|
|
|
|
|
|
|
||
© The Rockefeller University Press,
0021-9525/1999//1151 $5.00
The Journal of Cell Biology, Volume 144, Number 6,
, 1999 1151-1162
Regular Articles |
Involvement of Pex13p in Pex14p Localization and Peroxisomal Targeting Signal 2–dependent Protein Import into Peroxisomes
Ruhr-Universität Bochum, Institut für Physiologische Chemie, 44780 Bochum, Germany
Pex13p is the putative docking protein for peroxisomal targeting signal 1 (PTS1)-dependent protein import into peroxisomes. Pex14p interacts with both the PTS1- and PTS2-receptor and may represent the point of convergence of the PTS1- and PTS2-dependent protein import pathways. We report the involvement of Pex13p in peroxisomal import of PTS2-containing proteins. Like Pex14p, Pex13p not only interacts with the PTS1-receptor Pex5p, but also with the PTS2-receptor Pex7p; however, this association may be direct or indirect. In support of distinct peroxisomal binding sites for Pex7p, the Pex7p/Pex13p and Pex7p/ Pex14p complexes can form independently. Genetic evidence for the interaction of Pex7p and Pex13p is provided by the observation that overexpression of Pex13p suppresses a loss of function mutant of Pex7p. Accordingly, we conclude that Pex7p and Pex13p functionally interact during PTS2-dependent protein import into peroxisomes. NH2-terminal regions of Pex13p are required for its interaction with the PTS2-receptor while the COOH-terminal SH3 domain alone is sufficient to mediate its interaction with the PTS1-receptor. Reinvestigation of the topology revealed both termini of Pex13p to be oriented towards the cytosol. We also found Pex13p to be required for peroxisomal association of Pex14p, yet the SH3 domain of Pex13p may not provide the only binding site for Pex14p at the peroxisomal membrane.
Key Words: peroxisome • peroxin • Pex13p • Pex14p • protein import
Abbreviations used in this paper: Fbp1p, fructose 1,6 bisphosphatase; Fox3p, antithiolase; MBP-SH3, maltose-binding protein SH3 domain fusion protein; nt, nucleotide; ORF, open reading frame; PTS, peroxisomal targeting signal; RT loop, reverse transcriptase loop; SD, minimal media; YPD, yeast complete media.
Address correspondence to Dr. Ralf Erdmann, Freie Universität Berlin, Institut für Biochemie, Limonenstrasse 7, 12203 Berlin, Germany. Tel.: (30)-8322-8040. Fax: (30)-838-2936. E-mail: ralferdm{at}zedat.fu-berlin.de
PEROXISOMAL matrix proteins are synthesized on free polyribosomes and imported after translation into preexisting organelles (Lazarow and Fujiki, 1985). The presence of two distinct peroxisomal targeting signals (PTSs)1 indicates the involvement of two pathways in the sorting process of peroxisomal matrix proteins. PTS1, present in the majority of peroxisomal matrix proteins, comprises the three COOH-terminal amino acids with the sequence SKL or conserved variants (for review see McNew and Goodman, 1996). Only one known peroxisomal matrix protein in Saccharomyces cerevisiae, thiolase, targets the peroxisomal lumen by the PTS2, which is typically localized close to the NH2 terminus of a protein, and consists of a conserved nonapeptide with the consensus sequence RLX5H/QL (for review see De Hoop and Ab, 1992).
Recognition of PTS1 and PTS2 targeting signals is performed by the PTS specific import receptors, Pex5p and Pex7p, respectively (for review see Subramani, 1996; Erdmann et al., 1997). Cells deficient in either protein display partial import deficiencies. pex5
cells correctly localize PTS2 proteins, but are deficient in the targeting of PTS1 proteins. pex7 cells exhibit the reverse phenotype (for review see Elgersma and Tabak, 1996). The intracellular localization of both targeting signal receptors is still a matter of debate. A predominantly cytosolic, membrane-bound, and even intraperoxisomal localization have been reported for both receptors (for review see Rachubinski and Subramani, 1995).
An attractive model to reconcile the different localization of the import receptors is the extended shuttle hypothesis (Dodt and Gould, 1996; van der Klei and Veenhuis, 1996; Erdmann et al., 1997), which is a modification of the original hypothesis of shuttling receptors (Marzioch et al., 1994). The extended shuttle suggests that the import receptors Pex5p and Pex7p bind cargo proteins in the cytosol, dock to specific proteins at the periphery of the peroxisomal membrane, subsequently enter the peroxisome, release their cargo in the lumen of the peroxisome, and shuttle back to the cytoplasm. There is no experimental evidence for this model, but it is consistent with the observation that peroxisomes are able to import both folded and oligomeric proteins (for review see McNew and Goodman, 1996). However, the mechanism of protein translocation across the peroxisomal membrane remains unclear.
These shuttle models predict the existence of docking sites at the peroxisomal membrane for cargo-loaded PTS receptors. To date, two peroxisomal membrane proteins have been described which display the necessary properties to serve as docking sites for PTS receptors at the organelle. Pex13p, an integral peroxisomal membrane protein, specifically binds by means of its cytosolic SH3 domain to the PTS1 receptor Pex5p (Elgersma et al., 1996; Erdmann and Blobel, 1996; Gould et al., 1996). The second protein, Pex14p, is a membrane protein located at the outer surface of the peroxisome (Albertini et al., 1997; Brocard et al., 1997; Komori et al., 1997; Fransen et al., 1998). Pex14p physically interacts with both receptors, Pex5p and Pex7p, as well as with the peroxisomal membrane proteins Pex13p and Pex17p (Albertini et al., 1997; Brocard et al., 1997; Huhse et al., 1998). Together, these data suggest that the two import pathways are not independent but overlapping, with Pex14p as the point of convergence of the pathways at the peroxisomal membrane (Albertini et al., 1997).
