|
||
© The Rockefeller University Press,
0021-9525/1999//1233 $5.00
The Journal of Cell Biology, Volume 145, Number 6,
, 1999 1233-1250
Article |
A Cytoplasmic Dynein Heavy Chain Is Required for Oscillatory Nuclear Movement of Meiotic Prophase and Efficient Meiotic Recombination in Fission Yeast


Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, Colorado 80309-0347
Meiotic recombination requires pairing of homologous chromosomes, the mechanisms of which remain largely unknown. When pairing occurs during meiotic prophase in fission yeast, the nucleus oscillates between the cell poles driven by astral microtubules. During these oscillations, the telomeres are clustered at the spindle pole body (SPB), located at the leading edge of the moving nucleus and the rest of each chromosome dangles behind. Here, we show that the oscillatory nuclear movement of meiotic prophase is dependent on cytoplasmic dynein. We have cloned the gene encoding a cytoplasmic dynein heavy chain of fission yeast. Most of the cells disrupted for the gene show no gross defect during mitosis and complete meiosis to form four viable spores, but they lack the nuclear movements of meiotic prophase. Thus, the dynein heavy chain is required for these oscillatory movements. Consistent with its essential role in such nuclear movement, dynein heavy chain tagged with green fluorescent protein (GFP) is localized at astral microtubules and the SPB during the movements. In dynein-disrupted cells, meiotic recombination is significantly reduced, indicating that the dynein function is also required for efficient meiotic recombination. In accordance with the reduced recombination, which leads to reduced crossing over, chromosome missegregation is increased in the mutant. Moreover, both the formation of a single cluster of centromeres and the colocalization of homologous regions on a pair of homologous chromosomes are significantly inhibited in the mutant. These results strongly suggest that the dynein-driven nuclear movements of meiotic prophase are necessary for efficient pairing of homologous chromosomes in fission yeast, which in turn promotes efficient meiotic recombination.
Key Words: meiosis homologous chromosome pairing dynein fission yeast telomere
Abbreviations used in this paper: DAPI, 4',6-diamidino-2-phenylindole; DHC, dynein heavy chain; GFP, green fluorescent protein; FISH, fluorescence in situ hybridization; ORF, open reading frame; SC, synaptonemal complex; SPB, spindle pole body.
Address correspondence to Ayumu Yamamoto, Kansai Advanced Research Center, Communications Research Laboratory, 588-2 Iwaoka, Nishi-ku, Kobe 651-2401, Japan. Tel.: 81-78-969-2245. Fax: 81-78-969-2249. E-mail: ayumu{at}crl.go.jp
MEIOTIC recombination contributes to the diversity in genetic information of eukaryotic cells. This event requires a physical association of homologous regions on each pair of homologous chromosomes. It occurs during meiotic prophase. In most organisms, the pairing takes place along the entire length of homologous chromosomes, and is followed by the formation of the synaptonemal complex (SC)1, a tripartite structure that appears to link the chromosomes. To accomplish successful chromosome pairing, cells possess a mechanism(s) that allows an efficient encounter of the homologous regions followed by their association without chromosome entangling. How cells accomplish proper pairing of homologous chromosomes remains an unsolved problem.
Cytological observations in many organisms have demonstrated that during meiotic prophase chromosomes form a characteristic bouquet-like arrangement by clustering their telomeres (Chikashige et al., 1994; Scherthan et al., 1996; Bass et al., 1997; Trelles-Sticken et al., 1999; reviewed in Fussell, 1987; John, 1990; Loidl, 1990; Therman and Susman, 1992; Dernburg et al., 1995). It is frequently observed that the centrosome is located near the cluster of telomeres (Trelles-Sticken et al., 1999; reviewed in Loidl, 1990; Therman and Susman, 1992; Dernburg et al., 1995). In addition to the clustering of telomeres, a specific pattern of nuclear movement has been observed during meiotic prophase in some organisms. For example, the nucleus rotates and oscillates during the bouquet stage in rodent spermatocytes (Yao and Ellingson, 1969; Parvinen and Söderström, 1976; Salonen et al., 1982). Some plant cells may have similar nuclear movements, since their nuclei have been observed at positions away from the center of the cell during this stage (Hiraoka, 1941, 1952a,b). Since these nuclear dynamics are observed around the time when homologous chromosome pairing occurs, it has been inferred that they play some role in the pairing. However, this has not been directly demonstrated.
Studies in the fission yeast, Schizosaccharomyces pombe, have presented one of the most striking examples of the bouquet structure and nuclear movement. In these cells, the whole nucleus, which is extensively elongated, migrates back and forth between the two poles of the cell during meiotic prophase (Chikashige et al., 1994). This movement continues for some hours through the entire meiotic period preceding chromosome segregation. This motion is driven by astral microtubules radiating from the spindle pole body (SPB; a centrosome-equivalent in fungi); these microtubules interact with the cell cortex (Svoboda et al., 1995; Ding et al., 1998). During movements, all the telomeres remain clustered near the SPB, which is located at the leading edge of the moving nucleus (Chikashige et al., 1994). It has been speculated that nuclear movement, in conjunction with telomere clustering, facilitates the spatial alignment of homologous chromosomes required for their proper pairing during meiotic prophase (Chikashige et al., 1994, 1997; Kohli, 1994; Ding et al., 1998).
