|
||
© The Rockefeller University Press,
0021-9525/1999//1103 $5.00
The Journal of Cell Biology, Volume 145, Number 5,
, 1999 1103-1115
Regular Articles |
Expression of the Heparan Sulfate Proteoglycan, Perlecan, during Mouse Embryogenesis and Perlecan Chondrogenic Activity In Vitro




Department of Basic Science, University of Texas, Dental Branch, Houston, Texas 77030; and
Department of Pediatrics, University of Texas Medical School, Houston, Texas 77030
Expression of the basement membrane heparan sulfate proteoglycan (HSPG), perlecan (Pln), mRNA, and protein has been examined during murine development. Both Pln mRNA and protein are highly expressed in cartilaginous regions of developing mouse embryos, but not in areas of membranous bone formation. Initially detected at low levels in precartilaginous areas of d 12.5 embryos, Pln protein accumulates in these regions through d 15.5 at which time high levels are detected in the cartilage primordia. Laminin and collagen type IV, other basal lamina proteins commonly found colocalized with Pln, are absent from the cartilage primordia. Accumulation of Pln mRNA, detected by in situ hybridization, was increased in d 14.5 embryos. Cartilage primordia expression decreased to levels similar to that of the surrounding tissue at d 15.5. Pln accumulation in developing cartilage is preceded by that of collagen type II. To gain insight into Pln function in chondrogenesis, an assay was developed to assess the potential inductive activity of Pln using multipotential 10T1/2 murine embryonic fibroblast cells. Culture on Pln, but not on a variety of other matrices, stimulated extensive formation of dense nodules reminiscent of embryonic cartilaginous condensations. These nodules stained intensely with Alcian blue and collagen type II antibodies. mRNA encoding chondrocyte markers including collagen type II, aggrecan, and Pln was elevated in 10T1/2 cells cultured on Pln. Human chondrocytes that otherwise rapidly dedifferentiate during in vitro culture also formed nodules and expressed high levels of chondrocytic marker proteins when cultured on Pln. Collectively, these studies demonstrate that Pln is not only a marker of chondrogenesis, but also strongly potentiates chondrogenic differentiation in vitro.
Key Words: heparan sulfate proteoglycan perlecan chondrogenesis
Abbreviations used in this paper: bFGF, basic FGF; CS, chondroitin sulfate; GAG, glycosaminoglycan; HP, heparin; HS, heparan sulfate; Pln, perlecan.
Address correspondence to D.D. Carson, Department of Biological Sciences, University of Delaware, 117 Wolf Hall, Newark, DE 19716. Tel.: (302) 831-6977. Fax: (302) 831-2281. E-mail: dcarson{at}udel.edu
CARTILAGE serves as a multifunctional tissue in the vertebrate body. It is found in adult structures, providing a flexible support in the nose, trachea, spine, and rib tips. Found also in the developing embryo, cartilage provides a framework for endochondral bone formation. During embryonic development, subsets of mesenchymal cells generate hypertrophic chondrocytes through a stepwise progression of chondrogenesis. This process begins with mesenchymal cell condensation. As condensed cells further differentiate into chondroblasts, collagen expression transitions from type I to type II (Castagnola et al., 1988). Further maturation into hypertrophic chondrocytes is marked by the expression of aggrecan and collagen type X (Kirsch and von der Mark, 1990; Elima et al., 1993). In endochondral bone formation, ossification of cartilage follows. In the search for chondrogenic factors, a variety of growth factors have been examined. Basic FGF (bFGF),1 TGF-β1, and its family members, BMP-2 and -4, are the most commonly used growth factors for in vitro assays of chondrocyte differentiation. BMP-2 is of particular interest in chondrogenesis due to its ability to induce bone in vitro via an endochondral pathway (Katagiri et al., 1990; Wang et al., 1990; Wozney et al., 1990) and osteoblastic maturation in vitro (Yamaguchi et al., 1991). During development, BMP-2 mRNA is expressed in the dorsal condensing mesenchyme and later in the periosteum and osteogenic zone. TGF-β1 is also detected in the periosteum as well as in other bone cells and tissues (Lehnert et al., 1988). In vitro assays demonstrated that TGF-β1 can stimulate the formation of chondrocytes (Rosen et al., 1988; Frenz et al., 1991; Denker et al., 1995; Basic et al., 1996). BMP-4, another TGF-β family member, is a mesodermal inducing factor in Xenopus, and is required for the formation of mesoderm in mice (Winnier et al., 1995). As a promoter of mesodermal induction, BMP-4 might stimulate the condensation of mesenchyme, initiating the cascade of chondrogenesis. Along with these TGF-β superfamily members, bFGF is also thought to induce differentiation in mesodermal cells (Smith, 1993).
