|
||
© The Rockefeller University Press,
0021-9525/1999//989 $5.00
The Journal of Cell Biology, Volume 144, Number 5,
, 1999 989-1000
Regular Articles |
Specific Myosin Heavy Chain Mutations Suppress Troponin I Defects in Drosophila Muscles


Instituto Cajal, Consejo Superior de Investigaciones Científicas, Madrid 28002, Spain
We show that specific mutations in the head of the thick filament molecule myosin heavy chain prevent a degenerative muscle syndrome resulting from the hdp2 mutation in the thin filament protein troponin I. One mutation deletes eight residues from the actin binding loop of myosin, while a second affects a residue at the base of this loop. Two other mutations affect amino acids near the site of nucleotide entry and exit in the motor domain. We document the degree of phenotypic rescue each suppressor permits and show that other point mutations in myosin, as well as null mutations, fail to suppress the hdp2 phenotype. We discuss mechanisms by which the hdp2 phenotypes are suppressed and conclude that the specific residues we identified in myosin are important in regulating thick and thin filament interactions. This in vivo approach to dissecting the contractile cycle defines novel molecular processes that may be difficult to uncover by biochemical and structural analysis. Our study illustrates how expression of genetic defects are dependent upon genetic background, and therefore could have implications for understanding gene interactions in human disease.
Key Words: Drosophila muscle myosin myofibril troponin I
Abbreviations used in this paper: Su(hdp2)D; DLM, dorsolongitudinal muscle; MHC, myosin heavy chain; Mhc, myosin heavy chain gene.
Address correspondence to Sanford I. Bernstein, Department of Biology and Molecular Biology Institute, San Diego State University, San Diego, California 92182-4614. Tel.: (619) 594-5629. Fax: (619) 594-5676. E-mail: sbernst{at}sunstroke.sdsu.edu
MUSCLE contraction is the result of a series of protein–protein interactions and conformational changes that culminate in ATP-dependent movement of the myosin head of the thick filament when it is attached to actin of the thin filament. The action of the myosin head slides the thin filament relative to the thick filament, causing sarcomere shortening. Thin filaments are normally inhibited from interacting with thick filaments due to blockage of the myosin binding sites on actin by a strand of tropomyosin molecules, and possibly by the troponin I protein of the thin-filament based troponin complex. The inhibition is relieved by release of calcium ions from internal stores following neural activity. Ca2+ binds to troponin C protein, reconfiguring the troponin T–based interaction of the entire troponin complex with tropomyosin. The resulting movement of the tropomyosin strand from its inhibitory position permits the myosin crossbridge to bind to the thin filament. For a recent review, see Squire (1997).
There are numerous conformational rearrangements involved in thin-filament regulation of the crossbridge cycle (Farah and Reinach, 1995). Multiple Ca2+-induced changes in interaction among subunits of the troponin complex and between troponin and tropomyosin occur, although the details of the structural role of the troponin complex in this regulation are not known. Not only does tropomyosin shift during Ca2+ activation of the thin filament, but the actin monomer changes conformation (al-Khayat et al., 1995). Further, binding of the myosin head to the thin filament is a cooperative process that involves progressive tropomyosin movement (Vibert et al., 1997). The first myosin heads bind weakly to actin and interact with tropomyosin to push it further away from myosin binding sites on actin. This leads to a decreased duration of the ATP cycle, i.e., a fully on state (McKillop and Geeves, 1993; Metzger, 1995). Understanding the details of the contractile cycle is important for defining the mechanisms of human diseases, such as familial hypertrophic cardiomyopathy, where mutations in a number of sarcomeric contractile proteins can result in aberrant contractile properties and muscle hypertrophy (Watkins et al., 1995; Towbin, 1998).
Some success in mapping precise interaction sites of various contractile apparatus components has resulted from electron microscopy/image reconstruction, and from biochemical assays that assess interaction between intact proteins, proteolytic fragments, and expressed recombinant peptides. These studies are supplemented by determinations of atomic structure of contractile proteins that indicate the location of putative binding sites in particular conformational states. For instance, it has been shown recently that an NH2-terminal
-helical region of troponin I binds to troponin C at low Ca2+ conditions (Vassylyev et al., 1998). It is proposed that Ca2+ binding to troponin C releases this troponin I region and allows binding of an inhibitory region of troponin I, thereby allowing actomyosin interaction (Tripet et al., 1997; Vassylyev et al., 1998). It is important to note, however, that in vitro approaches represent a trade off between structural resolution and biological significance of derived conclusions. The inhibitory role of troponin I is a case in point. Inhibitory properties have been ascribed to the fragment between residues 104–115. However, this fragment's inhibiting efficiency is lower than the entire 1–116 fragment and this, in turn, is less inhibitory than the whole molecule (Tripet et al., 1997; Van Eyk et al., 1997).
An alternative method to assessing functional interactions of proteins during the contractile cycle involves genetic analysis, i.e., disrupting muscle function by mutating a particular contractile protein and searching for suppressor mutations that restore function. This is a particularly powerful approach in that interactions relevant to muscle function in vivo are clarified. In principle, suppressor mutations reveal sites of specific protein–protein interactions that are important to myofibril assembly and/or function. It is also possible that suppressor mutations work by less direct mechanisms, such as through interactions with an intermediary component of the contractile apparatus, or by a general change in protein function that compensates for the original mutation in a less specific way. The suppressor mutation approach has been applied most successfully to mapping muscle protein interactions in Caenorhabditis elegans (Greenwald and Horvitz, 1982; Moerman et al., 1982; Park and Horvitz, 1986; Gengyo-Ando and Kagawa, 1991).
