|
||



* Freie Universität Berlin, Institut für Biochemie, 12203 Berlin, Germany; and
Ruhr-Universität Bochum, Institut für
Physiologische Chemie, 44780 Bochum, Germany
| |
Abstract |
|---|
|
|
|---|
Pex13p is the putative docking protein for peroxisomal targeting signal 1 (PTS1)-dependent protein import into peroxisomes. Pex14p interacts with both the PTS1- and PTS2-receptor and may represent the point of convergence of the PTS1- and PTS2-dependent protein import pathways. We report the involvement of Pex13p in peroxisomal import of PTS2-containing proteins. Like Pex14p, Pex13p not only interacts with the PTS1-receptor Pex5p, but also with the PTS2-receptor Pex7p; however, this association may be direct or indirect. In support of distinct peroxisomal binding sites for Pex7p, the Pex7p/Pex13p and Pex7p/ Pex14p complexes can form independently. Genetic evidence for the interaction of Pex7p and Pex13p is provided by the observation that overexpression of Pex13p suppresses a loss of function mutant of Pex7p. Accordingly, we conclude that Pex7p and Pex13p functionally interact during PTS2-dependent protein import into peroxisomes. NH2-terminal regions of Pex13p are required for its interaction with the PTS2-receptor while the COOH-terminal SH3 domain alone is sufficient to mediate its interaction with the PTS1-receptor. Reinvestigation of the topology revealed both termini of Pex13p to be oriented towards the cytosol. We also found Pex13p to be required for peroxisomal association of Pex14p, yet the SH3 domain of Pex13p may not provide the only binding site for Pex14p at the peroxisomal membrane.
Key words: peroxisome; peroxin; Pex13p; Pex14p; protein import| |
Introduction |
|---|
|
|
|---|
PEROXISOMAL matrix proteins are synthesized on free
polyribosomes and imported after translation into
preexisting organelles (Lazarow and Fujiki, 1985
).
The presence of two distinct peroxisomal targeting signals
(PTSs)1 indicates the involvement of two pathways in
the sorting process of peroxisomal matrix proteins. PTS1,
present in the majority of peroxisomal matrix proteins,
comprises the three COOH-terminal amino acids with the
sequence SKL or conserved variants (for review see McNew and Goodman, 1996
). Only one known peroxisomal
matrix protein in Saccharomyces cerevisiae, thiolase, targets the peroxisomal lumen by the PTS2, which is typically
localized close to the NH2 terminus of a protein, and consists of a conserved nonapeptide with the consensus sequence RLX5H/QL (for review see De Hoop and Ab,
1992
).
Recognition of PTS1 and PTS2 targeting signals is performed by the PTS specific import receptors, Pex5p and
Pex7p, respectively (for review see Subramani, 1996
; Erdmann et al., 1997
). Cells deficient in either protein display
partial import deficiencies. pex5
cells correctly localize
PTS2 proteins, but are deficient in the targeting of PTS1
proteins. pex7
cells exhibit the reverse phenotype (for review see Elgersma and Tabak, 1996
). The intracellular localization of both targeting signal receptors is still a matter of debate. A predominantly cytosolic, membrane-bound,
and even intraperoxisomal localization have been reported for both receptors (for review see Rachubinski and
Subramani, 1995
).
An attractive model to reconcile the different localization of the import receptors is the extended shuttle hypothesis (Dodt and Gould, 1996
; van der Klei and Veenhuis, 1996
; Erdmann et al., 1997
), which is a modification
of the original hypothesis of shuttling receptors (Marzioch
et al., 1994
). The extended shuttle suggests that the import
receptors Pex5p and Pex7p bind cargo proteins in the cytosol, dock to specific proteins at the periphery of the peroxisomal membrane, subsequently enter the peroxisome,
release their cargo in the lumen of the peroxisome, and
shuttle back to the cytoplasm. There is no experimental evidence for this model, but it is consistent with the
observation that peroxisomes are able to import both
folded and oligomeric proteins (for review see McNew
and Goodman, 1996
). However, the mechanism of protein translocation across the peroxisomal membrane remains unclear.
These shuttle models predict the existence of docking
sites at the peroxisomal membrane for cargo-loaded PTS
receptors. To date, two peroxisomal membrane proteins
have been described which display the necessary properties to serve as docking sites for PTS receptors at the
organelle. Pex13p, an integral peroxisomal membrane
protein, specifically binds by means of its cytosolic SH3
domain to the PTS1 receptor Pex5p (Elgersma et al., 1996
; Erdmann and Blobel, 1996
; Gould et al., 1996
). The second protein, Pex14p, is a membrane protein located at the
outer surface of the peroxisome (Albertini et al., 1997
;
Brocard et al., 1997
; Komori et al., 1997
; Fransen et al.,
1998
). Pex14p physically interacts with both receptors,
Pex5p and Pex7p, as well as with the peroxisomal membrane proteins Pex13p and Pex17p (Albertini et al., 1997
;
Brocard et al., 1997
; Huhse et al., 1998
). Together, these
data suggest that the two import pathways are not independent but overlapping, with Pex14p as the point of convergence of the pathways at the peroxisomal membrane
(Albertini et al., 1997
).
We report that Pex13p directly or indirectly interacts with the PTS2 receptor. In cells lacking Pex14p, Pex13p efficiently coimmunoprecipitates with Pex7p and interacts with Pex7p in the yeast two-hybrid system. In addition, overexpression of Pex13p suppresses the protein import defect caused by HA-tagged, functionally compromised Pex7p, further suggesting an interaction between the two proteins by genetic means. Regions NH2-terminal of the COOH-terminal SH3 domain of Pex13p were required for its interaction with Pex7p. Reinvestigation of the membrane topology of Pex13p revealed that both termini of the protein are exposed to the cytosol. Pex13p was also required for Pex14p localization at the peroxisomal membrane. However, the peroxisomal targeting of Pex14p did not require interaction with the SH3 domain of Pex13p.
| |
Materials and Methods |
|---|
|
|
|---|
Strains and Culture Conditions
S. cerevisiae strains used in this study are listed in Table I. Yeast complete
(YPD) and minimal media (SD) have been described previously (Erdmann et al., 1989
). YNO medium contained 0.1% oleic acid, 0.05% Tween
40, 0.1% yeast extract, and 0.67% yeast nitrogen base without amino acids, adjusted to pH 6.0. When necessary, auxotrophic requirements were
added according to Ausubel et al. (1992)
. For induction of the CUP1 promoter CuSO4 was added according to Marzioch et al. (1994)
.
|
Plasmids
For construction of pRS-PEX7HA3, the SacI/KpnI fragment of YIp-PEB-
HA3 (Zhang and Lazarow, 1995
) was subcloned into low copy plasmid
pRS316 (Sikorski and Hieter, 1989
). YEp351-PEX14 was constructed by
subcloning the SacI/BamHI fragment of pRS-PEX14 into YEp351 (Hill
et al., 1986
; Albertini et al., 1997
). YEp351-PEX13 was constructed by
subcloning the XhoI/PstI fragment of pRS-PEX13 into YEp351 (Erdmann and Blobel, 1996
).
