|
||

* Department of Pediatric Oncology, The Dana-Farber Cancer Institute and Department of Pediatric Hematology, The
Children's Hospital, Harvard Medical School, Boston, Massachusetts 02115;
Department of Molecular Biology, Princeton
University, Princeton, New Jersey 08544; § Institut für Biochemie, Universität Stuttgart, 70569 Stuttgart, Germany; and ¶ Department of Biology, Queen's University, Kingston, Ontario, Canada K7L 3N6
| |
Abstract |
|---|
|
|
|---|
Alignment of the mitotic spindle with the
axis of cell division is an essential process in Saccharomyces cerevisiae that is mediated by interactions between cytoplasmic microtubules and the cell cortex. We
found that a cortical protein, the yeast formin Bni1p,
was required for spindle orientation. Two striking abnormalities were observed in bni1
cells. First, the initial movement of the spindle pole body (SPB) toward
the emerging bud was defective. This phenotype is similar to that previously observed in cells lacking the kinesin Kip3p and, in fact, BNI1 and KIP3 were found to be
in the same genetic pathway. Second, abnormal pulling
interactions between microtubules and the cortex appeared to cause preanaphase spindles in bni1
cells to
transit back and forth between the mother and the bud.
We therefore propose that Bni1p may localize or alter
the function of cortical microtubule-binding sites in the
bud. Additionally, we present evidence that other bipolar bud site determinants together with cortical actin
are also required for spindle orientation.
| |
Introduction |
|---|
|
|
|---|
CELL division requires the correct positioning of the
spindle within the cell in addition to assembly of
the mitotic apparatus and segregation of the chromosomes (Hyman and Karsenti, 1996
; Stearns, 1997
). Significant progress has been made in characterizing the proteins involved in spindle construction and chromosome
movement, but little is known about the proteins that mediate interactions between microtubules and the cell cortex to establish spindle position.
Various strategies to align the spindle with the plane of
cell division are used in different organisms (Rhyu and
Knoblich, 1995
). In budding yeast, the axis of division is
determined by the signaling molecules that control bud
site selection (Freifelder, 1960
; Chant and Pringle, 1995
).
The polarity of the dividing yeast cell is established first
and then the spindle is aligned in response to this polarity
to segregate the nuclei. This alignment is postulated to
be mediated by interactions between cytoplasmic microtubules and asymmetrically localized cortical proteins
(Snyder et al., 1991
; Hyman and Stearns, 1992
). Spindle
positioning in plant cells is similar to yeast in that the
spindle appears to be aligned by preestablished cortical
cues (Staiger and Lloyd, 1991
). By contrast, in animal cells
spindle position determines the position of cytokinesis
(Cao and Wang, 1996
). This is important for development because correct spindle position is essential for generating
asymmetric cell divisions. Furthermore, there are several
examples in animal cells where spindle position appears to
be developmentally regulated (Hyman and White, 1987
;
Hyman, 1989
; Chenn and McConnell, 1995
; Rhyu and
Knoblich, 1995
; Kraut et al., 1996
). Despite the cell type
differences in the relationship between spindle position, cell polarity, and cytokinesis, many of the molecular components involved in these processes are conserved, suggesting that some of the mechanisms linking microtubules
to cortical polarity factors may also be conserved (Drubin
and Nelson, 1996
).
The establishment of spindle position in Saccharomyces
cerevisiae occurs in distinct morphological steps (Yeh et al.,
1995
; DeZwaan et al., 1997
; Carminati and Stearns, 1997
;
Shaw et al., 1997
, 1998
). First, the centrosome or spindle
pole body (SPB)1 migrates toward the incipient bud site.
Around the time of SPB separation and the formation of a
bipolar spindle, cytoplasmic microtubules penetrate into
the bud, and the spindle assumes a relatively stable position at the neck aligned with the mother-bud axis (Shaw
et al., 1997
). At anaphase, the spindle is inserted across the
bud neck and then elongates, segregating the chromosomes between mother and daughter cells (Yeh et al.,
1995
). Genetic analysis has identified two partially redundant pathways for spindle orientation. One mediated by
the kinesin Kip3p, is necessary for the initial movement of
the SPB toward the bud. The other is mediated by cytoplasmic dynein which is necessary for the insertion of the
spindle through the bud neck (Cottingham and Hoyt,
1997
; DeZwaan et al., 1997
; Stearns, 1997
). It is not known
if these motors act primarily by affecting the dynamics of
cytoplasmic microtubules or whether they directly link cytoplasmic microtubules to the cell cortex.
One of the most interesting questions about the mechanism of spindle orientation is the identity and molecular
function of the cortical proteins that interact with cytoplasmic microtubules. The existence of microtubule "capture sites," loosely analogous to those at the kinetochore,
has been postulated, but little is known about the molecular composition of these cortical regions (Kaverina et al.,
1998
; Snyder et al., 1991
). One factor that is clearly important for controlling spindle position in diverse organisms is
the actin cytoskeleton. In S. cerevisiae, mutations in ACT1,
the gene that encodes actin, result in defects in spindle position and nuclear segregation (Palmer et al., 1992
; Drubin et al., 1993
). In Caenorhabditis elegans, actin is required
for the developmentally regulated rotation of the spindle
during specific early embryonic cell divisions (Hyman and
White, 1987
; Hyman, 1989
). Actin is also required for centrosome movement in human leukocytes (Euteneuer and
Schliwa, 1985
). The molecular role of actin in these different systems is not known. Cortical actin and associated
proteins might bind microtubules or alternatively, they
might be required to localize cortical microtubule-binding proteins. Recent genetic analysis in yeast has identified
two novel cortical proteins, Num1p and Kar9p, that are
required for spindle orientation. Num1p localizes to the
mother cell cortex (Farkasovsky and Küntzel, 1995
), whereas
Kar9p localizes to a discrete region of the bud cortex and
to the tip of the mating projection (shmoo). Although it
has not been determined if these proteins bind microtubules, it is interesting that overexpressed Kar9p concentrates at sites of contact between cytoplasmic microtubules and the bud cortex (Miller and Rose, 1998
).
Here we report a requirement for the conserved protein
Bni1p in spindle orientation. Bni1p belongs to a family of
proteins called formins, which are required for diverse cellular and developmental functions (Woychik et al., 1990
;
Castrillon and Wasserman, 1994
; Emmons et al., 1995
; Petersen et al., 1995
; Zahner et al., 1996
; Chang et al., 1997
;
Evangelista et al., 1997
; Harris et al., 1997
). Formins are
characterized by conserved regions called formin homology (FH) domains. There is substantial evidence to suggest that Bni1p and other formins function as molecular
scaffolds that link Rho-type GTPases with components of
the actin cytoskeleton. The NH2-terminal domain of Bni1p
interacts with the activated forms of G proteins, Cdc42p
and Rho1p, which regulate organization of the actin cytoskeleton (Kohno et al., 1996
; Evangelista et al., 1997
).
The proline-rich FH1 domain of Bni1p binds profilin and
this interaction may regulate actin polymerization at cortical sites (Evangelista et al., 1997
; Imamura et al., 1997
).
The COOH-terminal domain of Bni1p interacts with another putative actin-binding protein, Aip3p/Bud6p (Amberg et al., 1997
; Evangelista et al., 1997
). In S. cerevisiae, a
second formin, Bnr1p, has at least partial functional overlap with Bni1p (Imamura et al., 1997
). Whether formins
link polarity signals to other cytoskeletal systems, such as
the microtubule cytoskeleton, has not been established.
Bni1p has been implicated in actin function during polarized morphogenesis and the establishment of cell polarity. Bni1p is localized in a cap-like structure (Jansen et al.,
1996
; Evangelista et al., 1997
; Fujiwara et al., 1998
), similar
to that observed for Cdc42p and other polarity determinants (Ziman et al., 1993
) at sites of polarized cell growth:
the bud tip early in the cell cycle, the septal region late in
the cell cycle, and to the shmoo tip. bni1
mutant cells
contain normal cortical actin patches and cables, but are
defective for the reorganization of these structures required for various aspects of cell polarization (Evangelista et al., 1997
). bni1
cells are normal for bud emergence,
but they are defective for polarized bud growth and appear to construct buds through isotropic growth, generating cells with a rounded shape. bni1
cells are also
defective in shmoo formation, pseudohyphal growth, localization of ASH1 mRNA to the bud, cytokinesis, and bipolar bud site selection (Jansen et al., 1996
; Zahner et al., 1996
; Evangelista et al., 1997
; Mösch and Fink, 1997
). The
role of Bni1p in bipolar bud site selection is notable because Bni1p interacts with two other proteins, Spa2p and
Bud6p, required for this process (Evangelista et al., 1997
;
Fujiwara et al., 1998
). The molecular links between Bni1p
and actin may also be relevant to bipolar bud site selection
because many actin mutants also affect this process (Yang
et al., 1997
).
