|
||
Proteins Alter Lamina
Assembly, Envelope Formation, Nuclear Size, and DNA
Replication Efficiency in Xenopus laevis Extracts

* Department of Cell Biology and Anatomy, The Johns Hopkins University School of Medicine, Baltimore, Maryland 21205; and
R.W. Johnson Pharmaceutical Research Institute Drug Discovery, Raritan, New Jersey 08869
| |
Abstract |
|---|
|
|
|---|
Humans express three major splicing isoforms of LAP2, a lamin- and chromatin-binding nuclear
protein. LAP2
and
are integral membrane proteins,
whereas
is intranuclear. When truncated recombinant human LAP2
proteins were added to cell-free Xenopus laevis nuclear assembly reactions at high concentrations, a domain common to all LAP2 isoforms (residues
1-187) inhibited membrane binding to chromatin,
whereas the chromatin- and lamin-binding region (residues 1-408) inhibited chromatin expansion. At lower
concentrations of the common domain, membranes attached to chromatin with a unique scalloped morphology, but these nuclei neither accumulated lamins nor
replicated. At lower concentrations of the chromatin-
and lamin-binding region, nuclear envelopes and
lamins assembled, but nuclei failed to enlarge and replicated on average 2.5-fold better than controls. This enhancement was not due to rereplication, as shown by
density substitution experiments, suggesting the hypothesis that LAP2
is a downstream effector of lamina assembly in promoting replication competence.
Overall, our findings suggest that LAP2 proteins mediate membrane-chromatin attachment and lamina assembly, and may promote replication by influencing
chromatin structure.
| |
Introduction |
|---|
|
|
|---|
THE nuclear envelope generates a unique structural
and functional environment for chromosomes inside the nucleus. Molecules move through the nuclear envelope via nuclear pore complexes (NPCs)1 which
regulate nucleocytoplasmic transport while permitting the passive diffusion of small molecules (<40 kD) and ions
(reviewed by Ohno et al., 1998
). The inner nuclear membrane and NPCs are anchored to the lamina, which is a
polymeric network of nuclear-specific intermediate filament proteins named lamins (reviewed by Hutchison et
al., 1994
; Gant and Wilson, 1997
). There are two major
types of lamins, B type and A/C type, which are encoded
by different genes. B lamins remain membrane-associated
throughout the cell cycle, predominantly through their
association with lamin-binding membrane proteins (see
below), whereas lamins A/C become soluble and are
dispersed throughout the cytosol during mitosis. During interphase, B type lamins have also been detected immunologically inside the nucleus at sites of DNA replication
(Moir et al., 1994
). Biochemical studies suggest that the
tail domains of lamins can bind to DNA and core histones
(Burke, 1990
; Glass et al., 1993
; Taniura et al., 1995
; reviewed in Gant and Wilson, 1997
).
The lamina is a key structural element of the nucleus.
When nuclei are assembled in cell-free extracts immunodepleted of soluble lamins, the lamin-depleted nuclei
fail to undergo DNA replication (Newport et al., 1990
;
Meier et al., 1991
; Jenkins et al., 1993
), suggesting that
lamina assembly is linked to the assembly or function of
replication complexes. However, this link is likely to be
indirect. When nuclei are exposed to dominant negative
mutant lamin A proteins, DNA replication sites (Mills
et al., 1989
; Hozak et al., 1994
) become physically and
functionally disrupted (Spann et al., 1997
). However, dominant lamin B mutants have different effects: nuclei with a
preexisting lamina can remain replication-competent even when their lamina is gradually dissolved by the mutant
lamin B proteins (Ellis et al., 1997
). In both cases, the mutant lamins are thought to sequester depolymerized wild-type lamins and prevent them from recycling (Schmidt et
al., 1994
). It was not clear why DNA replication would depend, either initially or in an ongoing capacity, on the integrity of the lamina. Furthermore, lamin assembly may
not be essential. New results show that plasmid DNA can
be fully replicated in vitro if it is incubated first in Xenopus laevis cytosol and subsequently in concentrated nucleosol,
suggesting that high concentrations of factors inside the
nucleus, rather than nuclear structure per se, are essential
for replication competence (Walter et al., 1998
).
The inner nuclear membrane contains several unrelated
resident proteins that bind to lamins (reviewed by Gerace
and Foisner, 1994
; Gant and Wilson, 1997
), including the
lamin B receptor (LBR, also known as p58; Worman et
al., 1988
, 1990
), three isoforms of the lamina-associated
polypeptide-1 (LAP1; Martin et al., 1995
), and several isoforms of LAP2 (Foisner and Gerace, 1993
; Harris et al.,
1994
, 1995
; Berger et al., 1996
). Because LBR, the C isoform of LAP1, and
and
isoforms of LAP2 are phosphorylated during mitosis, these proteins are postulated to
play structural roles that must be modified for nuclei to
disassemble at mitosis (Simos and Georgatos, 1992
; Foisner and Gerace, 1993
; Ye and Worman, 1994
; Martin et
al., 1995
; Dechat et al., 1998
). LAP1, LAP2
, and LBR do
not appear to associate with each other. Instead, LBR and
LAP1 form separate complexes, each of which has a distinct protein kinase (Simos and Georgatos, 1992
; Nikolakaki et al., 1996
; Maison et al., 1997
). It is not known if
LAP2 proteins associate with a kinase. Two proteins related to LAP2, named emerin (Bione et al., 1994
; Manilal
et al., 1996
; Nagano et al., 1996
) and MAN (Paulin-Levasseur et al., 1996
; H. Worman, personal communication), also reside at the inner nuclear membrane. Loss of emerin
causes Emery-Dreifuss muscular dystrophy, a rare form of
muscular dystrophy in humans (see Bione et al., 1994
;
Gant and Wilson, 1997
), an effect which has not yet been
explained at the functional level.
LBR and LAP2 both bind to chromatin in vitro, and
therefore are both in a position to directly mediate chromosome attachment to the inner nuclear membrane. The
chromatin partner for LBR is Hp1, a chromodomain protein associated with repressive (transcriptionally silent)
chromatin structure (Ye and Worman, 1996
; Ye et al.,
1997
; reviewed by Lamond and Earnshaw, 1998
). Based
on immunoprecipitation and liposome reconstitution experiments, LBR appears to play a major role in targeting
membranes to chromatin (Pyrpasopoulou et al., 1996
). In
contrast, immunodepletion of LAP2 had little effect on
membrane targeting to chromatin in vitro (Pyrpasopoulou et al., 1996
).