Cartilage is known to contain a variety of proteoglycans primarily carrying glycosaminoglycan chains other than heparan sulfate (HS). Aggrecan, decorin, biglycan, and fibromodulin are well studied chondroitin sulfate (CS), keratan sulfate, and dermatan sulfate proteoglycans, respectively, found in chondrocyte matrix (Roughley and Lee, 1994). Recently, the HS proteoglycan perlecan (Pln) has been identified as a component of chondrocyte matrix (Iozzo et al., 1994; SundarRaj et al., 1995; Handler et al., 1997). Syndecan-2, a cell surface HS proteoglycan, also has been identified in chondrocytes (David et al., 1993). Both Pln and syndecan-2 carry HS chains in cartilage (David et al., 1993; SundarRaj et al., 1995).
Previous studies with cultures of chick limb bud mesenchymal cells proposed a role for HS in formation and growth of chondrogenic regions. When these cells were cultured in the presence of soluble HS or heparin (HP), the numbers of aggregates and 35S-sulfate incorporation increased. This effect was dependent on HS chain structure, size, and charge. CS, lacking L-iduronic acid, and less sulfated than HS derivatives, had little activity in this assay. The presence of HS or HP was proposed to promote the growth of the aggregates through assisting in formation of tighter aggregates, thereby detaching the cells from matrix molecules that would maintain cells in a less differentiated state (SanAntonio et al., 1987).
In this study, the pattern of Pln protein and mRNA expression during murine development was examined. High levels of Pln protein were detected in developing cartilage and compared with cartilage markers such as collagen type II and Alcian blue staining, an index of proteoglycan accumulation. Because of their multipotential nature, the mouse embryonic fibroblast cell line 10T1/2 has been used extensively in assays to study the developmental progression of chondrogenesis and osteogenesis in vitro (Taylor and Jones, 1979; Konieczny and Emerson, 1984; Ahrens et al., 1993; Gazit et al., 1993; Wang et al., 1993; Atkinson et al., 1997). Assays using this cell line, as well as human chondrocytes, demonstrate that Pln can both stimulate and maintain chondrogenic differentiation in vitro, suggesting a similar potentiating role in vivo.
| Materials and Methods |
|---|
|
|
|---|
Immunofluorescent Detection of Extracellular Matrix Components
Under the I.A.U.C.C. approved guidelines for animal use, CF-1 female mice were subjected to superovulation by intraperitoneal injection of 5 IU pregnant mare serum gonadotropin followed by 5 IU human chorionic gonadotropin (hCG) 48 h later. After hCG injection, females were caged with stud males overnight. Females were inspected the next morning for vaginal plugs, indicating d 0.5 of pregnancy at noon. Uteri and embryos were collected on various days of pregnancy. The tissue was snap frozen in isopentane chilled by dry ice and stored at –70°C. 8-µm sections cut on a Reichert-Jung cryostat were allowed to air dry briefly and stored at –70°C until they were processed. Immunostaining was carried out as described previously (Carson et al., 1993). Sections were not decalcified before staining. In brief, sections or wells were fixed in 100% methanol for 10 min at room temperature, washed with Dulbecco's PBS without magnesium or calcium (D-PBS) twice for 5 min each, incubated with the primary antibody for 1 h at 37°C, washed with D-PBS three times for 5 min each, incubated with the secondary antibody for 45 min at 37°C, washed with D-PBS three times for 10 min, and mounted. Samples were stored in the dark at –20°C until they were photographed on a Leitz microscope equipped for epifluorescence. Some sections were pretreated with hyaluronidase to ensure no epitopes were masked. Frozen sections were washed in PBS three times for 4 min each before treatment with hyaluronidase (4 mg/ml in PBS, pH 5) at 37°C for 30 min. After treatment, sections were washed for 4 min in PBS and the standard staining procedure described above was followed, starting with fixation in methanol. Detection of HS chains in the tissue was performed as described previously (Carson et al., 1993). In brief, methanol fixed sections were rehydrated in 0.15 M NaCl, 20 mM EDTA, and 10 mM Tris, pH 8 (TEN), and incubated with human recombinant bFGF (0.05 µg/ml in TEN) for 2 h at 37°C in a humid chamber. Sections were then washed with TEN three times for 5 min each at room temperature, incubated with rabbit anti–human bFGF for 1 h at 37°C, washed again as before, incubated with FITC-conjugated donkey anti–rabbit antibody for 40 min at 37°C, washed three times for 10 min each, and mounted in glycerol/PBS (9:1, vol/vol) buffered to pH 8 with 0.5 M sodium carbonate buffer, pH 9, and containing 0.1% (wt/vol) p-phenylenediamine.