We have now found that Bni1p is required for specific
steps in establishing the position of the mitotic spindle before anaphase. By fluorescence time-lapse microscopy, we
observed that Bni1p was required for the initial movement
of the SPB toward the incipient bud site. In addition, a
strikingly abnormal movement of preanaphase spindles
was observed in bni1
cells: short spindles were pulled back and forth between the mother cell and the bud. In
wild-type cells, apparent pulling forces on the spindle were
observed toward the bud, but not toward the mother cell.
These findings suggest that in the absence of Bni1p, microtubule-binding sites at the cell cortex are either mislocalized or functionally altered, resulting in the loss of
polarization of preanaphase spindle movement. Finally, analysis of mutations affecting the actin cytoskeleton suggest that actin structures involved in bipolar budding are
also required for spindle orientation.
| |
Materials and Methods |
|---|
|
|
|---|
Microbial Techniques
Media and genetic techniques were as described (Rose et al., 1990
). The
mating pheromone,
-factor, was added to log phase cultures at 6 µg/ml.
Latrunculin-A (Lat-A) (from P. Crews, University of California, Santa
Cruz, CA) was added to cultures at 400 mM. Benomyl sensitivity (a gift
from E.I. du Pont de Nemours, Wilmington, DE) was tested in rich (YPD)
medium. Geneticin (GIBCO BRL) was used at a concentration of 0.2 µg/
ml in YPD. Lists of the strains and plasmids used in this study are provided in Tables I and II. Except where indicated, all strains are congenic
to W3031a.
|
|
Strain and Plasmid Construction
A complete deletion of the BNI1 coding sequence was created by one-step gene replacement with the selectable marker kanr, which confers Geneticin resistance to yeast (Wach et al., 1994
). The bni1
::kanr containing
DNA sequence was generated by PCR using oligonucleotide primers:
5' TATCTATCTTCTGTATTGAGGAGAAACATTTTACTCAAGC - AGCTGAAGCTTCGTACGC and 5'GAGTAAAGATGAATGTAAAGTGTATCATAAGTGATCTATAGCATAGGCCACTAGTGGAT- CTG. Deletion of the BNI1 locus was confirmed by Southern blot analysis
of Geneticin-resistant transformants. This BNI1 deletion strain, hereafter
referred to as bni1
, was used for all subsequent analyses unless specified
otherwise. The deletion of ASE1 was also created by one-step gene replacement (Pellman et al., 1995
).
The centromere-based (CEN) plasmid carrying BNI1 (p182) has been
described (Boone et al., 1992
). This genomic sequence was also cloned
into a CEN ARS TRP1 plasmid (pRS314) (Sikorski and Hieter, 1989
) to
create p1832. The COOH-terminal deletion mutant, bni1-CT
1, lacks the
coding sequence for amino acids 1,749-1,953 of Bni1p, and was created
by the following strategy. p182 was digested with SstII which cuts BNI1
at bp 5,249 and in the polylinker, and ligated to an oligonucleotide
(5'GTAGGCGGCCGCCTACGC). This created a stop codon followed
by a NotI site adjacent to the SstII site in BNI1. A CEN plasmid (p2029)
derived from pRS314 and an integrating plasmid (PB1046) derived from
pRS305 (Sikorski and Hieter, 1989
) contain the bni1-CT
1 sequence on a
6.3-kb BamHI/NotI restriction fragment. The strain containing PB1046
was used for genetic crosses, and the strain containing p2029 was used for morphological studies.
The act1-116 and sla1
SH3#3 strains and their isogenic wild-type controls are in the S288c genetic background. To construct PY2596, the ACT1
locus was replaced by act1-116::HIS3 from pRB1537 by homologous recombination in a strain containing NUF2::GFP (PB1000). This was done
because previously constructed act1-116 strains contain a linked TUB2
mutation. Integration was confirmed by PCR analysis.
Genetic Analysis
The screen to identify mutations that were lethal in combination with an
ASE1-null allele was performed using an ADE3 sectoring assay as described (Bender and Pringle, 1991
). The starting strains MAT
and MATa
ase1::kanr ade2 ade3 leu2 lys2 trp1 ura3 {2µ ASE1 ADE3 TRP1} (PY1994
and PY1996) were mutagenized by transformation with a genomic library containing random insertions of a mini-Tn3lacZ-LEU2 transposon (Burns
et al., 1994
). Candidate mutants were backcrossed to demonstrate that the
mutation represented a single genetic locus and to confirm that the mutation cosegregated with the LEU2 marker. The genomic site of transposon
insertion was identified by direct sequencing of PCR products spanning
the insertion site. These PCR products were generated by an arbitrary
primed PCR strategy (Di Rienzo et al., 1996
). The bni1::Tn3::LEU2 allele
has an insertion of the transposon at nucleotide 5,006 of the BNI1-coding
sequence. This allele has an identical phenotype to the bni1
::kanr-null allele described above. In addition to BNI1, genes that affect many aspects
of microtubule function in S. cerevisiae were identified by this screen (to
be described elsewhere).
For the bni1
× ase1
cross, 37 tetrads were dissected and 41 double
mutants were recovered, all of which were temperature sensitive for
growth. For the bni1
× dyn1
cross, 19 tetrads were dissected and 11 temperature-sensitive double mutants were recovered. For the bni1
× kar3
cross, 27 tetrads were dissected and 20 viable double mutants were
recovered. bni1
kar3
double mutants formed smaller colonies than the
kar3
single mutant at 23°C and were inviable at 30°C. For the bni1
× cin8
cross, 35 tetrads were dissected and 28 double mutants were recovered. For the crosses of bni1
with kip1
and smy1
, 23 and 17 tetrads
were dissected respectively, and the double mutants were recovered at the
expected frequency.
Quantitative mating assays (Sprague, 1991
) were performed using a
MATa bni1::kanr bar1::LEU2 strain (Y1445), carrying different alleles of
BNI1 on a CEN plasmid. The mating partner used for the mating assays was a MAT
far1-c strain (Y66) which was itself defective in mating and
thus increased the sensitivity of the assay. The assays were performed in triplicate.
The strain background used for our initial genetic experiments and for
our time-lapse analysis, W3031a, has a mixed random/bipolar budding
pattern (Cvrckova et al., 1995
). Therefore, in experiments where the
movement of the SPB after telophase toward the bud was followed by fluorescence microscopy, the distance between the SPB and the bud was determined by overlaying images from each time point with a differential interference contrast (DIC) image obtained after bud emergence. The
spindle orientation defect of bni1
that we observed is not specific to this
strain background because we observed a similar spindle orientation defect in a YEF473-derived bni1
strain (Bi and Pringle, 1996
) that has normal axial and bipolar bud site selection (data not shown).
Microscopic Analysis of Cells
Nuclear morphology was observed by fluorescence microscopy in cells
fixed and stained with 4',6'-diamidino-2-phenylindole (DAPI) as described (Rose et al., 1990
). To preserve green fluorescent protein (GFP)
fluorescence for the analysis of spindle orientation, cells were fixed in culture medium with 3.7% formaldehyde for 30 min, washed, and then applied to slides. Indirect immunofluorescence was performed as described
(Pellman et al., 1995
). Experiments to measure nuclear or spindle position
were performed at least twice.
Budding pattern was assayed after staining bud scars with calcofluor
(Pringle et al., 1989
). The strain used was a bni1::HIS3/bni1::HIS3 YEF473 diploid (Y1353), containing alleles of BNI1 on a CEN plasmid. Results from these strains were compared with results from an isogenic
BNI1/BNI1 diploid. The fact that BNI1 carried on a CEN plasmid does
not fully complement bni1::HIS3/bni1::HIS3 suggests that the gene dosage
of BNI1 may be important for bipolar bud site selection. Mating projection assays using a W3031a MATa bni1::kanr bar1::LEU2 strain (Y1445)
containing the bni1 alleles were performed in triplicate (Evangelista et al.,
1997
).
For live cell fluorescence microscopy, cells were applied to a microscope slide (DeZwaan et al., 1997
) and observed at 23°C. The doubling
time of cells in liquid culture at this temperature was 150 min, compared
with the average doubling time of 176 min for cells observed with our
time-lapse fluorescence protocol. A microscope (model ECLIPSE E600;
Nikon) equipped with a 100×/1.4 NA Planapochromat objective, a 100-W
mercury arc illuminator, a Z-axis focus motor (Biopoint Z-axis focus motor; Ludl Electronics), a fluorescence illumination shutter (Ludl Electronics), and an Endow GFP filter set (excitation 450-490 nm, dichroic 495, emission 500 nm LP; Chroma Optics) was used. Images were acquired
with a cooled charge-coupled device camera (Hamamatsu 4742-95, Hamamatsu Photonics), containing a 1280 × 1024 Sony Interline chip
(Hamamatsu Photonics). At each time point a series of fluorescence images in six focal planes spaced 0.5 µm apart were collected along with a
DIC image. To minimize photo bleaching and photo damage of the cells,
the light from the mercury lamp was attenuated to one-eighth of maximal
intensity with neutral density filters and exposure times were limited to
200-400 ms. Images were analyzed using Openlabs Software (Improvision), and all statistical analysis was performed using StatView software
(Abacus Concepts).
| |
Results |
|---|
|
|
|---|
BNI1 Has a Role in Microtubule Function
An allele of BNI1 was unexpectedly isolated in a genetic
screen to identify genes involved in microtubule function.