We focused on the role of LAP2 in nuclear assembly,
structure, and function. LAP2, which was originally discovered, cloned, and characterized in rat, binds in vitro to
lamin B1, and to mitotic HeLa chromosomes with an affinity of 40-80 nM (Foisner and Gerace, 1993
; Furukawa et
al., 1995
). Cloning of human and mouse LAP2 cDNAs
showed that there are three major alternatively spliced isoforms, named LAP2
(75 kD),
(51 kD), and
(39 kD;
Fig. 1 a; Harris et al., 1994
, 1995
), and four minor isoforms
(Berger et al., 1996
). LAP2 is highly conserved among
mammals; for example, human LAP2
is 91% identical to
rat LAP2. All LAP2 isoforms share a common NH2-terminal domain, which is encoded by three exons in humans. Beyond this NH2-terminal region (residues 1-187),
LAP2
differs from all other LAP2 isoforms;
has no
transmembrane anchor, whereas LAP2
and
(and presumably most other
-related minor isoforms) are anchored to the inner nuclear membrane by a single predicted transmembrane span near the COOH terminus.
The
isoform is located inside the nucleus, where it associates tightly with intranuclear structures and cofractionates with the detergent-resistent lamina-matrix fraction
(Dechat et al., 1998
). The existence of both membrane-bound and soluble isoforms of LAP2 suggests that these
isoforms serve distinct functions. Proliferating cells consistently express LAP2
, whereas
and
(but not
) are expressed at high levels in nonproliferating cerebellar tissue
(Ishijima et al., 1996
). Expression of LAP2 isoforms is also
regulated during spermatogenesis; in mature rat sperm
the only detectable LAP2 isoform is
(Alsheimer et al.,
1998
). We have now cloned and sequenced three LAP2
cDNAs from a Xenopus oocyte library, demonstrating the
presence of multiple LAP2 isoforms in Xenopus eggs.
|
To investigate the function of LAP2, we tested the effect
of two recombinant polypeptides derived from human
LAP2
, on nuclear assembly in cell-free extracts of Xenopus eggs. Xenopus egg extracts are an efficient system for
assembling replication-competent nuclei in vitro (Wilson
and Wiese, 1996
). Xenopus extract components also interact efficiently with nuclear proteins from other species; for
example, Xenopus membranes readily incorporate into rat
liver nuclei, Xenopus extracts support nucleocytoplasmic
transport into all exogenous nuclei tested (e.g., Newmeyer
et al., 1986
), and Xenopus extracts can assemble nuclei
around isolated mitotically condensed mammalian chromosomes (e.g., Lawlis et al., 1996
). Our results, presented
here, show that human LAP2 fragments are functional in
the Xenopus extracts, and inhibit nuclear assembly in distinct ways. Our most unexpected finding was that LAP2
fragment 1-408 can influence the efficiency of DNA replication.
| |
Materials and Methods |
|---|
|
|
|---|
Reagents and Solutions
Membrane wash buffer (MWB) consisted of 250 mM sucrose, 50 mM KCl,
2.5 mM MgCl2, 50 mM Hepes, pH 8.0, 1 mM dithiothreitol, 0.5 mM ATP,
1 µg/ml aprotinin, and 1 µg/ml leupeptin. Sonication buffer consisted of
50 mM NaPO4, pH 8.0, and 300 mM NaCl. Protease inhibitors benzamidine (5 mM final concentration; Sigma Chemical Co.), PMSF (0.5 mM final concentration; Sigma Chemical Co.), and pepstatin A (1 µg/ml final
concentration; Sigma Chemical Co.) were included in the sonication
buffer during sonication, but were not added in subsequent steps. Stop
buffer consisted of 80 mM Tris-HCl, pH 8.0, 8 mM EDTA, 0.13% phosphoric acid, 10% Ficoll, 5% SDS, and 0.2% Bromophenol blue. TBS consisted of 100 mM Tris-HCl, pH 7.5, plus 0.9% (wt/vol) NaCl. WGA
(Sigma Chemical Co.) was kept frozen as a 10 mg/ml stock at
80°C.
Aphidicolin (Sigma Chemical Co.; catalog number A-0781) was kept as a
2.5 mg/ml stock in DMSO at
20°C.
In Vitro Nuclear Assembly Reactions and Import Assays
Membrane and cytosol fractions were prepared from unactivated Xenopus eggs as previously described (Newmeyer and Wilson, 1991
; Boman et al.,
1992
). Demembranated Xenopus sperm chromatin was also prepared as
previously described (Lohka and Masui, 1983
; Newmeyer and Wilson,
1991
). Chromatin, at a final concentration of ~40,000 sperm/µl, was
stored at
80°C. For nuclear assembly reactions, 2 µl membranes (~30 mg
protein/ml), 20 µl cytosol (~25-30 mg protein/ml, supplemented with 10 mM
phosphocreatine, 1 mM ATP, and 50 µg/ml creatine phosphokinase as an
ATP regenerating system), and 1 µl demembranated sperm chromatin
were mixed on ice and transferred to 22-24°C to initiate nuclear assembly.
All reactions were done using components that had been frozen and
thawed once. For reactions that contained recombinant LAP2 fragments,
1 µl of LAP2 protein (in MWB) was added to mixed cytosol and membranes to yield the indicated final concentration of LAP2 fragment. Chromatin was added, and reactions were mixed again and transferred to 22-
24°C to initiate assembly.
To assay for nuclear import, rhodamine-labeled nucleoplasmin was
prepared according to Newmeyer et al. (1986)
, and added to nuclei after
2 h of assembly in the presence or absence of LAP2 fragment 1-408. Nuclei were imaged by epifluorescence microscopy 30 min later (time = 2.5 h). As a negative control for import, WGA (final concentration, 1 mg/
ml) was added 5 min before adding fluorescent nucleoplasmin. WGA inhibits active transport by binding to O-GlcNAc-modified nucleoporins at
the NPC (see Finlay and Forbes, 1990
, and references therein).