Detection of Pln mRNA by In Situ Hybridization
Embryos were isolated on either d 14.5 or d 15.5 of pregnancy and frozen as described above. In situ hybridization was performed as described previously (Smith et al., 1997). The Pln probe was prepared as described previously (Smith et al., 1997). In brief, linearized Pln cDNA clone 5 was used in an in vitro transcription kit from Ambion Inc. Probes were purified using phenol/chloroform extraction and ethanol precipitation. Hydrolysis to reduce probe size was performed and afterwards probes were resuspended in 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, and 10 mM dithiothreitol and stored at –70°C until use.
10-µm frozen sections were prepared as described above and used in in situ hybridization as described (De et al., 1989; McMaster et al., 1992). Sections were not decalcified before use. In brief, sections were fixed in 4% (wt/vol) paraformaldehyde for 15 min after thawing. Each sample was incubated with 2 x 107 cpm/ml 35S-labeled riboprobe after prehybridization and covered with a siliconized coverslip. After hybridization at 45°C for 4 h, sections were digested with RNase A (20 µg/ml) at 37°C for 15 min. After 2 wk of autoradiography with Kodak NTB-2 emulsion, hybridized probe was visualized after development. Sections were counterstained with hematoxylin and eosin.
Culture of 10T1/2 Cells or Human Chondrocytes on Various Matrix Components
Tissue culture dishes of either 4 wells (Nunc) or 24 wells (Corning) were coated with 5 µg each of the following matrix components: Pln (9 nmol/ well), HP (330 nmol/well), HP-BSA (HP chains covalently linked to BSA, 41 nmol/well), BSA (75 nmol/well), bovine intestinal mucosa HS (660 nmol/well), collagen type IV (16 nmol/well), laminin (5 nmol/well), fibronectin (11 nmol/well), or Matrigel. For coating wells, 5 µg of the matrix component was added to the well followed by D-PBS to attain a total volume of 200 µl. The area of wells in either the 4- or 24-well dishes is 1.76 cm2 (4-well plates from Nunc, Nunclon, Cat. No. 176740; 24-well plates from Costar Corp., Cat. No. 3524). Matrigel was applied undiluted to the well as a thin layer and excess was removed immediately. The plate was allowed to dry overnight at 37°C. In all cases, on the following day wells were washed twice with D-PBS before adding cells. Coating efficiency was determined by including 125I-iodine labeled Pln at the time of coating and counting material rinsed from the wells. Bound Pln gave a coating density of 1.5 µg Pln/cm2.
Murine 10T1/2 cells obtained from ATCC were maintained as subconfluent cultures in tissue culture flasks with Dulbecco's modified Eagle's media/Ham's F12 (1:1) media containing 100 mg/ml streptomycin sulfate, 100 U/ml penicillin, 1.2 g/liter NaHCO3, and 15 mM Hepes (pH 7.2) supplemented with 10% (vol/vol) heat-inactivated FBS. For matrix assays, cells were detached with trypsin/EDTA (Irvine Scientific) and plated on matrix-coated wells in CMRL-1066 media supplemented with antibiotics and either high (15% [vol/vol]) or low (2.5% [vol/vol]) FBS for preliminary experiments. In later experiments, the media was supplemented with 15% (vol/vol) FBS, pyruvate (50 µg/mg), citrate (50 µg/ml), and ascorbic acid (50 µg/ml). Plating density was 2 x 105 cells per well (114,600 cells per cm2). Media was added to bring the total volume in a well to 500 µl. Media was changed every other day during assays. For growth factor assays, growth factors were added at 1 ng/ml (bFGF, BMP-2 at 0.055 nM, TGF-β1 at 0.2 nM, and BMP-4 at 0.063 nM) to CMRL-1066 supplemented with 15% (vol/vol) FBS, citrate, ascorbate, and pyruvate. Medium was changed every other day and a fresh aliquot of growth factor added.