Recent studies have provided evidence showing an important role of telomere clustering in the pairing of homologous chromosomes. Meiotic recombination is significantly reduced in mutants which fail to form a telomere cluster due to aberrant telomere structure (Cooper et al., 1998; Nimmo et al., 1998). However, these mutants still show nuclear movement (Nimmo et al., 1998; A. Yamamoto and Y. Hiraoka, unpublished observation), suggesting that telomere clustering and the nuclear movement are distinct biological events. Specific inhibition of the nuclear movement without affecting telomere clustering would provide direct evidence for the role of this process in homologous chromosome pairing. To achieve specific inhibition, we have initiated a search for microtubule motor proteins that are involved in the microtubule-mediated nuclear movement. Cytoplasmic dynein is a likely candidate for such a motor, since it is required for microtubule-mediated nuclear movement in other fungi (Eshel et al., 1993; Li et al., 1993; Plamann et al., 1994; Xiang et al., 1994, 1995; Inoue et al., 1998). The dynein holoenzyme is a complex of several molecules with an ATP-dependent motility towards the minus end of microtubules. The largest subunit, cytoplasmic dynein heavy chain (DHC), contains the motor domain with ATPase activity (reviewed in Holzbaur and Vallee, 1994).
In this study, we have identified a cytoplasmic DHC as a motor that is necessary for the nuclear movement of meiotic prophase in fission yeast. Cells disrupted for the gene encoding a cytoplasmic DHC lacked the meiotic oscillatory nuclear movement, but most of them completed meiosis successfully to form four viable spores. In the cells lacking the nuclear movement, meiotic recombination was significantly reduced. Moreover, the colocalization of homologous regions on a pair of homologous chromosomes were significantly inhibited in the meiotic stage preceding chromosome segregation, strongly suggesting that the mutant cells failed to achieve efficient pairing of homologous chromosomes. Our study provides the first evidence that the nuclear movement of meiotic prophase, together with telomere clustering, facilitates the homologous chromosome pairing that is required for meiotic recombination.
| Materials and Methods |
|---|
|
|
|---|
|
52% identity to the DHC sequence of Dictyostelium (Koonce et al., 1992). A genomic DNA library (Barbet et al., 1992) was screened using the PCR-amplified DNA fragment as a probe, and a 2.7-kb genomic clone (pDHC1-1) was obtained (Fig. 1 A). This cloned fragment was mapped between the mei2+ and leu2+ loci on the right arm of chromosome I from two different cosmid libraries (Hoheisel et al., 1993, Mizukami et al., 1993).
|
Integration plasmids and restriction enzymes used for obtaining dynein clones are as follows: Plasmids of pAY119, pAY123, pAY120, pAY131, and pAY130 were used for the integration to obtain pDHC1-Sac, pDHC1-Sal, pDHC1-Bam, pDHC1-Cla, and pAY142, respectively. pAY-119 was constructed by deleting a 1.2-kb ClaI fragment containing ars1 from pDHC1-1. pAY123 was constructed by inserting an Ecl136II– BamHI fragment of pDHC1-Sac between the SmaI and BamHI sites of pRS405 (Stratagene). pAY120 was constructed by moving an EcoRV fragment of pDHC1-1 into the SmaI site of pRS405. pAY131 was constructed by inserting an XbaI fragment of pDHC1-Sal, of which ends were filled in by Klenow fragments, into the SmaI site of pRS306 (Sikorski and Hieter, 1989). pAY130 was constructed by inserting a BamHI–SmaI fragment of pDHC1-Bam between the Ecl136II and BamHI sites of pRS-306. Restriction enzymes used for obtaining pDHC1-Sac, pDHC1-Sal, pDHC1-Bam, pDHC1-Cla, and pAY142 were SacI, SalI, BamHI, ClaI, and SmaI, respectively. DNA sequences of the cloned fragments were determined by the method recommended by Applied Biosystems Inc., using synthetic DNA primers complementary to the sequence.
Disruption of Dynein Heavy Chain Gene
The dhc1-d1 disruption allele was generated as follows: a 1.8 kb DNA fragment bearing the ura4+ gene was inserted at an EcoRV site located between the BamHI and XhoI sites in the DHC coding region of pDHC1-1. A linear DNA fragment of the heavy chain coding region between the BamHI and EcoRV (located between XhoI and SmaI) sites bearing the ura4+ gene was integrated at the dhc1+ locus of a diploid strain (h+/h– ade6-210/ade6-216 leu1/leu1 ura4/ura4) by one-step gene replacement (Moreno et al., 1991). The diploid integrants were sporulated and one of the ura+ progenies of integrants was further crossed with an h90 homothallic strain to obtain a dhc1-d1 homothallic strain (DHC102). Homologous integration was confirmed by Southern blot and PCR analyses.
To construct strains bearing the dhc1-d2 and the dhc1-d3 mutant alleles, pAY119 and pAY120 were integrated at the dhc1 locus in a haploid strain. Strains bearing dhc1-d2 (CRL1521) and dhc1-d3 (CRL1522) were used for most of the phenotypic analyses. The dhc1-d4 allele was created as follows: a BamHI–EcoRI DNA fragment of pDHC1-Cla was inserted between EcoRI and BamHI sites of an integration vector, which was constructed by deleting the ClaI fragment containing ars1 from pUR19 (Barbet et al., 1992). Then, a BamHI–SphI DNA fragment of pDHC1–Bam was inserted between BamHI and SphI sites. The resulting plasmid, pAY144, was linearized by digesting with BamHI and then integrated at dhc1 gene in a diploid strain (h+/h– ade6-M210/ade6-M216 his2/his2+ lys1/ lys1+ ura4/ura4) by one-step gene replacement. The diploid integrants were sporulated and one of the ura+ progenies of integrants was further crossed with an h90 homothallic strain to create a dhc1-d4 homothallic strain (AY160-30A). Homologous integration was confirmed by Southern blot analysis.