We report that Pex13p directly or indirectly interacts with the PTS2 receptor. In cells lacking Pex14p, Pex13p efficiently coimmunoprecipitates with Pex7p and interacts with Pex7p in the yeast two-hybrid system. In addition, overexpression of Pex13p suppresses the protein import defect caused by HA-tagged, functionally compromised Pex7p, further suggesting an interaction between the two proteins by genetic means. Regions NH2-terminal of the COOH-terminal SH3 domain of Pex13p were required for its interaction with Pex7p. Reinvestigation of the membrane topology of Pex13p revealed that both termini of the protein are exposed to the cytosol. Pex13p was also required for Pex14p localization at the peroxisomal membrane. However, the peroxisomal targeting of Pex14p did not require interaction with the SH3 domain of Pex13p.
 |
Materials and Methods |
|---|
 TopAbstract Materials and Methods ResultsDiscussionReferences |
|---|
|
For construction of Pex14pAXXA and Pex13pE320K, mutations were introduced by PCR using gene splicing by overlap extension (Yon and Fried, 1989). Primers used to construct Pex14pAXXA were: KU107, 5'-(GGAATTCGAGGCCTTATGAGTGACGTGGTCAGT)-3', (nucleotides [nt] 1–18); RE9, 5'-(ATCCCTGTGGGCCAGCGTTGCTGGCATCGC)-3', (nt 249–278; underlined nt represent introduced mutations); RE8, 5'-(GCGATGCCAGCAACGCTGGCCCACAGGGAT)-3', (nt 249–278); and KU109, 5'-(GGGGATCCCGGGATACCTATGGGATGGAGTCTTC)-3', (nt 1016–1026). pRS-PEX14 (Albertini et al., 1997) served as template. Primers used to construct Pex13p-E320K were T3, 5'-(AATTAACCCTCACTAAAGGG)-3'; RE51, 5'-(CTCTGGGTTTTTTGGAACAAAATC)-3', (nt 946–969); RE50, 5'-(GATTTTGTTCCAAAAAACCCAGAG)-3', (nt 946–969); and T7, 5'-(GTAATACGACTCACTATAGGGC). pRS-PEX13 (Erdmann and Blobel, 1996) served as template. The PEX14-PCR product was digested with EcoRI/ BamHI and subcloned into pBluescript SK(+) (Stratagene) resulting in plasmid pWG14/4. The PEX13-PCR product was digested with XhoI/PstI and subcloned into pBluescript SK(+) resulting in plasmid pWG13/13.
For complementation studies, pRS-PEX14 (Albertini et al., 1997) was digested with HpaI/HindIII and the internal fragment of PEX14 (nt 123–702) was exchanged by a HpaI/HindIII fragment of PEX14AXXA from plasmid pWG14/4. The resulting plasmid pWG14/9 contained the PEX14AXXA-ORF as well as 601 bp of the 5'- and 628 bp of the 3'-noncoding region of PEX14. For complementation studies of pex13, the 1.9-kb XhoI/PstI fragment of pWG13/13 containing the PEX13E320K-ORF, as well as 356 bp 5'- and 381 bp 3'-noncoding region of PEX13 were subcloned in the yeast CEN-plasmid pRS351 (Sikorski and Hieter, 1989) resulting in pWG13/15.
Two-Hybrid Assay
The two-hybrid assay was based on the method of Fields and Song (1989). The ORFs of selected PEX genes were fused to the DNA-binding domain or transcription-activating domain of GAL4 in the vectors pPC86 and pPC97 (Chevray and Nathans, 1992). To construct the Gal4p-(BD)- Pex13p fusion, the EcoRI/SpeI fragment of plasmid pSP43D (Erdmann and Blobel, 1996) containing the complete ORF of PEX13 was subcloned into pPC86 resulting in pPC86-PEX13. To construct the Gal4p(DB)- Pex14pAXXA fusion, the 1.1-kb EcoRI/SacII fragment from pWG14/4, containing the complete PEX14AXXA-ORF was subcloned into EcoRI/ SacII-digested pPC86. The resulting plasmid was designated pWG14/6. The SalI/SacII of pWG14/6 contained PEX14AXXA and was subcloned into SalI/SacII digested pPC97, resulting in plasmid pWG14/8.
The PEX13E320K ORF was amplified from plasmid pWG13/13 by PCR, using oligonucleotides 43fus1 5'-(GTGAATTCGGATCCATATGTCATCCACAGCAGTA)-3' and the T7-primer (see above). The resulting PCR fragment was subcloned into a EcoRI/SpeI digested pPC86, resulting in plasmid pWG13/18. Amino acids 286–386 of Pex13pE320K were amplified by PCR using primers 37hyb1 5'-(TCCAGAATTCGGATCCTACAGACCTCTGGAACCATA)-3', T7, and pWG13/13 as templates. The PCR product was subcloned with EcoRI/SpeI into pPC86, resulting in plasmid pWG13/16. Subsequently, pWG13/16 was digested with SmaI/SpeI, and the excised PEX13E320K fragment was subcloned into SmaI/SpeI digested pPC97, resulting in plasmid pWG13/19.
Constructions of the Gal4p-AD-Pex5p, Gal4p-DB-Pex7p, and Gal4p-AD-Pex14p fusion proteins have been described previously (Erdmann and Blobel, 1996; Rehling et al., 1996; Albertini et al., 1997). Cotransformation of two-hybrid vectors into the PCY2 and HF7c was performed according to Gietz and Sugino (1988). Double transformants were selected on SD synthetic medium without tryptophane and leucine. β-galactosidase activity of transformed cells was determined by a filter assay described by Rehling et al. (1996), using X-Gal (GIBCO BRL) as substrate. His auxotrophy of transformed HF7c was determined by growth on selective plates lacking leucine, tryptophane, and histidine, but containing 10 mM 3-aminotriazole.