Preparation of Recombinant LAP2 Proteins
Escherichia coli cells, strain BL21(DE3)pLysS (Novagen, Inc.), were
transformed with the pET-23a expression vector (Novagen, Inc.) containing inserts coding for either residues 1-408 or residues 1-187 of human
LAP2
, or residues 1-164 of Xenopus LAP2 (see below). We followed the
convention of numbering amino acids that excludes the initiating methionine, consistent with previous papers (Foisner and Gerace, 1993
; Harris et
al., 1994
). The pET-23a expression vector adds a His tag (Leu-Glu-His6)
to the COOH terminus of the expressed protein. Thus, LAP2
fragment
1-408 is a 417-amino acid, 46.49-kD protein, and LAP2 fragment 1-187
is a 196-amino acid, 21.716-kD protein. To produce each recombinant
protein, an overnight culture of a single colony was diluted 1:60 in fresh
media. Upon reaching an OD600 of ~0.6, protein expression was induced
with 0.4 mM isopropyl-
-D-thiogalactopyranoside (IPTG) for 3 h, and the
bacteria were pelleted by centrifugation (6,000 g for 15 min at 4°C). The
pellet was frozen in liquid N2 and stored at
80°C. To purify each recombinant protein, the pellet was resuspended in sonication buffer, subjected
to pulse sonification, and centrifuged (20,000 g for 20 min at 4°C). The supernatant was applied to a Ni-NTA-agarose column (Qiagen, Inc.), which
was washed successively with 10 column volumes each of sonication buffer
and sonication buffer plus 10 mM imidazole. Recombinant His-tagged
proteins were eluted with sonication buffer containing 100 mM imidazole.
The proteins were concentrated and desalted using Centricon-30 units (Amicon, Inc.). Small aliquots were frozen in liquid N2 and stored at
80°C; the thawed proteins were stable at 4°C for at least a week. Mock
purifications were done in parallel using uninduced bacteria to provide a
control for potential nonspecific effects due to either imidazole or bacterial proteins. However, in no case did the effect of mock-purified proteins
differ from that of buffer alone.
Light Microscopy and Photography
Aliquots of assembly reactions were fixed in MWB containing 3.7% formaldehyde, 20 µg/ml Hoechst 33342 (a DNA stain; Calbiochem Corp.). The samples were observed using a Nikon Microphot fluorescence microscope and photographed with Kodak Tri-X Pan 400 film. In some cases samples were imaged using a Photometrics SenSys cooled CCD camera, and images were processed and printed using IPLabSpectrum software.
Transmission Electron Microscopy
Samples for electron microscopy were fixed for 30 min on ice in 1.5% (vol/ vol) glutaraldehyde and 1% (vol/vol) paraformaldehyde in 0.1 M cacodylate buffer, pH 7.4. Samples were pelleted for 1 min in an Eppendorf centrifuge at 4°C, and the chromatin/nuclear pellet was rinsed in cacodylate buffer. Pellets were postfixed for 30 min at 4°C in 1% reduced osmium tetroxide, dehydrated, and embedded in Spurr's medium. Samples were sectioned (90-nm sections) and poststained in uranyl acetate followed by lead citrate. Electron micrographs of thin sections were taken on a TEM10 microscope (Carl Zeiss, Inc.) at 60 or 80 kV.
In Vitro Replication Assays
DNA replication was assayed by incorporation of
[32P]dCTP (see Powers et al., 1995
). In brief, 1 µl of
[32P]dCTP (Redivue, 3,000 Ci/mmol; Nycomed Amersham) was added to 24-µl nuclear assembly reactions (20 µl
cytosol, 2 µl membranes, 1 µl chromatin [stock concentration ~40,000/µl],
plus 1 µl buffer or recombinant LAP2
polypeptides). As a negative control, aphidicolin was added at a final concentration of 50 µM; this agent inhibits the activity of DNA polymerase
. Alternatively, independent negative control reactions were made 1 mM in GTP
S to inhibit nuclear
membrane formation (Boman et al., 1992
) and, indirectly, DNA replication. After 3 h, samples were combined with an equal volume of stop buffer, proteinase K (Boehringer Mannheim GmbH) was added to 1 mg/
ml final concentration, and samples were incubated at 37°C for 2 h. To detect incorporated
[32P]dCTP, the protease-digested samples were mixed
thoroughly by pipetting to ensure homogeneity, and 5-µl aliquots were
electrophoresed through 0.8% agarose gels. Note that all reactions contained equal numbers of nuclei, and samples were processed without pelleting steps that might cause loss of material. Gel loading was monitored by ethidium stain contained in the gel. Dried gels were exposed to x-ray
film, and signals quantitated with scanning densitometry using the Microcomputing Imaging Device (Imaging Research Inc.). In one experiment,
the signal was quantitated by both phosphorimaging and densitometry,
with the same results.
To measure the time course of replication, 10-µl aliquots were removed every 15 min from 200-µl reactions (190 µl crude extract, 10 µl chromatin, 5 µl [32P]dCTP, plus 6 µl of buffer or purified LAP2 fragment 1-408), digested with proteinase K, and the DNA was separated on agarose gels and quantitated by PhosphorImager as described above.
Bromodeoxyuridine (BrdU) Density Substitution
Density substitution experiments were done essentially as described by
Hua and Newport (1998)
, using both freshly prepared crude nuclear assembly extracts (10,000 g cytoplasmic fraction), and high speed fractionated, frozen, reconstituted extracts, with the same results. Nuclei were assembled for 90-120 min in the presence or absence of 3.3 µM fragment
1-408. Crude reactions contained 60 µl cytoplasm with 2,000 sperm per µl,
plus 0.5 mM BrdU (Sigma Chemical Co.), 0.5 mM MgCl2, and 0.2 µCi of
[32P]dCTP per µl of extract. Fractionated/reconstituted reactions contained 60 µl cytosol, 12 µl membranes, and a total of 100,000 sperm chromatin, plus 0.2 µCi/µl
[32P]dCTP and 0.5 mM BrdU. Reactions were
stopped by adding 1 ml ice cold buffer A (50 mM KCl, 50 mM Hepes-KOH, pH 7.4, 5 mM MgCl2, and 1 mM DTT), incubated on ice for 5 min,
centrifuged 5 min at 16,000 g in a microfuge, resuspended in 100 µl buffer
A, made 0.5% in SDS and 0.4 mg/ml in proteinase K, and digested for 2 h
at 37°C. DNA was then extracted three times with phenol-chloroform, once with chloroform, and ethanol precipitated using 0.3 M sodium acetate. Each ethanol pellet was resuspended in 100 µl TE, mixed with 12.7 ml
of 1.75 g/ml CsCl, loaded into a Beckman 16 × 76 mm Quick-Seal Tube,
and centrifuged 45 h at 30,000 rpm at 20°C in a Beckman Ti-70.1 rotor. 46-
50 fractions (250-300 µl each) were collected by needle puncture from the
bottom of each tube. To quantitate radioactivity, an aliquot of each fraction was counted by liquid scintillation (Beckman LS-7000). The refractive index of each fraction was measured using a refractometer (Bausch & Lomb Inc.), and converted to density using the equation: d (in units of
g/ml) = 0.99823 × d2020, where d2020is the specific gravity of solution at
20°C. Values for d2020for cesium chloride at each index of refraction (n)
are provided in the CRC Handbook (Weast, 1967
).