The screen was for mutations that were lethal when combined with an ase1
allele (see Materials and Methods).
ASE1 encodes a nonmotor microtubule-associated protein
that localizes to the spindle midzone and promotes spindle elongation (anaphase B) (Pellman et al., 1995
; Juang et al.,
1997
). The genetic interaction between BNI1 and ASE1
suggested that BNI1 might have a role in maintaining the
integrity of the microtubule cytoskeleton.
A deletion allele of BNI1 was created (see Materials
and Methods). The bni1
ase1
double mutant strain displayed a marked temperature-sensitive growth defect (Fig.
1 a). Because this strain grew at a near normal rate at
23°C, we were able to test its sensitivity to the microtubule
depolymerizing agent, benomyl. In contrast to the control
strains, the bni1
ase1
strain had a strikingly increased
sensitivity to benomyl (5 µg/ml). bni1
and ase1
mutations therefore have an additive detrimental effect on microtubule function.
|
bni1
Cells Have a Defect in Spindle Orientation
Because Bni1p is localized at the bud cortex and septum of
mitotic cells and the shmoo tip in mating cells (Jansen et al., 1996
; Evangelista et al., 1997
; Fujiwara et al., 1998
) (Evangelista, M., and C. Boone, unpublished results) we considered the possibility that BNI1 affects microtubules through
a role in spindle orientation and/or nuclear positioning.
Here, defects in the location of the nucleus within the
mother cell or defects in nuclear segregation that result in
binucleate mother cells will be referred to as "nuclear position defects." Defects in the alignment of the spindle with the mother-bud axis will be described as "spindle orientation defects." The role of Bni1p in nuclear positioning
was initially tested by examining bni1
and control cells
stained with the DNA-binding dye, DAPI. Whereas mitosis in wild-type cells results in the faithful distribution of
nuclei to mother and daughter cells (Fig. 1 b), mitosis in a
significant fraction of bni1
cells was abnormal, resulting
in two nuclei in the mother cell. The fraction of binucleate mother cells in bni1
strains increased at 37°C (Fig. 1 b).
We next tested whether the binucleate phenotype of
bni1
cells was due to a defect in spindle orientation.
bni1
and control strains were grown to early logarithmic
stage and the angle between the spindle and the mother-
bud axis was measured (Fig. 2). A chimeric gene expressing a fusion between Nuf2p, a spindle pole body protein,
and GFP was introduced into both strains, allowing visualization of the poles by fluorescence microscopy (Kahana et al., 1995
; Kahana and Silver, 1996
). In wild-type cells,
more than 60% of cells had spindles oriented within 30 degrees of the mother-bud axis (Fig. 2 a). By contrast, spindle orientation in bni1
cells appeared to be random (Fig.
2 b). Furthermore, the distance between the neck-proximal SPB and the bud neck was significantly greater in
bni1
than in BNI1 cells: 1.0 and 0.7 µm, respectively (t
test, P < 0.0001, n = 180). Thus, bni1
has a defect in
spindle orientation.
|
Genetic Interactions Suggest that BNI1 and KIP3 Are in the Same Pathway
The entire set of Saccharomyces cerevisiae microtubule-based motor proteins has been defined. The genome contains a single gene encoding a dynein heavy chain, DYN1,
and six genes encoding kinesin-related proteins, KIP1,
KIP2, KIP3, KAR3, CIN8, and SMY1. Strains lacking any
one of these genes are viable; however, combinations of
different null alleles result in lethality. Only Dyn1p, Kip2p, Kip3p, and Kar3p are implicated in cytoplasmic microtubule function (Stearns, 1997
; Winsor and Schiebel, 1997
).
Single mutant kip3
and dyn1
strains have the most
striking effect on nuclear position. kip3
and dyn1
affect
distinct steps in nuclear positioning: kip3
cells have a
spindle orientation defect, whereas dyn1
cells have a defect in the insertion of the spindle across the bud neck. The
fact that kip3
dyn1
double mutant strains are not viable suggests that there are two partially redundant pathways
for spindle orientation (Cottingham and Hoyt, 1997
; De
Zwaan et al., 1997; Miller et al., 1998
).
Double mutants were constructed to test if BNI1 was in
the KIP3 pathway. Consistent with the similar spindle orientation defect observed in bni1
and kip3
strains, the
bni1
kip3
strain was viable and grew indistinguishably
from single mutant strains (Table III). The percentage of
binucleate mother cells in the bni1
kip3
strain was also
not increased relative to either single mutant strain (Fig. 1
b). By contrast, bni1
produced a striking synthetic interaction when combined with dyn1
. The bni1
dyn1
strain had a growth defect at 23°C and was inviable at 14°
and 37°C (Fig. 1 a and Table III). Also, the bni1
dyn1
strain had a marked increase in binucleate mother cells
relative to the single mutant strains (Fig. 1 b). Like the
bni1
ase1
strain, the bni1
dyn1
strain had increased
sensitivity to benomyl (Fig. 1 a).
|
The genetic interactions we observed between bni1
and the other motor gene deletions paralleled those
observed with kip3
(Table III). Like kip3
, bni1
is lethal when combined with kar3
. bni1
did not show a significant synthetic interaction with either kip1, cin8
, or
smy1
. This pattern of genetic interactions observed with
bni1
suggests that BNI1 and KIP3 function in the same pathway.
Defective Movement of the SPB to the Incipient Bud in
bni1
Cells
Because of the spindle orientation defect in bni1
and
kip3
strains, we determined whether movement of the
SPB to the incipient bud site was defective in bni1
cells
as previously observed in kip3
cells. Time-lapse fluorescence microscopy of live cells expressing either Nuf2p-
GFP (Kahana et al., 1995
; Kahana and Silver, 1996
) or
GFP-Tub1p (the major
tubulin gene in S. cerevisiae) was
used to examine SPB movement early in the cell cycle in
both bni1
and control cells (see Materials and Methods).
SPB movements in wild-type haploid cells were observed from the end of mitosis (telophase) through bud emergence and SPB separation (Fig. 3 a). At the end of mitosis (Fig. 3 a, 1.7 min, mother cell indicated by white arrow) the poles were extended 8-10 µm and located near the cell periphery. After spindle disassembly, the poles usually moved ~1-2 µm toward the center of the cell (Fig. 3 a and Fig. 4 a). In the wild-type strain, this initial movement of the SPB was followed by a concerted movement of the pole toward the site of the incipient bud. This movement of the SPB toward the bud occurred on average within 100 min (n = 6), and once the SPB had moved toward the bud its position became relatively stable. SPB separation usually occurred after the old SPB was positioned near the bud. Although the SPB underwent some oscillations as it moved toward the bud, large movements away from the bud were not observed in wild-type cells (Fig. 4 a).
|
|
In a significant fraction of posttelophase bni1
cells,
prolonged movement of the SPB away from the bud was
observed (Fig. 3 b and Fig. 4 b). In Fig. 3 b, the daughter
cell (white arrow) shows this abnormal movement of the
SPB (for example, 14.2-121.1 min). In the cells that exhibited the phenotype, the SPB spent almost as much time
moving away from the bud as toward the bud. The more
random direction of movement of the SPB with respect to
the incipient bud in bni1
cells was similar to the abnormal SPB movements previously observed in kip3
cells
(DeZwaan et al., 1997
). This phenotype was detected in
four out of 10 cells and was observed in both mother and
daughter cells. The mother cell in Fig. 3 b is an example of
a bni1
cell with relatively normal SPB movement. As in
kip3
cells, the SPB eventually assumed a relatively stable
position near the bud, suggesting that other factors may
stabilize the interaction of the SPB with the bud neck.
Abnormal Spindle Rotation and Transiting of Short
Mitotic Spindles in bni1
Cells
In addition to the defect in the movement of the unduplicated SPB toward the bud, we observed strikingly abnormal movements of short (1.5 µm) spindles that were
unique to bni1
cells. In another series of experiments,
spindle movements before anaphase were observed in
bni1
and wild-type cells. In wild-type cells, short spindles
aligned along the mother-bud axis as expected from our
analysis of fixed cells and previous imaging of live cells (Yeh et al., 1995
). These short spindles displayed some oscillations relative to the bud neck. However, short spindle
movement in these cells was limited and only rarely were
large rotations (90-180°) of the spindle observed. At anaphase, the spindles in wild-type cells were correctly inserted into the bud neck, and spindle elongation occurred
through the bud neck (Fig. 3 a and Fig. 5 a).
|
|
By contrast, the spindles of bni1
cells underwent much
more noticeable oscillations, and large rotations of the
spindle were frequently observed. In the example shown
in Fig. 5 b the spindle underwent four 90-180° rotations in
a 40-min time period before anaphase (crossing of lines
with open and filled circles). Furthermore, in bni1
cells
the short spindle frequently underwent what we refer to as
transiting: movements of the entire short spindle into the
bud or back into the mother cell. In the example shown in
Fig. 5 b and Fig. 6, transiting of short spindles back and forth between the bud and mother cell was observed four
times in the interval before anaphase (Fig. 6, 157.0, 167.5, 188.3, and 193.4 min). Like the defect in the initial SPB
movement toward the bud observed in our other series of
experiments, this phenotype was not completely penetrant
(four out of 10 cells).
