|
||


* Kansai Advanced Research Center, Communications Research Laboratory, Kobe 651-2401, Japan; and
Department of
Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, Colorado 80309-0347
| |
Abstract |
|---|
|
|
|---|
Meiotic recombination requires pairing of homologous chromosomes, the mechanisms of which remain largely unknown. When pairing occurs during meiotic prophase in fission yeast, the nucleus oscillates between the cell poles driven by astral microtubules. During these oscillations, the telomeres are clustered at the spindle pole body (SPB), located at the leading edge of the moving nucleus and the rest of each chromosome dangles behind. Here, we show that the oscillatory nuclear movement of meiotic prophase is dependent on cytoplasmic dynein. We have cloned the gene encoding a cytoplasmic dynein heavy chain of fission yeast. Most of the cells disrupted for the gene show no gross defect during mitosis and complete meiosis to form four viable spores, but they lack the nuclear movements of meiotic prophase. Thus, the dynein heavy chain is required for these oscillatory movements. Consistent with its essential role in such nuclear movement, dynein heavy chain tagged with green fluorescent protein (GFP) is localized at astral microtubules and the SPB during the movements. In dynein-disrupted cells, meiotic recombination is significantly reduced, indicating that the dynein function is also required for efficient meiotic recombination. In accordance with the reduced recombination, which leads to reduced crossing over, chromosome missegregation is increased in the mutant. Moreover, both the formation of a single cluster of centromeres and the colocalization of homologous regions on a pair of homologous chromosomes are significantly inhibited in the mutant. These results strongly suggest that the dynein-driven nuclear movements of meiotic prophase are necessary for efficient pairing of homologous chromosomes in fission yeast, which in turn promotes efficient meiotic recombination.
Key words: meiosis; homologous chromosome pairing; dynein; fission yeast; telomere| |
Introduction |
|---|
|
|
|---|
MEIOTIC recombination contributes to the diversity in genetic information of eukaryotic cells. This event requires a physical association of homologous regions on each pair of homologous chromosomes. It occurs during meiotic prophase. In most organisms, the pairing takes place along the entire length of homologous chromosomes, and is followed by the formation of the synaptonemal complex (SC)1, a tripartite structure that appears to link the chromosomes. To accomplish successful chromosome pairing, cells possess a mechanism(s) that allows an efficient encounter of the homologous regions followed by their association without chromosome entangling. How cells accomplish proper pairing of homologous chromosomes remains an unsolved problem.
Cytological observations in many organisms have demonstrated that during meiotic prophase chromosomes form
a characteristic bouquet-like arrangement by clustering
their telomeres (Chikashige et al., 1994
; Scherthan et al.,
1996
; Bass et al., 1997
; Trelles-Sticken et al., 1999
; reviewed in Fussell, 1987
; John, 1990
; Loidl, 1990
; Therman
and Susman, 1992
; Dernburg et al., 1995
). It is frequently observed that the centrosome is located near the cluster of
telomeres (Trelles-Sticken et al., 1999
; reviewed in Loidl,
1990
; Therman and Susman, 1992
; Dernburg et al., 1995
).
In addition to the clustering of telomeres, a specific pattern of nuclear movement has been observed during meiotic prophase in some organisms. For example, the nucleus rotates and oscillates during the bouquet stage in rodent spermatocytes (Yao and Ellingson, 1969
; Parvinen
and Söderström, 1976
; Salonen et al., 1982
). Some plant
cells may have similar nuclear movements, since their nuclei have been observed at positions away from the center
of the cell during this stage (Hiraoka, 1941
, 1952a
,b). Since
these nuclear dynamics are observed around the time
when homologous chromosome pairing occurs, it has been
inferred that they play some role in the pairing. However,
this has not been directly demonstrated.
Studies in the fission yeast, Schizosaccharomyces pombe,
have presented one of the most striking examples of the
bouquet structure and nuclear movement. In these cells,
the whole nucleus, which is extensively elongated, migrates back and forth between the two poles of the cell
during meiotic prophase (Chikashige et al., 1994
). This
movement continues for some hours through the entire meiotic period preceding chromosome segregation. This
motion is driven by astral microtubules radiating from
the spindle pole body (SPB; a centrosome-equivalent in
fungi); these microtubules interact with the cell cortex
(Svoboda et al., 1995
; Ding et al., 1998
). During movements, all the telomeres remain clustered near the SPB,
which is located at the leading edge of the moving nucleus (Chikashige et al., 1994
). It has been speculated that nuclear movement, in conjunction with telomere clustering,
facilitates the spatial alignment of homologous chromosomes required for their proper pairing during meiotic
prophase (Chikashige et al., 1994
, 1997
; Kohli, 1994
; Ding
et al., 1998
).
Recent studies have provided evidence showing an important role of telomere clustering in the pairing of homologous chromosomes. Meiotic recombination is significantly reduced in mutants which fail to form a telomere
cluster due to aberrant telomere structure (Cooper et al.,
1998
; Nimmo et al., 1998
). However, these mutants still
show nuclear movement (Nimmo et al., 1998
; A. Yamamoto and Y. Hiraoka, unpublished observation), suggesting that telomere clustering and the nuclear movement are
distinct biological events. Specific inhibition of the nuclear
movement without affecting telomere clustering would
provide direct evidence for the role of this process in homologous chromosome pairing. To achieve specific inhibition, we have initiated a search for microtubule motor
proteins that are involved in the microtubule-mediated
nuclear movement. Cytoplasmic dynein is a likely candidate for such a motor, since it is required for microtubule-mediated nuclear movement in other fungi (Eshel et al.,
1993
; Li et al., 1993
; Plamann et al., 1994
; Xiang et al.,
1994
, 1995
; Inoue et al., 1998
). The dynein holoenzyme is a
complex of several molecules with an ATP-dependent motility towards the minus end of microtubules. The largest
subunit, cytoplasmic dynein heavy chain (DHC), contains
the motor domain with ATPase activity (reviewed in
Holzbaur and Vallee, 1994
).