For construction of Pex14pAXXA and Pex13pE320K, mutations were
introduced by PCR using gene splicing by overlap extension (Yon
and Fried, 1989
). Primers used to construct Pex14pAXXA were: KU107,
5'-(GGAATTCGAGGCCTTATGAGTGACGTGGTCAGT)-3', (nucleotides [nt] 1-18); RE9, 5'-(ATCCCTGTGGGCCAGCGTTGCTGGCATCGC)-3', (nt 249-278; underlined nt represent introduced mutations);
RE8, 5'-(GCGATGCCAGCAACGCTGGCCCACAGGGAT)-3', (nt
249-278); and KU109, 5'-(GGGGATCCCGGGATACCTATGGGATGGAGTCTTC)-3', (nt 1016-1026). pRS-PEX14 (Albertini et al., 1997
)
served as template. Primers used to construct Pex13p-E320K were
T3, 5'-(AATTAACCCTCACTAAAGGG)-3'; RE51, 5'-(CTCTGGGTTTTTTGGAACAAAATC)-3', (nt 946-969); RE50, 5'-(GATTTTGTTCCAAAAAACCCAGAG)-3', (nt 946-969); and T7, 5'-(GTAATACGACTCACTATAGGGC). pRS-PEX13 (Erdmann and Blobel, 1996
)
served as template. The PEX14-PCR product was digested with EcoRI/
BamHI and subcloned into pBluescript SK(+) (Stratagene) resulting in
plasmid pWG14/4. The PEX13-PCR product was digested with XhoI/PstI
and subcloned into pBluescript SK(+) resulting in plasmid pWG13/13.
For complementation studies, pRS-PEX14 (Albertini et al., 1997
) was
digested with HpaI/HindIII and the internal fragment of PEX14 (nt
123-702) was exchanged by a HpaI/HindIII fragment of PEX14AXXA
from plasmid pWG14/4. The resulting plasmid pWG14/9 contained the
PEX14AXXA-ORF as well as 601 bp of the 5'- and 628 bp of the 3'-noncoding region of PEX14. For complementation studies of pex13
, the
1.9-kb XhoI/PstI fragment of pWG13/13 containing the PEX13E320K-ORF, as well as 356 bp 5'- and 381 bp 3'-noncoding region of PEX13 were
subcloned in the yeast CEN-plasmid pRS351 (Sikorski and Hieter, 1989
)
resulting in pWG13/15.
Two-Hybrid Assay
The two-hybrid assay was based on the method of Fields and Song (1989)
.
The ORFs of selected PEX genes were fused to the DNA-binding domain
or transcription-activating domain of GAL4 in the vectors pPC86 and
pPC97 (Chevray and Nathans, 1992
). To construct the Gal4p-(BD)-
Pex13p fusion, the EcoRI/SpeI fragment of plasmid pSP43D (Erdmann
and Blobel, 1996
) containing the complete ORF of PEX13 was subcloned
into pPC86 resulting in pPC86-PEX13. To construct the Gal4p(DB)-
Pex14pAXXA fusion, the 1.1-kb EcoRI/SacII fragment from pWG14/4,
containing the complete PEX14AXXA-ORF was subcloned into EcoRI/
SacII-digested pPC86. The resulting plasmid was designated pWG14/6.
The SalI/SacII of pWG14/6 contained PEX14AXXA and was subcloned
into SalI/SacII digested pPC97, resulting in plasmid pWG14/8.
The PEX13E320K ORF was amplified from plasmid pWG13/13 by PCR, using oligonucleotides 43fus1 5'-(GTGAATTCGGATCCATATGTCATCCACAGCAGTA)-3' and the T7-primer (see above). The resulting PCR fragment was subcloned into a EcoRI/SpeI digested pPC86, resulting in plasmid pWG13/18. Amino acids 286-386 of Pex13pE320K were amplified by PCR using primers 37hyb1 5'-(TCCAGAATTCGGATCCTACAGACCTCTGGAACCATA)-3', T7, and pWG13/13 as templates. The PCR product was subcloned with EcoRI/SpeI into pPC86, resulting in plasmid pWG13/16. Subsequently, pWG13/16 was digested with SmaI/SpeI, and the excised PEX13E320K fragment was subcloned into SmaI/SpeI digested pPC97, resulting in plasmid pWG13/19.
Constructions of the Gal4p-AD-Pex5p, Gal4p-DB-Pex7p, and Gal4p-AD-Pex14p fusion proteins have been described previously (Erdmann and Blobel, 1996
; Rehling et al., 1996
; Albertini et al., 1997
). Cotransformation of two-hybrid vectors into the PCY2 and HF7c was performed according to Gietz and Sugino (1988)
. Double transformants were selected
on SD synthetic medium without tryptophane and leucine.
-galactosidase activity of transformed cells was determined by a filter assay described by Rehling et al. (1996)
, using X-Gal (GIBCO BRL) as substrate.
His auxotrophy of transformed HF7c was determined by growth on selective plates lacking leucine, tryptophane, and histidine, but containing
10 mM 3-aminotriazole.
Construction of Knockout Strains
To delete PEX5, PEX13, PEX14, and PEX17 in the yeast two-hybrid reporter strains PCY2 and HF7c, as well as the deletion of PEX7 and
PEX13 in wild-type UTL7A, PEX14 in pex17
, PEX17 in pex13
, and
PEX5 in pex14
, the kanMX4 gene was used as a selective marker for insertion into the genomic locus (Wach et al., 1994
). Deletion cassettes containing the kanMX4 gene and the 5' and 3' untranslated regions of the
corresponding ORFs were constructed by PCR using pFA6a-kanMX4
(Wach et al., 1994
) as a template. To generate the deletion cassettes for
the PEX5 gene deletion, the primer sets KU301, 5'-(TATACATCAATAAACAATATATCATAACACATGGACGTACGTACGCTGCAG- GTGGAC)-3' and KU302, 5'-(TGATGCGAGAACATAAAATTGCGGAGAACCATATCAATCGATGAATTCGAGCTCG)-3' were used.
For the PEX13 gene deletion, the primer sets KU274, 5'-(TATCTATAAATATCAAGGGGATTCTATACTATAACAATACCTGCGC-GTACGCTGCAGGTCGAC)-3' and KU275, 5'-(TTTACTATATATATATGCGAATATATG TG TGCAAATATTGATGCAATCGATGA- ATTCGAGCTCG)-3' were used. For the PEX7 gene deletion, KU371, 5'-
(GTTAACGGAC TAT CATC TAAC TTTTTGCATAATTTATACAACATGCGTACGCTGCAGGTCGAC)-3' and KU372, 5'-(GTTTAAATAATGCAAAAAATTTGTGTAAAAAGAATATGTGTCAACATC- GATGAATTCGAGCTCG)-3' were used. For PEX14 gene deletion, the
primer sets KU289, 5'-(GAAAACTCAAGTAAAACAGAGAAGTTGTAAGGTGAATAAGGACGTACGCTGCAGGTCGAC)-3' and KU290,
5'- (AATTACAATTTCCG TTAAAAAAC TAATTACTTACATAGAAATTGCGATCGATGAATTCGAGCTCG)-3' were used. Finally, for
a PEX17 gene deletion the primer sets KU251, 5'-(TCCATCATTCT GATAAGCAGAACCACG TAAGGCAGAC TAAAATCCG TAC-GCTGCAGGTCGAC)-3' and KU273, 5'-(ACGTGCACTAGAGCGTTTTAAATTCAATGCTATTATTTTTGATTGATCGATGAATTCG- AGCTCG)-3' were used.