Synchronization of Mitotic Cell Cycle
Cells were grown in YEA medium at 30°C at the cell density of 4 to 6 x 106 cells/ml. They were arrested in S phase by incubating for 3 h in the presence of 15 mM hydroxyurea at 30°C. After washing twice with YEA medium, arrested cells were resuspended in fresh YEA medium at the cell density of 2 x 106 cells/ml and further incubated at 30°C to synchronously resume mitotic cell cycle. A portion of the culture was taken at intervals and cells were fixed by adding 1/10 vol of 37% formaldehyde. Progression of mitosis was monitored by analyzing chromosomal DNA of fixed cells stained with 4',6-diamidino-2-phenylindole (DAPI; Sigma Chemical Co.).
Analysis of Microtubule Morphology and Dynamics of Mitotic Spindles in Living Cells
To examine microtubule morphology, cells were transformed with pDQ105, a multicopy plasmid which carries a green fluorescent protein (GFP)–
-tubulin fusion gene (GFP–atb2+) placed under the nmt1 promoter (Ding et al., 1998). The transformed cells were grown or sporulated in the medium containing 5 µM thiamine for the repression of the GFP-tubulin expression at low levels. The GFP-labeled microtubules were examined under a microscope as described by Ding et al. (1998). To examine dynamics of the mitotic spindle, cells were used which express the GFP–
-tubulin from the fusion gene integrated at the lys1+ locus. To integrate the fusion gene, PstI–SacI fragment of pDQ105, which contains the GFP–
-tubulin gene placed under the nmt1 promoter, was moved into pYC36, an integration plasmid containing a partial lys1+ gene. The resultant plasmid was introduced into strains CRL152, CRL1521, and AY160-30A to produce strains YY105, GT1521, and GT160-30A, respectively. Integration was confirmed by Southern analysis. Cells of these strains were grown in YEA medium containing 5 µM thiamine at the cell density of 2 to 4 x 106 cells/ml and examined for spindle dynamics at 30°C.
Live Cell Analysis of Chromosome Dynamics
Live cell analysis of chromosome dynamics was carried out using a computer-operated microscope system, previously described by Chikashige et al. (1994 and 1997).
Synchronization of the Meiotic Process
Wild-type (AY162) and dhc1 (AY163) diploid strains were grown in liquid YEA medium at 33°C to 5 x 107 cells/ml. We found that sporulation efficiency was high when meiosis was induced in cells at late log or early stationary phase. The cells were then washed twice and resuspended in EMM medium lacking a source of nitrogen (EMM – N). Meiosis was synchronously induced by incubating the culture at 26°C with shaking. Progression of meiosis was monitored as described in Synchronization of Mitotic Cell Cycle.
Chromosome Missegregation Assay
Chromosome III missegregation was examined using intragenic complementation of two alleles of the ade6 gene on chromosome III, ade6-M210 and ade6-M216, previously described in Molnar et al. (1995). Strains AY1491-1A and AY1491-1B, or AY1491-1C and AY1491-1D, were mated and sporulated on ME plates at 26°C for 3 d. Sporulated cells were suspended in 400 µl of water containing 2 µl of Glusulase (Sigma Chemical Co.) and incubated for 16 to 18 h at 30°C to liberate spores and kill vegetative cells. Liberated spores were washed twice with water and plated on YEA and EMM plates supplemented with appropriate amino acids for selecting ade+ progenies. More than 100 ade+ progenies were tested for disomic chromosome III by streaking on YE plates after growing for several generations on YEA plates. Cells disomic for chromosome III give rise to red colonies on YE plates, since they frequently generate offspring monosomic for chromosome III (Niwa and Yanagida, 1985). Frequency of spores disomic for chromosome III was determined by the frequency of ade+ progenies and the ratio of the disomic progenies.
Construction of a Strain Bearing GFP–DHC Fusion Gene
The coding sequence of GFP-S65T (Heim et al., 1995) cloned in pRSET-B vector (Invitrogen Corp.; a gift from Dr. Tsien, University of California, San Diego, CA) was amplified by PCR using primers, CGCGGATCCATGAGTAAAGGAGAAGAACTT and GAAGGCCTATTTGTATAGTTCATCCATGCC. The PCR product was digested with BamHI and StuI and then inserted between the BamHI and SmaI sites of pREP1 vector (Maundrell, 1993) to form pEG3. A BamHI–SacI fragment of pEG3 containing GFP-S65T with a nmt1-polyadenylation sequence was cloned into the corresponding polylinker sites of pRS405 to form pAY147. A DNA fragment encoding a COOH-terminal portion of DHC was amplified by PCR using pAY142 as a template and synthetic oligonucleotides, TGGATGCCCTAAGAGATTT and CGGGATCCAATGCACATACTAAAATAAATATC. The PCR product was digested with NsiI and BamHI and inserted between the PstI and BamHI sites of pAY147 to form pAY150, which encodes the COOH-terminal portion of the DHC protein fused with GFP. pAY150 was integrated at the dhc1 locus of CRL152 to make strain CRL1526, replacing the wild-type dhc1 gene with the GFP-fused dhc1 gene.
Indirect Immunofluorescence Microscopy
Cells induced into meiosis on solid ME medium were fixed in methanol for 8 min at –30°C. The fixed cells were washed once with 0.1 M potassium phosphate buffer, pH 6.5, and resuspended in the same buffer containing 1 M sorbitol (spheroplast buffer). They were spheroplasted by adding 100 µg/ml of Zymolyase 100T (Seikagaku Kogyo) and 0.1% 2-mercaptoethanol. The spheroplasted cells were washed twice with spheroplast buffer and permeabilized with 1% Triton X-100 in spheroplast buffer. After permeabilization, the cells were washed twice with the phosphate buffer and resuspended in solution F (10 mM potassium phosphate buffer, pH 7.0, 150 mM NaCl, and 1% BSA). Antibody reactions with permeabilized cells were carried out in a microtube at 23°C as described in Hagan and Hyams (1988) using solution F for antibody incubations.
