; Ziv and
Smith, 1996
). During the next 2 wk, these filopodia-like
protrusions actively initiate contacts with nearby axons,
and by 3-4 wk in vitro, transform into mature spines with
stubby or mushroom-like shapes (Fig. 6 E), as seen with
hippocampal dendritic spines in vivo (Papa et al., 1995
).
|
We hypothesized that, if syndecan-2 is functionally involved in spine development, then forced expression of syndecan-2 in young neurons would affect the morphology of spines. To test this hypothesis, hippocampal neurons were transfected at 1 DIV with syndecan-2 cDNA in an expression vector driven by the cytomegalovirus promoter. A GFP-expression vector was cotransfected with the syndecan-2 cDNA expression vector to visualize entire cell contours of transfected neurons, including dendritic protrusions. At 7 d after transfection (8 DIV), cultures cotransfected with syndecan-2 and GFP were examined for expression of exogenous syndecan-2 by immunostaining with anti-syndecan-2 antibodies and the morphology of dendritic protrusions by GFP fluorescence (see Fig. 4 C, endogenous syndecan-2 is not yet expressed at 8 DIV). Neurons transfected with GFP alone were considered as control transfected neurons.
We found remarkable morphological changes in the
dendritic protrusions of syndecan-2 transfected neurons.
While dendritic protrusions of control transfected neurons
were highly variable in length (Fig. 6 H; control transfectants, 8 DIV), protrusions in syndecan-2 transfected neurons were shorter and more homogeneous in length (Fig. 6
F; syndecan-2 transfectants, 8 DIV; also see Table I).
More remarkably, the majority of the protrusions in syndecan-2 transfected neurons had stubby or mushroom-like
shapes with conspicuous heads (Fig. 6 A; arrowheads).
Spines with these types of morphologies are typically
found in mature neurons after 3 wk in vitro (Fig. 6, E and
J; see also Papa et al., 1995
), but are rarely observed in
young neurons before 2 wk in vitro (Fig. 6 D and Table I).
Immunofluorescent staining revealed that exogenous syndecan-2 was expressed as numerous dots along the dendrites, tightly associated with these spine-like structures
(Figs. 6 A and 7 A). This pattern of distribution was similar to that of endogenous syndecan-2 after 3 wk in vitro
(see Fig. 4, E and F). In contrast, dendritic protrusions
of control transfected neurons showed no morphological
changes. They showed thin, filopodia-like shapes (Fig. 6
C) as seen in normal nontransfected hippocampal neurons
at the same stage in culture (Fig. 6 D).
|
To examine the specificity of the effect, we compared the morphological changes between syndecan-2-expressing and syndecan-2-nonexpressing cells in the same culture (Table I). When syndecan-2 and GFP expression vectors were cotransfected in a 1:1 ratio, ~30% of the GFP-positive neurons also expressed syndecan-2, while the others expressed GFP but not syndecan-2. These cells expressing only GFP served as an internal control for possible nonspecific effects of transfection. We found that neurons showing GFP fluorescence, but not syndecan-2 immunoreactivity, had dendritic protrusions with immature morphology similar to those seen in normal nontransfected neurons (Fig. 6, D and I), whereas neurons in the same culture that showed both GFP fluorescence and syndecan-2 immunoreactivity had spines with mature morphology (Table I). These results indicate that the effect of syndecan-2 transfection on spine morphology is not a nonspecific effect of transfection, but a specific effect of syndecan-2 expression.
Despite the changes in protrusion length and shape, the total number of dendritic protrusions was not altered by syndecan-2 transfection (12.2 ± 1.3 and 10.2 ± 1.6 protrusions per 50-µm segment of dendrite for syndecan-2 and control transfected neurons, respectively). Hence, these results indicate that the observed changes were due to morphological transformation of long filopodia into spines with mature morphologies, rather than the selective elimination of filopodia.