In this study, we have identified a cytoplasmic DHC as a motor that is necessary for the nuclear movement of meiotic prophase in fission yeast. Cells disrupted for the gene encoding a cytoplasmic DHC lacked the meiotic oscillatory nuclear movement, but most of them completed meiosis successfully to form four viable spores. In the cells lacking the nuclear movement, meiotic recombination was significantly reduced. Moreover, the colocalization of homologous regions on a pair of homologous chromosomes were significantly inhibited in the meiotic stage preceding chromosome segregation, strongly suggesting that the mutant cells failed to achieve efficient pairing of homologous chromosomes. Our study provides the first evidence that the nuclear movement of meiotic prophase, together with telomere clustering, facilitates the homologous chromosome pairing that is required for meiotic recombination.
| |
Materials and Methods |
|---|
|
|
|---|
Strains, Media, and Basic Technique
The strains used in this study are listed in Table I and were created in this
study. Media were prepared as previously described (Moreno et al., 1991
),
except that YE medium containing adenine sulfate at the concentration of
75 µg/ml (YEA medium) was used for routine growth of cells. fur1 mutation was tested by the growth on the YEA medium containing 5-fluorouracil (Sigma Chemical Co.) at the concentration of 100 µg/ml. Genetic
manipulations were carried out as described by Moreno et al. (1991)
.
|
Cloning and Sequencing of Dynein Heavy Chain Gene
A portion of the DHC was isolated by PCR using degenerated primers
based on regions of highly conserved amino acid sequence that lie in the
neighborhood of the P-loop ATP-binding site lying nearest to the NH2
terminus of the DHC (Vaisberg et al., 1993
). A 320-bp genomic DNA
fragment encoding a partial open reading frame (ORF) was obtained
which had ~52% identity to the DHC sequence of Dictyostelium (Koonce
et al., 1992
). A genomic DNA library (Barbet et al., 1992
) was screened
using the PCR-amplified DNA fragment as a probe, and a 2.7-kb genomic
clone (pDHC1-1) was obtained (Fig. 1 A). This cloned fragment was
mapped between the mei2+ and leu2+ loci on the right arm of chromosome I from two different cosmid libraries (Hoheisel et al., 1993
, Mizukami et al., 1993
).
|
The complete coding sequence was obtained by recovering plasmids that had been integrated at the dhc1 locus. Plasmids containing different portions of the DHC coding region were integrated at the dhc1 locus of strain CRL152. The genomic DNA of the integrant was isolated, digested with a restriction enzyme, and ligated. The ligated DNA was transformed into Escherichia coli strain STBL2 for subsequent analysis (GIBCO BRL). Cloned genomic DNA fragments on the recovered plasmids are schematically shown in Fig. 1 A.
Integration plasmids and restriction enzymes used for obtaining dynein
clones are as follows: Plasmids of pAY119, pAY123, pAY120, pAY131,
and pAY130 were used for the integration to obtain pDHC1-Sac,
pDHC1-Sal, pDHC1-Bam, pDHC1-Cla, and pAY142, respectively. pAY-119 was constructed by deleting a 1.2-kb ClaI fragment containing ars1
from pDHC1-1. pAY123 was constructed by inserting an Ecl136II- BamHI fragment of pDHC1-Sac between the SmaI and BamHI sites of pRS405 (Stratagene). pAY120 was constructed by moving an EcoRV fragment of pDHC1-1 into the SmaI site of pRS405. pAY131 was constructed by inserting an XbaI fragment of pDHC1-Sal, of which ends were filled in by Klenow fragments, into the SmaI site of pRS306 (Sikorski and
Hieter, 1989
). pAY130 was constructed by inserting a BamHI-SmaI fragment of pDHC1-Bam between the Ecl136II and BamHI sites of pRS-306. Restriction enzymes used for obtaining pDHC1-Sac, pDHC1-Sal, pDHC1-Bam, pDHC1-Cla, and pAY142 were SacI, SalI, BamHI, ClaI, and SmaI, respectively. DNA sequences of the cloned fragments were determined by the method recommended by Applied Biosystems Inc., using
synthetic DNA primers complementary to the sequence.
Disruption of Dynein Heavy Chain Gene
The dhc1-d1 disruption allele was generated as follows: a 1.8 kb DNA
fragment bearing the ura4+ gene was inserted at an EcoRV site located
between the BamHI and XhoI sites in the DHC coding region of pDHC1-1.
A linear DNA fragment of the heavy chain coding region between the
BamHI and EcoRV (located between XhoI and SmaI) sites bearing the
ura4+ gene was integrated at the dhc1+ locus of a diploid strain (h+/h
ade6-210/ade6-216 leu1/leu1 ura4/ura4) by one-step gene replacement (Moreno et al., 1991
). The diploid integrants were sporulated and one of
the ura+ progenies of integrants was further crossed with an h90 homothallic strain to obtain a dhc1-d1 homothallic strain (DHC102). Homologous
integration was confirmed by Southern blot and PCR analyses.
To construct strains bearing the dhc1-d2 and the dhc1-d3 mutant alleles, pAY119 and pAY120 were integrated at the dhc1 locus in a haploid
strain. Strains bearing dhc1-d2 (CRL1521) and dhc1-d3 (CRL1522) were
used for most of the phenotypic analyses. The dhc1-d4 allele was created
as follows: a BamHI-EcoRI DNA fragment of pDHC1-Cla was inserted
between EcoRI and BamHI sites of an integration vector, which was constructed by deleting the ClaI fragment containing ars1 from pUR19 (Barbet et al., 1992
). Then, a BamHI-SphI DNA fragment of pDHC1-Bam
was inserted between BamHI and SphI sites. The resulting plasmid,
pAY144, was linearized by digesting with BamHI and then integrated at
dhc1 gene in a diploid strain (h+/h
ade6-M210/ade6-M216 his2/his2+ lys1/
lys1+ ura4/ura4) by one-step gene replacement. The diploid integrants were sporulated and one of the ura+ progenies of integrants was further
crossed with an h90 homothallic strain to create a dhc1-d4 homothallic
strain (AY160-30A). Homologous integration was confirmed by Southern
blot analysis.