Prado et al. (1995) described the isolation of suppressor mutations in Drosophila melanogaster for a particular point mutation of troponin I, the inhibitory subunit of the troponin complex. These suppressors prevent the heldup wings phenotype that arises from severe defects in the indirect flight muscles of the troponin I mutant. One suppressor is within the mutated troponin I protein itself (Prado et al., 1995). Four others are mapped to the second chromosome. Determination of mutant gene(s) that act to suppress troponin I defect, and definition of the precise location of mutations should reveal protein–protein interactions important to muscle function in vivo.
In this paper, we show that the four genetic suppressors of a Drosophila troponin I point mutation are within the myosin heavy chain (MHC)1. We determine molecular alterations in the myosin molecule and map these on the three-dimensional structure of globular head in an effort to understand the molecular basis of suppression. We show that observed suppression is allele-specific, i.e., it is dependent on a specific mutated residue in troponin I and particular sites within MHC. We elucidate the degree of phenotypic suppression observed in indirect flight muscles of adult flies using light and electron microscopy, and demonstrate that different myosin suppressor alleles suppress the troponin defects to different degrees. Finally, we discuss the possibility that our work reveals an interaction between MHC and troponin I, a prospect not previously proposed based on structural or biochemical studies.
| Materials and Methods |
|---|
|
|
|---|
We obtained recessive–lethal, homozygous suppressor strain embryos for DNA amplification and sequencing by using a second chromosome balancer line (CyO y+) marked with the yellow+ gene (y+; Mardahl et al., 1993) in combination with an X chromosome marked with the y and w (white eye) mutations. To this end, hdp2;D mutation/CyO males were mated with y w;CyO y+/Bc Elp females. Male offspring of genotype y w;D mutation/CyO y+ were backcrossed to y w;CyO y+/Bc Elp females. Resulting males and females of the y w;D mutation/CyO y+ genotype were mated to produce a stable stock. Embryos with dark mouth hooks carry one or two copies of the second chromosome marked with CyO y+, while homozygotes for the D suppressor mutation display yellow mouth hooks.
Genomic DNA was extracted from homozygous embryos of each suppressor mutant according to the method of Jowett (1986). 60 embryos were frozen in an Eppendorf tube and stored at –80°C for at least 1 h. 40 µl of single fly homogenization buffer (10 mM Tris-HCl, pH 7.5, 60 mM NaCl, 50 mM EDTA, 150 µM spermine, 150 µM spermidine) were added and the samples were ground with a plastic pestle. 40 µl of single fly lysis buffer (1.25% [wt/vol] SDS, 300 mM Tris-HCl, pH 8, 100 mM EDTA, 5% [wt/vol] sucrose, 0.75% freshly added diethyl pyrocarbonate) were added. The mixture was incubated for 30 min at 60°C. The sample was cooled to room temperature and 12 µl of 8 M potassium acetate was added. After cooling on ice for 45 min, debris was pelleted by 1 min centrifugation in a microfuge. Supernatant was removed to a fresh tube and 200 µl of 100% ethanol was added. DNA was precipitated at room temperature for 10 min and pelleted in a microfuge for 10 min. The sample was washed with 80% ethanol and vacuum dried. The pellet was resuspended in 60 µl TE (10 mM Tris-HCl, pH 8, 1 mM EDTA).
Genomic DNA from each mutant was used in PCR to generate 11 fragments that cover the entire coding region, plus flanking introns of the Mhc gene. The following oligonucleotide primers were used for amplification (sequences given for noncoding strand in a 5' to 3' orientation): 1, ATGCCGAAGCCAGTCGCAAAT (position 1924), GGAATTCGATACGGATGAATTTACC (position 4141); 2, TAAGCTTGAAGACCGATGAGGCC (position 3948), ATAGCCGTCACTACATAGAGC (position 5941); 3, TTATGTTCTTCTTGCTAAACC (position 6456), ATCTGACTAAAATCCTCAGA (position 8185); 4, GATACACTGCAGCACTAT (position 8367), TGATCGGAGGCCTTGGGGAAC (position 10131); 5, GTTCCCCAAGGCCTCCGATCA (position 10131), GTGTGGGGATTCAATTGAAAG (position 11087); 6, GGAATCAAAAACGAACTCTAC (position 11206), CTAATTGTGGAAGGAGC (position 11818); 7, GTTAAGATCAACTGTAACTAA (position 12206), AGACCCAGGCTGGTCTCGTT (position 14095); 8, CTTCAGCCCGAATCGACCGCC (position 15455), TCAGATCTCTCTATCTCGAT (position 16958); 9, TTGAAGGATCTACAGTTTACA (position 16959), GGGTGACAGACGCTGCTTGGT (position 18365); 10, GTCCCAGGTGTCTCAGCTGT (position 18045), GGCGGGCGGCATCGACCATAG (position 19512); and 11, TGCGTCGTGAGAACAAGAACC (position 18653), TATTACTCTCTTGTTTT (position 20368). Each PCR sample contained 5 µl of genomic DNA, 20 µl of 10x PCR buffer (Promega Corp.), 20 µl of 5 µM solutions of each dNTP (80 µl total), 16 µl of 25 mM MgCl2, 100 pmol each of two primers, 0.8 µl of Taq polymerase (Promega Corp.), and was brought to a total volume of 200 µl with distilled H2O. Paraffin oil was placed on top of the sample to prevent evaporation, and DNA was amplified in an Ericomp thermocycler as follows: one cycle at 95°C for 1 min, 45°C for 2 min, 72°C for 40 min; 28 cycles at 95°C for 1 min, 45°C for 2 min, 72°C for 6 min; and one cycle at 95°C for 1 min, 45°C for 2 min, 72°C for 15 min. Paraffin oil was then removed and DNA was chloroform extracted and precipitated.