To examine whether these morphological changes in dendritic protrusions were accompanied by an increase in the number of synaptic contacts, we quantitated the number of synapsin I-positive presynaptic boutons in syndecan-2 transfected and control transfected neurons. Normally, the morphological changes from long, thin filopodia to mature spines occur after the formation of synaptic contacts with presynaptic axons. However, spine maturation induced by the early introduction of syndecan-2 into young neurons was not due to an acceleration of synaptogenesis. As shown in Table II, the number of synapsin I-positive presynaptic boutons did not increase in syndecan-2 transfected neurons. Moreover, only a portion of syndecan-2-positive protrusions with the mature spine-like morphology received presynaptic boutons (Table II). These results suggest that the early introduction of syndecan-2 into young neurons, before they establish synapses, circumvented this process and caused premature initiation of a spine maturation program.
|
|
Syndecan-2-induced Maturation of Dendritic Spines Requires the COOH-terminal EFYA Motif
Syndecan-2 has been shown recently to interact with at
least two PDZ domain proteins, syntenin (Grootjans et al.,
1997
) and CASK (Cohen et al., 1998
; Hsueh et al., 1998
),
through its COOH-terminal EFYA motif. The importance
of PDZ domain proteins in synaptic organization has attracted increasing attention. The subsynaptic molecular
lattice involving PSD-95 and CASK is thought to play a
critical role in the organization of postsynaptic specialization by localizing signal transduction molecules and
ligand-gated ion channels to the postsynaptic membrane
(Naisbitt et al., 1997
; reviewed in Craven and Bredt, 1998
).
To investigate whether the syndecan-2-mediated maturation of dendritic spines involves the interaction of syndecan-2 with PDZ domain proteins, we transfected neurons
with a syndecan-2 deletion mutant that lacked the COOH-terminal EFYA motif (syndecan-2
EFYA). It has been
shown that the EFYA motif is critical for binding to both
syntenin and CASK (Grootjans et al., 1997
; Cohen et al.,
1998
; Hsueh et al., 1998
). We found that deletion of this PDZ domain binding motif abolished the ability of syndecan-2 to induce the morphological maturation of spines.
In syndecan-2
EFYA-transfected neurons, the majority
of dendritic protrusions showed immature morphologies
(Fig. 6 B) and were highly variable in length (Fig. 6 G, syndecan-2
EFYA transfectants, 8 DIV), similar to those of
control transfected neurons (Fig. 6, C and H, control transfected, 8 DIV). These results indicate that the effect of
syndecan-2 on spine maturation requires the interaction of
syndecan-2 with PDZ domain proteins expressed in hippocampal neurons.
Targeting of Syndecan-2 to Dendritic Protrusions Requires the Cytoplasmic Domain But Not the EFYA Motif
Interestingly, although deletion of the PDZ domain binding motif abrogated the ability of syndecan-2 to induce
spine maturation, it did not affect the targeting of syndecan-2 into dendritic protrusions. Syndecan-2 that lacked
the EFYA motif was still sorted to dendrites and showed a
punctate distribution (Fig. 7 B), similar to that of full-length syndecan-2 (Fig. 7 A). High-power views revealed the clustering of truncated syndecan-2 on dendritic protrusions that had immature morphologies (Fig. 6 B). In some
instances, clusters of truncated syndecan-2 were found at
the tips of the protrusions. Quantitative analysis showed
that the numbers of syndecan-2 clusters in dendrites were
essentially the same between full-length syndecan-2 and
syndecan-2
EFYA transfected neurons (Table II). However, clustering of syndecan-2 in dendritic protrusions was
completely abolished in neurons transfected with another
syndecan-2 mutant that lacked most of the cytoplasmic domain, except three juxtamembrane amino acids (syndecan-2
cyto). This three amino acid tail was left to ensure
correct folding of the deletion mutant. A similar strategy
was used by Carey et al. (1996)
with a syndecan-1 deletion
mutant that shares 100% homology with other syndecans in transmembrane and juxtamembrane cytoplasmic domains.
Cell surface anchoring of our mutant was also confirmed
by confocal microscopy in Z-plane (data not shown). Syndecan-2
cyto was diffusely distributed on the surface of
neurons without any specific sorting pattern (Fig. 7 C).