Synchronization of Mitotic Cell Cycle
Cells were grown in YEA medium at 30°C at the cell density of 4 to 6 × 106 cells/ml. They were arrested in S phase by incubating for 3 h in the presence of 15 mM hydroxyurea at 30°C. After washing twice with YEA medium, arrested cells were resuspended in fresh YEA medium at the cell density of 2 × 106 cells/ml and further incubated at 30°C to synchronously resume mitotic cell cycle. A portion of the culture was taken at intervals and cells were fixed by adding 1/10 vol of 37% formaldehyde. Progression of mitosis was monitored by analyzing chromosomal DNA of fixed cells stained with 4',6-diamidino-2-phenylindole (DAPI; Sigma Chemical Co.).
Analysis of Microtubule Morphology and Dynamics of Mitotic Spindles in Living Cells
To examine microtubule morphology, cells were transformed with
pDQ105, a multicopy plasmid which carries a green fluorescent protein
(GFP)-
-tubulin fusion gene (GFP-atb2+) placed under the nmt1 promoter (Ding et al., 1998
). The transformed cells were grown or sporulated
in the medium containing 5 µM thiamine for the repression of the GFP-tubulin expression at low levels. The GFP-labeled microtubules were examined under a microscope as described by Ding et al. (1998)
. To examine
dynamics of the mitotic spindle, cells were used which express the GFP-
-tubulin from the fusion gene integrated at the lys1+ locus. To integrate
the fusion gene, PstI-SacI fragment of pDQ105, which contains the GFP-
-tubulin gene placed under the nmt1 promoter, was moved into pYC36,
an integration plasmid containing a partial lys1+ gene. The resultant plasmid was introduced into strains CRL152, CRL1521, and AY160-30A to
produce strains YY105, GT1521, and GT160-30A, respectively. Integration was confirmed by Southern analysis. Cells of these strains were grown
in YEA medium containing 5 µM thiamine at the cell density of 2 to 4 × 106 cells/ml and examined for spindle dynamics at 30°C.
Live Cell Analysis of Chromosome Dynamics
Live cell analysis of chromosome dynamics was carried out using a computer-operated microscope system, previously described by Chikashige
et al. (1994
and 1997).
Synchronization of the Meiotic Process
Wild-type (AY162) and dhc1 (AY163) diploid strains were grown in liquid YEA medium at 33°C to 5 × 107 cells/ml. We found that sporulation
efficiency was high when meiosis was induced in cells at late log or early
stationary phase. The cells were then washed twice and resuspended in
EMM medium lacking a source of nitrogen (EMM
N). Meiosis was synchronously induced by incubating the culture at 26°C with shaking. Progression of meiosis was monitored as described in Synchronization of Mitotic Cell Cycle.
Chromosome Missegregation Assay
Chromosome III missegregation was examined using intragenic complementation of two alleles of the ade6 gene on chromosome III, ade6-M210
and ade6-M216, previously described in Molnar et al. (1995)
. Strains
AY1491-1A and AY1491-1B, or AY1491-1C and AY1491-1D, were
mated and sporulated on ME plates at 26°C for 3 d. Sporulated cells were
suspended in 400 µl of water containing 2 µl of Glusulase (Sigma Chemical Co.) and incubated for 16 to 18 h at 30°C to liberate spores and kill
vegetative cells. Liberated spores were washed twice with water and
plated on YEA and EMM plates supplemented with appropriate amino
acids for selecting ade+ progenies. More than 100 ade+ progenies were
tested for disomic chromosome III by streaking on YE plates after growing for several generations on YEA plates. Cells disomic for chromosome
III give rise to red colonies on YE plates, since they frequently generate
offspring monosomic for chromosome III (Niwa and Yanagida, 1985
).
Frequency of spores disomic for chromosome III was determined by the
frequency of ade+ progenies and the ratio of the disomic progenies.
Construction of a Strain Bearing GFP-DHC Fusion Gene
The coding sequence of GFP-S65T (Heim et al., 1995
) cloned in pRSET-B
vector (Invitrogen Corp.; a gift from Dr. Tsien, University of California,
San Diego, CA) was amplified by PCR using primers, CGCGGATCCATGAGTAAAGGAGAAGAACTT and GAAGGCCTATTTGTATAGTTCATCCATGCC. The PCR product was digested with BamHI and
StuI and then inserted between the BamHI and SmaI sites of pREP1 vector (Maundrell, 1993
) to form pEG3. A BamHI-SacI fragment of pEG3
containing GFP-S65T with a nmt1-polyadenylation sequence was cloned
into the corresponding polylinker sites of pRS405 to form pAY147. A
DNA fragment encoding a COOH-terminal portion of DHC was amplified by PCR using pAY142 as a template and synthetic oligonucleotides,
TGGATGCCCTAAGAGATTT and CGGGATCCAATGCACATACTAAAATAAATATC. The PCR product was digested with NsiI and
BamHI and inserted between the PstI and BamHI sites of pAY147 to
form pAY150, which encodes the COOH-terminal portion of the DHC
protein fused with GFP. pAY150 was integrated at the dhc1 locus of
CRL152 to make strain CRL1526, replacing the wild-type dhc1 gene with
the GFP-fused dhc1 gene.
Indirect Immunofluorescence Microscopy
Cells induced into meiosis on solid ME medium were fixed in methanol
for 8 min at
30°C. The fixed cells were washed once with 0.1 M potassium phosphate buffer, pH 6.5, and resuspended in the same buffer containing 1 M sorbitol (spheroplast buffer). They were spheroplasted by
adding 100 µg/ml of Zymolyase 100T (Seikagaku Kogyo) and 0.1%
2-mercaptoethanol. The spheroplasted cells were washed twice with
spheroplast buffer and permeabilized with 1% Triton X-100 in spheroplast buffer. After permeabilization, the cells were washed twice with the
phosphate buffer and resuspended in solution F (10 mM potassium phosphate buffer, pH 7.0, 150 mM NaCl, and 1% BSA). Antibody reactions
with permeabilized cells were carried out in a microtube at 23°C as described in Hagan and Hyams (1988)
using solution F for antibody incubations.