Abnormal Interactions between Microtubules and the
Cortex in bni1
Cells
Recent live-cell fluorescence microscopy experiments suggest that spindle or SPB movement is driven by cytoplasmic microtubule contacts with the cell cortex (Carminati
and Stearns, 1997
; Shaw et al., 1997
). Three types of contacts between cytoplasmic microtubules and the cell cortex
have been correlated with changes in the position of the
poles or spindles. Apparent pushing forces are generated when cytoplasmic microtubules remain in contact with the
cortex while polymerizing. Apparent pulling forces are
generated when they depolymerize while maintaining contact with the cortex. Finally, lateral movements of the SPB
or spindles are seen as microtubules sweep across the cortex (Carminati and Stearns, 1997
; Shaw et al., 1997
).
To determine if the spindle movements in bni1
cells
were due to abnormal interactions of cytoplasmic microtubules with cortical sites, image sets of wild-type and bni1
cells expressing GFP::Tub1p were acquired over short
time intervals (30-60 s) using exposures that enabled us to
clearly visualize cytoplasmic microtubules. In the wild-type cells with short spindles, the pattern of microtubule interactions with the cell cortex and the associated pattern
of SPB and/or spindle movement were similar to that described above. Most notably, pulling events in our wild-type strain were observed in cells with short spindles when
microtubules interacted with the bud cortex (five events
observed over 140 min in five cells); however, such pulling
events toward the mother cell were not observed (0 events
over 140 min in five cells). Furthermore, in different experiments, we did not observe transiting of preanaphase
spindles in seven wild-type cells, observed for an average
time of 57 min per cell, over longer time intervals (data not
shown). Although we did not observe spindle transits in
our wild-type strain, low frequency spindle transits have
been reported in some wild-type strains (Palmer et al.,
1989
).
We next examined microtubule interactions with the
cell cortex in bni1
cells (Fig. 7). Unlike the control strain,
pulling events between the cortex and the SPB in both the
bud and mother cell were frequently observed (14 events
toward bud and 10 events toward mother observed over
147 min in four out of 12 cells). An example of such interactions is shown in Fig. 7. In this cell, from time points 8.9-
9.8 min, a microtubule end remained at a fixed position at
the mother cell cortex whereas the microtubule shrank
from 5.1 to 0 µm. A concomitant 5.6-µm movement of
the spindle toward the mother cell cortex was observed.
Again, from 15.8-16.6 min, a microtubule with one end at
the mother cell cortex shrank from 4.2 to 1.7 µm, whereas
the spindle moved 2.1 µm toward the cortex. Overall, we
observed a strong correlation between pulling events and
the abnormal transiting of short spindles between the
mother and the bud in bni1
cells. Therefore, although
microtubules in the bni1
cells still interact with the cortex, the inability to restrict pulling interactions toward the
bud suggests that the microtubule cytoskeleton of the
bni1
strain fails to sense the cell's polarity.
|
Bni1p Is Not Required for Anaphase Spindle Elongation or Cell Cycle Progression
Because loss of BNI1 affects cytoplasmic microtubule
function, we next tested whether nuclear microtubule
function was affected by measuring the kinetics of anaphase spindle elongation. Two major stages of anaphase
have been observed in S. cerevisiae (Kahana et al., 1995
;
Yeh et al., 1995
; Straight et al., 1997
). There is an initial
fast stage of elongation from an ~2-µm spindle to an ~4-µm
spindle. The rate of elongation then slows as the spindle reaches maximal extension at 8-10 µm. Anaphase kinetics
was measured in bni1
and wild-type cells (Fig. 8). Fast
elongation was 0.55 µm/min ± 0.14 (n = 7) in the bni1
strain and 0.48 µm/min ± 0.10 (n = 5) in the wild-type
strain. Slow elongation was 0.14 µm/min ± 0.04 (n = 7) in
the bni1
strain and 0.12 µm/min ± 0.04 (n = 5) in the
wild-type strain. Thus, loss of BNI1 does not have a significant effect on anaphase spindle elongation.
|
Because the bni1
mutant could affect spindle orientation either through a direct effect on the cytoskeleton or
indirectly by perturbing the cell cycle, we next tested
whether bni1
strains were delayed in any specific stage of
the cell cycle. bni1
strains grew slightly slower than control strains at 23°C. The distribution of cells throughout
the cell cycle was first characterized by examining the distribution of cell morphologies in cultures of logarithmically growing cells (Table IV). The numbers of unbudded G1 cells, budded cells with undivided nuclei, and postanaphase cells were nearly identical in bni1
and the wild-type strain. The ratio of cells in G1 and G2 cell cycle
phases were also similar in both strains by FACS® analysis
(data not shown). Finally, we analyzed our time-lapse experiments to measure the intervals between spindle disassembly and the initiation and completion of budding in
bni1
and control cells. After completion of anaphase, the
bni1
and control strains initiated budding on average at
87 and 89 min, respectively. Budding was completed on
average at 138 and 150 min, respectively, in these strains.
|
Therefore, although we cannot rule out a subtle effect
on cell cycle progression in bni1
cells, our analysis shows
that the cells do not exhibit a prominent delay at a specific
stage of the cell cycle. This is consistent with the idea that
loss of BNI1 function affects spindle orientation through
direct effects on the cytoskeleton rather than indirect effects on the cell cycle.
Bud6p and the Bud6p-binding Domain of Bni1p Are Required for Spindle Orientation and Bipolar Bud Site Selection
Bni1p associates with other proteins that are required for
bipolar bud site selection (Amberg et al., 1997
; Evangelista et al., 1997
; Fujiwara et al., 1998
). As an initial test to
determine if these associations are required for spindle
orientation, we characterized a BNI1 allele (bni1-CT
1)
lacking the COOH-terminal domain of Bni1p that interacts with the actin-associated protein Bud6p (Amberg et al.,
1997
; Evangelista et al., 1997
). The bni1-CT
1 strain is
proficient both for shmoo formation and mating (Table V). By contrast, bni1-CT
1 did not complement the bud
site selection defect of a bni1
/bni1
diploid strain (Table
V). Furthermore, bni1-CT
1 cells had a significant defect
in spindle orientation (Fig. 2 c). Like bni1
cells, the spindles in bni1-CT
1 cells were also located farther from the
bud neck and were highly variable in position (mean distance of 1.1 µm in bni1-CT
1 versus 0.7 µm in BNI1, t
test, P < 0.0001, n = 180) and, like the bni1 null allele, the
bni1-CT
1 allele produced a striking temperature-sensitive growth defect when combined with ase1
or dyn1
(Fig. 1 a). bni1-CT
1 ase1
and bni1-CT
1 dyn1
strains
were also more sensitive to benomyl, although the effect
was less pronounced in the bni1-CT
1 ase1
strain (Fig. 1 a).
|
Spindle orientation was also affected in cells lacking
Bud6p. At 23°C, the mean spindle orientation angle in a
bud6
strain was 24.0°, compared with 17.8° in an isogenic
wild-type (t test, P < 0.0001, n = 290). At 37°C, the mean
angle in bud6
was 28.3° in contrast to 20.6° in the wild-type (t test, P < 0.0001, n = 330). These results demonstrate that Bud6p and the Bud6p interaction domain of
Bni1p are required for spindle orientation and bipolar bud
site selection, but suggest that Bud6p is less important for spindle orientation than Bni1p.
The Role of Actin in Spindle Orientation and Bipolar Bud Site Selection
Because Bni1p and Bud6p are both thought to be regulators of actin function, we next characterized the nature of
actin's role in spindle orientation and nuclear positioning.
Previous studies demonstrated that actin mutations interfere with normal nuclear position (Palmer et al., 1992
;
Drubin et al., 1993
). To determine if actin is required for
spindle orientation, we treated logarithmically growing
wild-type cells with Lat-A for a brief period (5 min), fixed
the cells, and then measured spindle orientation (Fig. 9 b).