Immunoblotting
To detect lamin accumulation by immunoblotting, nuclei were assembled
for 3 h in the presence or absence of human LAP2
fragments, diluted
with 100 µl MWB, and then pelleted at top speed in an Eppifuge for 1 min
and washed with 200 µl MWB. The washed nuclear pellet was resuspended in SDS-sample buffer, subjected to SDS-PAGE (12% gel), and
proteins transferred to Immobilon PVDF membrane (Millipore Corp.).
The Immobilon was blocked with 5% dry milk in TBS 0.1% Tween-20
(TBS-Tw) for 30 min, rinsed briefly in TBS-Tw, and incubated overnight
at 4°C with either of two mAbs: antibody 46F7 (1:750 dilution in TBS-Tw;
a kind gift from Prof. Georg Krohne; Lourim and Krohne, 1993
), which is
specific for Xenopus lamin B3 (formerly known as lamin Liii), the major
lamin found in Xenopus eggs (Lourim et al., 1996
), or a monoclonal directed against human lamin B (Calbiochem; final concentration 100 µg/ml
in TBS-Tw). Blots were rinsed six times (5 min each) with TBS-Tw and
then incubated for 1 h at 22-24°C with HRP-conjugated anti-mouse secondary antibody in TBS-Tw (Nycomed Amersham). The blots were
washed again (six times for 5 min) and developed using enhanced chemiluminescence (ECL) reagents (Nycomed Amersham). Both antibodies
gave identical results, detecting a single band of ~70 kD that was present
in Xenopus cytosol and (much less abundantly) in Xenopus membrane fractions.
Indirect Immunofluorescence of In Vitro Assembled Nuclei
To visualize nuclear lamins by immunofluorescence, nuclei were assembled in the presence or absence of LAP2
fragments for 3 h. A 2.5-µl aliquot of each assembly reaction was placed on a slide and covered with the
siliconized side of an 18 mm square coverslip. The slide was plunged into
liquid N2 for 10 s. Subsequent steps were performed at 22-24°C. The coverslip was quickly peeled off, and the sample was fixed/dehydrated in
100% methanol for 1 h. The slide was then rehydrated by incubation for
5 min each in 70, 50, and 30% methanol, then in PBS. After washing twice in PBS/0.1% Triton, and blocking for 5 min in PBS/0.1% Triton/2% BSA,
the sample was incubated with 100 µg/ml mouse anti-human lamin B
mAb (Calbiochem-Novabiochem Corp.) in PBS/0.1% Triton/2% BSA for
1 h. After extensive washes with PBS/2% BSA, the sample was incubated
for 30 min with Texas red-conjugated goat anti-mouse antibody (Organon Teknika), washed twice with PBS/2% BSA, and incubated with the
DNA dye Hoechst 33342 for 5 min. After three more washes with PBS/
2% BSA, the sample was overlaid with 5 µl glycerol, covered with an 18 mm square coverslip, and viewed by phase-contrast and immunofluorescence on a Nikon Microphot fluorescent microscope.
Cloning Xenopus LAP2 Isoforms
A Xenopus stage VI oocyte cDNA library in the UniZap vector (Stratagene Cloning Systems) was screened using full-length human LAP2
DNA as a probe. The probe was radiolabeled with
[32P]dCTP using the
Multiprime DNA labeling system (Nycomed Amersham). The Xenopus
cDNA library was a kind gift from D. Patterton and A. Wolffe (National
Institutes of Health, Bethesda, MD). For the primary screen of 106
plaques, we used moderate stringency hybridization (30% formamide, 5×
SSC, 42°C; washes in 2× SSC, 42°C), and obtained ~300 positives. 20 strong
positives were rescreened, and 12 remained positive. Single positive
plaques from the tertiary screen were picked and converted to phagemids
according to the manufacturer's protocol. Insert DNA was analyzed using
restriction enzymes, revealing four distinct DNA inserts, which were sequenced. Sequences were aligned using ClustalW Multiple Sequence
Align (http://dot.imgen.bcm.tmc.edu:9331/multi-align/Options/clustalw. html) and BOXSHADE (http://ulrec3.unil.ch/software/BOX_form.html) software; DNA sequence information was further analyzed using DNA
Strider. Clone 1 was a variant of clone 2, with several frameshifting point
mutations, and was not studied further. GenBank accession numbers for
Xenopus LAP2 clones are: clone 2 (AF048815), clone 3 (AF048816), and
clone 4 (AF048817).
To construct Xenopus LAP2
fragment 1-164, a 5' primer was designed to code for an Nde1 site followed by the first five amino acids
5'(GGGCATATGCCCGAGTTTCTG)3', and a 3' primer designed to encode the six terminal amino acids followed by an Xho1 site 5'(CCCCTCGAGTTCTTTATCACTGTAATG)3'. These primers were used in a
PCR reaction to obtain a 510-bp fragment using clone 2 as template. This
PCR product was digested with Nde1 and Xho1 (Life Technologies, Inc.;
GIBCO BRL) and ligated into corresponding sites in pET23a (Novagen,
Inc.). In this case, the vector is predicted to express Xenopus LAP2
amino acids 1-164 followed by the six-His tag (173 amino acids; predicted
mass of 19,749 D). The Xenopus fragment was expressed and purified as described above for the human LAP2 fragments.
| |
Results |
|---|
|
|
|---|
LAP2
Fragment 1-408 Inhibits Nuclear Envelope
Expansion; Fragment 1-187 Inhibits Enclosure
To explore LAP2
function, we purified two His-tagged
recombinant polypeptides derived from human LAP2
(Fig. 1 b). Fragment 1-408 (~46.5 kD) included the entire
nucleoplasmic portion of LAP2
, and is predicted to have
both lamin-binding and chromatin-binding properties (Furukawa et al. 1998
). Fragment 1-187 (~21.7 kD) corresponds to the three conserved NH2-terminal exons present
in all LAP2 isoforms and includes residues 1-85, which are
sufficient for binding to chromatin (Furukawa et al., 1998
).