For construction of the double knockout strain pex5/14
, the PEX14
locus was replaced by the loxP-kanMX4-loxP cassette (Güldener et al.,
1996
). The PEX14 deletion cassette was constructed by PCR with the
primer set KU289, 5'-(GAAAACTCAAGTAAAACAGAGAAGTTGTAAGGTGAATAAGGACGTACGCTGCAGGTCGAC)-3' and RE24,
5'- (CAATTTCC GTTAAAAAAC TAATTAC TTACATAGAA TTGCGATAGGCCACTAGTGGATCTG)-3' with plasmid pUG6 as template
(Güldener et al., 1996
).
The loxP-kanMX4-loxP cassette was integrated into the PEX14 locus
and excised afterwards by the CRE recombinase expressed from plasmid
pSH47 (Güldener et al., 1996
). Subsequently, PEX5 was deleted as described above.
PCRs and selection for geneticin resistance of transformants were performed according to Wach et al. (1994)
. Authenticity of each gene deletion by integration of the kanMX4 gene was confirmed by PCR.
Cell Fractionation
Spheroplasting of yeast cells, homogenization, and differential centrifugation at 25,000 g of homogenates were performed as described previously
(Erdmann et al., 1989
).
For subfractionation by flotation gradient centrifugation, solid sucrose was added to a cell free extract, for a final concentration of 50% (wt/wt). 7 ml of this extract was overlaid with 5 ml 46% (wt/wt), 15 ml 38% (wt/wt), and 3 ml 25% (wt/wt) sucrose in gradient buffer (5 mM MES, 1 mM EDTA, 1 mM KCl, 0.1% [vol/vol] ethanol). Gradients were centrifuged in a Sorvall-SV288 rotor at 20,000 rpm for 4 h. 27 fractions were collected from the bottom and processed for enzyme measurement and Western blotting.
Enzyme Assays
3-oxoacyl-CoA thiolase (EC 2.3.1.16), catalase (EC 1.11.1.6), and fumarate hydratase (fumarase: EC 4.2.1.2) were assayed according to published
procedures (Moreno de la Garza et al., 1985
; Veenhuis et al., 1987
).
Protease Protection Assay
The peroxisomal peak fractions of a sucrose density gradient were pooled
and subsequently diluted fivefold in gradient buffer (Erdmann and Blobel, 1995
). Peroxisomes were concentrated by centrifugation at 25,000 g
for 30 min. The resultant pellet was resuspended in homogenization
buffer (Erdmann et al., 1989
) supplemented with 50 mM KCl, but without
protease inhibitors. Equal amounts of isolated peroxisomes were incubated for 10 min on ice with increasing amounts of proteinase K. The proteinase was inhibited by the addition of 4 mM PMSF. The proteins were
then precipitated with TCA and the samples were processed for SDS-PAGE.
Antibodies, Western Blotting, and Coimmunoprecipitation
The protein fusion and purification system of New England Biolabs was
used for overexpression of a maltose-binding protein-SH3 domain fusion
protein (MBP-SH3). Amino acids 286-386 of Pex13p comprising the SH3
domain of Pex13p were fused to the COOH terminus of the Escherichia
coli MBP (Erdmann and Blobel, 1996
). MBP-SH3 was expressed from
pMAL-SH3 in E. coli strain TG1. The expression was induced with 0.3 mM
isopropyl-
-D-thiogalactopyranoside (IPTG), and affinity purification of
the MBP-SH3 fusion protein on amylose resin was performed according
to the manufacturer's protocol. Polyclonal antibodies were raised against
the fusion protein (Eurogentec).
Rabbit polyclonal anti-Pex11p antibodies were raised against a synthetic peptide (KAKSQSQGDEHEDHK) corresponding to amino acids 162-176 generated by Eurogentec.
Antithiolase (Fox3p; Erdmann and Kunau, 1994
), anti-Pcs60p (Blobel
and Erdmann, 1996
), anti-Pex3p (Höhfeld et al., 1991
), anti-Pex5p (Albertini et al., 1997
), anti-Pex14p (Albertini et al., 1997
), anti-Pex17p
(Huhse et al., 1998
), and anti-fructose 1,6 bisphosphatase (anti-Fbp1p;
Bigl and Escherich, 1994
) have been described previously. Anti-rabbit or
anti-mouse IgG-coupled HRP (Nycomed Amersham) was used as a secondary antibody, and blots were developed using the ECL-system (Nycomed Amersham). Western blot analyses were performed according to
standard protocols (Harlow and Lane, 1988
).
Coimmunoprecipitation experiments were performed as described in
Rehling et al. (1996)
with the exception of omitting the 35,000 g sedimentation step.
Immunofluorescence Microscopy
Immunofluorescence microscopy was performed according to the procedure of Rout and Kilmartin (1990)
, with modifications previously described in Erdmann (1994)
. Rabbit antisera against thiolase were used at
dilutions of 1:3,000. For detection, 6 µg/ml solution of CY3-conjugated
donkey anti-rabbit (Jackson ImmunoResearch Laboratories) was used.
HA-tagged Pex11p was detected with monoclonal 12CA5 antiserum
(BAbCO; dilution of 1:1,000).
Membrane Sedimentation
Yeast cells were grown on 0.3% SD medium to late log phase and subsequently for 15 h in YNOD (0.1% dextrose, 0.1% oleic acid, 0.05% Tween
40, 0.1% yeast extract, and 0.67% yeast nitrogen base). Cells were washed
with dH2O and 1 g was used per sedimentation. 3 ml of buffer A (50 mM
Tris-HCl, pH 7.5, 50 mM NaCl), protease inhibitors (0.02% PMSF
[Serva], 15 µg/ml bestatin, 1.5 µg/ml pepstatin, 1 µg/ml leupeptin, 0.1 µg/
ml chymostatin [Boehringer Mannheim], 0.21 mg/ml NaF), and 3 g glass
beads (0.5 mm) were added to the cells. Breakage was achieved by vortexing for 4 min (8 × 30 s, with breaks
30 s on ice; Lamb et al., 1994
). Samples were filtered through cotton wool, and the filtrate was transferred to
Corex tubes and centrifuged at 1,000 g for 30 min. Supernatants were normalized for protein and volume, and membranes were sedimented at
200,000 g for 30 min (Sorvall AH650, 40,850 rpm) through a cushion of
0.25 M sucrose in buffer A. The resulting pellet was resuspended in buffer
A plus protease inhibitors corresponding to the volume of the supernatant. Aliquots of the samples were analyzed by SDS-PAGE.
| |
Results |
|---|
|
|
|---|
Interaction of Pex7p with Pex5p Depends on the Presence of Pex14p
It has been reported that the import receptors Pex5p and
Pex7p interact with each other in the yeast two-hybrid system, which opened the possibility that both proteins may
form a heteromeric cytosolic signal recognition complex
(Rehling et al., 1996
). However, the yeast two-hybrid system does not necessarily distinguish between a direct and
indirect binding of two S. cerevisiae proteins, as endogenous proteins may contribute to the observed interaction. As Pex14p can bind both import receptors, we investigated whether the Pex5p/Pex7p interaction is still observed in a yeast two-hybrid reporter strain deleted for the
genomic copy of PEX14 (Huhse et al., 1998
). As shown in
Fig. 1, the interaction of the two import receptors strictly
depended on the presence of Pex14p which may be required for the activation of either receptor, or it may function as a bridging molecule between Pex5p and Pex7p.