Staining with rhodamine-phalloidin revealed a complete
loss of polymerized actin after treatment with Lat-A (data
not shown). By contrast with mock-treated cultures (Fig. 9
a), the 5-min treatment with Lat-A-randomized spindle
orientation. Thus, actin is required for spindle orientation
in normal growing cells. The rapid effect on spindle orientation suggests that the role of actin in controlling spindle
orientation may be direct.
|
Genetic experiments have provided evidence for a specialized actin structure that mediates bipolar bud site selection (Yang et al., 1997
). Many, but not all, mutations
that affect the actin cytoskeleton affect bipolar bud site selection. A sla1
SH3#3 strain with abnormal cortical actin
structure did not have a defect in bipolar bud site selection
(Yang et al., 1997
). Strains with this sla1 allele accumulated abnormal cortical actin aggregates (Fig. 9 f) and like
sla1
strains, were temperature-sensitive for growth. Like
sla1
, these strains were also supersensitive to osmotic stress at 23°C (data not shown). On the other hand, two
"pseudo-wild-type" actin alleles, act1-116 and act1-117, exhibited normal growth and cortical actin structures but
had a defect in bipolar bud site selection (Yang et al.,
1997
). The reciprocal phenotypes of these mutants suggested that a specific actin structure might mediate bipolar
bud site selection. This postulated structure (or substructure) might also contain bipolar bud site determinants since these proteins are known to interact with actin.
The work by Yang et al. (1997)
together with our analysis of bni1
and bni1-CT
1 prompted us to test the hypothesis that similar actin structure(s) required for bipolar
budding are required for spindle orientation. We first examined spindle orientation in the sla1
SH3#3 strain. As
shown in Fig. 9, c and d, spindle orientation in sla1
SH3#3
cells was indistinguishable from that of the isogenic wild-type strain. This demonstrates that alterations in the actin cytoskeleton per se do not affect spindle orientation and
supports the idea that a specific actin structure may be required for both spindle orientation and bipolar bud site selection.
We next examined spindle orientation in the act1-116
strain. For our analysis we chose act1-116 of the two
pseudo-wild-type actin alleles previously studied because
it has the most noticeable effect on bipolar bud site selection (Yang et al., 1997
). The mean angle for spindle orientation in the act1-116 strain was significantly greater than
that for the isogenic wild-type strain (25.8° and 19.1° respectively, t test, P = 0.0002, n = 360). The percentage of
cells with obviously misoriented spindles was also greater
in the act1-116 strain (10.4% with spindle orientation between 60° and 90° compared with 3.4% for the wild-type
strain). Although the spindle orientation defect in act1-116
was small, it was consistent with the magnitude of the defect in bipolar bud site selection pattern (35% of act1-116/
act1-116 diploid cells had a random budding pattern; data
not shown). The fact that a mutant strain with no detectable cortical actin defect (act1-116) disrupts spindle orientation and bipolar bud site selection, whereas another mutant strain (sla1
SH3#3) with abnormal cortical actin does
not, supports the idea that spindle orientation and bipolar
bud site selection may be mediated by a similar actin-containing structure.
| |
Discussion |
|---|
|
|
|---|
The Role of Bni1p in Spindle Orientation
The formins are important for cytokinesis and aspects of
development in many organisms (Frazier and Field, 1997
).
On the molecular level, formins are thought to be regulators of the actin cytoskeleton, but their exact role in actin
function is not defined. Here we report that the yeast
formin, Bni1p, is required for orientation of preanaphase
mitotic spindles in S. cerevisiae. Our analysis of the spindle
positioning defect in bni1
cells suggests that Bni1p is required to assemble or transport cortical microtubule-binding sites into the bud.
The idea that Bni1p has a role in spindle orientation was
prompted by genetic interactions we observed between
bni1
and mutations in genes encoding components of the
microtubule cytoskeleton. The localization of Bni1p to the
bud cortex early in mitosis and to the septum late in mitosis (Jansen et al., 1996
; Evangelista et al., 1997
; Fujiwara et al.,
1998
) (Evangelista, M., and C. Boone, unpublished observation) suggested that Bni1p would most likely regulate
cytoplasmic microtubules. Indeed, we observed that in
bni1
cells the orientation of preanaphase spindles was random with respect to the mother-bud axis.
Our real-time analysis demonstrated two striking phenotypes in bni1
cells. First, Bni1p was required for the
initial directed movement of the SPB toward the incipient
bud site. Unlike wild-type cells, where the SPB makes a
concerted (but not absolutely direct) movement toward
the incipient bud site, the SPB in bni1
cells spent almost
as much time moving away from the incipient bud site as
toward it. Consistent with the idea that a partially redundant pathway is able to compensate for the loss of BNI1
(in some cells better than others), this defect was observed
in four out of 10 cells. This phenotype is very similar to
that previously observed in kip3
cells (DeZwaan et al.,
1997
), and parallels the common spindle orientation defect
observed in fixed populations of bni1
and kip3
cells.
The polarity of the cell is established before bud emergence. Bni1p and other proteins are localized to the incipient bud before bud emergence (Chant, 1996
; Ayscough et al.,
1997
). Initial studies of fixed populations of cells detected
interactions between cytoplasmic microtubules and the incipient bud site in unbudded cells (Snyder et al., 1991
).
These observations suggested that the microtubule cytoskeleton must be able to sense and respond to polarity
cues even before the bud emerges. This study and previous fluorescence time-lapse microscopy studies of wild-type cells demonstrate that the SPB does move toward
the bud site before bud emergence (DeZwaan et al.,
1997
). The finding that Bni1p was required for this initial
movement of the SPB suggests that Bni1p is either directly involved in the physical interactions between cytoplasmic microtubules and the cortex, or that it regulates these interactions.
It is important to note that, although there was a profound delay in movement of the SPB in bni1
cells toward
the incipient bud, the SPB eventually assumed a position
close to the bud before SPB separation. Therefore it is
possible that other proteins can also mediate the cortical
interaction, but that they assemble at cortical sites later
than Bni1p. Alternatively, there may be a Bni1p-independent pathway for spindle orientation. Because of the genetic evidence of functional overlap between BNI1 and
DYN1, cytoplasmic dynein is one candidate to mediate an
alternate mechanism for spindle orientation.
A second striking phenotype that was unique to bni1
cells was the abnormal rotations of the preanaphase spindle and transiting of these spindles between the mother
and the bud. The transiting motions of the spindle were
correlated with shortening of the cytoplasmic microtubules that maintain contact with the cell cortex. We interpret these movements to be the result of pulling forces between the cortex and the spindle, because the shortening
microtubule consistently maintained contact with the cell
cortex. These spindle movements did not appear to result
from pushing forces, because we did not observe consistent contact between the cortex and cytoplasmic microtubules from the distal SPB.
What was most remarkable about the bni1
cells was
that these apparent pulling movements were observed
with approximately equal frequency toward the mother
cell body as toward the bud. Apparent pulling interactions
between cytoplasmic microtubules and the bud cortex
were observed in wild-type cells during spindle orientation. However, apparent pulling movements of the spindle into the mother cell were not observed in our wild-type samples.
The simplest explanation for the high frequency of transiting of preanaphase spindles in bni1
cells is that Bni1p
is required to concentrate microtubule-binding sites to the
bud cortex while spindle orientation occurs. In the absence
of Bni1p, these microtubule-binding sites would no longer
be asymmetrically localized and would be distributed evenly
between the mother and the bud. Bni1p could participate
in the assembly or transport of microtubule-binding sites
into the bud. Other models are also possible. For examples, cortical attachment sites might be evenly distributed
throughout the cell, but Bni1p might specifically alter
those in the bud, therefore biasing pulling movements toward the bud. Interestingly, we have found that the second
formin in yeast, Bnr1p, is not required for spindle orientation (Lee, L., and D. Pellman, unpublished results). This is
consistent with Bnr1p's specific localization to the septal
regions and not the bud cortex (Kamei et al., 1998
).
The Genetic Pathways Controlling Spindle Orientation
Two major pathways for spindle positioning have been
identified. As discussed above, the kinesin Kip3p is required for the initial migration of the SPB toward the incipient bud site before SPB duplication (DeZwaan et al.,
1997
). Cytoplasmic dynein is required for insertion of the
preanaphase spindle into the bud neck, but not for the initial alignment of the spindle with the axis of division (Yeh
et al., 1995
; DeZwaan et al., 1997
). These pathways are
at least partially overlapping, because cells lacking both
KIP3 and DYN1 are inviable (Cottingham and Hoyt,
1997
; DeZwaan et al., 1997
; Miller et al., 1998
). The pattern of genetic interactions that we observed between
bni1
and null alleles of different motor genes was remarkably similar to the pattern of genetic interactions previously observed with kip3
. These findings together with
the fact that bni1
kip3
double mutant cells were viable
and did not have an exacerbated defect in nuclear segregation relative to the single mutant cells, place KIP3 and
BNI1 in the same genetic pathway.
There are several molecular models that can explain the
relationship between BNI1 and KIP3. One possibility is
that Kip3p is a minus end-directed motor, and that the
pulling of the spindle toward the bud is mediated by Kip3p
tethered to Bni1p. Arguing against this idea is the fact that
Kip3p is not detected at the cell cortex (DeZwaan et al.,
1997
; Miller et al., 1998
). Also, Kip3p and Bni1p do not
coimmunoprecipitate under a variety of conditions, and
the localization of Kip3p is not altered in a bni1
mutant
(Ellingson, E., L. Lee, and D. Pellman, unpublished results). However, it remains possible that there is a physical interaction that is transient or of low affinity.