We used fragment 1-187 for two reasons. First, conserved
exons frequently code for conserved structural domains
within a protein, and second, fragment 1-187 was expected
to compete with all endogenous LAP2 isoforms for binding to partners other than lamins.
To determine its effects on nuclear assembly, fragment 1-408 was purified (Fig. 1 b) and added to Xenopus nuclear assembly reactions at concentrations ranging from 0.16 to 54 µM (Fig. 2 a). Fragment 1-408 had no detectable effect on vesicle binding, envelope enclosure, or nuclear import (see below), but inhibited envelope growth at concentrations as low as 1-3 µM (Fig. 2 a). The nuclei became enclosed by an intact nuclear envelope at the same time as control nuclei (~30 min) but did not increase in size for at least 4.5 h. The final size of the arrested nuclei correlated inversely with the amount of fragment 1-408 in the reaction: at higher concentrations, the nuclei were smaller. At concentrations of 1.5-3 µM, fragment 1-408 reproducibly inhibited nuclear growth in all assembly extracts tested (three independent preparations), and virtually all nuclei were similar to those seen in Fig. 2 a. Inhibition was not due to residual imidizole, since control nuclei, which were assembled with proteins purified from uninduced bacteria, assembled and grew normally (Fig. 2 a, control).
|
Nuclei Growth-arrested by Fragment 1-408 Are Active for Nuclear Import
Three lines of evidence showed that nuclei growth-arrested
by fragment 1-408 were not defective for nuclear import.
First, they contained prenucleolar coiled bodies (Fig. 2 a),
the formation of which is dependent on nuclear import
(Bell et al., 1992
; Bauer et al., 1994
). Second, they were active for DNA replication (see below), which also requires
nuclear import. Third, we directly tested for import activity
by first assembling nuclei for 2 h in the presence or absence of fragment 1-408, then adding a fluorescent karyophilic protein (rhodamine-conjugated nucleoplasmin), and imaging 30 min later. Nucleoplasmin accumulated at the
nuclear rim and interior of the positive controls, and
1-408-arrested nuclei (Fig. 2 b, left and middle). Negative control nuclei, pretreated with the transport inhibitor
WGA for 5 min before adding the nucleoplasmin, failed to
accumulate the transport substrate (Fig. 2 b, right). Because fragment 1-408 had no detectable effect on nuclear
import in three independent assays, we concluded that the
nuclear expansion defect was probably a direct effect of
fragment 1-408 on other nuclear structures or pathways.
Inhibition by LAP2 Fragment 1-187: Scalloped, Nonenclosed Nuclear Envelopes
Nuclei assembled for 3 h in the presence of purified fragment 1-187 appeared very different from 1-408-arrested
nuclei, as seen by comparing Fig. 2 a (panel labeled 3.1 µM)
with Fig. 3 a (upper right). Nuclei inhibited by fragment
1-187 remained small, and did not acquire a typical enclosed nuclear envelope. These effects were titratable over
the low micromolar range. Nuclei assembled in the presence of 2-3 µM fragment 1-187 were smaller than positive
controls. At 5-10 µM, the nuclear membranes consistently had an unusual scalloped morphology: some regions
seemed flattened against the chromatin, whereas other regions appeared as oversized, unflattened vesicles. This
scalloped appearance did not change for
5 h. The effects
of fragment 1-187 were reproduced in three independent
extracts. At a higher concentration (30 µM), fragment 1-187 delayed the attachment of membranes to chromatin
(Fig. 3 b): after 1-2 h of assembly, only a few patches of
nuclear envelope were flattened onto chromatin. However, by 3 h the nuclear membranes had assembled enough
to appear scalloped, like those assembled in lower concentrations (5-10 µM) of 1-187. These results showed that the
putative chromatin-binding fragment of LAP2 inhibited membrane attachment to chromatin at a concentration of
30 µM. However, at lower concentrations the NH2-terminal fragment had quite different effects, interfering with
both the enclosure and morphology of the nuclear envelope.
|
Ultrastructure of Arrested Nuclei
To study their morphology in greater detail, nuclei were
examined by transmission electron microscopy (TEM; Fig.
4). As expected, control nuclei were enclosed by two nuclear membranes and studded with NPCs (Fig. 4 a; inset
arrows point to NPCs). Nuclei inhibited by fragment 1-408
had an enclosed nuclear envelope (Fig. 4 b), confirming
our phase-contrast observations (Fig. 2 a). Although the
particular cross-sections shown in Fig. 4, a and b, are similar in size, the magnifications are different, and 1-408-inhibited nuclei were much smaller than control nuclei
(Fig. 2). TEM further revealed that 1-408-inhibited nuclei
had numerous NPC-containing invaginations of the inner
nuclear membrane (Fig. 4 b; arrows). These invaginations
were morphologically distinct from the nuclear tunnels described by Fricker et al. (1997)
in which the entire envelope invaginates to form tubules extending into the nuclear interior. Nuclei inhibited by 1.5-3 µM fragment 1-408
also appeared to have a higher density of NPCs than control nuclei, consistent with ongoing NPC assembly into
growth-arrested nuclei.
|
TEM of nuclei assembled in the presence of 5 or 10 µM fragment 1-187 revealed that the chromatin was covered, but not enclosed, by nuclear membranes that contained NPCs (Fig. 4, c and d; two nuclei assembled in 10 µM 1-187 are shown). The envelope patches were concave relative to the chromatin, in contrast to the rounded convex shapes of control nuclei (Fig. 4 a) and nuclei inhibited by fragment 1-408 (Fig. 4 b). We did not detect huge vesicles by TEM that might have corresponded to those seen by phase-contrast microscopy; we speculate that either these structures break during sample preparation, or that deeply concave sections of envelope might give the illusion of vesicles by light microscopy. The 1-187-arrested nuclei were similar to 1-408-arrested nuclei in two ways. First, they both had more NPCs than control nuclei, demonstrating that these LAP2 fragments do not interfere with NPC assembly. Second, they both had invaginations of the inner membrane into the nucleus, which might represent a problem in remodeling (or disconnecting) membrane-chromatin attachments (see Discussion).
Our morphological results and import assays suggested
that LAP2 proteins help shape the structural interface between the nuclear membranes and chromatin. We were
particularly intrigued by the structural effects of fragment
1-187, which generated concave scallop-shaped envelopes.
To our knowledge this phenotype is novel; for example,
lamin-depleted nuclei are enclosed and round (Newport et al., 1990
).