PCR products were cloned before sequencing. Amplified products were separated by agarose gel electrophoresis, isolated using GeneClean (Bio 101), and blunt ends were created with the Klenow fragment of Escherichia coli DNA polymerase I (Sambrook et al., 1989). Each fragment was cloned into the EcoRV site of pKS plasmid (Stratagene) and DNA sequencing was performed using a Sequenase kit (United States Biochemicals) or on an automated DNA sequencer (Applied Biosystems).
Reverse Transcription and Amplification of Mhc mRNA
First strand synthesis of cDNA was performed using 1 µg of total RNA (isolated as described in Hess and Bernstein, 1991), 100 pmol of 3' primer (TGATCGGAGGCCTTGGGGAAC, position 10131), 1.4 µl of 5x first strand buffer (250 mM Tris, pH 8.5, 375 mM KCl, 5 mM MgCl2, 50 mM dithiothreitol), brought to a total volume of 7 µl with distilled H2O. The mixture was placed in boiling water for 30 s, then allowed to cool to 37°C. 1 µl of Inhibitase (1 U/µl; Promega Corp.) was then added along with 0.5 µl of each dNTP at 10 mM. Then 0.6 µl of 5x first strand buffer was added plus 0.5 µl of distilled H2O. The reaction was started by addition of 1.0 µl of M-MLv reverse transcriptase (100 U/µl; GIBCO BRL) and the sample was incubated at 37°C for 1.5 h. The reaction was terminated on ice by adding 20 µl of 0.3 M NaOH/0.03 M EDTA. RNA was hydrolyzed at 60°C for 1 h. The solution was neutralized by adding 3.4 µl of 3 M sodium acetate, pH 5.2, and cDNA was precipitated with 2.5 vol of 100% ethanol. After centrifugation in the microfuge for 15 min at 4°C, the DNA pellet was washed with 80% ethanol and vacuum dried. The sample was resuspended in 10 µl distilled H2O. Half the sample was amplified using the 3' primer at position 10131 and 5' primer GGCTGGTGCTGATATTGAGA (position 4182), as described for genomic DNA above.
In Situ Hybridization
Slides were cleaned by thorough washing with liquid hand soap, then treated with subbing solution (0.5% gelatin, 0.05% chrome alum). Slides were dried overnight in a dust-free environment. Tissue was prepared by embedding whole flies (with wings removed) in OCT compound and freezing on dry ice. Frozen tissue sections (8–16 µm) were taken using a microtome. These were placed onto treated slides and allowed to dry. Tissue was fixed with 4% paraformaldehyde for 20 min and then washed three times in 1x PBT (1.3 M NaCl, 0.07 M Na2HPO4, 0.03 M NaH2PO4, 1% Tween 20). Sections were then treated with 50 µg/ml proteinase K in PBT for 3 min. This was followed by treatment with 2 mg/ml glycine in PBT for 1 min (repeated once). Slides were washed in PBS (1.3 M NaCl, 0.07 M Na2HPO4, 0.03 M NaH2PO4) for 1 min and placed in 4% paraformaldehyde for 20 min. This was followed by two washes with PBS for 5 min each. The samples were dehydrated in 30% ethanol, 50% ethanol, 70% ethanol, 80% ethanol, 95% ethanol, 100% ethanol (5 min each), and placed under the vacuum for 40 min.
Transcription of digoxigenin-labeled probes was according to the procedure provided in Genius 3 Kit (Boehringer Mannheim). Antisense probes from each copy of exon 7 were prepared from the following fragments that had been cloned into a plasmid containing a T3 or T7 RNA polymerase binding site: exon 7a, XbaI (4568) to HindIII (4940); exon 7b, HindIII (4940) to HindIII (5300); exon 7c, Hind III (5300) to EcoRV (5900); exon 7d, EcoRV (5900) to EcoRI (6600). 1 µg of RNA probe was added to 25 µl of 10 mg/ml tRNA and brought to a total volume of 100 µl with distilled H2O. The probe was denatured by heating at 75°C for 10 min.
Hybridization was carried out by adding the denatured probe to 400 µl of hybridization buffer (50% formamide, 10% dextran sulfate, 0.3 M NaCl, 10 mM Tris-HCl, pH 8, 1 mM EDTA, 0.1% Tween 20, 50 µg/ml heparin, 1x Denhardt's solution). 100 µl of the probe in hybridization solution were placed onto each slide. Slides were covered with a plastic sealer (HybriWell, Research Products International) and placed in a sealed box. Hybridization was allowed to proceed for at least 18 h at 56°C.
After hybridization, slides were washed with 4x SSC (twice for 10 min each). This was followed by RNase A treatment (20 µg/ml in 0.5 M NaCl, 10 mM Tris, pH 7.5, 1 mM EDTA) to remove single-stranded probe for 30 min at 37°C. Slides were washed in PBT for 5 min (repeated once), and then incubated with antibody conjugate at a ratio of 1:500 in PBT plus 5% normal goat serum for 120 min. Unbound antibody was washed off with buffer 3 (100 mM Tris, pH 9.53, 100 mM NaCl, 50 mM MgCl2) for 5 min. This was repeated. Color reaction buffer was prepared by adding 20 ml of buffer 3 to 100 µl of NBT and 75 µl of X phosphate. This reaction was allowed to proceed for at least 1 h and as long as overnight. The reaction was stopped by rinsing in H2O.
Protein Analysis
One-dimensional SDS-PAGE was performed by the method of Laemmli (1970). Upper thoraces from 10 flies were dissected, homogenized in 100 µl sample buffer and boiled. Samples (10 µl) were loaded on gels containing 9.5% acrylamide. After staining in Coomassie blue, scanning was performed using a Molecular Dynamics densitometer. MHC levels were normalized to actin levels within the same lane to account for differences in protein loading levels.
Flight Testing
Flight testing was performed using the method of Drummond et al. (1991) on young (2-d-old flies).