-Tubulin and GFP were stained using TAT1 mouse monoclonal anti–
-tubulin antibody (Woods et al., 1989) and rabbit polyclonal anti-GFP antibody (1:2,000 dilution, CLONTECH Laboratories, Inc.), respectively. FITC-conjugated goat polyclonal anti–mouse antibody (1:100 dilution, Jackson ImmunoResearch Laboratories, Inc.) and rhodamine-conjugated goat polyclonal anti–rabbit antibody (1:100 dilution, Cappel Laboratories/Organon Teknika Corp.) were used for secondary antibodies. DNA was stained with 100 ng/ml DAPI.
Analysis of Recombination Frequency
To examine the frequency of meiotic recombination, two strains bearing appropriate genetic markers were grown on the solid YEA medium at 33°C, mated, and then sporulated on the solid ME or EMM – N medium at 26°C (zygotic meiosis). Alternatively, after mating, diploid cells were selected on the solid EMM medium supplemented with appropriate amino acids. The diploid cells were grown on the solid YEA medium at 33°C and then sporulated on the solid ME medium at 26°C (azygotic meiosis). The frequency of intergenic recombination was examined by tetrad analysis. The frequency of intragenic recombination at the ade6 locus was analyzed, previously described by Ponticelli and Smith (1989). An approximate map of genetic markers used in this study is shown in Fig. 9.
|
-tubulin antibody (1:10,000 dilution; a gift from Dr. Masuda, The Institute of Physical and Chemical Research, Wako, Saitama, Japan) and then with Cy5-conjugated anti-rabbit antibody (1:100 dilution, Nycomed Amersham). After antibody reactions, the cells were postfixed with 3% paraformaldehyde in PEM buffer for 10 min at room temperature and then washed twice with PEM buffer.
For FISH, the cells were suspended in 2x SSC and incubated for 10 min at 23°C. Next, they were resuspended in 2x SSC containing 10% formamide and incubated for another 10 min at 23°C. The concentration of formamide was increased to 20% and then to 40%, step-wise with 10 min incubations at each step. After incubating cells in a 40% formamide solution, they were suspended in hybridization buffer (50% formamide, 5x Denhardt's solution, and 5% dextran sulfate in 2x SSC) containing fluorescent-labeled probes. Fluorescent-labeled probes were prepared as follows: Ribosomal RNA genes, which hybridize to both ends of chromosome III (Uzawa and Yanagida, 1992), were used for telomere probes. Alternatively, cosmid cos212 was used; this hybridizes to both ends of chromosome I and II (Funabiki et al., 1993). Plasmid pRS140, which contains centromeric repeats common to all three chromosomes, was used to hybridize to the centromeres (Chikashige et al., 1989). Cosmids, cos256, cos146, cos1228 (from Dr. Yanagida, Kyoto University, Kyoto, Japan) and ICRFc60D0727 (from Resource Center of the German Human Genome Project at the Max-Planck-Institut for Molecular Genetics) were used to hybridize to regions on the chromosome arms (Hoheisel et al., 1993, Mizukami et al., 1993). Approximate position of the chromosome regions to which the probes hybridize are shown in Fig. 9. The DNA used for telomere and chromosome-arm probes was fragmented with RsaI, TaqI, AluI, Sau3AI, and HaeIII, and then labeled with Cy3- or Cy5-dUTP (Nycomed Amersham Inc.) using an oligonucleotide tailing kit containing a terminal deoxynucleotidyl transferase (Boehringer Mannheim Co.). Similarly, the DNA used for centromere probes was digested with RsaI, TaqI, and AluI and labeled with Cy3-dUTP. Concentrations of the fluorescent-labeled DNA probes in the hybridization buffer were
15 µg/ml for telomere probes and 30 µg/ml for centromere and chromosome-arm probes. Before the hybridization step the cell suspension containing fluorescent probes was preheated to 70°C for 5 min to denature the DNA. Hybridization was carried out at 37°C for 16 h. After hybridization, the formamide concentration in the hybridization buffer was decreased to 40, 25, 15, and finally 7.5% by step-wise dilution with 2x SSC. For each dilution step, the cell suspension was incubated for 10 min at 23°C. After the concentration was decreased to 7.5%, the cells were resuspended in fresh 2x SSC and incubated for another 10 min at 23°C. Lastly, the cells were washed twice with 2x SSC and then stained for DNA with DAPI.
| Results |
|---|
|
|
|---|
|
Cytoplasmic DHC Is Not Required for Proper Positioning and Orientation of the Mitotic Spindle
To examine the role of the DHC molecule in fission yeast, we disrupted the coding sequence by integrating either the ura4+ gene of fission yeast or the LEU2 gene of budding yeast at the dhc1+ locus by homologous recombination (Fig. 1 B; see Materials and Methods). Cells containing the integration that truncates the putative motor domain (dhc1-d1, dhc1-d2, and dhc1-d3) or a deletion of the NH2-terminal two-thirds of the heavy chain gene (dhc1-d4) grew in rich and minimal media at temperatures from 20°C to 36°C and their doubling times were similar to those of wild-type cells. Indirect immunofluorescence and living cell analysis using GFP-tagged
-tubulin (Ding et al., 1998) revealed that nuclear and microtubule morphology of all the mutants were similar to those of wild-type cells. In addition, the number of cytoplasmic microtubules extending along the cell axis in G2 cells (Hagan and Hyams, 1988) were not significantly different, 2.9 ± 0.7 (mean ± SD) for wild-type and 2.7 ± 0.7 for the dhc1-d2 mutant (n = 40). Cytokinesis took place in the middle of the cell, just as in wild-type cells. In addition, when cells were synchronized in S phase by a DNA synthesis inhibitor, hydroxyurea, the mutant cells underwent nuclear division and cytokinesis with a similar timing to that of wild-type cells (Fig. 3 A). These results indicated that the DHC is not essential for the mitotic growth and the loss of its function does not cause gross defects in mitosis.