Together, these results demonstrate that the clustering of
syndecan-2 on the dendritic protrusions is mediated, at
least in part, by the cytoplasmic domain, but is independent of interactions with PDZ domain proteins, suggesting
that a part of the cytoplasmic domain other than the
EFYA motif is involved in the targeting of syndecan-2 to
dendritic protrusions.
| |
Discussion |
|---|
|
|
|---|
In this paper, we present evidence that the cell surface heparan sulfate proteoglycan syndecan-2 plays a significant functional role in the structural transformation of dendritic protrusions into mature spines. We demonstrate that syndecan-2 is specifically localized on the dendritic spines of cultured hippocampal neurons, coinciding with the morphological maturation of the spines. Syndecan-2 introduced by transfection into young hippocampal neurons is targeted to dendritic protrusions, and induces their early morphological maturation into spine-like structures. The COOH-terminal EFYA motif of syndecan-2, the binding site for PDZ domain proteins, is required for the maturation-inducing effect of syndecan-2, but is not essential for the targeting of syndecan-2 to dendritic protrusions. These results suggest that molecular interactions involving syndecan-2 play a significant role in the organization of postsynaptic structures.
The interaction of syndecan-2 with PDZ domain proteins has been reported recently by different groups.
Grootjans et al. (1997)
identified a novel PDZ domain
protein called syntenin by yeast two-hybrid screening, using the cytoplasmic domain of syndecan-2 as a bait. More
recently, yeast two-hybrid screening identified the cytoplasmic domain of syndecan-2 as a ligand for CASK (Cohen et al., 1998
; Hsueh et al., 1998
). Hsueh et al. (1998)
have further demonstrated that syndecan-2 is present in
the vicinity of synapses in adult rat brain. By using cultures
of rat hippocampal neurons, we have been able to localize
syndecan-2 to the dendritic spines of mature hippocampal
pyramidal neurons. Moreover, we showed that the accumulation of syndecan-2 on dendritic spines occurs concomitant with their structural maturation. These observations indicate that syndecan-2 is actively targeted to, and
accumulated on, dendritic spines by a developmentally
regulated mechanism.
The most intriguing finding of our study is that syndecan-2, when transfected into young neurons, directly
influences the morphology of dendritic protrusions, transforming them into mature spine-like structures with
characteristic shapes. This effect was clearly due to syndecan-2, as syndecan-2 deletion mutants did not show these
changes. Transfected full-length syndecan-2 was indeed
expressed on the dendritic protrusions that had undergone morphological reorganization. Abnormalities in dendritic
spine development have been found in some forms of
mental retardation and autism (Rudelli et al., 1985
; Hinton
et al., 1991
; Comery et al., 1997
). Interestingly, recent findings have shown that the syndecan-2 gene may be inactivated by positional effects in a patient with autism, mental
retardation, and multiple exostoses (Ishikawa-Brush et al.,
1997
). It is tempting to speculate that the deficiency in
dendritic spine maturation, seen in patients with these
neurodevelopmental disorders, might be caused by misexpression of syndecan-2.
As to how syndecan-2 induces the formation of morphologically mature spines is now an important question in understanding the mechanism of spine development. Our results have provided some preliminary insight into this process. We found that the COOH-terminal EFYA motif of syndecan-2 is required for the induction of spine maturation by syndecan-2. These results strongly suggest that interaction with PDZ domain proteins is essential for this effect. CASK, which has been shown to be expressed in synapses, is the most likely candidate for the syndecan-2 ligand in spines, although other PDZ domain proteins may also be involved.
While syndecan-2 is specifically localized in the synaptic
junctions of mature neurons, CASK is not exclusively concentrated at synapses, but is also present in a variety of
membrane compartments in neurons, and its compartmentalization between membrane and cytoplasm may be regulated by an as yet unknown mechanism (Hsueh et al.,
1998
). Our transfection experiments with syndecan-2 lacking the EFYA motif (syndecan-2
EFYA) illuminates a
new view on this matter. While the EFYA motif (PDZ domain binding site) is required for the morphological maturation of spines in syndecan-2 transfected neurons, a mutant lacking the EFYA motif still clustered in dendritic protrusions. Therefore, clustering of syndecan-2 in spines
occurs independent of (or before) its interaction with PDZ
domain proteins. However, deletion of the cytoplasmic
domain of syndecan-2 abolished its clustering in dendritic
protrusions. This finding indicates that a region of the cytoplasmic domain, excluding the EFYA motif, is necessary
for this process. Thus, it appears more likely that syndecan-2 first clusters on dendritic membranes and then recruits CASK and/or other PDZ domain proteins to membrane compartments within the vicinity of synapses.