Microscopy
For transmission electron microscopy, flies were dissected according to the protocol of Peckham et al. (1990). Once the heads, wings, and abdomens were removed, thoraces were fixed overnight at 4°C in 4% paraformaldehyde, 1% glutaraldehyde in 0.1 M phosphate buffer, pH 7.2. The dorsolongitudinal muscles (DLMs) were dissected from the thoraces, washed several times in buffer, and postfixed in 2% OsO4 in buffer for 45 min at 4°C in the dark. After dehydration, DLMs were embedded in Araldite resin. Silver sections (60–70 nm) were cut on a Reichert Ultracut E ultramicrotome, collected on Formvar-coated grids, and counterstained with uranyl acetate (10 min) and lead citrate (10 min). Micrographs were obtained using a JEOL 1200 EX electron microscope. Morphological analysis at the light microscope level was carried out on paraffin-embedded samples stained with Toluidine blue (Prado et al., 1995).
| Results |
|---|
|
|
|---|
1,000 thick and 2,000 thin filaments accumulate in each fibril. These numbers are fairly constant within a muscle showing only a 5% variability in DLM muscle (a) of our CS stock. Note, however, that other normal strains may exhibit up to 1,500 thick filaments per fibril.
|
D Suppressors on Chromosome II are Mhc Mutations
To identify molecular interactions between muscle proteins and troponin I, we screened for mutations that suppress the heldup wing position of the troponin I hdp2 mutation and isolated four D mutations that map to chromosome II (Prado et al., 1995). We employed meiotic recombination to discern their locations on the second chromosome, and found they map between markers rd and pr. Further, we localized recessive lethality associated with mutations D41, 45, and 62 to the interval uncovered by Df(2)H20. This deficiency removes polytene chromosome regions 36A8–36A9;36F1 and contains the myosin heavy chain (Mhc) gene.
To determine whether the suppressor mutations are Mhc alleles, we performed genetic complementation tests with known Mhc alleles (for details on these alleles, see Lindsley and Zimm, 1992). We crossed each of the D-suppressor mutants to a null mutant (Mhc1), a hypomorphic mutant (Mhc2), and several point mutants (Mhc5, Mhc6, Mhc8). Mhc1, Mhc2, and Mhc8 are recessive lethal alleles, while Mhc5 and Mhc6 are viable as homozygotes. Our results show that the D-suppressor mutants are likely to be Mhc alleles, since none of the suppressors produced progeny over Mhc null or hypomorphic alleles, except for D1 which occasionally was viable in combination with Mhc1. The suppressors produced viable progeny in combination with the various point mutations, except that D1 is lethal in combination with Mhc5, D41 is lethal with Mhc8, and D62 produces very few viable adults in combination with Mhc8. These data demonstrate interaction, and likely allelism, between the D-suppressor mutants and Mhc.
Since Mhc null alleles are recessive lethal (O'Donnell and Bernstein, 1988), as are three of the four D-series suppressor mutants, it is important to determine whether the latter exert their suppression effect through failure to accumulate MHC. We determined whether MHC protein accumulates in the suppressor strains by crossing each to Mhc10 and measuring MHC levels in upper thoraces of heterozygotes. Mhc10 adults fail to accumulate MHC in the jump and indirect flight muscles due to a mutation in an alternative exon specifically used in these muscle types (O'Donnell et al., 1989). Each of the D/Mhc10 heterozygotes accumulate more MHC than Mhc10/Mhc10 adults, but less than +/Mhc10 individuals (Table I). This indicates that suppressor mutations produce stable MHC protein. While the suppressor mutants accumulate only
65–85% as much MHC as flies carrying one copy of wild-type Mhc gene, it is clear that suppressor alleles are not null mutations for Mhc. It is also noteworthy that Mhc missense mutations that cause flight muscle dysfunction typically result in less than wild-type levels of MHC accumulation (Mogami et al., 1986; Kronert et al., 1995).
|
|
G), changing amino acid 625 (chicken MHC numbering system) from Asp to Gly (Table I). This mutation affects an amino acid at the base of the second loop of the molecule (Fig. 2). This loop is involved in actin binding (Mornet et al., 1981; Sutoh, 1982; Rayment et al., 1993a,b; Uyeda et al., 1994; Rovner et al., 1995). If the mutation affects the mobility of the loop, it could dampen acto-myosin interaction. Mutation D62 also affects exon 10, and is a 24-bp in-frame deletion starting at amino acid 638 (Table I). Like D1, this mutation affects the loop that binds actin. It removes eight amino acids within the loop and clearly would be expected to affect actomyosin interaction. The loop, which runs from residue 627 to 646, is not visible in Fig. 2 due to its flexible nature (Rayment et al., 1993b).
Mutation D45 is a point mutation in exon 5 (G
A), changing amino acid 261 from Ala to Thr (Table I). This amino acid is in the general vicinity of ATP entry and the ATP binding site (Fig. 2). However, it is on the surface of the molecule, away from direct interactions with the nucleotide. It is located very close to loop 1 of the molecule (residues 204–216), which is not visible in the structure. This loop is important for regulating nucleotide entry and exit from the ATP binding pocket (Murphy and Spudich, 1998; Sweeney et al., 1998).
Mutation D41 is a 2-bp insertion into exon 7a, interrupting amino acid codon 328. It places this alternative exon out of frame and inserts a stop codon (Table I). The mutation also produces a potential 5' splice junction, GTAGCT. This could disrupt alternative splicing. To study this, we used RT-PCR to amplify the exon 7 region in adult upper thoraces from this mutant. Since this mutation is recessive lethal, the thoraces were taken from D41/Mhc10 organisms (note that Mhc10 RNA fails to accumulate in fly thoraces due to a splicing defect; Collier et al., 1990). We cloned the PCR products from D41/ Mhc10 heterozygotes and analyzed a number of clones by DNA sequencing or restriction enzyme digestion. Normally exon 7d is used in indirect flight muscles (Hastings and Emerson, 1991), which make up the bulk of the thorax. We found this to be the case in all 17 clones analyzed from wild-type thoraces. However, we observed an extreme reduction in exon 7d usage, replaced by in-frame inclusion of exons 7b or 7c, in clones of Mhc PCR products from thoraces of D41/Mhc10 organisms (1 exon 7b, 13 exon 7c, and 4 exon 7d). Thus, the insertion of a splice junction in exon 7a appears to disrupt the alternative splicing process.