Lamins Accumulate in 1-408-arrested Nuclei, but Not 1-187-arrested Nuclei
To ask if LAP2 fragments affected lamina assembly, we
assayed the inhibited nuclei for lamin accumulation (Fig. 5
a). Nuclei were assembled for 3 h in reactions supplemented with either buffer, 3 µM fragment 1-408, or 5 µM
fragment 1-187. Nuclei were then pelleted, subjected to
SDS-PAGE, and immunoblotted with mAb 46F7, which is
specific for lamin B3, the major lamin found in Xenopus eggs (Lourim and Khrone, 1993; Lourim et al., 1996
) (Fig.
5 a). Identical results were obtained using an mAb raised
against human lamin B (data not shown). Nuclei inhibited
by fragment 1-408, but not those inhibited by fragment
1-187, accumulated lamins over time as shown by immunoblotting of pelleted nuclei (3-h time points shown; Fig. 5
a). The lamin signal in 1-408-inhibited nuclei was sometimes slightly stronger than in control nuclei (two of five
experiments), perhaps reflecting the presence of additional lamin-binding proteins (i.e., fragment 1-408) in
these nuclei. These lamin results were consistent with the
structural results, since 1-408-inhibited nuclei were enclosed and active for nuclear protein import, and 1-187-inhibited nuclei were not enclosed and did not accumulate
imported proteins such as lamins.
|
We also used indirect immunofluorescence to detect lamins in inhibited nuclei (Fig. 5 b). Consistent with the lamin blots, lamins were not detected by indirect immunofluorescence in 1-187-inhibited nuclei. Lamins were detected both in control nuclei and nuclei inhibited by fragment 1-408, in close association with the nuclear envelope (Fig. 5 b). However, because the 1-408-inhibited nuclei were small, and the immunofluorescent signal quite bright (see Fig. 5 b), we could not determine unambiguously whether lamins were associated exclusively with the envelope, or if they might have also accumulated at inappropriate sites inside the nucleus.
Fragment 1-187 Blocks Lamina Assembly
As a negative control for the DNA replication experiments described below, we used GTP
S to inhibit vesicle
fusion (Boman et al., 1992
; Newport and Dunphy, 1992
).
No replication was observed in GTP
S-treated reactions,
as expected, since these nuclei consist of small vesicles
bound to the chromatin surface. However, the GTP
S-arrested nuclei accumulated a low level of lamins (Fig. 6 b;
see also Wiese et al., 1997
), suggesting that some interactions involving lamins may have proceeded to a limited extent even though vesicle fusion was inhibited by GTP
S.
The modest accumulation of lamins on GTP
S-arrested
nuclei contrasted significantly with 1-187-inhibited nuclei,
which had only background amounts of lamins (compare
to membranes alone; Fig. 5 a). We concluded that fragment 1-187 blocks lamin recruitment or attachment to the
membrane-chromatin interface. Because there is strong
evidence that the NH2-terminal region of LAP2 binds to
chromatin (Furukawa et al., 1998
), we further concluded
that fragment 1-187 binds competitively to, and blocks,
the chromatin partners for endogenous LAP2 proteins. These findings therefore suggest that endogenous LAP2
isoforms must engage their chromatin partner as a prerequisite for lamina assembly.
|
DNA Replication Assays
DNA replication normally occurs in in vitro assembled nuclei if the lamina is properly assembled (Blow and Watson,
1987
; Newport et al., 1990
; Leno and Laskey, 1991
; Cox,
1992
). Therefore, replication is used as a marker for the
assembly of a structurally intact nucleus. Since nuclei inhibited by fragment 1-187 did not accumulate lamins, we
predicted that these nuclei would be unable to replicate. We did not know what to expect with 1-408-inhibited nuclei, which accumulated lamins. Fragment 1-408 is predicted to bind lamins (Foisner and Gerace, 1993
; Furukawa et al., 1998
), and might somehow disrupt lamina
assembly, and hence, secondarily disrupt replication.
To test DNA replication, nuclei were assembled in the
presence of [32P]dCTP for 3 h, with or without added
LAP2 fragments, and the DNA was analyzed by agarose
gel electrophoresis and autoradiography (Fig. 6 a). Aliquots were processed in parallel for Western blotting with
an anti-lamin antibody (Fig. 6 b), and a representative nucleus from each sample is shown by phase-contrast (Fig. 6
c). No replication activity was detected in 1-187-arrested
nuclei (Fig. 6 a), as predicted from their lack of enclosure.
However, nuclei assembled in the presence of 3 µM fragment 1-408 consistently replicated at levels as high (three
experiments) or higher (eight experiments) than control
nuclei (Fig. 6 a). In the experiment shown, 1-408-inhibited nuclei also accumulated lamins at higher levels than controls (Fig. 6 b). The increased replication signal in 1-408-inhibited nuclei was not due to unequal loading (ethidium
stain of DNA; Fig. 6 a, lower panels). No replication was
detected in negative controls treated with GTP
S to prevent envelope formation (Boman et al., 1992
; Newport and
Dunphy, 1992
), or in the presence of 50 µg/ml aphidicolin
(Fig. 7), a specific inhibitor of DNA polymerase
(Ikegami et al., 1978
). Note the modest degree of enhancement by fragment 1-408 in Fig. 7, an example of the low end of
experimental variation in the extent of enhancement.
We concluded that although the LAP2 fragment 1-408
blocked the expansion of nascent nuclei in vitro, it unexpectedly enhanced DNA replication activity. Based on
densitometry quantitation of eight experiments, nuclei arrested by fragment 1-408 replicated an average of 2.5-fold
better than controls.
|
Enhanced [32P]dCTP Incorporation Is Not Due to Rereplication
We considered two different mechanisms for the increase
in [32P]dCTP incorporation: fragment 1-408 might cause
rereplication, which would represent a loss of cell cycle
control, or it might enhance semiconservative DNA replication, the efficiency of which can vary from 30 to 100% in
Xenopus egg extracts (Leno and Laskey, 1991
).