|
-tubulin (Ding et al., 1998). In wild-type cells, the mitotic spindle was formed at the center of the cell and elongated to
1 µm within 2 min (Fig. 3 B, left, 0 and 2 min). During this early stage of the spindle formation, cytoplasmic microtubules extending along the cell axis disappeared. The spindle continuously elongated to
3 µm and its length remained constant until further elongation (anaphase B) begins (Fig. 3 B, left, 2–16 min; Table II), as previously reported by Nabeshima et al., (1998). The spindle was always located at the middle of the cell and often changed its orientation (see spindle orientation in Fig. 3 B, left, 2, 10, and 14 min). In addition, short astral microtubules radiating from the spindle pole(s) were often observed (Fig. 3 B, left, 6 and 14 min). The time length of this stage was between 8 and 26 min, varying among cells. After this stage, the spindle elongated along the cell axis at the constant rate to reach its maximum length (anaphase B; Fig. 3 B, left, 18–26 min; Table II), and eventually disappeared (Fig. 3 B, left, 28 min). Astral microtubules radiating from the spindle poles were observed during elongation (Fig. 3 B, left, 20 and 24 min). When the dhc1-d2 cells were examined, no significant differences were observed in positioning, orientation, or kinetics of the mitotic spindles or in the behavior of astral-microtubules (Fig. 3 B, right; Table II). Therefore, we conclude that DHC is not required for maintaining proper positioning, orientation, or kinetics of mitotic spindles in fission yeast.
|
tagged with GFP as a nuclear marker (D.-Q. Ding and Y. Hiraoka manuscript in preparation), all of the nuclei eventually fused to form a single nucleus. These results strongly suggest that nuclear fusion was delayed to some extent in cells lacking a cytoplasmic DHC, but not abolished.
|
|
Despite the lack of oscillatory nuclear movement, many mutant cells underwent two rounds of meiotic chromosome segregation, as observed by the appearance of two and then four nuclei (Fig. 4 B). In wild-type cells, the nucleus performs some hours of oscillatory movement through meiotic prophase and then initiates two rounds of chromosome segregation (Chikashige et al., 1994). Live observations of the nuclear behavior in the dynein-disrupted mutant showed that the nucleus remained in the middle of the cell for
3 h after nuclear fusion and then initiated the first chromosome segregation. Unlike wild-type cells, chromosomes sometimes moved separately and failed to form two distinct chromosome masses during the first chromosome segregation (Fig. 4 B, 204 min; compare to Figure 2 C in Chikashige et al., 1994). Despite this aberrant behavior, two rounds of chromosome segregation were accomplished within 2 h, as in wild-type cells (Fig. 4 B).
Analysis of azygotic diploid cells, which synchronously entered meiosis without undergoing nuclear fusion, suggest that both wild-type and mutant cells accomplished meiotic processes with a similar timing. As shown in Fig. 5, both wild-type and mutant diploid cells showed similar profiles after nitrogen starvation. Specifically, cells containing a deformed nucleus, which is characteristic of the meiotic stage preceding chromosome segregation, increased at
5 h and decreased at
8 h. Live observations confirmed that the deformed nucleus of the mutant lacked the oscillatory movement, whereas that of wild-type moved back and forth between cell poles (data not shown). These results suggested that the mutant cells accomplished the meiotic process preceding meiotic chromosome segregation with a timing similar to that of wild-type, despite the lack of nuclear movement.
|
14-fold increase of the disomic spores indicated that chromosome missegregation increased during meiosis I in the mutant. Thus, the dynein function is required for faithful chromosome segregation.
|
|
Microtubule Morphology in the Dynein Mutant during Meiosis
Since the oscillatory nuclear movement is dependent upon astral microtubules radiating from the SPB (Ding et al., 1998), it is possible that the lack of the movement in the dynein mutants is due to a loss of astral microtubules. We examined microtubule morphology in living meiotic dhc1-d2 cells using GFP-tagged
-tubulin (Ding et al., 1998). In a zygote containing a single nucleus, astral microtubules radiated from the SPB (Fig. 7, c–f), although the oscillatory nuclear movement was not observed. Therefore, the lack of the oscillatory nuclear movement in the mutant is not caused by a loss of astral microtubules. The microtubule morphology of the mutant cells was not significantly different from that observed in wild-type cells during the remainder of meiosis (Hagan and Yanagida, 1995; Svoboda et al., 1995; Ding et al., 1998). During karyogamy, astral microtubules radiated from the SPB as each of two nuclei converged to bring the two SPBs together (Fig. 7, a and b) and the meiotic spindles were normal during meiotic chromosome segregation (Fig. 7, g–j).
|
In mitotically growing cells, the dynein-GFP was not detected (data not shown). Meiotic cells, on the other hand, showed specific intracellular localization. During nuclear fusion through meiotic prophase, the dynein-GFP was localized at the SPB (Fig. 8 A, b, d, and f, large arrows, and B, large arrowheads), and astral microtubules (Fig. 8 A, b, d, and f, and C, e). The localization of the dynein-GFP to the SPB was demonstrated by the position of the GFP dot at the protruding edge of the nucleus (Fig. 8 A, a and b, and B, large arrowheads) and its colocalization with the focal point of astral microtubules (Fig. 8 C). This localization was apparent until anaphase of the first meiotic division (Fig. 8 A, g and h), but was not detected through the rest of meiosis (Fig. 8 A, i and j). The localization to astral microtubules was demonstrated by colocalization of the GFP line with microtubules (Fig. 8 C, e, f, and h) and further confirmed by the disappearance of the GFP lines by treating the cells with a microtubule-depolymerizing drug, thiabendazole (data not shown). Interestingly, during the oscillatory nuclear movement, a dynein-GFP dot was frequently observed on an astral microtubule(s) at a point where the microtubule(s) contacts the cell cortex in front of the moving nucleus, and the nucleus moved towards it (Fig. 8 A, d and f, small arrows, and B, small arrowheads). The dot appeared during the approach of the SPB to the cortex (Fig. 8 B, lower, 15 s) and disappeared after the SPB reached it and reversed the direction of its movement (Fig. 8 B, lower, 90 s). This observation suggests the presence of a novel structure on the cell cortex that promotes a transient accumulation of the dynein-GFP and is involved in the nuclear movement (see Discussion).