-Tubulin and GFP were stained using TAT1 mouse monoclonal
anti-
-tubulin antibody (Woods et al., 1989
) and rabbit polyclonal anti-GFP antibody (1:2,000 dilution, CLONTECH Laboratories, Inc.), respectively. FITC-conjugated goat polyclonal anti-mouse antibody (1:100
dilution, Jackson ImmunoResearch Laboratories, Inc.) and rhodamine-conjugated goat polyclonal anti-rabbit antibody (1:100 dilution, Cappel
Laboratories/Organon Teknika Corp.) were used for secondary antibodies. DNA was stained with 100 ng/ml DAPI.
Analysis of Recombination Frequency
To examine the frequency of meiotic recombination, two strains bearing
appropriate genetic markers were grown on the solid YEA medium at
33°C, mated, and then sporulated on the solid ME or EMM
N medium
at 26°C (zygotic meiosis). Alternatively, after mating, diploid cells were
selected on the solid EMM medium supplemented with appropriate
amino acids. The diploid cells were grown on the solid YEA medium at
33°C and then sporulated on the solid ME medium at 26°C (azygotic meiosis). The frequency of intergenic recombination was examined by tetrad
analysis. The frequency of intragenic recombination at the ade6 locus was
analyzed, previously described by Ponticelli and Smith (1989)
. An approximate map of genetic markers used in this study is shown in Fig. 9.
|
Fluorescence In Situ Hybridization Analysis of Centromere and Telomere Positions
Fluorescence in situ hybridization (FISH) analysis was performed as described (Chikashige et al., 1994
) with the following modifications. Cells
grown on the YEA agar medium were transferred on the ME agar medium to induce meiosis. After incubation at 23°C for 12 to 13 h, they were
fixed in 3% paraformaldehyde and 0.2% glutaraldehyde in PEM buffer
(100 mM Pipes-KOH, pH 6.9, 1 mM EGTA, 1 mM MgCl2) for 30 min at
23°C. After fixation, the cells were permeabilized and treated with RNase
A as described (Funabiki et al., 1993
). The RNase A-treated cells were
then processed for FISH. For simultaneous staining of the SPB and telomeres, the cells were immunostained for the SPB before being processed for FISH. The cells were reacted with rabbit polyclonal anti-
-tubulin antibody (1:10,000 dilution; a gift from Dr. Masuda, The Institute of Physical
and Chemical Research, Wako, Saitama, Japan) and then with Cy5-conjugated anti-rabbit antibody (1:100 dilution, Nycomed Amersham). After
antibody reactions, the cells were postfixed with 3% paraformaldehyde in
PEM buffer for 10 min at room temperature and then washed twice with
PEM buffer.
For FISH, the cells were suspended in 2× SSC and incubated for 10 min at 23°C. Next, they were resuspended in 2× SSC containing 10% formamide and incubated for another 10 min at 23°C. The concentration of
formamide was increased to 20% and then to 40%, step-wise with 10 min
incubations at each step. After incubating cells in a 40% formamide solution, they were suspended in hybridization buffer (50% formamide, 5×
Denhardt's solution, and 5% dextran sulfate in 2× SSC) containing fluorescent-labeled probes. Fluorescent-labeled probes were prepared as follows: Ribosomal RNA genes, which hybridize to both ends of chromosome III (Uzawa and Yanagida, 1992
), were used for telomere probes.
Alternatively, cosmid cos212 was used; this hybridizes to both ends of
chromosome I and II (Funabiki et al., 1993
). Plasmid pRS140, which contains centromeric repeats common to all three chromosomes, was used to
hybridize to the centromeres (Chikashige et al., 1989
). Cosmids, cos256,
cos146, cos1228 (from Dr. Yanagida, Kyoto University, Kyoto, Japan) and ICRFc60D0727 (from Resource Center of the German Human Genome Project at the Max-Planck-Institut for Molecular Genetics) were used to
hybridize to regions on the chromosome arms (Hoheisel et al., 1993
, Mizukami et al., 1993
). Approximate position of the chromosome regions to
which the probes hybridize are shown in Fig. 9. The DNA used for telomere and chromosome-arm probes was fragmented with RsaI, TaqI, AluI,
Sau3AI, and HaeIII, and then labeled with Cy3- or Cy5-dUTP (Nycomed
Amersham Inc.) using an oligonucleotide tailing kit containing a terminal
deoxynucleotidyl transferase (Boehringer Mannheim Co.). Similarly, the
DNA used for centromere probes was digested with RsaI, TaqI, and AluI
and labeled with Cy3-dUTP. Concentrations of the fluorescent-labeled DNA probes in the hybridization buffer were ~15 µg/ml for telomere probes and 30 µg/ml for centromere and chromosome-arm probes. Before
the hybridization step the cell suspension containing fluorescent probes
was preheated to 70°C for 5 min to denature the DNA. Hybridization was
carried out at 37°C for 16 h. After hybridization, the formamide concentration in the hybridization buffer was decreased to 40, 25, 15, and finally
7.5% by step-wise dilution with 2× SSC. For each dilution step, the cell
suspension was incubated for 10 min at 23°C. After the concentration was
decreased to 7.5%, the cells were resuspended in fresh 2× SSC and incubated for another 10 min at 23°C. Lastly, the cells were washed twice with
2× SSC and then stained for DNA with DAPI.
| |
Results |
|---|
|
|
|---|
Cloning and Sequence Analysis of the dhc Gene
Since the meiotic oscillatory nuclear movement is driven
by the dynamic activity of microtubules (Svoboda et al.,
1995
; Ding et al., 1998
), microtubule-dependent motor enzymes seemed to be involved. As a first step in examining
this possibility, we cloned the dhc gene (Fig. 1 A; see Materials and Methods). A total of 17.3 kb of genomic DNA
from the locus containing a candidate gene was examined.
Sequence analysis of the cloned fragments revealed that
they contained a continuous ORF of 12.6 kb. The ORF encodes a predicted protein of 4,196 amino acids with a deduced molecular weight of 484 kD (Fig. 2 A; GenBank/
EMBL/DDBJ accession number AB006784). A comparison of the amino acid sequence with the protein sequences
in the SwissProt database using the BLASTP algorithm (Altschul et al., 1990
) revealed a high similarity to the
DHC sequences of other organisms. The cytoplasmic dhc
gene of Aspergillus nidulans was most similar to the fission
yeast sequence (27.4% identity). Dot-plot analysis showed
that they are highly similar in their entire length (Fig. 2 B).