The first possibility, rereplication, was tested by equilibrium density substitution in the presence of a dense nucleotide derivative, BrdU (Fig. 8 a). These reactions also contained [32P]dCTP, which allowed us to detect replicated strands, and quantitate the extent of replication (see Materials and Methods). The positive control (no LAP2 fragment) was expected to undergo a single round of semiconservative replication to yield DNA with one light strand and one heavy strand, which would migrate as a single peak in a CsCl gradient. If the enhanced replication were due to rereplication, we would detect a second peak of heavy-heavy DNA at a higher density, and we would not expect the heavy-light DNA from LAP2-treated nuclei to have significantly more radioactivity than the positive control. The experiment was done using both fractionated/reconstituted extract (data not shown) and fresh 10,000 g crude cytoplasm (Fig. 8 a). We found that LAP2-arrested nuclei yielded a single peak of radiolabeled DNA that comigrated at exactly the same refractive index, and hence, density, as the positive control, indicating a single round of semiconservative DNA replication. Furthermore, the peak of incorporated nucleotide was at least fourfold higher than the positive control, consistent with fragment 1-408 enhancing the efficiency of semiconservative replication. These results effectively ruled out the possibility that LAP2 fragment 1-408 causes rereplication.
|
To examine the time course of replication in LAP2-arrested nuclei, nuclei were assembled in reactions containing
[32P]dCTP in the presence or absence of fragment
1-408; aliquots were removed from each reaction every 15 min, and the incorporated radiolabel was quantitated (Fig.
8 b; see Materials and Methods). The time course of replication was initially indistinguishable between LAP2-arrested nuclei and positive controls: there was a lag phase
of 45 min, followed by DNA synthesis. The only difference was that
[32P]dCTP incorporation into LAP2-arrested
nuclei continued at the same rate for
15 min longer than
positive controls, reaching a plateau that was, in this case,
~1.8-fold higher than the positive control (Fig. 8 b).
The replication results collectively led us to two conclusions. First, the majority of our extracts, which were made from unactivated eggs, were not 100% efficient for replication. Based on the amount of replication enhancement seen in these experiments, which ranged from 0 to ~4-fold (average, 2.5-fold), we estimated that the efficiency of replication in our extracts varied from 20% to 100%. Second, in extracts that were <100% efficient for replication, LAP2 fragment 1-408 increased the efficiency of semiconservative DNA replication, when present at low (2-4 µM) concentrations. Possible mechanisms for the enhancement of replication efficiency by LAP2 are considered in the Discussion.
Xenopus Oocytes Express LAP2 cDNAs Closely
Related to Mammalian LAP2
Given the effects of human LAP2 fragments in Xenopus
nuclear assembly extracts, it was essential to determine if
Xenopus LAP2 had the same structural effect on nuclear
assembly. To do this, and compare the Xenopus and human LAP2 proteins, we screened a stage VI Xenopus oocyte cDNA library using radiolabeled full-length human
LAP2
as a probe (see Materials and Methods). We rescreened 20 of nearly 300 positives, and identified three
cDNAs coding for Xenopus LAP2
homologues, which
were designated clones 2, 3, and 4 (see Fig. 9 a, and Materials and Methods).
|
The three Xenopus LAP2 proteins are compared schematically to human LAP2
in Fig. 9 a. Clone 2 was the
longest Xenopus LAP2 cDNA, encoding a protein of predicted mass 62.841 kD. Except for a single-base deletion at
nucleotide 1119 in clone 3, which is either a mutation or
the result of an alternative splicing event (see below), the
three Xenopus cDNAs were identical at the nucleotide level except for two regions: nucleotides 595-705 and
1068-1278 in clone 2. These two regions encoded polypeptide inserts that we named insert A (37 residues, 198-234),
insert B (17 residues, 357-373), and insert C (53 residues,
374-426), as diagrammed in Fig. 9 a. Clone 2 had all three
inserts, whereas clone 3 lacked insert C, and clone 4 lacked
insert A, suggesting that inserts A and C were alternatively spliced exons. Although insert B was present in all
three Xenopus cDNAs, it was absent from human LAP2 and is therefore either a new exon, or a nonhomologous
extension of the neighboring exon. All three putative new
exons were located at exon boundaries in the mouse genomic sequence (Berger et al., 1996
): insert A between
mouse exons 5 and 6, and inserts B and C between mouse
exons 8 and 9. We concluded that inserts A and C (and
probably B) represent bona fide LAP2 exons in Xenopus. Exons homologous to inserts A, B, and C have not yet
been reported in mammals. Overall, these results suggested that Xenopus clones 2, 3, and 4 were splicing variants related to mammalian LAP2
. Notably, clone 3 encoded a putative
-related isoform that lacks a transmembrane domain, similar to the
(zeta) isoform in mice (Berger et al., 1996
).
Three regions were broadly similar between Xenopus
and human LAP2
proteins: an NH2-terminal region
(gray and white boxes in Fig. 9 a), a middle region (diagonal bars), and a COOH-terminal region (horizontal
stripes). The protein encoded by clone 2 is compared
with human LAP2
in detail in Fig. 9 b. The NH2-terminal region of clone 2 (residues 1-197) was 70% identical
and 80% similar to the same region in human LAP2 (residues 1-220). The middle region was less conserved:
residues 234-352 of clone 2 were 39% identical and
53% similar to human LAP2
residues 220-325. At the
COOH-terminal region, Xenopus residues 427-556 were
63% identical and 74% similar to human LAP2
residues
330-453. We concluded that the middle region of LAP2
is the least conserved between species, in contrast to the
more-conserved NH2-terminal and COOH-terminal domains.
Xenopus LAP2 Fragment 1-164 Inhibits Nuclear Growth
To assess the effects of Xenopus LAP2 on nuclear assembly, we focussed on the NH2-terminal domain. We expressed and purified the Xenopus LAP2 fragment consisting of residues 1-164, which are homologous to human fragment 1-187, and added it to Xenopus nuclear assembly reactions at concentrations ranging from 1 to 10 µM (Fig. 10). The Xenopus LAP2 fragment had structural effects identical to those of human LAP2 fragment 1-187, producing scalloped, nonenclosed envelopes at concentrations of 1, 2.5, and 5 µM (Fig. 10). At 10 µM, fragment 1-164 interfered with membrane targeting to the chromatin surface (Fig. 10), paralleling the effects of human fragment 1-187 at 30 µM (Fig. 3 b). We noted that Xenopus fragment 1-164 was inhibitory at concentrations two to five times lower than the comparable human fragment. We concluded that the human and Xenopus NH2-terminal fragments of LAP2 had the same effects on nuclear assembly in vitro. These results strongly suggested that the human polypeptides interacted with bona fide LAP2 binding partners in Xenopus extracts, with slightly lower efficiency, presumably due to species-specific differences in amino acid sequence. We concluded that the human LAP2 fragments used in our experiments affected nuclear assembly and DNA replication by competing for the binding partners of endogenous LAP2 proteins.
|
| |
Discussion |
|---|
|
|
|---|
Consistent with previous results from microinjected HeLa
cells (Yang et al., 1997
), our in vitro results show that a
LAP2
fragment capable of binding to lamins has the effect of blocking nuclear expansion after enclosure. This
finding confirms the importance of LAP2
and lamins in
mediating nuclear growth. We further show that nuclei
growth-arrested by the chromatin-and-lamin-binding nucleoplasmic domain of LAP2
(residues 1-408) were enhanced in their efficiency of semi-conservative DNA replication; this result has important new implications for
LAP2 function, as discussed below. In contrast to Yang et al.