|
Association of Pex7p with Membranes in the Absence of Pex14p
Deletion of genes encoding the three components of the
docking machinery known to date, Pex13p, Pex14p, or
Pex17p, results in an import defect for both PTS1 and
PTS2 proteins. One possible explanation could be a functional overlap of the proteins in PTS1- and PTS2-dependent protein import into peroxisomes. This prediction prompted us to search for additional Pex7p-binding proteins at the peroxisomal membrane. We expressed a functional mycPex7p fusion protein (Marzioch et al., 1994
) in
wild-type, pex17
, pex14
, and pex13
cells, and determined the localization of the protein by subcellular fractionation studies. Fractions were analyzed for the presence
of mycPex7p and for peroxisomal membrane markers Pex14p and Pex13p, as well as for cytosolic Fbp1p (Entian
et al., 1988
) as a control for proper separation. Pex14p and
Pex13p, but not Fbp1p, pelleted, indicating the complete
sedimentation of cytosol-free peroxisomal membranes
(Fig. 2). As reported previously (Rehling et al., 1996
),
mycPex7p was predominantly found in the soluble fraction in wild-type cells, while a low but significant amount
was detected in the membrane fraction. A decrease of
mycPex7p in the pellet fraction of pex14
cells (Fig. 2)
suggests that the majority of sedimentable Pex7p associates with membranes in a Pex14p-dependent manner.
However, in pex14
cells a significant amount of mycPex7p was detected in the membrane pellet fraction (Fig.
2), indicating that next to Pex14p additional binding factors for Pex7p exist at the peroxisomal membrane.
|
Coimmunoprecipitation of Pex13p and Pex7p in the Absence of Pex14p and Pex5p
To determine the binding partners of Pex7p, we isolated
mycPex7p from wild-type and various pex mutant strains
by immunoprecipitation, and immunoblotted for the presence of selected peroxins. As reported previously, we
found Pex5p, Pex13p, Pex14p, and Pex17p associated with
mycPex7p when the receptor was precipitated from wild-type or complemented pex7
cells (Albertini et al., 1997
;
Huhse et al., 1998
). Comparison of the constituents of the
precipitates revealed five interesting observations.
First, in pex14
and pex5
/pex14
strains, Pex13p still
coimmunoprecipitated with mycPex7p (Fig. 3), suggesting
that Pex13p associates directly or indirectly with Pex7p.
Moreover, this result indicated that neither Pex14p nor
Pex5p is required for the formation of this subcomplex of
Pex13p and Pex7p. Second, the amount of Pex5p in the
precipitate from pex14
cells was drastically reduced, while the amount in Pex13p remained essentially unchanged (Fig. 3, lane pex14
). This result supports the notion that the amount of Pex5p bound to Pex13p does not
determine the stoichiometry of the Pex13p-Pex7p subcomplex. However, it also suggests that Pex13p may not
bind both import receptors equally at the same time.
Third, Pex13p, Pex14p, and Pex5p still coimmunoprecipitated with Pex7p in pex17
cells (Fig. 3, lane pex17
). Obviously, Pex7p is associated with components of the peroxisomal translocation machinery in the absence of Pex17p,
suggesting that the presence of Pex17p is not a prerequisite for docking of Pex7p to the peroxisomal membrane.
Fourth, the lack of Pex17p in the coimmunoprecipitate from pex14
cells (Fig. 3, lane pex14
), suggests that
Pex14p is required for the association of Pex17p with the
complex, and is consistent with the assumption that
Pex17p binding to the complex may be via Pex14p. However, this observation must be interpreted with care since
the pex14
cells contain much less immunologically detectable Pex17p (Huhse et al., 1998
). Finally, the amount of Fox3p that coimmunoprecipitates with Pex7p drastically
increases in mutants with an import defect for PTS2 proteins (pex17
, pex13
, pex14
, and pex5
/pex14
) relative to the strains unaffected in this pathway (wild-type and
pex5
). Since the total amount of both proteins is similar in
all strains (Fig. 3 B), it seems unlikely that the observed
Pex7p/Fox3p complex has formed in vitro after cell disruption. A simple explanation for this may be that the high cytosolic concentration of thiolase in the import mutants results in greater occupation of the PTS2 receptor.
|
To exclude the possibility of nonspecific coprecipitation
of proteins, we checked the precipitates for the presence
of peroxisomal membrane proteins Pex11p (Erdmann and
Blobel, 1995
; Marshall et al., 1995
) and Pmp35p (putative
peroxisomal ATP-transporter; Erdmann, R., unpublished
observations). These proteins were not detected in any of
the samples, indicating the specificity of the observed interactions (data not shown).
Pex13p Interacts with the PTS2 Receptor Pex7p in the Yeast Two-Hybrid System
The observed in vivo association of Pex7p with Pex13p in
cells lacking Pex14p and Pex5p encouraged us to analyze
the interaction of these proteins in more detail. In previous experiments, only fragments of Pex13p were used to
address whether Pex13p binds to Pex7p, and so far they
have not indicated an interaction between these two proteins (Erdmann and Blobel, 1996
). To revisit this possibility, we analyzed the interaction of the full length Pex13p with Pex7p in the yeast two-hybrid system. The results
shown in Fig. 4 A reveal that the full length Pex13p is indeed able to interact with the PTS2-receptor Pex7p. The
controls included show that coexpression of either of the
fusion proteins alone did not support transcription activation of the reporter genes.
|
To analyze whether the observed Pex13p/Pex7p two-hybrid interaction depends on known binding partners for
Pex13p, tests were also performed in isogenic pex5
and
pex14
strains (Fig. 4 A). Furthermore, we analyzed the
association of Pex7p with a mutated Pex13pE320K in a
pex5
mutant (Fig. 4 B). Because Pex13pE320K lost the
ability to interact with Pex14p in the yeast two-hybrid system (Fig. 4 B, see also Fig. 8), this experiment was expected to monitor the Pex13p/Pex7p interaction upon
simultaneous elimination of the Pex14p and Pex5p influence. As shown in Fig. 4, these two-hybrid analyses did not
reveal an influence of Pex5p or Pex14p on the Pex13p/
Pex7p interaction. No difference was observed independent of whether the Pex7p/Pex13p interaction was analyzed in wild-type, pex5
, or pex14
strains (Fig. 4 A), or
for the Pex7p/Pex13pE320K interaction in pex5
cells
(Fig. 4 B). These results indicate that neither Pex14p nor
Pex5p is required for the in vivo interaction of Pex7p with
Pex13p, and therefore are in agreement with results obtained in the coimmunoprecipitation experiment (Fig. 3).
|
The two-hybrid interaction of the complete Pex13p with Pex14p is only detected by histidine prototrophy (Fig. 4 B), indicating that regions NH2-terminal of the SH3 domain of Pex13p may weaken the interaction of these proteins in the two-hybrid system.
PEX13 Suppresses a Defect in Pex7p Function
Mutant cells lacking Pex7p are characterized by their inability to grow on oleic acid as the sole carbon source (Fig.
5 A) and by mislocalization of peroxisomal thiolase to the
cytosol (Marzioch et al., 1994
; Zhang and Lazarow, 1995
).