Human costochondral cartilage samples were acquired from pectus excavatum surgeries after appropriate consent was obtained and with institutional IRB approval. Cartilage samples were minced and digested in collagenase, 2 mg/ml, overnight at 37°C. The chondrocytes were plated and grown in DMEM with 15% FBS. All chondrocytes were expanded in monolayer cultures, and used at passage 3.
Formation of aggregates was assessed by visual examination using a microscope. Cells that had drawn together into dense, multi-layered regions reminiscent of condensing mesenchyme of developing cartilage, leaving areas of the well bare, were scored as aggregate positive. Also, cells in these regions were highly rounded compared with the fibroblastic morphology typical of 10T1/2 cells. To determine whether expression of chondrocyte markers was uniform throughout the aggregate mass, aggregates formed on Pln were fixed in paraformaldehyde, embedded in cryoprotectant, and sectioned. Alcian blue staining was performed before embedding. Sections were processed for immunostaining as described for tissue sections. Cells grown on plastic were similarly treated and scraped off the plate before embedding.
Enzymatic Digestion of Glycosaminoglycan (GAG) Chains
Wells were coated with Pln, as described above. Before plating of 10T1/2 cells, wells were subjected to digestion with chondroitinase ABC (Sigma Chemical Co.) or a mix of heparinases I, II, and III (Sigma Chemical Co.). To each well, 0.25 ml of enzyme mix containing 1 U/ml enzymes, 0.5 mM Mg2+/Ca2+, a protease inhibitor mixture (PIMS I described in Pimental et al., 1996) in D-PBS was added. Plates were incubated at 37°C for 4 h. After digestion, wells were rinsed with D-PBS before plating cells. As a control, 0.5 ml of CS or HP at 1 mg/ml was treated with enzyme or with buffer lacking enzyme for the same time. After digestion of control solutions, 1/10 volume 10% (wt/vol) cetylpyridinium chloride was added to precipitate and visualize GAGs to confirm enzyme activity. A successful digest resulted in at least 50% reduction of precipitated GAGs in the digested control compared with undigested. To determine if digestion removed Pln from wells, digested and undigested Pln wells were subjected to an ELISA binding assay. No loss of Pln protein core through digestion was detected by this assay.
Identification of Chondrocytic Phenotype by Alcian Blue Staining
10T1/2 cells were cultured for 10 d on various matrices, washed twice with D-PBS, and fixed for 15 min in 10% (wt/vol) paraformaldehyde in PBS. After fixation, cells were washed twice with ultrapure water before Alcian blue (1% [wt/vol]) in 0.1 N HCl was added to the cells for 30 min. Cells were washed twice with 0.1 N HCl and allowed to dry. Photography was performed on a Nikon inverted microscope using bright-field conditions.
RNA Extraction
After culture for various times on different matrices, RNA was isolated from
4 x 105 10T1/2 cells per treatment using the method of Chomczynski and Sacchi (1987). After determining the concentration of RNA for each sample, reverse transcription and polymerase chain reactions (RT-PCR) were performed.
Analysis of Gene Expression by RT-PCR
PCR primers for various chondrocyte markers were acquired from GIBCO-BRL. Collagen type I
2: forward 5' GAACGGTCCACGATTGCATG 3', reverse 5' GGCATGTTGCTAGGCACGAAG 3'; collagen type II
1: forward 5' CACACTGGTAAGTGGGGCAAGACCG 3', reverse 5' GGATTGTGTTGTTTCAGGGTTCGGG 3' (Shukunami et al., 1996); aggrecan: forward 5' CTACGACGCCATCTGCTACA 3', reverse 5' ACGAGGTCCTCACTGGTGAA 3' (Doege et al., 1987); Pln: forward 5' CCTACGATGGCCTTTCCCT 3', reverse 5' TTGGCACTTGCATCCTCCA 3' (Smith et al., 1997). First-strand cDNA was synthesized with total RNA extracted from cultured cells by random hexamer priming using an RNA PCR kit (Perkin Elmer). In brief, purified total RNA (840 ng) was incubated at 42°C for 60 min with a mixture of 1 U of RNase inhibitor, 2.5 U of MuLV reverse transcriptase, 2.5 µM of random hexamers, 5 mM MgCl2, 10 mM Tris-HCl (pH 8.3), 50 mM KCl, and 1 mM each of dGTP, dATP, dTTP, and dCTP in a volume of 20 µl.