The cytoplasmic domain of syndecan-2 contains four
potential tyrosine phosphorylation sites shared by all syndecans (Asundi and Carey, 1997
), and unique serine phosphorylation sites that can be phosphorylated by Ca2+-dependent and conventional isoforms of PKC
,
and
(Oh
et al., 1997
). It is conceivable that phosphorylation of some
of these residues is involved in the clustering of syndecan-2 on the spines. A role for PKC in synaptic plasticity and
memory storage has been proposed (Wang and Feng,
1992
; Klann et al., 1993
; Van der Zee and Douma, 1997
;
Zeeuw et al., 1998
). It has been shown that the postsynaptic substrates for PKC activity, RC3/neurogranin and adducin, are targeted to dendritic spines and are involved in
their development (Neuner-Jehle et al., 1996
; reviewed in
Gerendasy and Sutcliffe, 1997
; Matsuoka et al., 1998
).
Matsuoka et al. (1998)
have suggested that external signals
cause the PKC-dependent phosphorylation of adducin in
dendritic spines that results in reorganization of cytoskeletal structures and morphological changes of spines. Thus it
is possible that the phosphorylation of syndecan-2 by PKC
may also be involved in its sorting and clustering on dendritic spines in response to extracellular ligands, such as
components of the extracellular matrix or growth factors.
It is interesting to note that extracellular interactions are
essential for the clustering of syndecan-1 on the cell surface (Carey et al., 1994
). In this vein, we found that the
number of syndecan-2 clusters that appeared on dendrites
of syndecan-2 transfected neurons correlates well with the
cell density of transfected neurons. When the cell density
was reduced to 25 and 50% of the regular plating condition (from 200,000 cells per 12-mm coverslip to 50,000 and
100,000 cells per coverslip), the number of syndecan-2
clusters decreased to 28 ± 8% and 54 ± 10%, respectively.
As the frequency of axo-dendritic contacts is thought to
increase in parallel with the cell density in the culture, this
observation suggests that the formation of syndecan-2
clusters may be contact dependent. Thus it is tempting to
speculate that the targeting and clustering of syndecan-2
may be triggered by extracellular ligands for syndecan-2. Such putative ligands may be presented by axons making
contact with dendrites and those extracellular interactions
work in conjunction with cytoplasmic phosphorylation to
localize syndecan-2 to dendritic spines.
Further studies will be required to fully understand the roles of phosphorylation and the putative extracellular ligand(s) in the process of syndecan-2-induced spine maturation. Nevertheless, the current knowledge suggests the following scenario. Upon the initiating signal, which might be provided by the contact between dendritic protrusions, and axons, syndecan-2 is translocated to immature dendritic protrusions, and forms clusters by a mechanism that probably involves the phosphorylation of its cytoplasmic domain. Clustered syndecan-2 then recruits CASK and/or other PDZ domain proteins to dendritic protrusions. The recruitment of PDZ domain proteins to the inner surface of dendritic membranes would lead to the organization of cytoskeletal and signaling molecules at these sites, resulting in the formation of mature dendritic spines.
We have shown here the first evidence that a cell surface HSPG can cause structural modifications to dendritic spines. Our results suggest that molecular interactions involving syndecan-2 play a critical role in the organization of postsynaptic structures. Elucidation of the molecular mechanism by which syndecan-2 modifies postsynaptic sites will provide insight into the functional relationship between cell surface adhesion events and intracellular cytoskeletal signaling complexes in the regulation of synaptic plasticity.
| |
Footnotes |
|---|
Received for publication 20 October 1998 and in revised form 24 December 1998.