Construction of Knockout Strains
To delete PEX5, PEX13, PEX14, and PEX17 in the yeast two-hybrid reporter strains PCY2 and HF7c, as well as the deletion of PEX7 and PEX13 in wild-type UTL7A, PEX14 in pex17, PEX17 in pex13, and PEX5 in pex14, the kanMX4 gene was used as a selective marker for insertion into the genomic locus (Wach et al., 1994). Deletion cassettes containing the kanMX4 gene and the 5' and 3' untranslated regions of the corresponding ORFs were constructed by PCR using pFA6a-kanMX4 (Wach et al., 1994) as a template. To generate the deletion cassettes for the PEX5 gene deletion, the primer sets KU301, 5'-(TATACATCAATAAACAATATATCATAACACATGGACGTACGTACGCTGCAG- GTGGAC)-3' and KU302, 5'-(TGATGCGAGAACATAAAATTGCGGAGAACCATATCAATCGATGAATTCGAGCTCG)-3' were used. For the PEX13 gene deletion, the primer sets KU274, 5'-(TATCTATAAATATCAAGGGGATTCTATACTATAACAATACCTGCGC-GTACGCTGCAGGTCGAC)-3' and KU275, 5'-(TTTACTATATATATATGCGAATATATG TG TGCAAATATTGATGCAATCGATGA- ATTCGAGCTCG)-3' were used. For the PEX7 gene deletion, KU371, 5'- (GTTAACGGAC TAT CATC TAAC TTTTTGCATAATTTATACAACATGCGTACGCTGCAGGTCGAC)-3' and KU372, 5'-(GTTTAAATAATGCAAAAAATTTGTGTAAAAAGAATATGTGTCAACATC- GATGAATTCGAGCTCG)-3' were used. For PEX14 gene deletion, the primer sets KU289, 5'-(GAAAACTCAAGTAAAACAGAGAAGTTGTAAGGTGAATAAGGACGTACGCTGCAGGTCGAC)-3' and KU290, 5'- (AATTACAATTTCCG TTAAAAAAC TAATTACTTACATAGAAATTGCGATCGATGAATTCGAGCTCG)-3' were used. Finally, for a PEX17 gene deletion the primer sets KU251, 5'-(TCCATCATTCT GATAAGCAGAACCACG TAAGGCAGAC TAAAATCCG TAC-GCTGCAGGTCGAC)-3' and KU273, 5'-(ACGTGCACTAGAGCGTTTTAAATTCAATGCTATTATTTTTGATTGATCGATGAATTCG- AGCTCG)-3' were used.
For construction of the double knockout strain pex5/14, the PEX14 locus was replaced by the loxP-kanMX4-loxP cassette (Güldener et al., 1996). The PEX14 deletion cassette was constructed by PCR with the primer set KU289, 5'-(GAAAACTCAAGTAAAACAGAGAAGTTGTAAGGTGAATAAGGACGTACGCTGCAGGTCGAC)-3' and RE24, 5'- (CAATTTCC GTTAAAAAAC TAATTAC TTACATAGAA TTGCGATAGGCCACTAGTGGATCTG)-3' with plasmid pUG6 as template (Güldener et al., 1996).
The loxP-kanMX4-loxP cassette was integrated into the PEX14 locus and excised afterwards by the CRE recombinase expressed from plasmid pSH47 (Güldener et al., 1996). Subsequently, PEX5 was deleted as described above.
PCRs and selection for geneticin resistance of transformants were performed according to Wach et al. (1994). Authenticity of each gene deletion by integration of the kanMX4 gene was confirmed by PCR.
Cell Fractionation
Spheroplasting of yeast cells, homogenization, and differential centrifugation at 25,000 g of homogenates were performed as described previously (Erdmann et al., 1989).
For subfractionation by flotation gradient centrifugation, solid sucrose was added to a cell free extract, for a final concentration of 50% (wt/wt). 7 ml of this extract was overlaid with 5 ml 46% (wt/wt), 15 ml 38% (wt/wt), and 3 ml 25% (wt/wt) sucrose in gradient buffer (5 mM MES, 1 mM EDTA, 1 mM KCl, 0.1% [vol/vol] ethanol). Gradients were centrifuged in a Sorvall-SV288 rotor at 20,000 rpm for 4 h. 27 fractions were collected from the bottom and processed for enzyme measurement and Western blotting.
Enzyme Assays
3-oxoacyl-CoA thiolase (EC 2.3.1.16), catalase (EC 1.11.1.6), and fumarate hydratase (fumarase: EC 4.2.1.2) were assayed according to published procedures (Moreno de la Garza et al., 1985; Veenhuis et al., 1987).
Protease Protection Assay
The peroxisomal peak fractions of a sucrose density gradient were pooled and subsequently diluted fivefold in gradient buffer (Erdmann and Blobel, 1995). Peroxisomes were concentrated by centrifugation at 25,000 g for 30 min. The resultant pellet was resuspended in homogenization buffer (Erdmann et al., 1989) supplemented with 50 mM KCl, but without protease inhibitors. Equal amounts of isolated peroxisomes were incubated for 10 min on ice with increasing amounts of proteinase K. The proteinase was inhibited by the addition of 4 mM PMSF. The proteins were then precipitated with TCA and the samples were processed for SDS-PAGE.
Antibodies, Western Blotting, and Coimmunoprecipitation
The protein fusion and purification system of New England Biolabs was used for overexpression of a maltose-binding protein–SH3 domain fusion protein (MBP-SH3). Amino acids 286–386 of Pex13p comprising the SH3 domain of Pex13p were fused to the COOH terminus of the Escherichia coli MBP (Erdmann and Blobel, 1996). MBP-SH3 was expressed from pMAL-SH3 in E. coli strain TG1. The expression was induced with 0.3 mM isopropyl-β-D-thiogalactopyranoside (IPTG), and affinity purification of the MBP-SH3 fusion protein on amylose resin was performed according to the manufacturer's protocol. Polyclonal antibodies were raised against the fusion protein (Eurogentec).
Rabbit polyclonal anti-Pex11p antibodies were raised against a synthetic peptide (KAKSQSQGDEHEDHK) corresponding to amino acids 162–176 generated by Eurogentec.