These results indicate that the cloned ORF encodes the
cytoplasmic DHC of fission yeast. Thus, the gene was
named dhc1+. Southern blot and PCR analyses suggested
that it is the only dhc gene in this organism (data not
shown).
|
The central motor domain of most DHC molecules
contains four P-loops, which are putative ATP-binding
sites comprising the consensus sequence, GXXXXKS/T
(Walker et al., 1982
; Saraste et al., 1990
). Similarly, the fission yeast DHC contained the consensus sequences at the
first three sites corresponding to other DHCs (Fig. 2 A,
boxed sequences, and C). The fourth site lacked the typical consensus sequence, although sequence around this
site was similar to those of other DHCs (Fig. 2 C). The existence of ATP-binding motifs suggests that fission yeast
dynein generates motor activity by ATP hydrolysis, like
other dynein molecules.
Cytoplasmic DHC Is Not Required for Proper Positioning and Orientation of the Mitotic Spindle
To examine the role of the DHC molecule in fission yeast,
we disrupted the coding sequence by integrating either the
ura4+ gene of fission yeast or the LEU2 gene of budding
yeast at the dhc1+ locus by homologous recombination
(Fig. 1 B; see Materials and Methods). Cells containing
the integration that truncates the putative motor domain
(dhc1-d1, dhc1-d2, and dhc1-d3) or a deletion of the NH2-terminal two-thirds of the heavy chain gene (dhc1-d4) grew in rich and minimal media at temperatures from 20°C
to 36°C and their doubling times were similar to those of
wild-type cells. Indirect immunofluorescence and living
cell analysis using GFP-tagged
-tubulin (Ding et al.,
1998
) revealed that nuclear and microtubule morphology
of all the mutants were similar to those of wild-type cells.
In addition, the number of cytoplasmic microtubules extending along the cell axis in G2 cells (Hagan and Hyams,
1988
) were not significantly different, 2.9 ± 0.7 (mean ± SD) for wild-type and 2.7 ± 0.7 for the dhc1-d2 mutant
(n = 40). Cytokinesis took place in the middle of the cell,
just as in wild-type cells. In addition, when cells were synchronized in S phase by a DNA synthesis inhibitor, hydroxyurea, the mutant cells underwent nuclear division
and cytokinesis with a similar timing to that of wild-type
cells (Fig. 3 A). These results indicated that the DHC is
not essential for the mitotic growth and the loss of its function does not cause gross defects in mitosis.
|
It has been reported that dynein plays an important role
in maintaining proper positioning, orientation, and kinetics of a mitotic spindle through astral microtubules in budding yeast (Eshel et al., 1993
; Li et al., 1993
; Yeh et al.,
1995
; Carminati and Stearns, 1997
; Cottingham and Hoyt,
1997
; DeZwaan et al., 1997
; Shaw et al., 1997
). To seek a
possible role of dynein in dynamics of the mitotic spindle,
we carried out detailed analysis of spindle behavior in
wild-type and the dynein-disrupted cells using GFP-tagged
-tubulin (Ding et al., 1998
). In wild-type cells, the mitotic spindle was formed at the center of the cell and elongated
to ~1 µm within 2 min (Fig. 3 B, left, 0 and 2 min). During
this early stage of the spindle formation, cytoplasmic microtubules extending along the cell axis disappeared. The
spindle continuously elongated to ~3 µm and its length
remained constant until further elongation (anaphase B)
begins (Fig. 3 B, left, 2-16 min; Table II), as previously reported by Nabeshima et al., (1998). The spindle was always located at the middle of the cell and often changed its
orientation (see spindle orientation in Fig. 3 B, left, 2, 10, and 14 min). In addition, short astral microtubules radiating from the spindle pole(s) were often observed (Fig. 3 B,
left, 6 and 14 min). The time length of this stage was between 8 and 26 min, varying among cells. After this stage,
the spindle elongated along the cell axis at the constant
rate to reach its maximum length (anaphase B; Fig. 3 B,
left, 18-26 min; Table II), and eventually disappeared (Fig.
3 B, left, 28 min). Astral microtubules radiating from the
spindle poles were observed during elongation (Fig. 3 B,
left, 20 and 24 min). When the dhc1-d2 cells were examined, no significant differences were observed in positioning, orientation, or kinetics of the mitotic spindles or in the
behavior of astral-microtubules (Fig. 3 B, right; Table II).
Therefore, we conclude that DHC is not required for
maintaining proper positioning, orientation, or kinetics of
mitotic spindles in fission yeast.
|
Cytoplasmic DHC Is Required for Meiotic Prophase Nuclear Movement
We then examined the phenotype of the dynein-disrupted
cells during meiotic progression. Haploid cells of opposite
mating types are induced to conjugate upon depletion of
nitrogen from the growth medium. In conjugating cells,
the two haploid nuclei migrate towards each other and
fuse at the site of their SPBs (karyogamy). Cells bearing
the dhc1-d2 mutation in both mating types underwent conjugation and nuclear fusion to form a zygotic cell containing a single chromosomal DNA mass and one SPB (Figs. 4
and 10 C). However, the fraction of conjugated cells with
unfused nuclei was significantly larger in the mutant than
in the wild-type: of 160 conjugated cells in the stage before
meiotic chromosome segregation, unfused nuclei were observed in 21.9% of the mutant cells, whereas only 2.5% of
wild-type cells had this phenotype. When unfused nuclei in
10 conjugated cells of the mutant were followed using a
portion of DNA-polymerase-
tagged with GFP as a nuclear marker (D.-Q. Ding and Y. Hiraoka manuscript in
preparation), all of the nuclei eventually fused to form a
single nucleus. These results strongly suggest that nuclear
fusion was delayed to some extent in cells lacking a cytoplasmic DHC, but not abolished.
|
|
The most striking consequence of the dynein disruption
was observed after nuclear fusion. In wild-type cells, the
fused nucleus immediately started oscillatory movement
between the cell poles (Fig. 4 A, left), as previously reported (Chikashige et al., 1994
). In contrast, the fused nucleus of the dynein mutant cells did not show oscillatory
movement and remained in the middle of the cell (Fig. 4
A, right, and B). These observations indicated that the
DHC is required for the oscillatory nuclear movement.