Aliquots of 1/10 (2 µl) of the cDNA were used to amplify coding sequences from type I and type II collagen, Pln, and aggrecan. The PCR conditions for collagen types I and II were 94°C for 30 s, 60°C for 1 min, 72° for 1 min for 25 cycles, and final extension at 72°C for 5 min. The PCR conditions for Pln and aggrecan were 94°C for 30 s, 55°C for 30 s, 72°C for 1.5 min for 25 cycles, and 94°C for 30 s, 68°C for 30 s, 72°C for 1.5 min for 25 cycles, respectively. The products were separated by electrophoresis through 4% Nusieve 3:1 agarose gels (FMC Bio Products) along with molecular weight markers and detected by ethidium bromide. PCR products were subsequently sequenced and determined to be specific for either Col I or Col II.
| Results |
|---|
|
|
|---|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| Discussion |
|---|
|
|
|---|
Initial assays determined that 10T1/2 plated on Pln and, to a lesser extent, the Pln-containing matrix, Matrigel, formed aggregates and stained positively with Alcian blue. The ability of 10T1/2 cells to undergo chondrogenic differentiation in vitro may be enhanced by the chondrogenic transcription factor, SOX9 (Bell et al., 1997). In developing cartilage, SOX9 expression precedes that of Pln (Bell et al., 1997). Interestingly, 10T1/2 cells express much higher levels of SOX9 than Balb-c 3T3 cells (Lefebvre et al., 1997). This may account, in part, for the ability of 10T1/2, but not 3T3 cells to differentiate more completely in response to Pln; however, 3T3 cells stably transfected with SOX9 form aggregates, but fail to stain with Alcian blue as completely as 10T1/2 cells (data not shown). Collectively, these data suggest that while SOX9 may be necessary, it is not sufficient to promote chondrogenesis either alone or in combination with Pln.
As described previously, other extracellular matrix molecules and glycosaminoglycans fail to induce differentiation. Heparinase-treated Pln displayed inductive ability, albeit at a greatly reduced rate compared with intact Pln. These experiments indicate that cooperation between the Pln core protein and its constituent HS chains occurs in the potentiation of chondrogenesis. To exclude action of potential contaminating growth factors, certain inactive Pln preps, obtained from either commercial sources or prepared in our laboratory, were supplemented with growth factors previously proposed as chondrogenic agents, i.e., bFGF, BMP-2, BMP-4, and TGF-β1. These potential contaminants failed to stimulate nodule formation on inactive Pln preparations. It was surprising that neither BMPs nor TGF-β1 stimulated chondrogenesis on surfaces coated with inactive Pln since these growth factors do so when 10T1/2 cells are cultured under other conditions (Katagiri et al., 1990; Denker et al., 1995; Atkinson et al., 1997). The assay developed here relies on the response of the cells to a matrix molecule presented in a solid phase, presumably similar to the state found in vivo. The features differentiating inactive Pln from the active preparations have not yet been clarified. However, it is clear that both the GAG chains and the protein core participate in this activity. Damage to the protein core or HS chain alteration, e.g., heparanase digestion or undersulfation, might result in a lack of activity in the 10T1/2 assay. We have found that chondrogenic activity maps to particular recombinant Pln domains and requires glycosaminoglycans (French, M., M. Hook, R. Timpl, and D.D. Carson, unpublished observations). It is possible that, in the absence of appropriate glycosaminoglycan chains, portions of cell surface receptors or binding sites become occupied that require glycosaminoglycan interactions to transmit signals fully. FGF receptors require such interactions with HS chains in complexes with FGFs (Yayon et al., 1991; Aviezer et al., 1994; Kan et al., 1996). In the absence of appropriate glycosaminoglycan complexes at these sites, cells may become locked in a state preventing them from responding to other signals. In addition, the observation that the Pln that is active in solid phase assays is inactive in soluble form also indicates that the context of Pln presentation is an important aspect of this response. The receptors involved in Pln recognition by 10T1/2 cells must be identified to understand these responses in molecular detail.