Expression of a COOH-terminally HA-tagged Pex7p from
the low copy plasmid pRSPEX7-HA3 leads only to a
partial complementation of the pex7
mutant phenotype (Zhang and Lazarow, 1995
). This is indicated by the inability of the transformants to grow on oleic acid plates
(Fig. 5 A) and a reduced ability to import Fox3p (thiolase)
into peroxisomes. The latter is evident by the pronounced
cytosolic mislocalization of this protein (Fig. 5 B, panel d).
This mutant phenotype of pex7
[pRSPEX7-HA3] was
employed to investigate whether overexpression of Pex7p-binding partners may suppress a defect in Pex7p function. Cells expressing Pex7p-HA3 were transformed with multicopy plasmids containing either PEX14 or PEX13 under
the control of their own promoters. As judged by their
growth characteristics on oleic acid medium (Fig. 5 A) and
by the fluorescence pattern for thiolase (Fig. 5 B), overexpression of PEX13, but not PEX14, rescued the mutant phenotype caused by the defective Pex7p-HA. Even
though the suppression was not as efficient as complementation with the wild-type PEX7, this observation demonstrates that Pex13p can suppress the mutant phenotype of
pex7
[pRSPEX7-HA3], providing genetic evidence for an
interaction between Pex7p and Pex13p.
|
The NH2 Terminus and the COOH-terminal SH3 Domain of Pex13p Face the Cytosol
Pex13p is an integral peroxisomal membrane protein and
the cytosolic orientation of the COOH-terminal SH3
domain was shown previously in human fibroblasts (Elgersma et al., 1996
) and Pichia pastoris (Gould et al., 1996
).
However, the COOH-terminal SH3 domain alone is not
sufficient to interact with Pex7p, suggesting that regions
NH2-terminal to the SH3 domain are involved in this association. To address whether the NH2 terminus of Pex13p is localized to the lumen of peroxisomes or to the cytosol,
we analyzed the accessibility of an NH2-terminally myc-tagged Pex13p to exogenously added protease K. The tag
has been shown previously not to affect the function of
Pex13p (Erdmann and Blobel, 1996
). Thus, the topology of the myc-tagged Pex13p is likely to reflect the in vivo situation for the wild-type protein. As judged by immunoblot
analysis, both the NH2-terminal myc-tag as well as the SH3
domain of Pex13p were rapidly degraded by the protease
(Fig. 6). Intraperoxisomal thiolase remained stable under
these conditions and was only degraded in the presence of
detergents (data not shown). From this data, we conclude
that both the NH2 terminus and the COOH-terminal SH3 domain are exposed to the cytosol. This result also implicates the presence of an even number of transmembrane
spans within Pex13p.
|
Pex13p Is Required for Association of Pex14p with Peroxisomal Membranes
Pex13p interacts with Pex14p via its COOH-terminal SH3
domain (Albertini et al., 1997
; Brocard et al., 1997
);
however, both proteins can interact with Pex7p independently. The latter is in agreement with the assumption that
Pex13p and Pex14p contribute to distinct docking sites for
Pex7p at the peroxisomal membrane. Since Pex14p is a peripheral membrane protein, two questions arise: How is it
associated with the peroxisomal membrane, and Does
Pex13p contribute to its localization? In an attempt to
identify proteins required for the targeting and binding of
Pex14p to the peroxisomal membrane, we analyzed the
subcellular localization of Pex14p in different pex-mutant
cells (Fig. 7 A). The congruent fluorescence patterns for
Pex14p and the peroxisomal membrane marker Pex11p in
pex17
cells indicate a peroxisomal localization of Pex14p. This observation suggests that Pex17p is not required for
the targeting of Pex14p to the peroxisomal membrane.
In contrast, no congruent fluorescence patterns were observed in pex13
cells. Since the HA-tagged Pex11p is
known to be targeted to peroxisomal membrane ghosts in
pex13
cells (Erdmann and Blobel, 1996
), the lack of congruence suggests that the majority of Pex14p is mislocalized. To confirm this result by independent means, we
performed a flotation of wild-type, pex13
, and pex17
homogenates in sucrose gradients (Fig. 7 B). Gradients
were designed such that peroxisomal membrane ghosts
would float to the upper fractions of the gradient, whereas intact peroxisomes would predominantly remain in the
loading zone. In pex13
cells, the peroxisomal membrane
markers Pex3p and Pex11p were predominantly found in
fractions that correspond to the peroxisomal membrane
ghosts. However, Pex14p was not detected in these fractions, but was found to cosegregate with mitochondrial
fumarase. These data suggest that the peroxisomal membrane ghosts in pex13
cells lack Pex14p. Thus, the presence of Pex13p is a prerequisite for peroxisomal membrane association of Pex14p. Pex13p could be involved in
targeting, or it could be required for binding or retention of Pex14p at the peroxisome.
|
Binding to the SH3 Domain of Pex13p Is Not Essential for the Peroxisomal Membrane Association of Pex14p
To clarify whether binding of Pex14p to the SH3 domain is
a prerequisite for the peroxisomal targeting of Pex14p, we
analyzed the subcellular localization of Pex14p under conditions in which this interaction is blocked. A proline-rich
sequence which corresponds to a type II SH3 domain
binding motif is present within the primary sequence of
Pex14p (Albertini et al., 1997
; Brocard et al., 1997
). We
substituted Pro87 and Pro90 of this putative binding motif (PPTLPHRDW) by two alanines (PATLAHRDW). Remarkably, the mutated Pex14pAXXA still complemented
the peroxisome biogenesis defect of pex14
cells (data not
shown). We also introduced an E320K mutation in the reverse transcriptase loop (RT loop) of the SH3 domain of
Pex13p. This mutation has been reported to result in the
inactivation of Pex13p function (Elgersma et al., 1996
). As shown in Fig. 8, the mutated Pex14pAXXA had lost the
ability to bind Pex13p in the yeast two-hybrid system while
binding to Pex5p, Pex7p, and oligomerization of the protein was unchanged. Also the E320K mutation of Pex13p
abolished the two-hybrid interaction of the SH3 domain of
Pex13p with Pex14p (Fig. 8). These results suggest that
strong interactions between Pex14p and the SH3 domain of Pex13p are dependent on the PXXP motif within
Pex14p, as well as on the RT loop of the SH3 domain of Pex13p.