We next used in situ hybridization to investigate the possibility of tissue-specific alternative splicing disruption in thoracic musculature of D41 adults. Alternative exon-specific probes were prepared and hybridized to sections of young adults, either wild-type or D41/Mhc10 mutant. The hybridization results clearly showed that exon 7d accumulates in indirect flight muscles of wild-type, but is below detectable levels in D41 indirect flight muscles (Fig. 3). High levels of exon 7c accumulate in D41 indirect flight muscles, but no trace of this exon is detected in wild-type indirect flight muscle transcripts. Thus, the unusual effect of the mutation is to disrupt the alternative splicing apparatus through the introduction of a 5' splice site, resulting in use of a different alternative exon than is normally employed in indirect flight muscles. Exon 7 encodes a region at the lip of the nucleotide binding pocket (light blue in Fig. 2). It is possible that using the wrong version of this alternative exon disrupts MHC function by changing nucleotide affinity and disrupting the ATPase cycle.
|
Functional and Structural Effects of D Suppressors
We examined the degree of rescue of hdp2 phenotypes by each suppressor mutation that maps within the head domain of MHC. While the suppressed wing position phenotype is evident in all hdp2;D/+ males, none can jump or fly under standard criteria (Prado et al., 1995). We analyzed the structural effects of the suppressors in hdp2;D/+ males at light and electron microscopic levels (Fig. 4). In general, the organization of the six DLMs is restored with similar efficiency by the four D mutations. However, the e and f muscles, their posterior region in particular, are still very sensitive to contraction, and appear grossly abnormal at 3–5 d (Fig. 4, A, E, I, and M).
|
We also studied the effects of the D-series suppressors upon flight muscle function in the absence of hdp2 mutation. The suppressors show dominant effects upon flight muscle function (Table II). D1 is least disruptive, with 85% of adults flying upward or horizontally, compared with 90% in wild-type. D62 is most disruptive, with only 16% flying upward or horizontally (Table II). We determined whether the wild-type Mhc gene could rescue defects in flight ability by crossing each suppressor strain to a stock containing an Mhc transgene (Cripps et al., 1994). No rescue was observed (Table II), consistent with our observation that suppressor alleles produce stable MHC proteins which interfere with myofibril function.
|
|
|
These three Mhc point mutations exhibit very different effects when tested in combination with the D mutations in a hdp2 background (Table III). D1 is lethal when over Mhc5, but viable over the other two Mhc alleles and the deficiency chromosome (Df(2)H20). In contrast, Mhc8 is lethal or poorly viable over D41, D45, or D62, but not over D1. The Mhc6 mutation has no effect on viability in combination with suppressor mutations or on their ability to suppress heldup wing phenotype, except for a reduction in suppression with the D45 allele.
Finally, we tested the troponin I allele specificity of heldup wing suppression by D-series mutations. We used hdp3 or hdp2/hdp3 as alternative backgrounds. The hdp3 point mutation causes abnormal RNA splicing, resulting in failure of a specific subset of troponin I isoforms to accumulate in the indirect flight muscles (Barbas et al., 1993). hdp3 mutants display a paucity of thin filaments and severely disrupted myofibrils (Beall and Fyrberg, 1991). We detected no suppression in hdp3 or hdp2/hdp3 backgrounds, indicating that D-series alleles suppress a specific molecular defect in hdp2 mutation.
Taken together, our genetic studies demonstrate that suppression of the heldup wing phenotype in the hdp2 point mutant can only result from specific modifications of MHC structure, as opposed to other perturbations in MHC structure or reductions in myosin concentration. Conversely, structural defects in DLMs caused by depletion of certain troponin I isoforms cannot be suppressed by these single amino acid changes in MHC.
| Discussion |
|---|
|
|
|---|
The role of the amino acid mutated in hdp2 may be inferred from recent structural and functional studies on this region of the protein in vertebrate troponin I. The hdp2 mutation affects the NH2-terminal
-helical portion of the protein shown to interact with troponin C (Farah et al., 1994; Tripet et al., 1997; Leszyk et al., 1998; Vassylyev et al., 1998). Rabbit skeletal muscle troponin I/troponin C cocrystal structure shows hydrophobic interactions between residue 25, which corresponds to the site of hdp2 mutation, and troponin C (Vassylyev et al., 1998). Although interaction between troponin I and troponin C appeared stable (Farah et al., 1994), the NH2-terminal fragment is now proposed to be released upon Ca2+ binding to troponin C (Tripet et al., 1997; Vassylyev et al., 1998). This release permits binding of an inhibitory domain of troponin I to troponin C, allowing the tropomyosin strand to move from its position blocking actin–myosin interaction. A reasonable model for hdp2 defect is that the mutation hastens release of the
helix at lower Ca2+ concentrations, resulting in more ready binding of troponin I's inhibitory domain to troponin C. Unregulated actin–myosin interaction would result. The hypercontracted sarcomeres and muscle degeneration observed are consistent with this model (Fig. 1), as is the requirement for thick filaments for the degenerative phenotype (Beall and Fyrberg, 1991).