Another explanation for the similar phenotypes and genetic interactions observed with bni1
and kip3
strains is
that Kip3p may promote microtubule dynamics that are
required for cortical microtubule capture. Dynamic microtubules could be required to increase the number of encounters between the ends of the cytoplasmic microtubules and the cortex, thereby increasing the likelihood that
the microtubules will find a binding site. Finally, Kip3p might mediate microtubule depolymerization after the cytoplasmic microtubule is tethered to the bud cortex through
interactions with another protein. Microtubule depolymerization in this manner would generate a pulling force
on the spindle. Consistent with the idea that Kip3p has an
important role in controlling microtubule dynamics, kip3
cells have longer cytoplasmic microtubules and are resistant to microtubule-depolymerizing agents (Cottingham and Hoyt, 1997
; DeZwaan et al., 1997
). Interestingly, we
have noted that bni1
cells also have longer cytoplasmic
microtubules than control cells, but we have not characterized microtubule dynamics in bni1
cells in detail (Lee, L.,
and D. Pellman, unpublished observation).
Bipolar Bud Site Determinants, Actin, and Cortical Microtubule Capture
Several lines of evidence suggest that other bipolar budding determinants in addition to Bni1p may be involved in
spindle orientation. First, several genes required for bipolar budding appear to define a functional group based on
similar mutant phenotypes, similar genetic interactions,
and similar localization of the encoded proteins (Snyder,
1989
; Valtz and Herskowitz, 1996
; Zahner et al., 1996
;
Amberg et al., 1997
; Winsor and Schiebel, 1997
). Furthermore, there is evidence for physical interactions among at
least four of these proteins. Bni1p and Spa2p interact by
two-hybrid analysis and in vitro, and the localization of
Bni1p is dependent upon Spa2p function (Fujiwara et al.,
1998
). There is also evidence for physical interactions between Spa2p, Pea2p, and Bud6p (Sheu et al., 1998
). Second, we found that bud6
cells exhibit a defect in spindle
orientation. Third, cells expressing Bni1-CT
1p, which lack the Bud6p-interacting domain of Bni1p, are defective
in bipolar budding and spindle orientation but not Bni1p
mating functions. Although Bud6p is necessary for normal
spindle positioning, our results demonstrate that it is not
as important as Bni1p. This suggests that the biochemical
mechanism for cortical microtubule capture may be complex, perhaps involving several partially redundant factors.
The actin cytoskeleton is also required for both spindle
orientation and bipolar budding (Palmer et al., 1992
; Yang
et al., 1997
). We have extended previous studies by demonstrating that spindle orientation in normal logarithmically growing cells becomes random within 5 min of depolymerizing cellular actin with Lat-A. The rapid effect of
Lat-A on spindle orientation argues that the role of actin
may be direct.
Our findings are also consistent with the idea that actin
structures postulated to be required for bipolar budding
(Yang et al., 1997
), are also required for spindle orientation. The supposition that a specific actin structure is required for both bipolar budding and spindle orientation is
based on several lines of evidence. First, a mutation that
results in abnormal cortical actin (sla1
SH3#3) does not
affect bipolar budding or spindle orientation, demonstrating that alterations in the actin cytoskeleton per se do not
perturb these two processes. Second, an act1-116 allele
that does not alter cortical actin or cell growth is defective
for both bipolar budding and spindle orientation. Third,
both bni1
and bni1-CT
1 cells have normal appearing
actin structures (Lee, L., and D. Pellman, unpublished
data) but are defective for spindle orientation and bipolar
bud site selection. Together, these findings are consistent with a model where Bni1p is a component of an actin complex that mediates bipolar bud site selection and spindle orientation.
Although our results suggest that Bni1p is necessary to
concentrate microtubule/cortical interaction sites into the
bud, the molecular nature of this postulated microtubule-binding site remains to be defined. As discussed above,
one possibility is that the interaction is mediated by transient association of a microtubule motor such as Kip3p
with the cortex. Another possibility is that cytoplasmic microtubules are captured by microtubule-binding proteins located at cortical sites. One candidate cortical protein
that might have microtubule-binding activity is Kar9p
(Miller and Rose, 1998
). The kar9
phenotype partially
overlaps with that of bni1
. Furthermore, Kar9p is mislocalized in bni1
cells, although not obviously to cortical
sites in the mother cell (see accompanying paper by Miller
et al., 1999
). Another candidate for a cortical interaction
site is coronin (Heil-Chapdelaine et al., 1998
; Goode et al.,
1999
). Coronin colocalizes with actin patches in vivo and,
interestingly, binds to both microtubules and actin in vitro. Since most of the proteins required for spindle orientation
are not essential, it seems likely that there may be several
cortical proteins that interact with microtubules.
Whatever the nature of the cortical microtubule-binding
sites, it is likely that their activity is regulated during the
cell cycle. One plausible mechanism to achieve this would
be through Rho-type GTPases. Because Bni1p links Rho-type GTPases to the actin cytoskeleton (Evangelista et al.,
1997
; Imamura et al., 1997
; Fujiwara et al., 1998
), it is interesting to note that genetic evidence suggests a role for
Rho2p and the GDP/GTP exchange factor Rom2p in microtubule function (Manning et al., 1997
). Whether the interaction between Bni1p and the activated forms of GTPases is required to maintain spindle orientation remains to
be determined.
The results described here define an important role for
an S. cerevisiae formin, Bni1p, in regulating spindle position. Whether formins in other organisms have similar
functions is unknown. However, we note that mutations in
the genes encoding the Drosophila formins, cappuccino
and diaphanous, result in abnormal microtubule structures
(Emmons et al., 1995
; Giansanti et al., 1998
). cappuccino mutant oocytes contain long and thick microtubule bundles around the cell cortex. During male meiosis in diaphanous mutants the structure of both the actin contractile
ring and the central spindle is disrupted. These findings
raise the possibility that formins have a conserved role in
microtubule function.
| |
Footnotes |
|---|
Address correspondence to D. Pellman, The Dana-Farber Cancer Institute, Room M621A, 44 Binney St., Boston, MA 02115. Tel.: (617) 632-4918. Fax: (617) 632-5757. E-mail: david_pellman{at}dfci.harvard.edu
Received for publication 7 October 1998 and in revised form 6 January 1999.
The authors wish to thank K. Salisbury and S. Randall of Improvision (Coventry, UK) for assistance with the imaging system and software, K. Ayscough (University of California, Berkeley, CA), K. Bloom (University of North Carolina, Chapel Hill, NC), S. Brown, D. Drubin, M.A. Hoyt, J. Kahana (Dana-Farber Cancer Institute/Harvard Medical School, Boston, MA), R. Miller, A. Murray, P. Silver, and A. Straight (Harvard Medical School) for plasmids and strains, A. Datta (Ludwig Institute for Cancer Research, La Jolla, CA) for help with cloning by PCR, N. Lee (Massachusetts Institute of Technology, Lexington, MA) for mathematical advice, K. Bloom, D. Drubin, D. Lew (Duke University, Durham, NC), R. Miller (Princeton University, Princeton, NJ), and M. Rose (Princeton University, Princeton, NJ) for helpful discussion, M. Christman (University of Virginia, Charlottesville, VA), R. Li (Harvard Medical School), M. McLaughlin (Brigham and Women's Hospital, Harvard Medical School), D. Roof (University of Pennsylvania, Philadelphia, PA), S. Schuyler (Harvard Medical School), and J. Tirnauer (Dana-Farber Cancer Institute) for comments on the manuscript, and members of the Pellman lab for stimulating discussions.
This work was supported by the National Institutes of Health (GM55772) and a Kimmel Scholar Award to D. Pellman, grants from the Natural Sciences and Engineering Research Council of Canada and the National Cancer Institute of Canada to C. Boone, and a Natural Sciences and Engineering Research Council of Canada postgraduate fellowship to M. Evangelista.
| |
Abbreviations used in this paper: CEN |
|---|
, centromere-based; DAPI, 4',6'-diamidino-2-phenylindole; DIC, differential interference contrast; GFP, green fluorescent protein; Lat-A, Latrunculin-A; SPB, spindle pole body.
| |
References |
|---|
|
|
|---|
| 1. | Amberg, D.C., J.E. Zahner, J.W. Mulholland, J.R. Pringle, and D. Botstein. 1997. Aip3p/Bud6p, a yeast actin-interacting protein that is involved in morphogenesis and the selection of bipolar budding sites. Mol. Biol. Cell 8: 729-753 [Abstract]. |
| 2. |
Ayscough, K.R.,
J. Stryker,
N. Pokala,
M. Sanders,
P. Crews, and
D.G. Drubin.
1997.