|
We then examined the frequency of intragenic recombination. It has been known that gene conversion occurs at high frequency at the ade6 locus on chromosome III. That is, a strain carrying a mutant allele of the ade6 gene, ade6-M26 or ade6-M375, spontaneously gives rise to ade+ recombinants in high frequency when crossed with a strain carrying another ade6 allele, ade6-469 (Gutz, 1971; Ponticelli et al., 1988; Schuchert and Kohli, 1988; Szankasi et al., 1988; Mizuno et al., 1997). As shown in Table IV, the frequency of intragenic recombination of both ade6-M26 and ade6-M375 was reduced by about nine- and fivefold, respectively, through zygotic meiosis in the dynein mutant. Thus, intragenic recombination was also reduced in the dynein mutant and this reduction was not allele-specific. Taken together, these results demonstrated that the dynein function is required for efficient meiotic recombination. In addition, the reduced frequency of the distinct types of recombination suggest that the reduced meiotic recombination results from inefficient pairing of homologous chromosomes, rather than defects in recombination machinery in the dynein mutant.
|
Cells were induced into meiosis and the positions of centromeres and telomeres were determined in zygotic nuclei by FISH analysis. When centromeres were examined the population of cells containing a single centromere cluster was significantly reduced in the dhc1 mutant. The fraction of single-nuclear cells containing a single centromere cluster was about threefold smaller in mutant than in wild-type cells (Table V). On the other hand, the fraction of those containing dispersed centromeres was significantly larger in the mutant (Table V; Fig. 10 B, g and j). Dispersed centromeres were not observed during karyogamy in the mutant, as in wild-type. Each of the two nuclei in the fusion process contained a single centromere signal (Fig. 10 B, a). These results suggest that centromeres fail to form a single cluster and disperse in many dhc1-d2 cells. The reduced population of cells containing a single centromere cluster strongly suggest that the dynein mutant cells failed to achieve efficient pairing of homologous centromeres.
|
We then examined four different chromosomal regions on the arms of chromosome I and II in the mutant (Fig. 9). Greater than 90% of the single-nuclear cells showed one or two nuclear FISH signals in both wild-type and the mutant (Fig. 11). However, in the mutant cells the population of cells containing a single FISH signal, which probably indicates the paired state of the regions, was significantly smaller than in wild-type cells (Table VI). These results strongly suggested that the mutant cells failed to achieve efficient pairing of homologous regions on a pair of homologous chromosomes. Taken together, these results support the idea that homologous chromosomes failed to pair efficiently in the dynein mutant, due to the lack of the oscillatory nuclear movement.
|
|
| Discussion |
|---|
|
|
|---|
Involvement of cytoplasmic dynein in microtubule-mediated nuclear migration has been reported in other fungi. In Neurospora crassa, A. nidulans, and Nectria haematococca, dynein is required for the migration of nuclei in the germ tube (Plamann et al., 1994; Xiang et al., 1994, 1995; Inoue et al., 1998). The budding yeast, Saccharomyces cerevisiae, requires dynein function for nuclear positioning and migration at the bud neck in mitosis (Eshel et al., 1993; Li et al., 1993; Yeh et al., 1995; Carminati and Stearns, 1997; Cottingham and Hoyt, 1997; DeZwaan et al., 1997; Shaw et al., 1997). Specifically, the nucleus penetrates into the bud neck at the onset of anaphase, oscillates several times at the neck, and then divides into mother and daughter cells (Yeh et al., 1995; DeZwaan et al., 1997). In the absence of dynein function, the anaphase nucleus often fails to penetrate into the neck and there are no oscillations (Yeh et al., 1995; DeZwaan et al., 1997). In those cells, the nucleus divides within the mother cell and eventually segregates into mother and bud cells. Thus, cytoplasmic dynein generates forces required for the nuclear penetration and oscillation at the bud neck during anaphase in budding yeast.
The dynein-dependent nuclear migration in budding yeast during mitosis and in fission yeast during meiosis share several features. First, both types of nuclear movement are driven by astral microtubules interacting with the cell cortex (Palmer et al., 1992; Sullivan and Huffaker, 1992; Svoboda et al., 1995; Carminati and Stearns, 1997; Shaw et al., 1997; Ding et al., 1998). Second, both are driven by dynein localized at the SPB and/or astral microtubules (Yeh et al., 1995; Shaw et al., 1997). Finally, both are oscillatory, though the amplitude of the oscillation is greater in fission yeast (Yeh et al., 1995; DeZwaan et al., 1997). These similarities strongly suggest that these nuclear movements in two evolutionary divergent organisms are driven by similar mechanisms.
Despite many similarities, dynein is not required for mitotic spindle dynamics in fission yeast, as demonstrated by the lack of significant defects in spindle behavior of the mutant. The difference may be due to the different geometry of their cell division. In budding yeast, divided nuclei are segregated into the mother and daughter cells through a narrow path at the bud neck. However, the fission yeast cell is divided by a septum formed at the middle of the cell after the divided nuclei have been segregated to opposite ends of the cell. Thus, the positioning of the nucleus in mitosis may be more important to budding yeast. Alternatively, another DHC, which has not been detected by our analysis, may play a role in mitosis of fission yeast.