The four suppressor alleles within the Mhc gene may identify specific molecular interactions between troponin I and myosin. Direct interaction between the troponin complex and the myosin head in insect flight muscle is structurally feasible, since antibody labeling of troponin complexes show they occur at some sites of rigor crossbridge attachment (Reedy et al., 1994). Myosin interaction may occur directly with the wild-type troponin I residue identified by the hdp2 mutation, perhaps aiding release of the surrounding
-helical region during Ca2+ binding by troponin C. This would facilitate actomyosin interactions, allowing the thin filament to progress to a fully active state. When poor regulation occurs in the hdp2 mutant, the suppressor mutation could prevent or alter myosin interaction with the troponin I molecule. This would decrease the mutant troponin I's ability to release from troponin C, allowing the blocking action of troponin I on actomyosin interaction to continue at low Ca2+ concentrations. More normal muscle structure and function would result. Thus, while the troponin I mutation could alter the equilibrium among the three states of the thin filament proposed by McKillop and Geeves (1993) and Vibert et al. (1997), this equilibrium could be reestablished through a compensating mutation in the myosin head. The observation by Lin et al. (1996), that troponin mutations can alter cycling of crossbridges, supports this possibility.
Direct interaction between mutated residues in troponin I and the myosin head is feasible for the residues identified by the D62 Mhc mutation. Biochemical (Mornet et al., 1981; Sutoh, 1982), structural (Rayment et al., 1993a,b), and chimeric molecule studies (Uyeda et al., 1994; Rovner et al., 1995) indicate that residues deleted from the actin binding loop of MHC in mutation D62 normally interact with the thin filament during the crossbridge cycle. For suppressor mutation D1, changes in orientation of the actin-binding loop could result from amino acid alteration at the loop's base. Instead of revealing a direct interaction between troponin I and MHC, D1 or D62 could affect crossbridge cycling and indirectly compensate for the troponin I mutation. The mechanism of action of these two suppressors may be similar. However, the synergistic effect of D1 when combined with the other D suppressors, and the peculiar effect of D1 in combination with other Mhc alleles (Table III), suggests that this suppressor elicits a different, albeit unknown, functional change.
Direct interaction between the MHC regions identified by the other two suppressor mutations (D41 and D45) and troponin I is not as obvious a possibility. However, it is important to realize that crystal structures of the myosin head represent static pictures of particular stages of the mechanochemical cycle. Thus, other contacts between thick and thin filaments are possible. A more likely explanation involves nucleotide exchange. Since both mutations are located near the nucleotide entry site of the molecule, it is reasonable to postulate that they would affect the ATPase cycle by regulating nucleotide entry or exit from the binding pocket (Murphy and Spudich, 1998; Sweeney et al., 1998). ADP release is the rate-limiting step in unloaded shortening of some muscles (Siemankowski et al., 1985). If suppressor mutations reduce the rate of ADP release, myosin's dissociation from actin, which occurs upon subsequent binding of ATP, would be inhibited. This could dampen the unregulated actomyosin interactions that appear to occur in the hdp2 mutant, since the ability of the myosin molecule to bind ATP and go through another step of the mechanochemical cycle would be reduced.
Another consideration for the mechanism of suppression is that myosin could act through a third protein to regulate troponin I. In this situation, troponin I would interact indirectly with myosin, through another protein or protein complex (such as tropomyosin or other components of the troponin complex). When troponin I has an abnormal interaction with this partner in the hdp2 mutant, the partner is unable to productively interact with myosin, unless a specific interacting site (the location of the suppressor mutation) is altered. Actin is an obvious possibility for such an intermediary protein, since it interacts with the troponin/tropomyosin complex, as well as with myosin.
A key result of our study is that specific residues on MHC are required for suppression, suggesting they are critical to thick–thin filament interactions. None of the other alleles of Mhc, including point mutations, suppress the heldup wing phenotype (Table III). This includes a mutation in the motor domain (Mhc5), a mutation in the lever arm (Mhc8), and a mutation in the rod (Mhc6). Interestingly, the genotype hdp2;Mhc5/+ results in a lethal interaction (Table III, and Homyk and Emerson, 1988). The location of this mutation close to the site of nucleotide entry/exit, and near D41 and D45 suppressors suggests that Mhc5 might affect the ATPase cycle in the reverse direction of suppressors, thereby exacerbating rather than ameliorating the hdp2 phenotypes. Support for this hypothesis is provided by the observation that lethality, but not heldup phenotype, of the hdp2;Mhc5/+ genotype is eliminated when either the D41, D45, or D62 suppressors replace the wild-type Mhc allele (Table III). D1 is an exception in rescuing lethality of the hdp2;Mhc5 combination. In contrast, MHC of the D1 type is compatible with Mhc8 for viability, but this is not so with D41, D45, or D62 (Table III). The opposite effects of D1 and other suppressor alleles strengthens our conclusion from suppressor heterozygote studies that D1 MHC acts to suppress the hdp2 phenotype by a different mechanism than other suppressors.
Our studies have implications for understanding disease processes in humans. In familial hypertrophic cardiomyopathy, single amino acid changes in a number of contractile proteins affect crossbridge cycling, resulting in myofibrillar disarray and hypertrophy (Towbin, 1998; Watkins et al., 1995). Mutations implicated in this disease include numerous defects in the myosin S1 domain (Rayment et al., 1995) and in troponin I (Kimura et al., 1997). Thus, mutations in both thick and thin filament components can have similar consequences upon human cardiac muscle structure and function. A confounding factor in understanding the basis of disease process, and predicting its severity, is that genetic background influences disease penetrance. Our observations in Drosophila indicate that mutations in other components of the contractile apparatus can either exacerbate or ameliorate muscle dysfunction, and could serve as a model for understanding influences of genetic background upon disease penetrance. Further, our findings suggest suppression of human diseases by a mutated version of a contractile protein might prove useful in developing therapeutic strategies.