Address correspondence to Yu Yamaguchi, The Burnham Institute, 10901 North Torrey Pines Road, La Jolla, CA 92037. Tel.: 619-646-3124. Fax:
619-646-3199. E-mail: yyamaguchi{at}burnham-inst.org
Abbreviations used in this paper: DIV, days in vitro; E, embryonic day;
GFP, green fluorescent protein; HSPG, heparan sulfate proteoglycan;
PKC, protein kinase C; PSD, postsynaptic density.
We thank Drs. Merton Bernfield, Andrew Czernik, and Vladimir Berezin for their gifts of antibodies, Drs. W. Stallcup, B. Ranscht, and D. Ethell for helpful discussion and critical reading of the manuscript, and Dr. E. Monosov for his advice on confocal imaging.
This work was supported by National Institutes of Health grants HD25938 and NS33117.
| |
References |
|---|
|
|
|---|
| 1. | Asundi, V.K., and D.J. Carey. 1997. Phosphorylation of recombinant N-syndecan (syndecan-3) core protein. Biochem. Biophys. Res. Commun. 240: 502-506 [Medline]. |
| 2. | Bernfield, M., R. Kokenyesi, M. Kato, M.T. Hinkes, J. Spring, R.L. Gallo, and E.J. Lose. 1992. Biology of the syndecans: a family of transmembrane heparan sulfate proteoglycans. Annu. Rev. Cell Biol. 8: 365-393 . |
| 3. | Brewer, G.J., and C.W. Cotman. 1989. Survival and growth of hippocampal neurons in defined medium at low density: advantage of a sandwich culture technique or low oxygen. Brain Res. 494: 65-74 [Medline]. |
| 4. |
Buchs, P.-A., and
D. Muller.
1996.
Induction of long-term potentiation is associated with major ultrastructural changes of activated synapses.
Proc. Natl.
Acad. Sci. USA.
93:
8040-8045
|
| 5. | Calverley, R.K.S., and D.G. Jones. 1990. Contributions of dendritic spines and perforated synapses to synaptic plasticity. Brain Res. Rev. 15: 215-249 [Medline]. |
| 6. | Carey, D.J.. 1997. Syndecans: multifunctional cell-surface co-receptors. Biochem. J. 327: 1-16 . |
| 7. | Carey, D.J., R.C. Stahl, B. Tucker, K.A. Bendt, and G. Cizmeci-Smith. 1994. Aggregation-induced association of syndecan-1 with microfilaments mediated by the cytoplasmic domain. Exp. Cell Res. 214: 12-21 [Medline]. |
| 8. |
Carey, D.J.,
K.M. Bendt, and
R.C. Stahl.
1996.
The cytoplasmic domain of syndecan-1 is required for cytoskeleton association but not detergent insolubility. Identification of essential cytoplasmic domain residues.
J. Biol. Chem.
271:
15253-15260
|
| 9. |
Chen, C., and
H. Okayama.
1987.
High-efficiency transformation of mammalian cells by plasmid DNA.
Mol. Cell. Biol.
7:
2745-2752
|
| 10. |
Cohen, A.R.,
D.F. Wood,
S.M. Marfatia,
Z. Walther,
A.H. Chishti, and
J.M. Anderson.
1998.
Human CASK/LIN-2 binds syndecan-2 and protein 4.1 and
localizes to the basolateral membrane of epithelial cells.
J. Cell Biol.
142:
129-138
|
| 11. | Cole, G.J., and W. Halfter. 1996. Agrin: an extracellular matrix heparan sulfate proteoglycan involved in cell interactions and synaptogenesis. Perspect. Dev. Neurobiol. 3: 359-371 [Medline]. |
| 12. | Colman, D.R.. 1997. Neurites, synapses, and cadherins reconciled. Mol. Cell. Neurosci. 10: 1-6 . |
| 13. | Comery, T.A., C.X. Stamoudis, S.A. Irwin, and W.T. Greenough. 1996. Increased density of multiple-head dendritic spines on medium-sized spiny neurons of the striatum in rats reared in a complex environment. Neurobiol. Learn. Mem. 66: 93-96 [Medline]. |
| 14. |
Comery, T.A.,
J.B. Harris,
P.J. Willems,
B.A. Oostra,
S.A. Irwin,
I.J. Weiler, and
W.T. Greenough.