Rinsing of Pln-coated surfaces with high salt concentrations, a treatment that would be expected to release HS-bound growth factors (McCaffrey et al., 1992) had no effect on this inductive activity. From these assays, inductive activity appears to be dependent in part on both the Pln core protein and the HS chains. This may account for the lack of inductive activity in some Pln preparations. If cells require interaction with both the HS chains and the core protein to elicit a full response, one or the other interaction might act to block stimulation from another source. Thus, contact with the core protein of inactive Pln primes the 10T1/2 cells to respond to stimulation from a linked HS chain. In the absence of the chain, the cell may be unable to respond to TGF-β or BMP-4 signals. Variations in isolation protocols or the actions of tissue heparanases during isolation could account for a depletion of specific classes of HS structures in these preparations. A preference for more highly negative molecules containing L-iduronic acid by differentiating chondrocytes in micromass culture has been demonstrated by SanAntonio et al. (1987). If larger and more negatively charged HS chains were selected against in the isolation process, or were degraded by tissue heparanases during isolation, the stimulatory effect of Pln might be lost or reduced. Another possibility is the large Pln core protein may become partially denatured or otherwise modified at subtle, yet critical, sites during isolation.
A simple model for the action of Pln on chondrogenesis focuses on attachment of the cells to a matrix. If cell– matrix interactions are impaired, then the cells would remain more rounded and attach to each other rather than the matrix, forming aggregates. When cultures from chick limb buds were supplemented with soluble HS or HP, increased aggregate formation and sulfate incorporation, i.e., glycosaminoglycan synthesis, was observed (SanAntonio et al., 1987). In these studies, it was suggested that a possible effect of the HS/HP was to free the cells from their attachment to the matrix, allowing them to round up and promoting cell–cell interaction. The induction of chondrogenesis observed in the present studies is more complex. Induction of chondrogenesis in vitro appears to require some specific interaction and binding to Pln. 10T1/2 cells attach, but do not spread, on Pln. Also, Pln can maintain human chondrocytes in their differentiated form in vitro. In contrast, human fibroblasts do not attach to or differentiate on Pln-coated surfaces. It remains unclear which receptor systems trigger chondrogenesis in vitro. Such systems appear to involve both HS- and Pln-recognizing events. Complexes containing integrin subunits
v, β3, and β1 have been reported to bind Pln, although Pln lacking HS chains appeared to be more effectively recognized (Hayashi et al., 1992). These integrin subunits also have been detected in developing cartilage (Woods et al., 1994).
While several potential chondrogenic factors have been identified, none of these factors have been examined in the context of interactions with the extracellular matrix surrounding the cells in vivo. In this study, examination of temporal and spatial patterns of the extracellular matrix protein, Pln, supports a role for this protein in the program of maturation or maintenance of chondrocytes. The combination of appropriate extracellular matrix molecules with various growth factors, secreted either by chondrocytes or surrounding cells, may prove to be an essential mix for development of cartilage in vivo.
| Acknowledgments |
|---|
Submitted: 28 May 1998
Revised: 5 April 1999
The authors wish to acknowledge Dr. J. Hassell for the kind gift of Pln clone 5; Dr. Randy Johnson for the generous gift of BMP-2 and -4; Bill Woods at Becton Dickinson Labware for assistance with obtaining Pln; Dr. M.M. DeSouza, Dr. C. Begue-Kirn, D. Hoke, J. Julian, R. Kardon, E. Lagow, and X. Zhou for helpful discussion; Karen Hensley for graphics generation; and Sharron Kingston for secretarial assistance.
| References |
|---|
|
|
|---|
Ahrens M, Ankenbauer T, Schroder D, Hollnagel A, Mayer H & Gross G. Expression of bone morphogenetic proteins-2 or -4 in murine mesenchymal progenitor C3H10T1/2 cells induces differentiation into distinct mesenchymal cell lineages, DNA Cell Biol, 1993, 12, 871–830.[Medline]
Atkinson BL, Fantle KS, Benedict JJ, Huffer WE & Gutierrez-Hartmann A. Combination of osteoinductive bone proteins differentiates mesenchymal C3H/10T1/2 cells specifically to the cartilage lineage, J Cell Biochem, 1997, 65, 325–339.[Medline]
Aviezer D, Hecht D, Safran M, Eisinger M, Guido G & Yayon A. Pln, a basal lamina proteoglycan, promotes basic fibroblast growth factor- receptor binding, mitogenesis and angiogenesis, Cell, 1994, 79, 1005–1013.[Medline]
Basic N, Basic V, Bulic K, Grgic M, Kleinman H, Luyten F & Vukicevic S. TGF-β and basement membrane Matrigel stimulate the chondrogenic phenotype in osteoblastic cells derived from fetal rat calvaria, J Bone Miner Res, 1996, 11, 384–391.[Medline]
Bell DM, Leung KK, Wheatley SC, Ng LJ, Zhou S, Ling KW, Sham MH, Koopman P, Tam PP & Cheah KS. SOX9 directly regulates the type-II collagen gene, Nat Genet, 1997, 16, 174–178.[Medline]
Carson DD, Tang J & Julian J. Heparan sulfate proteoglycan expression by periimplantation stage embryos, Dev Biol, 1993, 155, 97–106.[Medline]
Castagnola P, Dozin B, Moro G & Cancedda R. Changes in the expression of collagen genes show two stages in chondrocyte differentiation in vitro, J Cell Biol, 1988, 106, 461–467.