Submitted: 12 November 1998
Revised: 29 January 1999
We appreciate the help of Dr. Ronald Milligan (The Scripps Research Institute) in preparation of Fig. 2. We thank Drs. Richard Cripps (University of New Mexico), Larry Tobacman (University of Iowa), and Douglas Swank (San Diego State University) for helpful comments on the manuscript.
| References |
|---|
|
|
|---|
al-Khayat HA, Yagi N & Squire JM. Structural changes in actin-tropomyosin during muscle regulation: computer modelling of low-angle X-ray diffraction data, J Mol Biol, 1995, 252, 611–632.[Medline]
Barbas JA, Galceran J, Torroja L, Prado A & Ferrús A. Abnormal muscle development in the heldup3 mutant of Drosophila melanogasteris caused by a splicing defect affecting selected troponin I isoforms, Mol Cell Biol, 1993, 13, 1433–1439.
Beall CJ & Fyrberg E. Muscle abnormalities in Drosophila melanogasterheldup mutants are caused by missing or aberrant troponin-I isoforms, J Cell Biol, 1991, 114, 941–951.
Bernstein SI & Milligan RA. Fine tuning a molecular motor: the location of alternative domains in the Drosophilamyosin head, J Mol Biol, 1997, 271, 1–6.[Medline]
Collier VL, Kronert WA, O'Donnell PT, Edwards KA & Bernstein SI. Alternative myosin hinge regions are utilized in a tissue-specific fashion that correlates with muscle contraction speed, Genes Dev, 1990, 4, 885–895.
Cripps RM, Becker KD, Mardahl M, Kronert WA, Hodges D & Bernstein SI. Transformation of Drosophila melanogasterwith the wild-type myosin heavy-chain gene: rescue of mutant phenotypes and analysis of defects caused by overexpression, J Cell Biol, 1994, 126, 689–699.
Dominguez R, Freyzon Y, Trybus KM & Cohen C. Crystal structure of a vertebrate smooth muscle myosin motor domain and its complex with the essential light chain: visualization of the pre-power stroke state, Cell, 1998, 94, 559–571.[Medline]
Drummond DR, Hennessey ES & Sparrow JC. Characterisation of missense mutations in the Act88F gene of Drosophila melanogaster. , Mol Gen Genet, 1991, 226, 70–80.[Medline]
Farah CS & Reinach FC. The troponin complex and regulation of muscle contraction, FASEB J, 1995, 9, 755–767.[Abstract]
Farah CS, Miyamoto CA, Ramos CH, da Silva AC, Quaggio RB, Fujimori K, Smillie LB & Reinach FC. Structural and regulatory functions of the NH2- and COOH-terminal regions of skeletal muscle troponin I, J Biol Chem, 1994, 269, 5230–5240.
Gengyo-Ando K & Kagawa H. Single charge change on the helical surface of the paramyosin rod dramatically disrupts thick filament assembly in Caenorhabditis elegans. , J Mol Biol, 1991, 219, 429–441.[Medline]
Greenwald IS & Horvitz HR. Dominant suppressors of a muscle mutant define an essential gene of Caenorhabditis elegans. , Genetics, 1982, 101, 211–225.
Hastings GA & Emerson CP Jr. Myosin functional domains encoded by alternative exons are expressed in specific thoracic muscles of Drosophila. , J Cell Biol, 1991, 114, 263–276.
Hess NK & Bernstein SI. Developmentally regulated alternative splicing of Drosophilamyosin heavy chain transcripts: in vivo analysis of an unusual 3' splice site, Dev Biol, 1991, 146, 339–344.[Medline]
Holmes KC. The swinging lever-arm hypothesis of muscle contraction, Curr Biol, 1997, 7, R112–R118.[Medline]
Homyk T Jr & Emerson CP Jr. Functional interactions between unlinked muscle genes within haploinsufficient regions of the Drosophilagenome, Genetics, 1988, 119, 105–121.
Jowett, T. 1986. Preparation of nucleic acids. In Drosophila, a Practical Approach. D.B. Roberts, editor. IRL Press, Oxford. 275–286.
Kimura A, Harada H, Park JE, Nishi H, Satoh M, Takahashi M, Hiroi S, Sasaoka T, Ohbuchi N, Nakamura T et al.. Mutations in the cardiac troponin I gene associated with hypertrophic cardiomyopathy, Nat Genet, 1997, 16, 379–382.[Medline]
Kronert WA, O'Donnell PT, Fieck A, Lawn A, Vigoreaux JO, Sparrow JC & Bernstein SI. Defects in the Drosophilamyosin rod permit sarcomere assembly but cause flight muscle degeneration, J Mol Biol, 1995, 249, 111–125.[Medline]
Laemmli UK. Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature, 1970, 227, 680–685.[Medline]
Leszyk J, Tao T, Nuwaysir LM & Gergely J. Identification of the photocrosslinking sites in troponin-I with 4-maleimidobenzophenone labelled mutant troponin-Cs having single cysteines at positions 158 and 21, J Muscle Res Cell Motil, 1998, 19, 479–490.[Medline]
Lin D, Bobkova A, Homsher E & Tobacman LS. Altered cardiac troponin T in vitro function in the presence of a mutation implicated in familial hypertrophic cardiomyopathy, J Clin Invest, 1996, 97, 2842–2848.[Medline]
Lindsley, D.L., and G. Zimm. 1992. The Genome of Drosophila melanogaster. Academic Press, San Diego. 1133 pp.
Mardahl M, Cripps RM, Rinehart RR, Bernstein SI & Harris GL. Introduction of y+ onto a CyOchromosome, Drosophila Inform Serv, 1993, 72, 141–142.