(1997)
, who found that residues 1-85 of the conserved
NH2-terminal domain had no effect in vivo, the complete
NH2-terminal chromatin-binding domain of both human and Xenopus LAP2 strongly inhibited nuclear assembly,
producing a scalloped envelope morphology and blocking
lamina assembly. The implications of this phenotype are
discussed below.
Is Chromatin Binding by LAP2 Proteins a Prerequisite for Lamin Assembly?
Several studies suggest that the LAP2 isoforms are collectively responsible for dynamically organizing the lamina: the biochemical demonstration that rat LAP2
binds
lamin B (Foisner and Gerace, 1993
), the sequential colocalization of LAP2
with lamin B and lamin A during nuclear assembly in vivo (Dechat et al., 1998
), the in vivo and
in vitro nuclear growth arrest by lamin-binding fragments
of LAP2
(Yang et al., 1997
; this study), and the block to
lamin accumulation caused by the NH2-terminal chromatin-binding domain of LAP2 (human residues 1-187; this
study). The finding, that nuclei arrested by fragment 1-187
did not accumulate lamins, was unexpected since this
shared domain of LAP2 binds to chromatin, not lamins.
We suggest that when the recombinant chromatin-binding domain of LAP2 is added to assembly reactions, it occupies chromatin sites and prevents endogenous LAP2 proteins from attaching to chromatin. To explain how fragment 1-187 then prevents lamin assembly, we propose that
the endogenous LAP2 proteins need to bind to chromatin as a prerequisite for binding to lamins and promoting
lamin assembly.
We characterized three cDNAs from Xenopus, which
appear to be new
-related isoforms of LAP2. These
cDNAs include three putative novel exons, referred to as
inserts A, B, and C. Insert A is positioned immediately after the conserved NH2-terminal domain. Inserts B and C
interrupt the minimal lamin-binding region of LAP2
(identified as residues 298-373 in rat LAP2
; see Yang et
al., 1997
). Interestingly, the minimal lamin-binding region
is not encoded by a single exon, but spans exons 8 and 9 (mice; Berger et al., 1996
). Xenopus inserts B and C are located precisely between mice exons 8 and 9, inserting 17 and 53 residues, respectively, into the middle of the lamin-binding region. Lamin-binding activity is influenced by the
COOH-terminal region of LAP2, since residues 298-452
of rat LAP2
bind to lamins fivefold better than minimal
residues 298-373 in a yeast two-hybrid assay (Furukawa et
al., 1998
). In view of our hypothesis that LAP2 chromatin-binding activity may regulate or promote lamin recruitment, it will be interesting to determine the lamin-binding and other activities of Xenopus LAP2 isoforms that have,
or lack, each new exon.
LAP2 Proteins May Influence Chromatin Structure
One explanation for why fragment 1-408 (the chromatin-and-lamin-binding fragment) arrests the expansion of nascent nuclei is that it may contribute to the formation of
excess or unregulated connections between lamins, membranes, and chromatin. This possibility is supported by the
extensive invagination of the inner membrane seen in nuclei arrested by fragment 1-408. However an alternative possibility, that this chromatin-and-lamin-binding LAP2
fragment inhibits chromatin decondensation, is supported
by our finding that high concentrations (54 µM) of fragment 1-408 caused the sperm chromatin to remain smaller
than the size expected of chromatin swelled by exposure
to egg cytosol (Fig. 2 a; see Newport and Dunphy, 1992
).
The association of LAP2 with chromatin is relatively strong, since immunoaffinity-purified LAP2
binds saturably to mitotic chromosomes with an affinity of 40-80 nM
(Foisner and Gerace, 1993
). We hypothesize that at high
concentrations, recombinant LAP2
may either block
chromatin decondensation, or promote condensation.
Interestingly, a chromatin binding partner for LAP2 has
been provisionally identified by two-hybrid analysis in
yeast as BAF (barrier to autointegration factor; Furukawa,
1999
). BAF localizes to the nucleus during interphase, and
to chromosomes during mitosis (Furukawa, 1999
). BAF is
a small novel cellular protein (89 residues) that was identified because it facilitates the efficient integration of HIV
DNA into the cell's genome (Chen and Engelman, 1998
;
Lee and Craigie, 1998
); in the absence of BAF, the viral
DNA molecule tends to integrate intramolecularly into itself. Lee and Craigie (1998)
propose that BAF acts by
crossbridging and thereby compacting the viral DNA molecule. The normal cellular role of BAF is not known. If
further experiments confirm that BAF and LAP2 are indeed binding partners, it will be interesting to test the idea
that LAP2 influences chromatin structure by affecting
BAF activity.
Concentration-dependent Effects of LAP2 Fragment 1-408 on DNA Replication
The minimal lamin-binding region of LAP2
(rat residues
298-373) inhibits the initiation, but not the progression, of
DNA replication in vivo (Yang et al., 1997
). Consistent
with this, the full nucleoplasmic region of human LAP2
(fragment 1-408) also inhibited DNA replication at concentrations above 6 µM (data not shown). However at
lower concentrations (1-3 µM), which reproducibly inhibited nuclear expansion, fragment 1-408 enhanced DNA
replication activity by an average of 2.5-fold in ~80% of
our experiments. Thus, by varying the concentration of recombinant protein in the reaction, we uncovered a positive
role for LAP2
in replication.
Based on density-substitution experiments, we eliminated the possibility that increased nucleotide incorporation was due to rereplication. A second possibility, that
fragment 1-408 triggers extreme levels of repair synthesis,
seems unlikely, but cannot be ruled out by our present
data. Our results favor a third possibility, that LAP2
fragment 1-408 increases the efficiency of semiconservative DNA replication. This increased efficiency could be
an indirect effect of LAP2 on nuclear size, since the small
arrested nuclei may achieve higher concentrations of imported replication factors. For example, chromatin can
replicate efficiently in the absence of nuclei in vitro, by sequential exposure to cytosolic extracts and 25-fold concentrated nucle