Next, we analyzed the Pex14pAXXA (Fig. 9 A) association with peroxisomal membrane ghosts of pex14
/pex17
double mutants which were predicted to contain peroxisomal membrane ghosts even upon complementation of the
pex14
mutation. In addition, we analyzed whether peroxisomal membrane ghosts that harbor mutated Pex13pE320K still contain Pex14p. The subcellular localization
of Pex14p, Pex14pAXXA, and peroxisomal membrane
markers was analyzed by double immunofluorescence microscopy and flotation analysis. Colocalization was observed for HA-Pex11p and Pex14pAXXA in pex14
cells,
as well as for HA-Pex11p and Pex14p in pex13
cells expressing Pex13pE320K, indicative of peroxisomal membrane
association of these proteins (Fig. 9 A). These results were
corroborated by flotation analysis which revealed that
Pex14pAXXA was associated with the fraction containing
the peroxisomal membrane ghosts of pex14
/pex17
, as were Pex14p in pex13
/pex17
cells expressing Pex13pE320K (Fig. 9 B). These observations suggest that Pex14p
is associated with peroxisomes and peroxisomal membrane ghosts independent of interaction between the proline-rich motif of Pex14p and the RT loop in the SH3 domain of Pex13p. Interestingly, the fractionation of pex13
/ pex17
[PEX13E320K] shows that, although the RT loop
of the SH3 domain of Pex13p is not absolutely required
for the targeting of Pex14p to the membrane of peroxisomal ghosts, it appears to enhance or stabilize the targeting,
as only Pex14p trails through the gradients of this mutant
strain (Fig. 9 B).
|
| |
Discussion |
|---|
|
|
|---|
The peroxisomal membrane protein Pex14p has been reported to bind both the PTS1 and the PTS2 receptor,
which led Albertini et al. (1997)
to the conclusion that
Pex14p may represent the point of convergence of the
PTS1- and PTS2-dependent protein import pathways at
the peroxisomal membrane. Here, we report that Pex13p is also involved in both the PTS1- and PTS2-dependent
protein import into peroxisomes. Pex13p interacts directly
or indirectly with the PTS2 receptor Pex7p and overexpression of Pex13p suppresses the protein import defect
caused by a functionally impaired epitope-tagged Pex7p.
Pex13p is also shown to be required for the peroxisomal association of Pex14p; however, evidence is provided that
the SH3 domain of Pex13p may not represent the only
binding site for Pex14p at the peroxisomal membrane.
Involvement of Pex13p in Targeting of Pex14p to the Peroxisomal Membrane
The SH3 domain of Pex13p has been reported to interact
with the PTS1 receptor Pex5p and with Pex14p (Elgersma
et al., 1996
; Erdmann and Blobel, 1996
; Gould et al., 1996
;
Albertini et al., 1997
; Fransen et al., 1998
; Fig. 8). A mutation in the RT loop of the SH3 domain of Pex13p, as well
as a mutation of a putative class II SH3 ligand motif of
Pex14p abolished the two-hybrid interaction of both proteins (Fig. 8), supporting the notion of a typical SH3 domain-ligand interaction between Pex13p and Pex14p. Interestingly, although the E320K mutation of the RT loop
of the SH3 domain of Pex13p abolishes its two-hybrid interaction with Pex14p, the mutated SH3 domain still interacts with Pex5p (Fig. 8 B). Accordingly, we conclude that
there are distinct binding sites for both Pex5p and Pex14p
within this domain or adjacent regions contained within the construct used for the assay.
Remarkably, neither the E320K mutation of the SH3
domain of Pex13p nor the mutation of the proline-rich
motif of Pex14p prevented the peroxisomal localization of
Pex14p (Fig. 9). This observation suggests that the binding
of Pex14p to the SH3 domain of Pex13p is not absolutely
required for the targeting and binding of Pex14p to peroxisomes. Why then does the absence of Pex13p lead to the mistargeting of Pex14p (Fig. 7)? One possibility is that
Pex13p is a component of a protein complex at the peroxisomal membrane that may disintegrate in the absence of
the entire protein, but remains stable without the SH3-dependent interaction between Pex13p and Pex14p. Association of Pex14p with the complex may not require a
direct interaction with Pex13p, but may be mediated by
other components of the complex. The simplest explanation for our observations on the Pex13p/Pex14p interaction is the existence of an as yet unrecognized binding
partner for Pex13p that may also provide the binding site
for Pex14p at the peroxisomal membrane. This missing
link, however, is not Pex17p. It is true that Pex17p is another binding partner of Pex14p, but our data suggest that
Pex17p is not required for association of the Pex13p/
Pex14p/Pex5p/Pex7p complex, as all these components
can efficiently coprecipitate in the absence of Pex17p (Fig.
3). Moreover, we found no Pex17p in a precipitate from
pex14
cells that still contains Pex13p and Pex7p (Fig. 3),
leading to two conclusions. First, a subcomplex of Pex13p
and Pex7p can form in the absence of Pex14p and Pex17p, and second, Pex14p is required for the association of
Pex17p with the complex. The latter may be explained by
the assumption that Pex17p is bound to the complex via Pex14p.
Pex7p/Pex13p Interaction
The amount of Pex7p in the membrane sediment of
pex14
cells is significantly lower than in wild-type or
pex13
cells (Fig. 2), suggesting that Pex14p may contribute to the majority of the total binding capacity of the peroxisomal membrane for the PTS2 receptor. However, a
significant amount of Pex7p was sedimented in the absence of Pex14p (Fig. 2, lane pex14
). Interestingly, in
cells lacking both Pex13p and Pex14p, no Pex7p was found
in the membrane pellet, which suggests that Pex13p contributed to the remaining Pex7p associated with peroxisomal membranes of pex14
cells (data not shown). This result, however, has to be interpreted with care since the
double deletion of PEX13 and PEX14 did result in a
significant decrease in immunologically detectable Pex7p (Girzalsky, W., and R. Erdmann, unpublished observations).
The observations that Pex13p and Pex7p interact in the
two-hybrid system and can be efficiently coimmunoprecipitated indicate that the proteins interact in vivo (Figs. 3
and 4). Whether Pex13p directly binds Pex7p remains to
be shown. Attempts to demonstrate direct binding of the
proteins by coimmunoprecipitation of in vitro translated
proteins were unsuccessful (data not shown). Our data do
not exclude the existence of a bridging protein which would directly interact with both Pex13p and Pex7p, a requirement fulfilled by Pex14p. However, two observations
indicate that the hypothetical bridging protein is not one
of the known binding partners for Pex13p. First, the
Pex7p/Pex13p interaction is also observed in the absence
of these proteins (Figs. 3 and 4), and second, the COOH-terminal SH3 domain alone is sufficient for the Pex13p/
Pex14p and Pex13p/Pex5p two-hybrid interaction, but not for the interaction of Pex13p with Pex7p (Erdmann and
Blobel, 1996
). A direct interaction of Pex13p and Pex7p is
further suggested by the genetic suppression of the defect
caused by a functionally compromised HA-tagged Pex7p
by overexpression of Pex13p (Fig. 5).
As discussed above, a Pex5p/Pex7p two-hybrid interaction is not observed in pex14
(Fig. 1). At first, this observation seems rather surprising, since both Pex5p and
Pex7p independently interact with Pex13p in the two-hybrid system (Fig. 4). One could imagine that Pex13p may
serve as a bridging molecule between the import receptors
to mediate an indirect binding which could have emerged in the two-hybrid system. However, the amount of Pex5p
simultaneously associated with the Pex7p-Pex13p complex
may be too low to give a positive response. In support of
this assumption, the amount of Pex5p coimmunoprecipitating with Pex7p in the absence of Pex14p is extremely
reduced, despite the presence of significant amounts of
Pex13p (Fig. 3, lane pex14
). Perhaps Pex13p does not
usually associate simultaneously with both of the import
receptors, or association is transient.