Despite the lack of oscillatory nuclear movement, many
mutant cells underwent two rounds of meiotic chromosome segregation, as observed by the appearance of two
and then four nuclei (Fig. 4 B). In wild-type cells, the
nucleus performs some hours of oscillatory movement
through meiotic prophase and then initiates two rounds of
chromosome segregation (Chikashige et al., 1994
). Live
observations of the nuclear behavior in the dynein-disrupted mutant showed that the nucleus remained in the
middle of the cell for ~3 h after nuclear fusion and then
initiated the first chromosome segregation. Unlike wild-type cells, chromosomes sometimes moved separately and
failed to form two distinct chromosome masses during the
first chromosome segregation (Fig. 4 B, 204 min; compare
to Figure 2 C in Chikashige et al., 1994
). Despite this aberrant behavior, two rounds of chromosome segregation
were accomplished within 2 h, as in wild-type cells (Fig. 4 B).
Analysis of azygotic diploid cells, which synchronously entered meiosis without undergoing nuclear fusion, suggest that both wild-type and mutant cells accomplished meiotic processes with a similar timing. As shown in Fig. 5, both wild-type and mutant diploid cells showed similar profiles after nitrogen starvation. Specifically, cells containing a deformed nucleus, which is characteristic of the meiotic stage preceding chromosome segregation, increased at ~5 h and decreased at ~8 h. Live observations confirmed that the deformed nucleus of the mutant lacked the oscillatory movement, whereas that of wild-type moved back and forth between cell poles (data not shown). These results suggested that the mutant cells accomplished the meiotic process preceding meiotic chromosome segregation with a timing similar to that of wild-type, despite the lack of nuclear movement.
|
After accomplishing two rounds of chromosome segregation, many mutant cells formed four spores (Fig. 6),
most of which were viable like those of wild-type cells (Table III), indicating that chromosomes were properly segregated in those cells. The slight increase in the number of
the mutant cells that failed to form four spores, however,
suggested increased chromosome missegregation in the
mutant (Fig. 6). To know if chromosome missegregation is increased in the mutant, we examined the frequency of
spores disomic for chromosome III. The frequencies of the
disomic spores were 8.0 × 10
4 for wild-type and 1.1 × 10
2 for the mutant. The ~14-fold increase of the disomic spores indicated that chromosome missegregation increased during meiosis I in the mutant. Thus, the dynein
function is required for faithful chromosome segregation.
|
|
Meiotic phenotypes similar to those described were observed in cells bearing each of the different mutations in the dynein gene (Fig. 1 B). In addition, the dynein mutations were recessive for the phenotypes described, since nuclear movement was normal in conjugates of mutant and wild-type cells. In summary, the DHC is required for the oscillatory nuclear movement of meiotic prophase and faithful chromosome segregation during meiosis. Moreover, the successful completion of meiotic processes in the absence of oscillatory nuclear movement in many mutant cells indicates that the movement itself is not essential for the progression of meiosis.
Microtubule Morphology in the Dynein Mutant during Meiosis
Since the oscillatory nuclear movement is dependent upon
astral microtubules radiating from the SPB (Ding et al.,
1998
), it is possible that the lack of the movement in the
dynein mutants is due to a loss of astral microtubules. We
examined microtubule morphology in living meiotic dhc1-d2 cells using GFP-tagged
-tubulin (Ding et al., 1998
). In
a zygote containing a single nucleus, astral microtubules
radiated from the SPB (Fig. 7, c-f), although the oscillatory nuclear movement was not observed. Therefore, the
lack of the oscillatory nuclear movement in the mutant is not caused by a loss of astral microtubules. The microtubule morphology of the mutant cells was not significantly
different from that observed in wild-type cells during the
remainder of meiosis (Hagan and Yanagida, 1995
; Svoboda et al., 1995
; Ding et al., 1998
). During karyogamy, astral microtubules radiated from the SPB as each of two nuclei converged to bring the two SPBs together (Fig. 7, a
and b) and the meiotic spindles were normal during meiotic chromosome segregation (Fig. 7, g-j).
|
Cytoplasmic DHC Is Localized at the SPB and Astral Microtubules
To further understand the functions of the DHC, we examined its intracellular localization by tagging the COOH terminus of Dhc1p with GFP. The dhc1+ gene was replaced with the tagged gene by chromosomal integration of the DNA encoding GFP, resulting in the expression of tagged Dhc1p under the endogenous promoter on the chromosome. The GFP-tagged Dhc1p (dynein-GFP) was functional, since cells expressing solely the tagged protein showed no aberrant phenotypes in meiosis, particularly in the oscillatory nuclear movement and intragenic recombination at the ade6 locus (data not shown).
In mitotically growing cells, the dynein-GFP was not detected (data not shown). Meiotic cells, on the other hand, showed specific intracellular localization. During nuclear fusion through meiotic prophase, the dynein-GFP was localized at the SPB (Fig. 8 A, b, d, and f, large arrows, and B, large arrowheads), and astral microtubules (Fig. 8 A, b, d, and f, and C, e). The localization of the dynein-GFP to the SPB was demonstrated by the position of the GFP dot at the protruding edge of the nucleus (Fig. 8 A, a and b, and B, large arrowheads) and its colocalization with the focal point of astral microtubules (Fig. 8 C). This localization was apparent until anaphase of the first meiotic division (Fig. 8 A, g and h), but was not detected through the rest of meiosis (Fig. 8 A, i and j). The localization to astral microtubules was demonstrated by colocalization of the GFP line with microtubules (Fig. 8 C, e, f, and h) and further confirmed by the disappearance of the GFP lines by treating the cells with a microtubule-depolymerizing drug, thiabendazole (data not shown). Interestingly, during the oscillatory nuclear movement, a dynein-GFP dot was frequently observed on an astral microtubule(s) at a point where the microtubule(s) contacts the cell cortex in front of the moving nucleus, and the nucleus moved towards it (Fig. 8 A, d and f, small arrows, and B, small arrowheads). The dot appeared during the approach of the SPB to the cortex (Fig. 8 B, lower, 15 s) and disappeared after the SPB reached it and reversed the direction of its movement (Fig. 8 B, lower, 90 s). This observation suggests the presence of a novel structure on the cell cortex that promotes a transient accumulation of the dynein-GFP and is involved in the nuclear movement (see Discussion).