Chomczynski P & Sacchi N. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction, Anal Biochem, 1987, 162, 156–159.[Medline]
David G, Bai XM, Van der Schueren B, Marynen P, Cassiman J-J & Van den Berghe H. Spatial and temporal changes in the expression of fibroglycan (syndecan-2) during mouse embryonic development, Development, 1993, 119, 841–854.
De SK, McMaster MT, Dey SK & Andrews GK. Cell-specific metallothionein gene expression in mouse decidua and placentae, Development, 1989, 107, 611–621.[Abstract]
Denker AE, Nicoll SB & Tuan RS. Formation of cartilage-like spheroids by micromass cultures of murine C3H10T1/2 cells upon treatment with transforming growth factor-β1, Differentiation, 1995, 59, 25–34.[Medline]
Doege K, Sasaki M, Horigan E, Hassel JR & Yamada Y. Complete primary structure of the rat cartilage proteoglycan core protein deduced from cDNA clones, J Biol Chem, 1987, 262, 17757–17767.
Elima K, Eerola I, Rosati R, Metsaranta M, Garofalo S, Perala M, De Crombrugghe B & Vuorio E. The mouse collagen X gene: complete nucleotide sequence, exon structure and expression pattern, Biochem J, 1993, 289, 247–253.[Medline]
Frenz DA, Williams JD & Van de Water TR. Initiation of chondrogenesis in cultured periotic mesenchyme, Ann NY Acad Sci, 1991, 630, 256–258.[Medline]
Gazit D, Reinhard E, Kahn A & Derynck R. Modulation of expression and the cell surface binding of members of the transforming growth factor-β superfamily during retinoic acid-induced osteoblastic differentiation of multipotential mesenchymal cells, Mol Endocrinol, 1993, 7, 189–198.
Handler M, Yurchenco PD & Iozzo RV. Developmental expression of perlecan during murine embryogenesis, Dev Dyn, 1997, 210, 130–145.[Medline]
Hayashi K, Madri JA & Yurchenko PD. Endothelial cells interact with the core protein of basement membrane perlecan through β1 and β3 integrins: an adhesion modulated by glycosaminoglycan, J Cell Biol, 1992, 119, 945–959.
Iozzo RV, Cohen IR, Grassel S & Murdoch AD. The biology of Pln: the multifaceted heparan sulphate proteoglycan of basement membranes and pericellular matrices, Biochem J, 1994, 302, 625–639.[Medline]
Kan M, Wang F, To B, Gabriel JL & McKeehan WL. Divalent cations and heparin/heparan sulfate cooperate to control assembly and activity of the fibroblast growth factor receptor complex, J Biol Chem, 1996, 271, 26143–26148.
Katagiri T, Yamaguchi A, Ikeda T, Yoshiki S, Wozney JM, Rosen V, Wang EA, Tanaka H, Omura S & Suda T. The non-osteogenic mouse pluripotent cell line, C3H10T1/2, is induced to differentiate into osteoblastic cells by recombinant human bone morphogenetic protein-2, Biochem Biophys Res Commun, 1990, 172, 295–299.[Medline]
Kirsch T & von der Mark K. Isolation of bovine type X collagen and immunolocalization in growth-plate cartilage, Biochem J, 1990, 265, 453–459.[Medline]
Konieczny SF & Emerson CP. 5-Azacytidine induction of stable mesodermal stem cell lineages from 10T1/2 cells: evidence for regulatory genes controlling determination, Cell, 1984, 38, 791–800.[Medline]
Lefebvre V, Huang W, Harley V, Goodfellow P & de Crombrugghe B. SOX9 in a potent activator of the chondrocyte-specific enhancer of the pro
1(II) collagen gene, Mol Cell Biol, 1997, 17, 2336–2346.[Abstract]
Lehnert SA & Akhurst RJ. Embryonic expression pattern of TGF beta type-1 RNA suggests both paracrine and autocrine mechanisms of action, Development, 1988, 104, 263–273.[Abstract]
McCaffrey TA, Falcone DJ & Du B. Transforming growth factor-beta 1 is a heparin-binding protein: identification of putative heparin-binding regions and isolation of heparins with varying affinity for TGF-β1, J Cell Physiol, 1992, 152, 430–440.[Medline]
McMaster MT, Newton RT, Dey SK & Andrews GK. Activation and distribution of inflammatory cells in the mouse uterus during the preimplantation period, J Immunol, 1992, 148, 1699–1705.[Abstract]
Pimental RA, Julian J, Gendler SJ & Carson DD. Intracellular trafficking and metabolism of Muc-1 in polarized mouse uterine epithelial cells, J Biol Chem, 1996, 271, 28128–28137.