The domain of Pex13 that interacts with Pex7p, as well
as the side of the peroxisomal membrane where the interaction occurs, remains unknown. Furthermore, the intracellular localization of Pex7p in yeast is still a matter of
debate. One group has reported that the protein is exclusively localized in the peroxisomal lumen (Zhang and Lazarow, 1995
, 1996
), whereas others found the protein to
be predominantly localized in the cytosol with a small
amount associated with the peroxisomal membrane (Marzioch et al., 1994
; Rehling et al., 1996
). Because the SH3 domain alone does not mediate the interaction with Pex7p,
we suggest that regions NH2-terminal of the SH3 domain
may be required for the interaction or contribute to the
correct conformation of the binding site. Previously, the COOH-terminal SH3 domain has been reported to face
the cytosol (Elgersma et al., 1996
; Gould et al., 1996
), and
we found that both the NH2 terminus and the COOH terminus of Pex13p are exposed to the cytosol (Fig. 6), suggesting that the protein traverses the membrane with an
even number of membrane spans. In this respect, it is interesting to note that two regions which would fulfill the
requirement for
-helical transmembrane segments are
present in Pex13p (Elgersma et al., 1996
).
The interaction of Pex13p with Pex7p has far reaching
implications for our understanding of protein import into
the peroxisomal matrix. Why are there several binding
sites for the import receptors at the peroxisomal membrane? One hypothesis suggests that the multiple interactions reflect the existence of an import cascade in which
the cargo-loaded import receptors are transferred from one component of the import complex to the next (Erdmann et al., 1997
). Our confirmation that at least two peroxisomal membrane proteins bind the receptors raises
concerns about which functions as the docking protein for
each of the import pathways. Experimental evidence that
Pex13p may be the docking protein for the PTS1 receptor has been provided (Gould et al., 1996
), but the unsolved
questions stress the need for reliable in vitro systems to
study the order of interactions during the process of peroxisomal protein import.
| |
Footnotes |
|---|
Address correspondence to Dr. Ralf Erdmann, Freie Universität Berlin, Institut für Biochemie, Limonenstrasse 7, 12203 Berlin, Germany. Tel.: (30)-8322-8040. Fax: (30)-838-2936. E-mail: ralferdm{at}zedat.fu-berlin.de
Received for publication 14 September 1998 and in revised form 10 February 1999.
Julia Kipper was supported by a fellowship from the Bochumer Graduiertenkolleg Biogenese und Mechanismen komplexer Zellfunktionen. This work was supported by grants from the Deutsche Forschungsgemeinschaft to R. Erdmann (Er178/2-1, Er178/2-2, and SFB 480) and to W.-H. Kunau (Ku329/17-3), as well as by the Fonds der Chemischen Industrie.
W. Girzalsky and P. Rehling contributed equally to this work.
Peter Rehling's current address is Division of Cellular and Molecular
Medicine, Howard Hughes Medical Institute, University of California,
San Diego, School of Medicine, La Jolla, CA 92093-0668.
We are grateful to Ulrike Freimann, Uta Ricken, and Sigrid Wüthrich for technical assistance. We thank Paul Lazarow for the plasmid YIpPEB1-HA3 and William B. Snyder, Gabriele Dodt, Michael Linkert, and Michael Schwierskott for reading of the manuscript.
| |
Abbreviations used in this paper |
|---|
Fbp1p, fructose 1,6 bisphosphatase; Fox3p, antithiolase; MBP-SH3, maltose-binding protein SH3 domain fusion protein; nt, nucleotide; ORF, open reading frame; PTS, peroxisomal targeting signal; RT loop, reverse transcriptase loop; SD, minimal media; YPD, yeast complete media.
| |
References |
|---|
|
|
|---|
| 1. | Albertini, M., P. Rehling, R. Erdmann, W. Girzalsky, J.A.K.W. Kiel, M. Veenhuis, and W.-H. Kunau. 1997. Pex14p, a peroxisomal membrane protein binding both receptors of the two PTS-dependent import pathways. Cell 89: 83-92 [Medline]. |
| 2. | Ausubel, F.J., R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl. 1992. Current Protocols in Molecular Biology. Greene Publishing Associates, New York. 13.1.2-13.1.7. |
| 3. | Bigl, M., and K. Escherich. 1994. Overexpression of catalytically active yeast (Saccharomyces cerevisiae) fructose-1,6-bisphosphatase in Escherichia coli. Biol. Chem. Hoppe-Seyle 375: 153-160 [Medline]. |
| 4. | Blobel, F., and R. Erdmann. 1996. Identification of a peroxisomal member of the AMP-binding protein family. Eur. J. Biochem. 240: 468-476 [Medline]. |
| 5. | Brocard, C., G. Lametschwandtner, R. Koudelka, and A. Hartig. 1997. Pex14p is a member of the protein linkage map of Pex5p. EMBO (Eur. Mol. Biol. Organ.) J 16: 5491-5500 [Medline]. |
| 6. |
Chevray, P.M., and
D. Nathans.
1992.
Protein interaction cloning in yeast: identification of mammalian proteins that react with the leucine zipper of Jun.
Proc. Natl. Acad. Sci. USA
89:
5789-5793
|
| 7. | De Hoop, M.J., and G. Ab. 1992. Import of proteins into peroxisomes and other microbodies. Biochem. J. 286: 657-669 . |
| 8. |
Dodt, G., and
S.J. Gould.
1996.
Multiple PEX genes are required for proper
subcellular distribution and stability of Pex5p, the PTS1 receptor: evidence
that PTS1 protein import is mediated by a cycling receptor.
J. Cell Biol.
135:
1763-1774
|
| 9. | Elgersma, Y., and H.F. Tabak. 1996. Proteins involved in peroxisome biogenesis and functioning. Biochim. Biophys. Acta 1286: 269-283 [Medline]. |
| 10. |
Elgersma, Y.,
L. Kwast,
A. Klein,
T. Voorn-Brouwer,
M. van den Berg,
B. Metzig,
T. America,
H.F. Tabak, and
B. Distel.
1996.
The SH3 domain of the
Saccharomyces cerevisiae peroxisomal membrane protein Pex13p functions
as a docking site for Pex5p, a mobile receptor for the import of PTS1 containing proteins.
J. Cell Biol.
135:
97-109
|
| 11. | Entian, K.D., R.F. Vogel, M. Rose, L. Hofmann, and D. Mecke. 1988. Isolation and primary structure of the gene encoding fructose-1,6-bisphosphatase from Saccharomyces cerevisiae. FEBS Lett. 236: 195-200 [Medline]. |
| 12. | Erdmann, R.. 1994. The peroxisomal targeting signal of 3-oxoacyl-CoA thiolase from Saccharomyces cerevisiae. Yeast 10: 935-944 [Medline]. |
| 13. |
Erdmann, R., and
G. Blobel.
1995.
Giant peroxisomes in oleic acid-induced
Saccharomyces cerevisiae lacking the peroxisomal membrane protein
Pmp27p.
J. Cell Biol.
128:
509-523
|
| 14. |
Erdmann, R., and
G. Blobel.
1996.
Identification of Pex13p, a peroxisomal
membrane receptor for the PTS1 recognition factor.
J. Cell Biol.
135:
111-121
|
| 15. | Erdmann, R., and W.-H. Kunau. 1994. Purification and immunolocalization of the peroxisomal 3-oxoacyl-CoA thiolase from Saccharomyces cerevisiae. Yeast 10: 1173-1182 [Medline]. |
| 16. | Erdmann, R., M. Veenhuis, D. Mertens, and W.-H. Kunau. 1989. Isolation of peroxisome-deficient mutants of Saccharomyces cerevisiae. Proc. Natl. Acad. Sci. USA 86: 2432-2436 . |
| 17. | Erdmann, R., M. Veenhuis, and W.-H. Kunau. 1997. Peroxisomes: organelles at the crossroads. Trends Cell Biol. 7: 400-407 . [Medline] |
| 18. | Fields, S., and O.K. Song. 1989. A novel genetic system to detect protein-protein interactions. Nature 340: 245-246 [Medline]. |
| 19. |
Fransen, M.,
S.R. Terlecky, and
S. Subramani.
1998.