Antithiolase (Fox3p; Erdmann and Kunau, 1994), anti-Pcs60p (Blobel and Erdmann, 1996), anti-Pex3p (Höhfeld et al., 1991), anti-Pex5p (Albertini et al., 1997), anti-Pex14p (Albertini et al., 1997), anti-Pex17p (Huhse et al., 1998), and anti–fructose 1,6 bisphosphatase (anti-Fbp1p; Bigl and Escherich, 1994) have been described previously. Anti–rabbit or anti–mouse IgG-coupled HRP (Nycomed Amersham) was used as a secondary antibody, and blots were developed using the ECL-system (Nycomed Amersham). Western blot analyses were performed according to standard protocols (Harlow and Lane, 1988).
Coimmunoprecipitation experiments were performed as described in Rehling et al. (1996) with the exception of omitting the 35,000 g sedimentation step.
Immunofluorescence Microscopy
Immunofluorescence microscopy was performed according to the procedure of Rout and Kilmartin (1990), with modifications previously described in Erdmann (1994). Rabbit antisera against thiolase were used at dilutions of 1:3,000. For detection, 6 µg/ml solution of CY3-conjugated donkey anti–rabbit (Jackson ImmunoResearch Laboratories) was used. HA-tagged Pex11p was detected with monoclonal 12CA5 antiserum (BAbCO; dilution of 1:1,000).
Membrane Sedimentation
Yeast cells were grown on 0.3% SD medium to late log phase and subsequently for 15 h in YNOD (0.1% dextrose, 0.1% oleic acid, 0.05% Tween 40, 0.1% yeast extract, and 0.67% yeast nitrogen base). Cells were washed with dH2O and 1 g was used per sedimentation. 3 ml of buffer A (50 mM Tris-HCl, pH 7.5, 50 mM NaCl), protease inhibitors (0.02% PMSF [Serva], 15 µg/ml bestatin, 1.5 µg/ml pepstatin, 1 µg/ml leupeptin, 0.1 µg/ ml chymostatin [Boehringer Mannheim], 0.21 mg/ml NaF), and 3 g glass beads (0.5 mm) were added to the cells. Breakage was achieved by vortexing for 4 min (8 x 30 s, with breaks 
30 s on ice; Lamb et al., 1994). Samples were filtered through cotton wool, and the filtrate was transferred to Corex tubes and centrifuged at 1,000 g for 30 min. Supernatants were normalized for protein and volume, and membranes were sedimented at 200,000 g for 30 min (Sorvall AH650, 40,850 rpm) through a cushion of 0.25 M sucrose in buffer A. The resulting pellet was resuspended in buffer A plus protease inhibitors corresponding to the volume of the supernatant. Aliquots of the samples were analyzed by SDS-PAGE.
|
Results |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
|
, pex14, and pex13 cells, and determined the localization of the protein by subcellular fractionation studies. Fractions were analyzed for the presence of mycPex7p and for peroxisomal membrane markers Pex14p and Pex13p, as well as for cytosolic Fbp1p (Entian et al., 1988) as a control for proper separation. Pex14p and Pex13p, but not Fbp1p, pelleted, indicating the complete sedimentation of cytosol-free peroxisomal membranes (Fig. 2). As reported previously (Rehling et al., 1996), mycPex7p was predominantly found in the soluble fraction in wild-type cells, while a low but significant amount was detected in the membrane fraction. A decrease of mycPex7p in the pellet fraction of pex14 cells (Fig. 2) suggests that the majority of sedimentable Pex7p associates with membranes in a Pex14p-dependent manner. However, in pex14 cells a significant amount of mycPex7p was detected in the membrane pellet fraction (Fig. 2), indicating that next to Pex14p additional binding factors for Pex7p exist at the peroxisomal membrane.
|
cells (Albertini et al., 1997; Huhse et al., 1998). Comparison of the constituents of the precipitates revealed five interesting observations.
First, in pex14 and pex5/pex14 strains, Pex13p still coimmunoprecipitated with mycPex7p (Fig. 3), suggesting that Pex13p associates directly or indirectly with Pex7p. Moreover, this result indicated that neither Pex14p nor Pex5p is required for the formation of this subcomplex of Pex13p and Pex7p. Second, the amount of Pex5p in the precipitate from pex14 cells was drastically reduced, while the amount in Pex13p remained essentially unchanged (Fig. 3, lane pex14). This result supports the notion that the amount of Pex5p bound to Pex13p does not determine the stoichiometry of the Pex13p-Pex7p subcomplex. However, it also suggests that Pex13p may not bind both import receptors equally at the same time. Third, Pex13p, Pex14p, and Pex5p still coimmunoprecipitated with Pex7p in pex17 cells (Fig. 3, lane pex17). Obviously, Pex7p is associated with components of the peroxisomal translocation machinery in the absence of Pex17p, suggesting that the presence of Pex17p is not a prerequisite for docking of Pex7p to the peroxisomal membrane. Fourth, the lack of Pex17p in the coimmunoprecipitate from pex14 cells (Fig. 3, lane pex14), suggests that Pex14p is required for the association of Pex17p with the complex, and is consistent with the assumption that Pex17p binding to the complex may be via Pex14p. However, this observation must be interpreted with care since the pex14 cells contain much less immunologically detectable Pex17p (Huhse et al., 1998). Finally, the amount of Fox3p that coimmunoprecipitates with Pex7p drastically increases in mutants with an import defect for PTS2 proteins (pex17, pex13, pex14, and pex5/pex14) relative to the strains unaffected in this pathway (wild-type and pex5). Since the total amount of both proteins is similar in all strains (Fig. 3 B), it seems unlikely that the observed Pex7p/Fox3p complex has formed in vitro after cell disruption. A simple explanation for this may be that the high cytosolic concentration of thiolase in the import mutants results in greater occupation of the PTS2 receptor.
|
Pex13p Interacts with the PTS2 Receptor Pex7p in the Yeast Two-Hybrid System
The observed in vivo association of Pex7p with Pex13p in cells lacking Pex14p and Pex5p encouraged us to analyze the interaction of these proteins in more detail. In previous experiments, only fragments of Pex13p were used to address whether Pex13p binds to Pex7p, and so far they have not indicated an interaction between these two proteins (Erdmann and Blobel, 1996). To revisit this possibility, we analyzed the interaction of the full length Pex13p with Pex7p in the yeast two-hybrid system. The results shown in Fig. 4 A reveal that the full length Pex13p is indeed able to interact with the PTS2-receptor Pex7p. The controls included show that coexpression of either of the fusion proteins alone did not support transcription activation of the reporter genes.