1997.
Abnormal dendritic spines in fragile X knockout
mice: maturation and pruning deficits.
Proc. Natl. Acad. Sci. USA.
94:
5401-5404
|
| 15. | Couchman, J.R., and A. Woods. 1996. Syndecans, signaling and cell adhesion. J. Cell. Biochem. 61: 578-584 [Medline]. |
| 16. | Craven, S.E., and D.S. Bredt. 1998. PDZ proteins organize synaptic signaling pathways. Cell. 93: 495-498 [Medline]. |
| 17. |
David, G.,
X.M. Bai,
B. Van der Schueren,
J.J. Cassiman, and
H. Van der
Berghe.
1992.
Developmental changes in heparan sulfate expression: in situ
detection with mAbs.
J. Cell Biol.
119:
961-975
|
| 18. | David, G., X.M. Bai, B. Van der Schueren, P. Marynen, J.-J. Cassiman, and H. Van der Berghe. 1993. Spatial and temporal changes in the expression of fibroglycan syndecan-2 during mouse embryonic development. Development. 119: 841-854 [Abstract]. |
| 19. | Durand, G.M., Y. Kovalchuk, and A. Konnerth. 1996. Long-term potentiation and functional synapse induction in developing hippocampus. Nature. 381: 71-75 [Medline]. |
| 20. | Edwards, F.A.. 1995. LTP: a structural model to explain the inconsistencies. Trends Neurosci. 18: 250-255 [Medline]. |
| 21. | Eldridge, C.F., J.R. Sanes, A.Y. Chiu, R.P. Bunge, and C.J. Cornbrooks. 1986. Basal lamina-associated heparan sulphate proteoglycan in the rat PNS: characterization and localization using monoclonal antibodies. J. Neurocytol. 15: 37-51 [Medline]. |
| 22. | Fifkova, E.. 1985. A possible mechanism of morphometric changes in dendritic spines induced by stimulation. Cell. Mol. Neurobiol. 5: 47-63 [Medline]. |
| 23. | Fuxe, K., B. Tinner, W. Staines, G. David, and L.F. Agnati. 1997. Regional distribution of neural cell adhesion immunoreactivity in the adult rat telencephalon and diencephalon. Partial colocalization with heparan sulfate proteoglycan immunoreactivity. Brain Res. 746: 25-33 [Medline]. |
| 24. | Gerendasy, D.D., and J.G. Sutcliffe. 1997. RC3/neurogranin, a postsynaptic calpacitin for setting the response threshold to calcium influxes. Mol. Neurobiol. 15: 131-163 [Medline]. |
| 25. | Goedert, M., R. Jakes, M.G. Spillantini, M. Hasegawa, M.J. Smith, and R.A. Crowther. 1996. Assembly of microtubule-associated protein tau into Alzheimer-like filaments induced by sulfated glycosaminoglycans. Nature. 383: 550-553 [Medline]. |
| 26. |
Grootjans, J.J.,
P. Zimmermann,
G. Reekmans,
A. Smets,
G. Degeest,
J. Durr, and
G. David.
1997.
Syntenin, a PDZ protein that binds syndecan cytoplasmic domains.
Proc. Natl. Acad. Sci. USA.
94:
13683-13688
|
| 27. | Hagler, D.J. Jr., and Y. Goda. 1998. Synaptic adhesion: the building blocks of memory? Neuron. 20: 1059-1062 [Medline]. |
| 28. | Harris, K.M., and S.B. Kater. 1994. Dendritic spines: cellular specializations imparting both stability and flexibility to synaptic function. Annu. Rev. Neurosci. 17: 341-371 [Medline]. |
| 29. | Hebb, D.O. 1949. The Organization of Behavior. John Wiley & Sons Inc., New York. 335 pp. |
| 30. | Hinton, V.J., W.T. Brown, K. Wisniewski, and R.D. Rudelli. 1991. Analysis of neocortex in three males with the fragile X syndrome. Am. J. Med. Genet. 41: 289-294 [Medline]. |
| 31. |
Hsueh, Y.P.,
F.C. Yang,
V. Kharazia,
S. Naisbitt,
A.R. Cohen,
R.J. Weinberg, and
M. Sheng.
1998.