During the oscillatory nuclear movements, GFP-tagged dynein is localized to the SPB and astral microtubules. It is also concentrated at the point where astral microtubules contact the cell cortex that faces an approaching nucleus. From analogy with other organisms, astral microtubules in fission yeast are probably oriented with their plus ends distal and minus ends proximal to the SPB (Bergen et al., 1980; Euteneuer and McIntosh, 1981; McIntosh and Euteneuer, 1984; Toriyama et al., 1988; Yamamoto et al., 1990). Given the localization of dynein and the polarity of the microtubules, we suggest two models for dynein function in the nuclear movement. In the first model, dynein immobilized on the cell cortex generates a pulling force by walking along astral microtubules toward their minus ends. The accumulation of dynein at the point where microtubules contact with the cortex facing an approaching nucleus is consistent with this model. A similar model was proposed for the function of dynein in budding yeast (Carminati and Stearns, 1997; Cottingham and Hoyt, 1997; DeZwaan et al., 1997). However, a cortical accumulation of dynein was not observed in this organism. In the second model, dynein motors at the SPB generate a pushing force on the SPB by walking in the minus end direction on microtubules that extend rearward. The localization of dynein at the SPB is consistent with this model. A contribution of pushing forces to create nuclear movement was previously proposed, since the movement was associated with the elongation of microtubules extending rearward (Ding et al., 1998). Supporting this model, it has been reported that a pushing by astral microtubules drives preanaphase nuclear migration in budding yeast. However, in this case the pushing force is not generated by dynein (Shaw et al., 1997). In either model, dynein may also play a role in dynamic changes of microtubule length, which are required for the oscillatory movement. Preliminary results showed that the rate of microtubule shortening, which occurs mostly in front of the moving nucleus in wild-type cells, was significantly altered in the dynein mutant at the meiotic stage preceding chromosome segregation (A. Yamamoto, unpublished results). Future analysis will be required to clarify the functions of DHC in the oscillatory nuclear movement.
Biological Significance of the Oscillatory Nuclear Movement during Meiotic Prophase
Most dynein mutant cells completed meiosis and formed four viable spores, despite the lack of oscillatory nuclear movement, and the duration of the meiotic stage preceding chromosome segregation is not obviously different in those cells. These results indicate that the movement is not essential for the progression of meiosis, and that the duration of the stage preceding chromosome segregation is determined independently of nuclear movement. However, the dynein mutant showed significant reduction in meiotic recombination suggesting that nuclear movement is required for efficient meiotic recombination. Our FISH observations of chromosome positioning strongly suggest that the reduced recombination results from inefficient pairing of homologous chromosomes. That is, the formation of a single cluster of centromeres and the colocalization of homologous regions in single-nuclear zygotes, which likely reflects the paired state of homologous chromosomes, were significantly inhibited in the dynein mutant. Preliminary observations of a centromere-linked locus in living cells using lac repressor/operator recognition (Robinett et al., 1996, Straight et al., 1996; Nabeshima et al., 1998) also support this idea. During oscillatory nuclear movement, the centromere-proximal loci on a pair of homologous chromosomes frequently contact each other in wild-type cells, but rarely in the dynein mutant (A. Yamamoto, K. Nabeshima, M. Yanagida, and Y. Hiraoka, unpublished observation). In addition to this idea, the frequency of both intergenic and intragenic recombination was reduced significantly in the mutant. Given the cytoplasmic role of dynein in nuclear movement, it is likely that the lack of the nuclear movement causes inefficient pairing of homologous chromosomes in the dynein mutant, which brings significant reduction in meiotic recombination.
In the mutant, intergenic recombination occurred more frequently in azygotic meiosis than in zygotic meiosis (Table III). The higher recombination frequencies in azygotic meiosis could be due to the positioning of homologous chromosomes in proximity during mitosis of diploid cells (Scherthan et al., 1994), which may facilitate pairing of homologous chromosomes in subsequent meiosis. However, despite this positioning the recombination frequencies of wild-type cells were lower in azygotic meiosis than in zygotic. Perhaps, a process(es) during karyogamy, which is absent in azygotic meiosis, is required for efficient meiotic recombination in fission yeast.
In addition to reduced frequencies of recombination, the dynein mutant showed increased missegregation of chromosomes, probably resulting in the slight increase of cells that failed to form four spores in the mutant. It is most likely that the increased missegregation of homologous chromosomes is caused by reduced crossing over on pairs of homologous chromosomes as a consequence of reduced recombination. The aberrant chromosome behavior that sometimes was observed during the first meiotic chromosome segregation of the dynein mutant (Fig. 3 B, 204 min) may also result from reduced crossing over. Future analysis is required to clarify the relation between crossing over and reductional segregation of homologous chromosomes in the dynein mutant.
When the fission yeast nucleus oscillates between the cell poles, its chromosomes form a bouquet structure, i.e., the telomeres remain clustered near the SPB at the leading edge of the moving nucleus (Chikashige et al., 1994, 1997). The reduction of the recombination frequency in several mutants of fission yeast in which telomeres failed to form a cluster suggests that formation of the telomere cluster is required for proper pairing of homologous chromosomes (Shimanuki et al., 1997; Cooper et al., 1998; Nimmo et al., 1998). Although the dynein mutants showed a similar phenotype, the defect was not caused by failure to form a telomere cluster, since telomeres were clustered near the SPB in most dhc1 cells (Fig. 10 C). Conversely, mutants defective in telomere clustering still showed nuclear movement (Nimmo et al., 1998; A. Yamamoto and Y. Hiraoka, unpublished observation) indicating that the lack of the nuclear movement is not a cause of the reduced recombination in these mutant cells. These results strongly suggest that telomere clustering and microtubule-mediated nuclear movement are distinct biological events, both of which are required for proper pairing of homologous chromosomes.