|
and pex14 strains (Fig. 4 A). Furthermore, we analyzed the association of Pex7p with a mutated Pex13pE320K in a pex5 mutant (Fig. 4 B). Because Pex13pE320K lost the ability to interact with Pex14p in the yeast two-hybrid system (Fig. 4 B, see also Fig. 8), this experiment was expected to monitor the Pex13p/Pex7p interaction upon simultaneous elimination of the Pex14p and Pex5p influence. As shown in Fig. 4, these two-hybrid analyses did not reveal an influence of Pex5p or Pex14p on the Pex13p/ Pex7p interaction. No difference was observed independent of whether the Pex7p/Pex13p interaction was analyzed in wild-type, pex5, or pex14 strains (Fig. 4 A), or for the Pex7p/Pex13pE320K interaction in pex5 cells (Fig. 4 B). These results indicate that neither Pex14p nor Pex5p is required for the in vivo interaction of Pex7p with Pex13p, and therefore are in agreement with results obtained in the coimmunoprecipitation experiment (Fig. 3).
|
PEX13 Suppresses a Defect in Pex7p Function
Mutant cells lacking Pex7p are characterized by their inability to grow on oleic acid as the sole carbon source (Fig. 5 A) and by mislocalization of peroxisomal thiolase to the cytosol (Marzioch et al., 1994; Zhang and Lazarow, 1995). Expression of a COOH-terminally HA-tagged Pex7p from the low copy plasmid pRSPEX7-HA3 leads only to a partial complementation of the pex7 mutant phenotype (Zhang and Lazarow, 1995). This is indicated by the inability of the transformants to grow on oleic acid plates (Fig. 5 A) and a reduced ability to import Fox3p (thiolase) into peroxisomes. The latter is evident by the pronounced cytosolic mislocalization of this protein (Fig. 5 B, panel d). This mutant phenotype of pex7[pRSPEX7-HA3] was employed to investigate whether overexpression of Pex7p-binding partners may suppress a defect in Pex7p function. Cells expressing Pex7p-HA3 were transformed with multicopy plasmids containing either PEX14 or PEX13 under the control of their own promoters. As judged by their growth characteristics on oleic acid medium (Fig. 5 A) and by the fluorescence pattern for thiolase (Fig. 5 B), overexpression of PEX13, but not PEX14, rescued the mutant phenotype caused by the defective Pex7p-HA. Even though the suppression was not as efficient as complementation with the wild-type PEX7, this observation demonstrates that Pex13p can suppress the mutant phenotype of pex7[pRSPEX7-HA3], providing genetic evidence for an interaction between Pex7p and Pex13p.
|
|
cells indicate a peroxisomal localization of Pex14p. This observation suggests that Pex17p is not required for the targeting of Pex14p to the peroxisomal membrane. In contrast, no congruent fluorescence patterns were observed in pex13 cells. Since the HA-tagged Pex11p is known to be targeted to peroxisomal membrane ghosts in pex13 cells (Erdmann and Blobel, 1996), the lack of congruence suggests that the majority of Pex14p is mislocalized. To confirm this result by independent means, we performed a flotation of wild-type, pex13, and pex17 homogenates in sucrose gradients (Fig. 7 B). Gradients were designed such that peroxisomal membrane ghosts would float to the upper fractions of the gradient, whereas intact peroxisomes would predominantly remain in the loading zone. In pex13 cells, the peroxisomal membrane markers Pex3p and Pex11p were predominantly found in fractions that correspond to the peroxisomal membrane ghosts. However, Pex14p was not detected in these fractions, but was found to cosegregate with mitochondrial fumarase. These data suggest that the peroxisomal membrane ghosts in pex13 cells lack Pex14p. Thus, the presence of Pex13p is a prerequisite for peroxisomal membrane association of Pex14p. Pex13p could be involved in targeting, or it could be required for binding or retention of Pex14p at the peroxisome.
|
cells (data not shown). We also introduced an E320K mutation in the reverse transcriptase loop (RT loop) of the SH3 domain of Pex13p. This mutation has been reported to result in the inactivation of Pex13p function (Elgersma et al., 1996). As shown in Fig. 8, the mutated Pex14pAXXA had lost the ability to bind Pex13p in the yeast two-hybrid system while binding to Pex5p, Pex7p, and oligomerization of the protein was unchanged. Also the E320K mutation of Pex13p abolished the two-hybrid interaction of the SH3 domain of Pex13p with Pex14p (Fig. 8). These results suggest that strong interactions between Pex14p and the SH3 domain of Pex13p are dependent on the PXXP motif within Pex14p, as well as on the RT loop of the SH3 domain of Pex13p.
Next, we analyzed the Pex14pAXXA (Fig. 9 A) association with peroxisomal membrane ghosts of pex14/pex17 double mutants which were predicted to contain peroxisomal membrane ghosts even upon complementation of the pex14 mutation. In addition, we analyzed whether peroxisomal membrane ghosts that harbor mutated Pex13pE320K still contain Pex14p. The subcellular localization of Pex14p, Pex14pAXXA, and peroxisomal membrane markers was analyzed by double immunofluorescence microscopy and flotation analysis. Colocalization was observed for HA-Pex11p and Pex14pAXXA in pex14 cells, as well as for HA-Pex11p and Pex14p in pex13 cells expressing Pex13pE320K, indicative of peroxisomal membrane association of these proteins (Fig. 9 A). These results were corroborated by flotation analysis which revealed that Pex14pAXXA was associated with the fraction containing the peroxisomal membrane ghosts of pex14/pex17, as were Pex14p in pex13/pex17 cells expressing Pex13pE320K (Fig. 9 B). These observations suggest that Pex14p is associated with peroxisomes and peroxisomal membrane ghosts independent of interaction between the proline-rich motif of Pex14p and the RT loop in the SH3 domain of Pex13p. Interestingly, the fractionation of pex13/ pex17[PEX13E320K] shows that, although the RT loop of the SH3 domain of Pex13p is not absolutely required for the targeting of Pex14p to the membrane of peroxisomal ghosts, it appears to enhance or stabilize the targeting, as only Pex14p trails through the gradients of this mutant strain (Fig. 9 B).