Direct interaction of CASK/LIN-2 and syndecan heparan sulfate proteoglycan and their overlapping distribution in neuronal synapses.
J. Cell Biol.
142:
139-151
|
| 32. |
Ishikawa-Brush, Y.,
J.F. Powell,
P. Bolton,
A.P. Miller,
F. Francis,
H.F. Willard,
H. Lehrach, and
A.P. Monaco.
1997.
Autism and multiple exostoses associated with an X;8 translocation occurring within the GRPR gene and 3' to the
SDC2 gene.
Hum. Mol. Genet.
6:
1241-1250
|
| 33. | Itano, N., K. Oguri, Y. Nagayasu, Y. Kusano, H. Nakanishi, G. David, and M. Okayama. 1996. Phosphorylation of a membrane-intercalated proteoglycan, syndecan-2 expressed in stroma-inducing clone from a mouse Lewis lung carcinoma. Biochem. J. 315: 925-930 . |
| 34. | Kim, C.W., O.A. Goldberger, R.L. Gallo, and M. Bernfield. 1994. Members of the syndecan family of heparan sulfate proteoglycans are expressed in distinct cell-, tissue-, and development-specific patterns. Mol. Biol. Cell. 5: 797-805 [Abstract]. |
| 35. |
Klann, E.,
S.-J. Chen, and
J.D. Sweatt.
1993.
Mechanism of protein kinase C activation during the induction and maintenance of long-term potentiation
probed using a selective peptide substrate.
Proc. Natl. Acad. Sci. USA.
90:
8337-8341
|
| 36. |
Kornau, H.-C.,
L.T. Schenker,
M.B. Kennedy, and
P.H. Seeburg.
1995.
Domain
interaction between NMDA receptor subunits and the postsynaptic density
protein PSD-95.
Science.
269:
1737-1740
|
| 37. | Lund, J.S., S.M. Holbach, and W.W. Chung. 1991. Postnatal development of thalamic recipient neurons in the monkey striate cortex. II. Influence of afferent driving on spine acquisition and dendritic growth of layer 4C spiny stellate neurons. J. Comp. Neurol. 309: 129-140 [Medline]. |
| 38. | Lüthi, A., J.P. Laurent, A. Figurov, D. Muller, and M. Schachner. 1994. Hippocampal long-term potentiation and neural cell adhesion molecules L1 and NCAM. Nature. 372: 777-779 [Medline]. |
| 39. |
Matsuoka, Y.,
X. Li, and
V. Bennett.
1998.
Adducin is an in vitro substrate for
protein kinase C: phosphorylation in the MARCKS-related domain inhibits
activity in promoting spectrin-actin complexes and occurs in many cells, including dendritic spines of neurons.
J. Cell Biol.
142:
485-497
|
| 40. |
Meier, T.,
F. Masciulli,
C. Moore,
F. Schoumacher,
U. Eppenberger,
A.J. Denzer,
G. Jones, and
H.R. Brenner.
1998.
Agrin can mediate acetylcholine receptor gene expression in muscle by aggregation of muscle-derived neuregulins.
J. Cell Biol.
141:
715-726
|
| 41. | Milner, B., L.R. Squire, and E.R. Kandel. 1998. Cognitive neuroscience and the study of memory. Neuron. 20: 445-468 [Medline]. |
| 42. |
Naisbitt, S.,
E. Kim,
R.J. Weinberg,
A. Rao,
F.C. Yang,
A.M. Craig, and
M. Sheng.
1997.
Characterization of guanylate kinase-associated protein, a
postsynaptic density protein at excitatory synapses that interacts directly
with postsynaptic density-95/synapse-associated protein 90.