Identification of a human
PTS1 receptor docking protein directly required for peroxisomal protein import.
Proc. Natl. Acad. Sci. USA
95:
8087-8092
|
| 20. | Gietz, R.D., and A. Sugino. 1988. New yeast-E. coli shuttle vectors constructed with in vitro mutagenized yeast genes lacking six-base pair restriction sites. Gene 74: 527-534 [Medline]. |
| 21. |
Gould, S.J.,
J.E. Kalish,
J.E. Morrell,
J. Bjorkman,
A.J. Urquhart, and
D.I. Crane.
1996.
Pex13 is an SH3 protein of the peroxisome membrane and a
docking factor for the predominantly cytosolic PTS1 receptor.
J. Cell Biol.
135:
85-95
|
| 22. |
Güldener, U.,
S. Heck,
T. Fielder,
J. Beinhauer, and
J.H. Hegemann.
1996.
A
new efficient gene disruption cassette for repeated use in budding yeast.
Nucleic Acids Res.
24:
2519-2524
|
| 23. | Harlow, E., and D. Lane. 1988. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 451-511. |
| 24. | Hill, J.E., A.M. Myers, T.J. Koerner, and A. Tzagaloff. 1986. Yeast E. coli shuttle vectors with multiple unique restriction sides. Yeast 2: 163-167 [Medline]. |
| 25. |
Höhfeld, J.,
M. Veenhuis, and
W.-H. Kunau.
1991.
PAS3, a Saccharomyces cerevisiae gene encoding a peroxisomal integral membrane protein essential for
peroxisome biogenesis.
J. Cell Biol.
114:
1167-1178
|
| 26. |
Huhse, B.,
P. Rehling,
M. Albertini,
L. Blank,
K. Meller, and
W.-H. Kunau.
1998.
Pex17p of Saccharomyces cerevisiae is a novel peroxin and component
of the peroxisomal protein translocation machinery.
J. Cell Biol.
140:
49-60
|
| 27. | Komori, M., S.W. Rasmussen, J.A. Kiel, R.J. Baerends, J.M. Cregg, I.J. van der Klei, and M. Veenhuis. 1997. The Hansenula polymorpha PEX14 gene encodes a novel peroxisomal membrane protein essential for peroxisome biogenesis. EMBO (Eur. Mol. Biol. Organ.) J 16: 44-53 [Medline]. |
| 28. | Lamb, J.R., W.A. Michaud, R.S. Sikorski, and P.A. Hieter. 1994. Cdc16p, Cdc23p and Cdc27p form a complex for mitosis. EMBO (Eur. Mol. Biol. Organ.) J 13: 4321-4328 [Medline]. |
| 29. | Lazarow, P.B., and Y. Fujiki. 1985. Biogenesis of peroxisomes. Ann. Rev. Cell. Biol. 1: 489-530 . |
| 30. |
Marshall, P.A.,
Y.I. Krimkevich,
R.H. Lark,
J.M. Deyer,
M. Veenhuis, and
J.M. Goodman.
1995.
PMP27 promotes peroxisome proliferation.
J. Cell Biol.
129:
345-355
|
| 31. | Marzioch, M., R. Erdmann, M. Veenhuis, and W.-H. Kunau. 1994. PAS7 encodes a novel yeast member of the WD-40 protein family essential for import of 3-oxoacyl-CoA thiolase, a PTS2-containing protein, into peroxisomes. EMBO (Eur. Mol. Biol. Organ.) J 13: 4908-4918 [Medline]. |
| 32. | McNew, J.A., and J.M. Goodman. 1996. The targeting and assembly of peroxisomal proteins: some old rules do not apply. Trends Biochem. Sci. 21: 54-58 [Medline]. |
| 33. | Moreno de la Garza, M., U. Schulz-Borchard, J.W. Crabb, and W.-H. Kunau. 1985. Purification of a multifunctional protein processing enoyl-CoA hydratase, 3-hydroxyacyl-CoA dehydrogenase and 3-hydroxyacyl-CoA epimerase activities. Eur. J. Biochem. 148: 285-291 [Medline]. |
| 34. | Rachubinski, R.A., and S. Subramani. 1995. How proteins penetrate peroxisomes. Cell 83: 525-528 [Medline]. |
| 35. | Rehling, P., M. Marzioch, F. Niesen, E. Wittke, M. Veenhuis, and W.-H. Kunau. 1996. The import receptor for the peroxisomal targeting signal 2 (PTS2) in Saccharomyces cerevisiae is encoded by the PAS7 gene. EMBO (Eur. Mol. Biol. Organ.) J 15: 2901-2913 [Medline]. |
| 36. |
Rout, M.P., and
J.V. Kilmartin.
1990.
Components of the yeast spindle pole
body.
J. Cell Biol.
111:
1913-1927
|
| 37. |
Sikorski, R.S., and
P. Hieter.
1989.
A system of shuttle vectors and yeast host
strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae.
Genetics
122:
19-27
|
| 38. |
Subramani, S..
1996.
Protein translocation into peroxisomes.
J. Biol. Chem.
271:
32483-32486
|
| 39. | van der Klei, I.J., and M. Veenhuis. 1996. Peroxisome biogenesis in the yeast Hansenula polymorpha: a structural and functional analysis. Ann. New York Acad. Sci. 804: 47-59 [Medline]. |
| 40. |
Van der Leij, I.,
M.M. Franse,
Y. Elgersma,
B. Distel, and
H.F. Tabak.
1993.
PAS10 is a tetratricopeptide-repeat protein that is essential for the import of
most matrix proteins into peroxisomes of Saccharomyces cerevisiae.
Proc.
Natl. Acad. Sci. USA
90:
11782-11786
|
| 41. | Veenhuis, M., M. Mateblowski, W.-H. Kunau, and W. Harder. 1987. Proliferation of microbodies in Saccharomyces cerevisiae. Yeast 3: 77-84 [Medline]. |
| 42. | Wach, A., A. Brachat, R. Pöhlmann, and P. Philippsen. 1994. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. Yeast 10: 1793-1808 [Medline]. |
| 43. |
Yon, J., and
M. Fried.
1989.
Precise gene fusion by PCR.
Nucleic Acids Res.
17:
4895
|
| 44. |
Zhang, J.W., and
P.B. Lazarow.
1995.
PEB1 (PAS7) in Saccharomyces cerevisiae encodes a hydrophilic, intra-peroxisomal protein that is a member of the
WD repeat family and is essential for the import of thiolase into peroxisomes.
J. Cell Biol.
129:
65-80
|
| 45. |
Zhang, J.W., and
P.B. Lazarow.
1996.
PEB1(PAS7) is a intraperoxisomal receptor for the NH2-terminal, type 2, peroxisomal targeting sequence of thiolase: Peb1p itself is targeted to peroxisomes by an NH2-terminal peptide.
J.
Cell Biol.
132:
325-334
|
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|