McKillop DF & Geeves MA. Regulation of the interaction between actin and myosin subfragment 1: evidence for three states of the thin filament, Biophys J, 1993, 65, 693–701.[Medline]
Metzger JM. Myosin binding-induced cooperative activation of the thin filament in cardiac myocytes and skeletal muscle fibers, Biophys J, 1995, 68, 1430–1442.[Medline]
Moerman DG, Plurad S, Waterston RH & Baillie DL. Mutations in the unc-54 myosin heavy chain gene of Caenorhabditis elegansthat alter contractility but not muscle structure, Cell, 1982, 29, 773–781.[Medline]
Mogami K, O'Donnell PT, Bernstein SI, Wright TR & Emerson CP Jr. Mutations of the Drosophilamyosin heavy-chain gene: effects on transcription, myosin accumulation, and muscle function, Proc Natl Acad Sci USA, 1986, 83, 1393–1397.
Mornet D, Bertrand R, Pantel P, Audemard E & Kassab R. Structure of the actin-myosin interface, Nature, 1981, 292, 301–306.[Medline]
Murphy CT & Spudich JA. Dictyostelium myosin 25–50K loop substitutions specifically affect ADP release rates, Biochemistry, 1998, 37, 6738–6744.[Medline]
O'Donnell PT & Bernstein SI. Molecular and ultrastructural defects in a Drosophilamyosin heavy chain mutant: differential effects on muscle function produced by similar thick filament abnormalities, J Cell Biol, 1988, 107, 2601–2612.
O'Donnell PT, Collier VL, Mogami K & Bernstein SI. Ultrastructural and molecular analyses of homozygous-viable Drosophila melanogastermuscle mutants indicate there is a complex pattern of myosin heavy-chain isoform distribution, Genes Dev, 1989, 3, 1233–1246.
Park EC & Horvitz HR. C. elegans unc-105mutations affect muscle and are suppressed by other mutations that affect muscle, Genetics, 1986, 113, 853–867.
Peckham M, Molloy JE, Sparrow JC & White DC. Physiological properties of the dorsal longitudinal flight muscle and the tergal depressor of the trochanter muscle of Drosophila melanogaster. , J Muscle Res Cell Motil, 1990, 11, 203–215.[Medline]
Prado A, Canal I, Barbas JA, Molloy J & Ferrús A. Functional recovery of troponin I in a Drosophilaheldup mutant after a second site mutation, Mol Biol Cell, 1995, 6, 1433–1441.[Abstract]
Rayment I, Holden HM, Whittaker M, Yohn CB, Lorenz M, Holmes KC & Milligan RA. Structure of the actin-myosin complex and its implications for muscle contraction, Science, 1993a, 261, 58–65.
Rayment I, Rypniewski WR, Schmidt-Base K, Smith R, Tomchick DR, Benning MM, Winkelmann DA, Wesenberg G & Holden HM. Three-dimensional structure of myosin subfragment-1: a molecular motor, Science, 1993b, 261, 50–58.
Rayment I, Holden HM, Sellers JR, Fananapazir L & Epstein ND. Structural interpretation of the mutations in the beta-cardiac myosin that have been implicated in familial hypertrophic cardiomyopathy, Proc Natl Acad Sci USA, 1995, 92, 3864–3868.
Reedy MC, Reedy MK, Leonard KR & Bullard B. Gold/Fab immuno electron microscopy localization of troponin H and troponin T in Lethocerusflight muscle, J Mol Biol, 1994, 239, 52–67.[Medline]
Rovner AS, Freyzon Y & Trybus KM. Chimeric substitutions of the actin-binding loop activate dephosphorylated but not phosphorylated smooth muscle heavy meromyosin, J Biol Chem, 1995, 270, 30260–30263.
Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular Cloning: a Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Siemankowski RF, Wiseman MO & White HD. ADP dissociation from actomyosin subfragment 1 is sufficiently slow to limit the unloaded shortening velocity in vertebrate muscle, Proc Natl Acad Sci USA, 1985, 82, 658–662.
Squire JM. Architecture and function in the muscle sarcomere, Curr Opin Struct Biol, 1997, 7, 247–257.[Medline]
Sutoh K. An actin-binding site on the 20K fragment of myosin subfragment 1, Biochemistry, 1982, 21, 4800–4804.[Medline]
Sweeney HL, Rosenfeld SS, Brown F, Faust L, Smith J, Xing J, Stein LA & Sellers JR. Kinetic tuning of myosin via a flexible loop adjacent to the nucleotide binding pocket, J Biol Chem, 1998, 273, 6262–6270.
Towbin JA. The role of cytoskeletal proteins in cardiomyopathies, Curr Opin Cell Biol, 1998, 10, 131–139.[Medline]
Tripet B, Van Eyk JE & Hodges RS. Mapping of a second actin-tropomyosin and a second troponin C binding site within the C terminus of troponin I, and their importance in the Ca2+-dependent regulation of muscle contraction, J Mol Biol, 1997, 271, 728–750.[Medline]
Uyeda TQ, Ruppel KM & Spudich JA. Enzymatic activities correlate with chimaeric substitutions at the actin-binding face of myosin, Nature, 1994, 368, 567–569.[Medline]
Van Eyk JE, Thomas LT, Tripet B, Wiesner RJ, Pearlstone JR, Farah CS, Reinach FC & Hodges RS. Distinct regions of troponin I regulate Ca2+-dependent activation and Ca2+sensitivity of the acto-S1-TM ATPase activity of the thin filament, J Biol Chem, 1997, 272, 10529–10537.
Vassylyev DG, Takeda S, Wakatsuki S, Maeda K & Maeda Y. Crystal structure of troponin C in complex with troponin I fragment at 2.3-Å resolution, Proc Natl Acad Sci USA, 1998, 95, 4847–4852.
Vibert P, Craig R & Lehman W. Steric-model for activation of muscle thin filaments, J Mol Biol, 1997, 266, 8–14.[Medline]
Watkins H, Seidman JG & Seidman CE. Familial hypertrophic cardiomyopathy: a genetic model of cardiac hypertrophy, Hum Mol Genet, 1995, 4, 1721–1727.[Abstract]
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|