J. Neurosci.
17:
5687-5696
|
| 43. | Neuner-Jehle, M., J.P. Denizot, and J. Mallet. 1996. Neurogranin is locally concentrated in rat cortical and hippocampal neurons. Brain Res. 733: 149-154 [Medline]. |
| 44. | Oh, E.-S., J.R. Couchman, and A. Woods. 1997. Serine phosphorylation of syndecan-2 proteoglycan cytoplasmic domain. Arch. Biochem. Biophys. 344: 67-74 [Medline]. |
| 45. | Papa, M., M.C. Bundman, V. Greenberger, and M. Segal. 1995. Morphological analysis of dendritic spine development in primary cultures of hippocampal neurons. J. Neurosci. 15: 1-11 [Abstract]. |
| 46. | Rollenhagen, A., and H.J. Bischof. 1994. Spine morphology of neurons in the avian forebrain is affected by rearing conditions. Behav. Neural. Biol. 62: 83-89 [Medline]. |
| 47. | Rose, S.P.R.. 1995. Cell-adhesion molecules, glucocorticoids and long-term-memory formation. Trends Neurosci. 18: 502-506 [Medline]. |
| 48. | Rudelli, R.D., W.T. Brown, K. Wisniewski, E.C. Jenkins, M. Laure-Kamionowska, F. Connell, and H.M. Wisniewski. 1985. Adult fragile X syndrome. Clinico-neuropathologic findings. Acta Neuropathol. 67: 289-295 [Medline]. |
| 49. | Schubert, D.. 1991. The possible role of adhesion in synaptic modification. Trends Neurosci. 14: 127-130 [Medline]. |
| 50. | Serafini, T.. 1997. An old friend in a new home: cadherins at the synapse. Trends Neurosci. 20: 322-323 [Medline]. |
| 51. | Spacek, J., and K.M. Harris. 1998. Three-dimensional organization of cell adhesion junctions at synapses and dendritic spines in area CA1 of the rat hippocampus. J. Comp. Neurol. 393: 58-68 [Medline]. |
| 52. | Van der Zee, E.A., and B.R. Douma. 1997. Historical review of research on protein kinase in learning and memory. Prog. Neuro-psychopharmacol. Biol. Psychiatry. 21: 379-406 [Medline]. |
| 53. | Wallace, C.S., N. Hawrylak, and W.T. Greenough. 1991. Studies of synaptic structural modifications after long-term potentiation and kindling: context for a molecular morphology. In Long-Term Potentiation: A Debate of Current Issues. M. Baudry and J.L. Davis, editors. MIT Press, Cambridge, MA. 189-232. |
| 54. |
Wang, J.-H., and
D.-P. Feng.
1992.
Postsynaptic protein kinase C essential to induction and maintenance of long-term potentiation in the hippocampal CA1
region.
Proc. Natl. Acad. Sci. USA.
89:
2576-2580
|
| 55. |
Watanabe, K., and
Y. Yamaguchi.
1996.
Molecular identification of a putative
human hyaluronan synthase.
J. Biol. Chem.
271:
22945-22948
|
| 56. | Woods, A., and J.R. Couchman. 1994. Syndecan-4 heparan sulfate proteoglycan is a selectively enriched and widespread focal adhesion component. Mol. Biol. Cell. 5: 183-192 [Abstract]. |
| 57. | Yuste, R., and W. Denk. 1995. Dendritic spines as basic functional units of neuronal integration. Nature. 375: 682-684 [Medline]. |
| 58. | Zafra, F., B. Hengerer, J. Leibrock, H. Thoenen, and D. Lindholm. 1990. Activity dependent regulation of BDNF and NGF mRNAs in the rat hippocampus is mediated by non-NMDA glutamate receptors. EMBO (Eur. Mol. Biol. Organ.) J. 9: 3545-3550 [Medline]. |
| 59. | Zeeuw, D.C.I., C. Hansel, F. Bian, S.K.E. Koekkoek, A.M. van Alphen, D.J. Linden, and J. Oberdick. 1998. Expression of a protein kinase C inhibitor in Purkinje cells blocks cerebellar LTD and adaptation of the vestibulo-ocular reflex. Neuron. 20: 495-508 [Medline]. |
| 60. | Ziv, N.E., and S.J. Smith. 1996. Evidence for a role of dendritic filopodia in synaptogenesis and spine formation. Neuron. 17: 91-102 [Medline]. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|