|
Frequencies of Meiotic Recombination Are Significantly Reduced in the Dynein Mutant
If the oscillatory nuclear movement of meiotic prophase
facilitates homologous chromosome pairing, as postulated
previously (Chikashige et al., 1994
, 1997
; Kohli, 1994
; Ding
et al., 1998
), the lack of this movement should affect meiotic recombination. To test this idea, we examined meiotic
recombination in the dynein mutant cells. Tetrad analysis
investigating the genetic linkage at four regions on three
chromosomes (Fig. 9) revealed that the frequencies of intergenic recombination at the regions were significantly reduced by up to fivefold in the mutant (Table III). Thus,
the intergenic recombination was reduced in the dynein
mutant. Interestingly, the recombination frequencies in
meioses initiated from the haploid state through karyogamy (zygotic meiosis) and from the diploid state without
undergoing karyogamy (azygotic meiosis) were significantly different. In the dynein-disrupted cells, recombination occurs more frequently in azygotic meiosis than in zygotic meiosis at almost every locus. In contrast, in wild-type cells recombination for azygotic meiosis is less frequent. These results indicated that processes of intergenic
recombination in azygotic and zygotic meiosis are distinct.
We then examined the frequency of intragenic recombination. It has been known that gene conversion occurs at
high frequency at the ade6 locus on chromosome III. That
is, a strain carrying a mutant allele of the ade6 gene, ade6-M26 or ade6-M375, spontaneously gives rise to ade+ recombinants in high frequency when crossed with a strain
carrying another ade6 allele, ade6-469 (Gutz, 1971
; Ponticelli et al., 1988
; Schuchert and Kohli, 1988
; Szankasi et al.,
1988
; Mizuno et al., 1997
). As shown in Table IV, the frequency of intragenic recombination of both ade6-M26 and
ade6-M375 was reduced by about nine- and fivefold, respectively, through zygotic meiosis in the dynein mutant.
Thus, intragenic recombination was also reduced in the
dynein mutant and this reduction was not allele-specific. Taken together, these results demonstrated that the dynein function is required for efficient meiotic recombination. In addition, the reduced frequency of the distinct
types of recombination suggest that the reduced meiotic
recombination results from inefficient pairing of homologous chromosomes, rather than defects in recombination machinery in the dynein mutant.
|
Homologous Regions on a Pair of homologous Chromosomes Fail to Colocalize Efficiently in the Dynein Mutant Cells
To characterize chromosome pairing in the dynein mutant,
we examined the nuclear position of chromosomes by
FISH using probes that hybridize to several different chromosomal regions (Fig. 9). First, we examined the positions
of centromeres and telomeres. It has been shown that centromeres and telomeres have distinct positions during the
progression of meiosis (Chikashige et al., 1994
, 1997
).
Centromeres locate away from the SPB forming one cluster in each nucleus during nuclear fusion and one or two
clusters in most of the elongated zygotic nuclei (Fig. 10 A,
a, d, and g). In contrast, telomeres locate near the SPB
forming a single cluster (Fig. 10 A, b, e, and h). It has been
inferred that one or two clusters of centromeres in a nucleus reflect the paired or unpaired state of homologous
centromeres, respectively (Chikashige et al., 1994
). Thus,
inefficient pairing of homologous chromosomes should result in a reduced population of cells containing a single
centromere cluster.
Cells were induced into meiosis and the positions of centromeres and telomeres were determined in zygotic nuclei by FISH analysis. When centromeres were examined the population of cells containing a single centromere cluster was significantly reduced in the dhc1 mutant. The fraction of single-nuclear cells containing a single centromere cluster was about threefold smaller in mutant than in wild-type cells (Table V). On the other hand, the fraction of those containing dispersed centromeres was significantly larger in the mutant (Table V; Fig. 10 B, g and j). Dispersed centromeres were not observed during karyogamy in the mutant, as in wild-type. Each of the two nuclei in the fusion process contained a single centromere signal (Fig. 10 B, a). These results suggest that centromeres fail to form a single cluster and disperse in many dhc1-d2 cells. The reduced population of cells containing a single centromere cluster strongly suggest that the dynein mutant cells failed to achieve efficient pairing of homologous centromeres.
|
When telomeres were examined the fraction of cells containing two telomere signals was larger in the mutant than in wild-type (Table V; Fig. 10 B, k). This mutant phenotype may result from delayed SPB fusion in the mutant, which is likely to be a cause of the delayed nuclear fusion during karyogamy. Otherwise, telomere behavior in dhc1 cells was not significantly different from that of wild-type cells; they form a single cluster near the SPB during karyogamy (Fig. 10 B, b and c) and during meiotic prophase (Fig. 10 C) in most cells.
We then examined four different chromosomal regions on the arms of chromosome I and II in the mutant (Fig. 9). Greater than 90% of the single-nuclear cells showed one or two nuclear FISH signals in both wild-type and the mutant (Fig. 11). However, in the mutant cells the population of cells containing a single FISH signal, which probably indicates the paired state of the regions, was significantly smaller than in wild-type cells (Table VI). These results strongly suggested that the mutant cells failed to achieve efficient pairing of homologous regions on a pair of homologous chromosomes. Taken together, these results support the idea that homologous chromosomes failed to pair efficiently in the dynein mutant, due to the lack of the oscillatory nuclear movement.
|
|
| |
Discussion |
|---|
|
|
|---|
Functions of Cytoplasmic Dynein in Meiotic Prophase Nuclear Movement of Fission Yeast
We have cloned a fission yeast gene encoding a cytoplasmic DHC and demonstrate that it plays an essential role in the oscillatory nuclear movement of meiotic prophase. In addition, it is probably important for nuclear fusion during karyogamy, since nuclear fusion appeared to be delayed in the dynein mutant cells. Consistent with its role in meiosis-specific nuclear movement, dynein was detected at the SPB and astral microtubules from karyogamy through anaphase of the first meiotic division. It remains to be determined if localization was only detected during meiosis due to a meiosis-specific enhancement of dynein's expression or to its meiosis-specific accumulation at the SPB and microtubules.