|
|
Discussion |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Involvement of Pex13p in Targeting of Pex14p to the Peroxisomal Membrane
The SH3 domain of Pex13p has been reported to interact with the PTS1 receptor Pex5p and with Pex14p (Elgersma et al., 1996; Erdmann and Blobel, 1996; Gould et al., 1996; Albertini et al., 1997; Fransen et al., 1998; Fig. 8). A mutation in the RT loop of the SH3 domain of Pex13p, as well as a mutation of a putative class II SH3 ligand motif of Pex14p abolished the two-hybrid interaction of both proteins (Fig. 8), supporting the notion of a typical SH3 domain-ligand interaction between Pex13p and Pex14p. Interestingly, although the E320K mutation of the RT loop of the SH3 domain of Pex13p abolishes its two-hybrid interaction with Pex14p, the mutated SH3 domain still interacts with Pex5p (Fig. 8 B). Accordingly, we conclude that there are distinct binding sites for both Pex5p and Pex14p within this domain or adjacent regions contained within the construct used for the assay.
Remarkably, neither the E320K mutation of the SH3 domain of Pex13p nor the mutation of the proline-rich motif of Pex14p prevented the peroxisomal localization of Pex14p (Fig. 9). This observation suggests that the binding of Pex14p to the SH3 domain of Pex13p is not absolutely required for the targeting and binding of Pex14p to peroxisomes. Why then does the absence of Pex13p lead to the mistargeting of Pex14p (Fig. 7)? One possibility is that Pex13p is a component of a protein complex at the peroxisomal membrane that may disintegrate in the absence of the entire protein, but remains stable without the SH3-dependent interaction between Pex13p and Pex14p. Association of Pex14p with the complex may not require a direct interaction with Pex13p, but may be mediated by other components of the complex. The simplest explanation for our observations on the Pex13p/Pex14p interaction is the existence of an as yet unrecognized binding partner for Pex13p that may also provide the binding site for Pex14p at the peroxisomal membrane. This missing link, however, is not Pex17p. It is true that Pex17p is another binding partner of Pex14p, but our data suggest that Pex17p is not required for association of the Pex13p/ Pex14p/Pex5p/Pex7p complex, as all these components can efficiently coprecipitate in the absence of Pex17p (Fig. 3). Moreover, we found no Pex17p in a precipitate from pex14 cells that still contains Pex13p and Pex7p (Fig. 3), leading to two conclusions. First, a subcomplex of Pex13p and Pex7p can form in the absence of Pex14p and Pex17p, and second, Pex14p is required for the association of Pex17p with the complex. The latter may be explained by the assumption that Pex17p is bound to the complex via Pex14p.
Pex7p/Pex13p Interaction
The amount of Pex7p in the membrane sediment of pex14 cells is significantly lower than in wild-type or pex13 cells (Fig. 2), suggesting that Pex14p may contribute to the majority of the total binding capacity of the peroxisomal membrane for the PTS2 receptor. However, a significant amount of Pex7p was sedimented in the absence of Pex14p (Fig. 2, lane pex14). Interestingly, in cells lacking both Pex13p and Pex14p, no Pex7p was found in the membrane pellet, which suggests that Pex13p contributed to the remaining Pex7p associated with peroxisomal membranes of pex14 cells (data not shown). This result, however, has to be interpreted with care since the double deletion of PEX13 and PEX14 did result in a significant decrease in immunologically detectable Pex7p (Girzalsky, W., and R. Erdmann, unpublished observations).
The observations that Pex13p and Pex7p interact in the two-hybrid system and can be efficiently coimmunoprecipitated indicate that the proteins interact in vivo (Figs. 3 and 4). Whether Pex13p directly binds Pex7p remains to be shown. Attempts to demonstrate direct binding of the proteins by coimmunoprecipitation of in vitro translated proteins were unsuccessful (data not shown). Our data do not exclude the existence of a bridging protein which would directly interact with both Pex13p and Pex7p, a requirement fulfilled by Pex14p. However, two observations indicate that the hypothetical bridging protein is not one of the known binding partners for Pex13p. First, the Pex7p/Pex13p interaction is also observed in the absence of these proteins (Figs. 3 and 4), and second, the COOH-terminal SH3 domain alone is sufficient for the Pex13p/ Pex14p and Pex13p/Pex5p two-hybrid interaction, but not for the interaction of Pex13p with Pex7p (Erdmann and Blobel, 1996). A direct interaction of Pex13p and Pex7p is further suggested by the genetic suppression of the defect caused by a functionally compromised HA-tagged Pex7p by overexpression of Pex13p (Fig. 5).
As discussed above, a Pex5p/Pex7p two-hybrid interaction is not observed in pex14 (Fig. 1). At first, this observation seems rather surprising, since both Pex5p and Pex7p independently interact with Pex13p in the two-hybrid system (Fig. 4). One could imagine that Pex13p may serve as a bridging molecule between the import receptors to mediate an indirect binding which could have emerged in the two-hybrid system. However, the amount of Pex5p simultaneously associated with the Pex7p-Pex13p complex may be too low to give a positive response. In support of this assumption, the amount of Pex5p coimmunoprecipitating with Pex7p in the absence of Pex14p is extremely reduced, despite the presence of significant amounts of Pex13p (Fig. 3, lane pex14). Perhaps Pex13p does not usually associate simultaneously with both of the import receptors, or association is transient.