High rates of actin filament turnover in budding yeast and roles for actin in establishment and maintenance of cell polarity revealed using the actin
inhibitor Latrunculin-A.
J. Cell Biol
137:
399-416
|
| 3. |
Bender, A., and
J.R. Pringle.
1991.
Use of a screen for synthetic lethal and multicopy suppressee mutants to identify two new genes involved in morphogenesis in Saccharomyces cerevisiae.
Mol. Cell. Biol
11:
1295-1305
|
| 4. | Bi, E., and J.R. Pringle. 1996. ZDS1 and ZDS2, genes whose products may regulate Cdc42p in Saccharomyces cerevisiae. Mol. Cell. Biol 10: 5264-5275 . |
| 5. |
Boone, C.,
K.L. Clark, and
G.F.J. Sprague.
1992.
Identification of a tRNAGln
ochre suppressor in Saccharomyces cerevisiae.
Nucleic Acids Res
20:
4661
|
| 6. |
Burns, N.,
B. Grimwade,
P.B. Ross-Macdonald,
E.-Y. Choi,
K. Finberg,
G.S. Roeder, and
M. Snyder.
1994.
Large-scale analysis of gene expression, protein localization, and gene disruption in Saccharomyces cerevisiae.
Genes
Dev
8:
1087-1105
|
| 7. | Cao, L.-G., and Y.-L. Wang. 1996. Signals from the spindle midzone are required for the stimulation of cytokinesis in cultured epithelial cells. Mol. Biol. Cell 7: 225-232 [Abstract]. |
| 8. |
Carminati, J.L., and
T. Stearns.
1997.
Microtubules orient the mitotic spindle in
yeast through dynein-dependent interactions with the cell cortex.
J. Cell
Biol
138:
629-641
|
| 9. | Castrillon, D.H., and S.A. Wasserman. 1994. diaphanous is required for cytokinesis in Drosophila and shares domains of similarity with the products of the limb deformity gene. Development (Camb.) 120: 3367-3377 [Abstract]. |
| 10. |
Chang, F.,
D. Drubin, and
P. Nurse.
1997.
cdc12p, a protein required for cytokinesis in fission yeast, is a component of the cell division ring and interacts
with profilin.
J. Cell Biol
137:
169-182
|
| 11. | Chant, J.. 1996. Generation of cell polarity in yeast. Curr. Opin. Cell Biol 8: 557-565 [Medline]. |
| 12. |
Chant, J., and
J.R. Pringle.
1995.
Patterns of bud-site selection in the yeast Saccharomyces cerevisiae.
J. Cell Biol
129:
751-765
|
| 13. | Chenn, A., and S.K. McConnell. 1995. Cleavage orientation and the asymmetric inheritance of Notch1 immunoreactivity in mammalian neurogenesis. Cell 82: 631-641 [Medline]. |
| 14. |
Cottingham, F.R., and
M.A. Hoyt.
1997.
Mitotic spindle positioning in Saccharomyces cerevisiae is accomplished by antagonistically acting microtubule
motor proteins.
J. Cell Biol
138:
1041-1053
|
| 15. |
Cvrckova, F.,
C. De Virgilio,
E. Manser,
J.R. Pringle, and
K. Nasmyth.
1995.
Ste20-like protein kinases are required for normal localization of cell growth
and for cytokinesis in budding yeast.
Genes Dev
9:
1817-1830
|
| 16. |
DeZwaan, T.M.,
E. Ellingson,
D. Pellman, and
D.M. Roof.
1997.
Kinesin-related KIP3 of Saccharomyces cerevisiae is required for a distinct step in
nuclear migration.
J. Cell Biol
138:
1023-1040
|
| 17. | Di Rienzo, A., A.C. Peterson, and N.B. Freimer. 1996. Amplification with arbitrary primers. Methods Mol. Biol 54: 123-129 [Medline]. |
| 18. | Drubin, D.G., H.D. Jones, and K.F. Wertman. 1993. Actin structure and function: roles in mitochondrial organization and morphogenesis in budding yeast and identification of the phalloidin-binding site. Mol. Biol. Cell 4: 1277-1294 [Abstract]. |
| 19. | Drubin, D.G., and W.J. Nelson. 1996. Origins of cell polarity. Cell 84: 335-344 [Medline]. |
| 20. |
Emmons, S.,
H. Phan,
J. Calley,
W. Chen,
B. James, and
L. Manseau.
1995.
cappuccino, a Drosophila maternal effect gene required for polarity of the egg
and embryo, is related to the vertebrate limb deformity locus.
Genes Dev
9:
2482-2494
|
| 21. |
Euteneuer, U., and
M. Schliwa.
1985.
Evidence for an involvement of actin in
the positioning and motility of centrosomes.
J. Cell Biol
101:
96-103
|
| 22. |
Evangelista, M.,
K. Blundell,
M.S. Longtine,
C.J. Chow,
N. Adames,
J.R. Pringle,
M. Peter, and
C. Boone.
1997.
Bni1p, a yeast formin linking Cdc42p and
the actin cytoskeleton during polarized morphogenesis.
Science
276:
118-122
|
| 23. |
Farkasovsky, I., and
H. Küntzel.
1995.
Yeast Num1p associates with the mother
cell cortex during S/G2 phase and affects microtubular functions.
J. Cell
Biol
131:
1003-1014
|
| 24. | Frazier, J.A., and C.M. Field. 1997. Actin cytoskeleton: are FH proteins local organizers? Curr. Biol 7: R414-R417 [Medline]. |
| 25. |
Freifelder, D..
1960.
Bud formation in Saccharomyces cerevisiae.
J. Bacteriol
80:
567-568
|
| 26. |
Fujiwara, T.,
K. Tanaka,
A. Mino,
M. Kikyo,
K. Takahashi,
K. Shimizu, and
Y. Takai.
1998.
Rho1p-Bni1p-Spa2p interactions: implication in localization of
Bni1p at the bud site and regulation of the actin cytoskeleton in Saccharomyces cerevisiae.
Mol. Biol. Cell
9:
1221-1233
|
| 27. |
Giansanti, M.G.,
S. Bonaccorsi,
B. Williams,
E.V. Williams,
C. Santolamazza,
M.L. Goldberg, and
M. Gatti.
1998.
Cooperative interactions between the
central spindle and the contractile ring during Drosophila cytokinesis.
Genes
Dev
12:
396-410
|
| 28. |
Goode, B.L.,
J.J. Wong,
A. Butty,
M. Peter,
A.L. McCormack,
J.R. Yates,
D.G. Drubin, and
G. Barnes.
1999.
Coronin promotes the rapid assembly and
cross-linking of actin filaments and may link the actin and microtubule cytoskeletons in yeast.
J. Cell Biol.
144:
83-98
|
| 29. | Harris, S.D., L. Hamer, K.E. Sharpless, and J.E. Hamer. 1997. The Aspergillus nidulans sepA gene encodes an FH1/2 protein involved in cytokinesis and the maintenance of cellular polarity. EMBO (Eur. Mol. Biol. Organ.) J 16: 3474-3483 [Medline]. |
| 30. | Heil-Chapdelaine, R.A., N.K. Tran, and J.A. Cooper. 1998. The role of Saccharomyces cerevisiae coronin in the actin and microtubule cytoskeletons. Curr. Biol 8: 1281-1284 [Medline]. |
| 31. |
Hyman, A.A..
1989.
Centrosome movement in the early divisions of Caenorhabditis elegans: a cortical site determining centrosome position.
J. Cell Biol
109:
1185-1193
|
| 32. |
Hyman, A.A., and
J.G. White.
1987.
Determination of cell division axes in the
early embryogenesis of Caenorhabditis elegans.
J. Cell Biol
105:
2123-2135
|
| 33. | Hyman, A.A., and T. Stearns. 1992. Spindle positioning and cell polarity. Curr. Biol 2: 469-471 [Medline]. |
| 34. | Hyman, A.A., and E. Karsenti. 1996. Morphogenic properties of microtubules and mitotic spindle assembly. Cell 84: 401-410 [Medline]. |
| 35. | Imamura, H., K. Tanaka, T. Hihara, M. Umikawa, T. Kamei, K. Takahashi, T. Sasaki, and Y. Takai. 1997. Bni1p and Bnr1p: downstream targets of the Rho family small G-proteins which interact with profilin and regulate actin cytoskeleton in Saccharomyces cerevisiae. EMBO (Eur. Mol. Biol. Organ.) J 16: 2745-2755 [Medline]. |
| 36. | Jansen, R.-P., C. Dowzer, C. Michaelis, M. Galova, and K. Nasmyth. 1996. Mother cell-specific HO expression in budding yeast depends on the unconventional myosin Myo4p and other cytoplasmic proteins. Cell 84: 687-697 [Medline]. |
| 37. |
Juang, Y.-L.,
J. Huang,
J.-M. Peters,
M.E. McLaughlin,
C.-Y. Tai, and
D. Pellman.
1997.