Involvement of cytoplasmic dynein in microtubule-mediated nuclear migration has been reported in other
fungi. In Neurospora crassa, A. nidulans, and Nectria haematococca, dynein is required for the migration of nuclei
in the germ tube (Plamann et al., 1994
; Xiang et al., 1994
,
1995
; Inoue et al., 1998
). The budding yeast, Saccharomyces cerevisiae, requires dynein function for nuclear positioning and migration at the bud neck in mitosis (Eshel et
al., 1993
; Li et al., 1993
; Yeh et al., 1995
; Carminati and Stearns, 1997
; Cottingham and Hoyt, 1997
; DeZwaan et al.,
1997
; Shaw et al., 1997
). Specifically, the nucleus penetrates into the bud neck at the onset of anaphase, oscillates
several times at the neck, and then divides into mother and
daughter cells (Yeh et al., 1995
; DeZwaan et al., 1997
). In
the absence of dynein function, the anaphase nucleus often fails to penetrate into the neck and there are no oscillations (Yeh et al., 1995
; DeZwaan et al., 1997
). In those
cells, the nucleus divides within the mother cell and eventually segregates into mother and bud cells. Thus, cytoplasmic dynein generates forces required for the nuclear penetration and oscillation at the bud neck during anaphase in budding yeast.
The dynein-dependent nuclear migration in budding
yeast during mitosis and in fission yeast during meiosis
share several features. First, both types of nuclear movement are driven by astral microtubules interacting with the
cell cortex (Palmer et al., 1992
; Sullivan and Huffaker,
1992
; Svoboda et al., 1995
; Carminati and Stearns, 1997
;
Shaw et al., 1997
; Ding et al., 1998
). Second, both are driven by dynein localized at the SPB and/or astral microtubules (Yeh et al., 1995
; Shaw et al., 1997
). Finally, both
are oscillatory, though the amplitude of the oscillation is
greater in fission yeast (Yeh et al., 1995
; DeZwaan et al.,
1997
). These similarities strongly suggest that these nuclear movements in two evolutionary divergent organisms
are driven by similar mechanisms.
Despite many similarities, dynein is not required for mitotic spindle dynamics in fission yeast, as demonstrated by the lack of significant defects in spindle behavior of the mutant. The difference may be due to the different geometry of their cell division. In budding yeast, divided nuclei are segregated into the mother and daughter cells through a narrow path at the bud neck. However, the fission yeast cell is divided by a septum formed at the middle of the cell after the divided nuclei have been segregated to opposite ends of the cell. Thus, the positioning of the nucleus in mitosis may be more important to budding yeast. Alternatively, another DHC, which has not been detected by our analysis, may play a role in mitosis of fission yeast.
During the oscillatory nuclear movements, GFP-tagged
dynein is localized to the SPB and astral microtubules. It is
also concentrated at the point where astral microtubules
contact the cell cortex that faces an approaching nucleus.
From analogy with other organisms, astral microtubules in
fission yeast are probably oriented with their plus ends distal and minus ends proximal to the SPB (Bergen et al.,
1980
; Euteneuer and McIntosh, 1981
; McIntosh and Euteneuer, 1984
; Toriyama et al., 1988
; Yamamoto et al., 1990
).
Given the localization of dynein and the polarity of the microtubules, we suggest two models for dynein function in
the nuclear movement. In the first model, dynein immobilized on the cell cortex generates a pulling force by walking along astral microtubules toward their minus ends. The
accumulation of dynein at the point where microtubules contact with the cortex facing an approaching nucleus is
consistent with this model. A similar model was proposed
for the function of dynein in budding yeast (Carminati and
Stearns, 1997
; Cottingham and Hoyt, 1997
; DeZwaan et al.,
1997
). However, a cortical accumulation of dynein was not
observed in this organism. In the second model, dynein
motors at the SPB generate a pushing force on the SPB by walking in the minus end direction on microtubules that
extend rearward. The localization of dynein at the SPB is
consistent with this model. A contribution of pushing
forces to create nuclear movement was previously proposed, since the movement was associated with the elongation of microtubules extending rearward (Ding et al.,
1998
). Supporting this model, it has been reported that a pushing by astral microtubules drives preanaphase nuclear
migration in budding yeast. However, in this case the
pushing force is not generated by dynein (Shaw et al.,
1997
). In either model, dynein may also play a role in dynamic changes of microtubule length, which are required
for the oscillatory movement. Preliminary results showed
that the rate of microtubule shortening, which occurs
mostly in front of the moving nucleus in wild-type cells,
was significantly altered in the dynein mutant at the meiotic stage preceding chromosome segregation (A. Yamamoto, unpublished results). Future analysis will be required to clarify the functions of DHC in the oscillatory nuclear movement.
Biological Significance of the Oscillatory Nuclear Movement during Meiotic Prophase
Most dynein mutant cells completed meiosis and formed four viable spores, despite the lack of oscillatory nuclear movement, and the duration of the meiotic stage preceding chromosome segregation is not obviously different in those cells. These results indicate that the movement is not essential for the progression of meiosis, and that the duration of the stage preceding chromosome segregation is determined independently of nuclear movement. However, the dynein mutant showed significant reduction in meiotic recombination suggesting that nuclear movement is required for efficient meiotic recombination. Our FISH observations of chromosome positioning strongly suggest that the reduced recombination results from inefficient pairing of homologous chromosomes. That is, the formation of a single cluster of centromeres and the colocalization of homologous regions in single-nuclear zygotes, which likely reflects the paired state of homologous chromosomes, were significantly inhibited in the dynein mutant. Preliminary observations of a centromere-linked locus in liv