The domain of Pex13 that interacts with Pex7p, as well as the side of the peroxisomal membrane where the interaction occurs, remains unknown. Furthermore, the intracellular localization of Pex7p in yeast is still a matter of debate. One group has reported that the protein is exclusively localized in the peroxisomal lumen (Zhang and Lazarow, 1995, 1996), whereas others found the protein to be predominantly localized in the cytosol with a small amount associated with the peroxisomal membrane (Marzioch et al., 1994; Rehling et al., 1996). Because the SH3 domain alone does not mediate the interaction with Pex7p, we suggest that regions NH2-terminal of the SH3 domain may be required for the interaction or contribute to the correct conformation of the binding site. Previously, the COOH-terminal SH3 domain has been reported to face the cytosol (Elgersma et al., 1996; Gould et al., 1996), and we found that both the NH2 terminus and the COOH terminus of Pex13p are exposed to the cytosol (Fig. 6), suggesting that the protein traverses the membrane with an even number of membrane spans. In this respect, it is interesting to note that two regions which would fulfill the requirement for 
-helical transmembrane segments are present in Pex13p (Elgersma et al., 1996).
The interaction of Pex13p with Pex7p has far reaching implications for our understanding of protein import into the peroxisomal matrix. Why are there several binding sites for the import receptors at the peroxisomal membrane? One hypothesis suggests that the multiple interactions reflect the existence of an import cascade in which the cargo-loaded import receptors are transferred from one component of the import complex to the next (Erdmann et al., 1997). Our confirmation that at least two peroxisomal membrane proteins bind the receptors raises concerns about which functions as the docking protein for each of the import pathways. Experimental evidence that Pex13p may be the docking protein for the PTS1 receptor has been provided (Gould et al., 1996), but the unsolved questions stress the need for reliable in vitro systems to study the order of interactions during the process of peroxisomal protein import.
|
Acknowledgments |
|---|
Submitted: 14 September 1998
Revised: 10 February 1999
Julia Kipper was supported by a fellowship from the Bochumer Graduiertenkolleg Biogenese und Mechanismen komplexer Zellfunktionen. This work was supported by grants from the Deutsche Forschungsgemeinschaft to R. Erdmann (Er178/2-1, Er178/2-2, and SFB 480) and to W.-H. Kunau (Ku329/17-3), as well as by the Fonds der Chemischen Industrie.
|
References |
|---|
|
TopAbstractMaterials and MethodsResultsDiscussionReferences |
|---|
Albertini M, Rehling P, Erdmann R, Girzalsky W, Kiel JAKW, Veenhuis M & Kunau W-H. Pex14p, a peroxisomal membrane protein binding both receptors of the two PTS-dependent import pathways, Cell, 1997, 89, 83–92.[Medline]
Ausubel, F.J., R. Brent, R.E. Kingston, D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl. 1992. Current Protocols in Molecular Biology. Greene Publishing Associates, New York. 13.1.2–13.1.7.
Bigl M & Escherich K. Overexpression of catalytically active yeast (Saccharomyces cerevisiae) fructose-1,6-bisphosphatase in Escherichia coli. , Biol Chem Hoppe-Seyle, 1994, 375, 153–160.[Medline]
Blobel F & Erdmann R. Identification of a peroxisomal member of the AMP-binding protein family, Eur J Biochem, 1996, 240, 468–476.[Medline]
Brocard C, Lametschwandtner G, Koudelka R & Hartig A. Pex14p is a member of the protein linkage map of Pex5p, EMBO (Eur Mol Biol Organ) J, 1997, 16, 5491–5500.[Medline]
Chevray PM & Nathans D. Protein interaction cloning in yeast: identification of mammalian proteins that react with the leucine zipper of Jun, Proc Natl Acad Sci USA, 1992, 89, 5789–5793.
De Hoop MJ & Ab G. Import of proteins into peroxisomes and other microbodies, Biochem J, 1992, 286, 657–669.[Medline]
Dodt G & Gould SJ. Multiple PEXgenes are required for proper subcellular distribution and stability of Pex5p, the PTS1 receptor: evidence that PTS1 protein import is mediated by a cycling receptor, J Cell Biol, 1996, 135, 1763–1774.
Elgersma Y & Tabak HF. Proteins involved in peroxisome biogenesis and functioning, Biochim Biophys Acta, 1996, 1286, 269–283.[Medline]
Elgersma Y, Kwast L, Klein A, Voorn-Brouwer T, van den Berg M, Metzig B, America T, Tabak HF & Distel B. The SH3 domain of the Saccharomyces cerevisiaeperoxisomal membrane protein Pex13p functions as a docking site for Pex5p, a mobile receptor for the import of PTS1 containing proteins, J Cell Biol, 1996, 135, 97–109.
Entian KD, Vogel RF, Rose M, Hofmann L & Mecke D. Isolation and primary structure of the gene encoding fructose-1,6-bisphosphatase from Saccharomyces cerevisiae. , FEBS Lett, 1988, 236, 195–200.[Medline]
Erdmann R. The peroxisomal targeting signal of 3-oxoacyl-CoA thiolase from Saccharomyces cerevisiae. , Yeast, 1994, 10, 935–944.[Medline]
Erdmann R & Blobel G. Giant peroxisomes in oleic acid-induced Saccharomyces cerevisiaelacking the peroxisomal membrane protein Pmp27p, J Cell Biol, 1995, 128, 509–523.
Erdmann R & Blobel G. Identification of Pex13p, a peroxisomal membrane receptor for the PTS1 recognition factor, J Cell Biol, 1996, 135, 111–121.
Erdmann R & Kunau W-H. Purification and immunolocalization of the peroxisomal 3-oxoacyl-CoA thiolase from Saccharomyces cerevisiae. , Yeast, 1994, 10, 1173–1182.[Medline]
Erdmann R, Veenhuis M, Mertens D & Kunau W-H. Isolation of peroxisome-deficient mutants of Saccharomyces cerevisiae. , Proc Natl Acad Sci USA, 1989, 86, 2432–2436.
Erdmann R, Veenhuis M & Kunau W-H. Peroxisomes: organelles at the crossroads, Trends Cell Biol, 1997, 7, 400–407.[Medline]
Fields S & Song OK. A novel genetic system to detect protein–protein interactions, Nature, 1989, 340, 245–246.[Medline]
Fransen M, Terlecky SR & Subramani S. Identification of a human PTS1 receptor docking protein directly required for peroxisomal protein import, Proc Natl Acad Sci USA, 1998, 95, 8087–8092.