APC-mediated proteolysis of Ase1 and the morphogenesis of the
mitotic spindle.
Science
275:
1311-1314
|
| 38. | Kahana, J.A., and P.A. Silver. 1996. Use of the A. victoria green fluorescent protein to study dynamics in vivo. In Current Protocols in Molecular Biology. F.M. Ausubel, R. Brent, R.E. Kingston, D.E. Moore, J.G. Seidman, J.A. Smith, and K. Struhl, editors. John Wiley and Sons, New York, NY. 9.6.13-9.6.19. |
| 39. |
Kahana, J.A.,
B.J. Schnapp, and
P.A. Silver.
1995.
Kinetics of spindle pole body
separation in budding yeast.
Proc. Natl. Acad. Sci. USA
92:
9707-9711
|
| 40. |
Kamei, T.,
K. Tanaka,
T. Hihara,
M. Umikawa,
H. Imamura,
M. Kikyo,
K. Ozaki, and
Y. Takai.
1998.
Interaction of Bnr1p with a novel Src homology 3 domain-containing Hof1p.
J. Biol. Chem
273:
28341-28345
|
| 41. |
Kaverina, I.,
K. Rottner, and
J.V. Small.
1998.
Targeting, capture, and stabilization of microtubules at early focal adhesions.
J. Cell Biol
142:
181-190
|
| 42. | Kohno, H., K. Tanaka, A. Mino, M. Umikawa, H. Imamura, T. Fujiwara, Y. Fujita, K. Hotta, H. Qadota, T. Watanabe, Y. Ohya, and Y. Takai. 1996. Bni1p implicated in cytoskeletal control is a putative target of Rho1p small GTP binding protein in Saccharomyces cerevisiae. EMBO (Eur. Mol. Biol. Organ.) J 15: 6060-6068 [Medline]. |
| 43. | Kraut, R., W. Chia, L.Y. Jan, and J.A. Knoblich. 1996. Role of inscuteable in orienting asymmetric cell divisions in Drosophila. Nature 383: 50-55 [Medline]. |
| 44. | Manning, B.D., R. Padmanabha, and M. Snyder. 1997. The Rho-GEF Rom2p localizes to sites of polarized cell growth and participates in cytoskeletal functions in Saccharomyces cerevisiae. Mol. Biol. Cell 10: 1829-1844 . |
| 45. | Miller, R.K., D. Matheos, and M.D. Rose. 1999. The cortical localization of the microtubule orientation protein, Kar9p, is dependent upon actin and proteins required for polarization. J. Cell Biol. 963-975. |
| 46. |
Miller, R.K., and
M.D. Rose.
1998.
Kar9p is a novel cortical protein required
for cytoplasmic microtubule orientation in yeast.
J. Cell Biol
140:
377-390
|
| 47. |
Miller, R.K.,
K.K. Heller,
L. Frisèn,
D.L. Wallack,
D. Loayza,
A.E. Gammie, and
M.D. Rose.
1998.
The kinesin-related proteins, Kip2p and Kip3p, function differently in nuclear migration in yeast.
Mol. Biol. Cell
9:
2051-2068
|
| 48. | Mösch, H.-U., and G.R. Fink. 1997. Dissection of filamentous growth by transposon mutagenesis in Saccharomyces cerevisiae. Genetics 145: 671-684 [Abstract]. |
| 49. |
Palmer, R.E.,
M. Koval, and
D. Koshland.
1989.
The dynamics of chromosomal
movement in the budding yeast Saccharomyces cerevisiae.
J. Cell Biol
109:
3355-3366
|
| 50. |
Palmer, R.E.,
D.S. Sullivan,
T. Huffaker, and
D. Koshland.
1992.
Role of astral
microtubules and actin in spindle orientation and migration in the budding
yeast, Saccharomyces cerevisiae.
J. Cell Biol
119:
583-593
|
| 51. |
Pellman, D.,
M. Bagget,
H. Tu, and
G.R. Fink.
1995.
Two microtubule-associated proteins required for anaphase spindle movement in Saccharomyces
cerevisiae.
J. Cell Biol
130:
1373-1385
|
| 52. | Petersen, J., D. Weilguny, R. Egel, and O. Nielsen. 1995. Characterization of fus1 of Schizosaccharomyces pombe: a developmentally controlled function needed for conjugation. Mol. Cell. Biol 15: 3697-3707 [Abstract]. |
| 53. | Pringle, J.R., R.A. Preston, A.E.M. Adams, T. Stearns, D.G. Drubin, B.K. Haarer, and E.W. Jones. 1989. Fluorescence microscopy methods for yeast. Methods Cell Biol 31: 357-435 [Medline]. |
| 54. | Rhyu, M.S., and J.A. Knoblich. 1995. Spindle orientation and asymmetric cell fate. Cell 82: 523-526 [Medline]. |
| 55. | Rose, M.D., F. Winston, and P. Hieter. 1990. Methods in Yeast Genetics. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 198 pp. |
| 56. |
Shaw, S.L.,
E. Yeh,
P. Maddox,
E.D. Salmon, and
K. Bloom.
1997.
Astral microtubule dynamics in yeast: a microtubule-based searching mechanism for
spindle orientation and nuclear migration into the bud.
J. Cell Biol
139:
985-994
|
| 57. |
Shaw, S.L.,
P. Maddox,
R.V. Skibbens,
E. Yeh,
E.D. Salmon, and
K. Bloom.
1998.
Nuclear and spindle dynamics in budding yeast.
Mol. Biol. Cell
9:
1627-1631
|
| 58. |
Sheu, Y.-J.,
B. Santos,
N. Fortin,
C. Costigan, and
M. Snyder.
1998.
Spa2p interacts with cell polarity proteins and signaling components involved in yeast
cell morphogenesis.
Mol. Cell. Biol
18:
4053-4069
|
| 59. |
Sikorski, R.S., and
P. Hieter.
1989.
A system of shuttle vectors and yeast host
strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:
19-27
|
| 60. |
Snyder, M..
1989.
The SPA2 protein of yeast localizes to sites of cell growth.
J.
Cell Biol
108:
1419-1429
|
| 61. |
Snyder, M.,
S. Gehrung, and
B.D. Page.
1991.
Studies concerning the temporal
and genetic control of cell polarity in Saccharomyces cerevisiae.
J. Cell Biol
114:
515-532
|
| 62. | Sprague, G.F. Jr.. 1991. Assay of yeast mating reaction. Methods Enzymol. 194: 77-93 [Medline]. |
| 63. | Staiger, C.J., and C.W. Lloyd. 1991. The plant cytoskeleton. Curr. Opin. Cell Biol 3: 33-42 [Medline]. |
| 64. |
Stearns, T..
1997.
Motoring to the finish: kinesin and dynein work together to
orient the yeast mitotic spindle.
J. Cell Biol
138:
957-960
|
| 65. |
Straight, A.F.,
W.F. Marshall,
J.W. Sedat, and
A.W. Murray.
1997.
Mitosis in
living budding yeast: anaphase A but no metaphase plate.
Science
277:
574-578
|
| 66. |
Valtz, N., and
I. Herskowitz.
1996.
Pea2 protein of yeast is localized to sites of
polarized growth and is required for efficient mating and bipolar budding.
J.
Cell Biol
135:
725-739
|
| 67. | Wach, A., A. Brachat, R. Pöhlmann, and P. Philippsen. 1994. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10: 1793-1808 [Medline]. |
| 68. | Winsor, B., and E. Schiebel. 1997. Review: an overview of the Saccharomyces cerevisiae microtubule and microfilament cytoskeleton. Yeast 13: 399-434 [Medline]. |
| 69. | Woychik, R.P., R.L. Maas, R. Zeller, T.F. Vogt, and P. Leder. 1990. "Formins": proteins deduced from the alternative transcripts of the limb deformity gene. Nature 346: 850-853 [Medline]. |
| 70. |
Yang, S.,
K.R. Ayscough, and
D.G. Drubin.
1997.
A role for the actin cytoskeleton of Saccharomyces cerevisiae in bipolar bud-site selection.
J. Cell Biol
136:
111-123
|
| 71. |
Yeh, E.,
R.V. Skibbens,
J.W. Cheng,
E.D. Salmon, and
K. Bloom.
1995.
Spindle
dynamics and cell cycle regulation of dynein in the budding yeast, Saccharomyces cerevisiae.
J. Cell Biol
130:
687-700
|
| 72. | Zahner, J.E., H.A. Harkins, and J.R. Pringle. 1996. Genetic analysis of the bipolar pattern of bud site selection in the yeast Saccharomyces cerevisiae. Mol. Cell. Biol 16: 1857-1870 [Abstract]. |
| 73. | Ziman, M., D. Preuss, J. Mulholland, J.M. O'Brien, D. Botstein, and D.I. Johnson. 1993. Subcellular localization of Cdc42p, a Sacchamromyces cerevisiae GTP-binding protein involved in the control of cell polarity. Mol. Biol. Cell 4: 1307-1316 [Abstract]. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|