Rosen D, Stempien SA, Thompson AY & Seyedin SM. Transforming growth factor-beta modulates the expression of osteoblast and chondroblast phenotypes in vitro, J Cell Physiol, 1988, 134, 337–346.[Medline]
Roughley PJ & Lee ER. Cartilage proteoglycans: structure and potential functions, Microsc Res Tech, 1994, 28, 385–397.[Medline]
SanAntonio JD, Winston BM & Tuan RS. Regulation of chondrogenesis by heparan sulfate and structurally related glycosaminoglycans, Dev Biol, 1987, 123, 17–24.[Medline]
Shukunami C, Shigeno C, Atsumi T, Ishizeki K, Suzuki F & Hiraki Y. Chondrogenic differentiation of clonal mouse embryonic cell line ATDC5 in vitro: differentiation-dependent gene expression of parathyroid hormone (PTH)/PTH-related peptide receptor, J Cell Biol, 1996, 133, 457–468.
Smith JC. Mesoderm-inducing factors in early vertebrate development, EMBO (Eur Mol Biol Organ) J, 1993, 12, 4463–4470.[Medline]
Smith SE, French MM, Julian J, Paria BC, Dey SK & Carson DD. Expression of heparan sulfate proteoglycan (Pln) in the mouse blastocyst is regulated during normal and delayed implantation, Dev Biol, 1997, 184, 38–47.[Medline]
SundarRaj N, Fite D, Ledbetter S, Chakravarti S & Hassell JR. Perlecan is a component of cartilage matrix and promotes chondrocyte attachment, J Cell Sci, 1995, 108, 2663–2672.[Abstract]
Taylor SM & Jones PA. Multiple new phenotypes induced in 10T1/2 and 3T3 cells treated with 5-azacytidine, Cell, 1979, 17, 771–779.[Medline]
Wang EA, Rosen V, D'Alessandro JS, Bauduy M, Cordes P, Harada T, Israel DI, Hewick RM, Kerns KM, LaPan P et al.. Recombinant human bone morphogenetic protein induces bone formation, Proc Natl Acad Sci USA, 1990, 87, 2220–2224.
Wang EA, Israel DI, Kelly S & Luxenberg DP. Bone morphogenetic protein-2 causes commitment and differentiation in CH310T1/2 and 3T3 cells, Growth Factors, 1993, 9, 57–71.[Medline]
Winnier G, Blessing M, Labosky PA & Hogan BL. Bone morphogenetic protein-4 is required for mesoderm formation and patterning in the mouse, Genes Dev, 1995, 9, 2105–2116.
Woods VL Jr, Schreck PJ, Gesink DS, Pacheo HO, Amiel D, Akeson WH & Lotz M. Integrin expression by human articular chondrocytes, Arthritis Rheum, 1994, 37, 537–544.[Medline]
Wozney JM, Rosen V, Celeste AJ, Mitsock LM, Whitters MJ, Kriz RW, Hewick RM & Wang EA. Novel regulators of bone formation: molecular clones and activities, Science, 1990, 242, 1528–1534.[Medline]
Yamaguchi A, Katagiri T, Ikeda T, Wozney JM, Rosen V, Wang EA, Kahn AJ, Suda T & Yoshiki S. Recombinant human bone morphogenetic protein-2 stimulates osteoblast maturation and inhibits myogenic differentiation in vitro, J Cell Biol, 1991, 113, 681–687.
Yayon A, Klagsbrun M, Esko JD, Leder P & Ornitz DM. Cell surface, heparin-like molecules are required for binding of basic fibroblast growth factor to its high affinity receptor, Cell, 1991, 64, 841–848.[Medline]
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|