Gietz RD & Sugino A. New yeast-E. coli shuttle vectors constructed with in vitromutagenized yeast genes lacking six-base pair restriction sites, Gene, 1988, 74, 527–534.[Medline]
Gould SJ, Kalish JE, Morrell JE, Bjorkman J, Urquhart AJ & Crane DI. Pex13 is an SH3 protein of the peroxisome membrane and a docking factor for the predominantly cytosolic PTS1 receptor, J Cell Biol, 1996, 135, 85–95.
Güldener U, Heck S, Fielder T, Beinhauer J & Hegemann JH. A new efficient gene disruption cassette for repeated use in budding yeast, Nucleic Acids Res, 1996, 24, 2519–2524.
Harlow, E., and D. Lane. 1988. Antibodies: A Laboratory Manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, NY. 451–511.
Hill JE, Myers AM, Koerner TJ & Tzagaloff A. Yeast E. colishuttle vectors with multiple unique restriction sides, Yeast, 1986, 2, 163–167.[Medline]
Höhfeld J, Veenhuis M & Kunau W-H. PAS3, a Saccharomyces cerevisiaegene encoding a peroxisomal integral membrane protein essential for peroxisome biogenesis, J Cell Biol, 1991, 114, 1167–1178.
Huhse B, Rehling P, Albertini M, Blank L, Meller K & Kunau W-H. Pex17p of Saccharomyces cerevisiaeis a novel peroxin and component of the peroxisomal protein translocation machinery, J Cell Biol, 1998, 140, 49–60.
Komori M, Rasmussen SW, Kiel JA, Baerends RJ, Cregg JM, van der Klei IJ & Veenhuis M. The Hansenula polymorpha PEX14gene encodes a novel peroxisomal membrane protein essential for peroxisome biogenesis, EMBO (Eur Mol Biol Organ) J, 1997, 16, 44–53.[Medline]
Lamb JR, Michaud WA, Sikorski RS & Hieter PA. Cdc16p, Cdc23p and Cdc27p form a complex for mitosis, EMBO (Eur Mol Biol Organ) J, 1994, 13, 4321–4328.[Medline]
Lazarow PB & Fujiki Y. Biogenesis of peroxisomes, Ann Rev Cell Biol, 1985, 1, 489–530.
Marshall PA, Krimkevich YI, Lark RH, Deyer JM, Veenhuis M & Goodman JM. PMP27promotes peroxisome proliferation, J Cell Biol, 1995, 129, 345–355.
Marzioch M, Erdmann R, Veenhuis M & Kunau W-H. PAS7encodes a novel yeast member of the WD-40 protein family essential for import of 3-oxoacyl-CoA thiolase, a PTS2-containing protein, into peroxisomes, EMBO (Eur Mol Biol Organ) J, 1994, 13, 4908–4918.[Medline]
McNew JA & Goodman JM. The targeting and assembly of peroxisomal proteins: some old rules do not apply, Trends Biochem Sci, 1996, 21, 54–58.[Medline]
Moreno de la Garza M, Schulz-Borchard U, Crabb JW & Kunau W-H. Purification of a multifunctional protein processing enoyl-CoA hydratase, 3-hydroxyacyl-CoA dehydrogenase and 3-hydroxyacyl-CoA epimerase activities, Eur J Biochem, 1985, 148, 285–291.[Medline]
Rachubinski RA & Subramani S. How proteins penetrate peroxisomes, Cell, 1995, 83, 525–528.[Medline]
Rehling P, Marzioch M, Niesen F, Wittke E, Veenhuis M & Kunau W-H. The import receptor for the peroxisomal targeting signal 2 (PTS2) in Saccharomyces cerevisiae is encoded by the PAS7gene, EMBO (Eur Mol Biol Organ) J, 1996, 15, 2901–2913.[Medline]
Rout MP & Kilmartin JV. Components of the yeast spindle pole body, J Cell Biol, 1990, 111, 1913–1927.
Sikorski RS & Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. , Genetics, 1989, 122, 19–27.
Subramani S. Protein translocation into peroxisomes, J Biol Chem, 1996, 271, 32483–32486.
van der Klei IJ & Veenhuis M. Peroxisome biogenesis in the yeast Hansenula polymorpha: a structural and functional analysis, Ann New York Acad Sci, 1996, 804, 47–59.[Medline]
Van der Leij I, Franse MM, Elgersma Y, Distel B & Tabak HF. PAS10 is a tetratricopeptide-repeat protein that is essential for the import of most matrix proteins into peroxisomes of Saccharomyces cerevisiae. , Proc Natl Acad Sci USA, 1993, 90, 11782–11786.
Veenhuis M, Mateblowski M, Kunau W-H & Harder W. Proliferation of microbodies in Saccharomyces cerevisiae. , Yeast, 1987, 3, 77–84.[Medline]
Wach A, Brachat A, Pöhlmann R & Philippsen P. New heterologous modules for classical or PCR-based gene disruptions in Saccharomyces cerevisiae. , Yeast, 1994, 10, 1793–1808.[Medline]
Yon J & Fried M. Precise gene fusion by PCR, Nucleic Acids Res, 1989, 17, 4895, .
Zhang JW & Lazarow PB. PEB1 (PAS7) in Saccharomyces cerevisiaeencodes a hydrophilic, intra-peroxisomal protein that is a member of the WD repeat family and is essential for the import of thiolase into peroxisomes, J Cell Biol, 1995, 129, 65–80.
Zhang JW & Lazarow PB. PEB1(PAS7) is a intraperoxisomal receptor for the NH2-terminal, type 2, peroxisomal targeting sequence of thiolase: Peb1p itself is targeted to peroxisomes by an NH2-terminal peptide, J Cell Biol, 1996, 132, 325–334.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Facebook 
Reddit 
Technorati 
Twitter What's this?
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|