Requirement of both telomere clustering and nuclear movement for efficient chromosome pairing is consistent with a previously published model (Chikashige et al., 1994, 1997; Kohli, 1994; Ding et al., 1998). In this model, the nuclear dynamics produce chromosome movement by pulling the clustered telomeres and this chromosome movement aligns homologous chromosomes side by side to promote their efficient pairing (Fig. 12, a–e). Subsequently, pairing of homologous chromosomes leads to the formation of a single centromere cluster. The nuclear dynamics also cause an elongation of the nucleus and we speculate that the constricted intranuclear space contributes to the chromosome pairing by promoting an efficient encounter of homologous chromosomes. In this scenario, when the nuclear movement is abolished, as in the dynein mutants, homologous chromosomes fail to achieve efficient pairing because they lack the necessary spatial alignment and inefficient pairing results in the reduced meiotic recombination and frequent failure to form a single centromere cluster (Fig. 12, f and g). The scattering of centromeres observed in dhc1 cells (Fig. 12 g) probably corresponds to the chromosomal state, which transiently appears in wild-type cells before the formation of a single centromere cluster (Fig. 12 d), given that a small population of wild-type cells contains dispersed centromeres (Table V). Similarly, when the telomere clustering is abolished homologous chromosomes fail to pair efficiently and meiotic recombination is reduced, as observed in the mutants defective in telomere clustering (Shimanuki et al., 1997; Cooper et al., 1998; Nimmo et al., 1998).
|
| Acknowledgments |
|---|
-tubulin antibody, Drs. O. Niwa, K. Okazaki, and K. Ohta for strains, and Dr. M. Yanagida for the cosmid DNA. We thank Dr. D.-Q. Ding for many helpful suggestions for live cell analysis and construction of the GFP-tubulin integration plasmid and strain YY105, and Dr. Y. Chikashige for the modified FISH method and many helpful suggestions. We thank Y. Tomita and R. Kurokawa for DNA sequencing, and C. Tsutsumi for assisting tetrad analysis and constructing a strain containing a portion of DNA polymerase
tagged with GFP. We thank Drs. D.-Q. Ding, A. Nabetani, T. Haraguchi, H. Masuda, and especially H. Renauld for critically reading the manuscript and many helpful comments to improve the manuscript. This work was supported by grants from the Japanese Ministry of Culture, Science, and Education and the Science and Technology Agency of Japan to Y. Hiraoka, and by National Institutes of Health grant GM36663 to J.R. McIntosh. R.R. West was supported by the American Cancer Society (PF-4035) and J.R. McIntosh is a Research Professor of the American Cancer Society.
Submitted: 7 August 1998
Revised: 3 May 1999
| References |
|---|
|
|
|---|
Altschul SF, Gish W, Miller W, Meyers EW & Lipman DJ. Basic local alignment search tool, J Mol Biol, 1990, 215, 403–410.[Medline]
Bähler J, Wyler T, Loidl J & Kohli J. Unusual nuclear structures in meiotic prophase of fission yeast: a cytological analysis, J Cell Biol, 1993, 121, 241–256.
Barbet N, Muriel WJ & Carr AM. Versatile shuttle vectors and genomic libraries for use with Schizosaccharomyces pombe. , Gene, 1992, 114, 59–66.[Medline]
Bascom-Slack CA & Dawson DS. The yeast motor protein, Kar3p, is essential for meiosis I, J Cell Biol, 1997, 139, 459–467.
Bass HK, Marshall WF, Sedat JW, Agard DA & Cande WZ. Telomeres cluster de novobefore the initiation of synapsis: a three-dimensional spatial analysis of telomere positions before and during meiotic prophase, J Cell Biol, 1997, 137, 5–18.
Bergen L, Kuriyama R & Borisy GG. Polarity of microtubules nucleated by centrosomes and chromosomes of chinese hamster ovary cells in vitro, J Cell Biol, 1980, 84, 151–159.
Carminati JL & Stearns T. Microtubule orient the mitotic spindle in yeast through dynein-dependent interactions with the cell cortex, J Cell Biol, 1997, 138, 629–641.
Chikashige Y, Kinoshita N, Nakaseko Y, Matsumoto T, Murakami S, Niwa O & Yanagida M. Composite motifs and repeat symmetry in S. pombe centromeres: direct analysis by integration of NotIrestriction sites, Cell, 1989, 57, 739–751.[Medline]
Chikashige Y, Ding D-Q, Funabiki H, Haraguchi T, Mashiko S, Yanagida M & Hiraoka Y. Telomere-led premeiotic chromosome movement in fission yeast, Science, 1994, 264, 270–273.
Chikashige Y, Ding D-Q, Imai Y, Yamamoto M, Haraguchi T & Hiraoka Y. Meiotic nuclear reorganization: switching the position of centromeres and telomeres in the fission yeast Schizosaccharomyces pombe. , EMBO (Eur Mol Biol Organ) J, 1997, 16, 193–202.[Medline]
Cooper JP, Watanabe Y & Nurse P. Fission yeast Taz1 protein is required for meiotic telomere clustering and recombination, Nature, 1998, 392, 828–831.[Medline]
Cottingham FR & Hoyt MA. Mitotic spindle positioning in Saccharomyces cerevisiaeis accomplished by antagonistically acting microtubule motor proteins, J Cell Biol, 1997, 138, 1041–1053.
Dernburg, A.F., J.W. Sedat, W.Z. Cande, and H.W. Bass. 1995. Cytology of telomeres. In Telomeres. E.H. Blackburn and C.W. Greider, editors. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. 295–338.
DeZwaan TM, Ellingson E, Pellman D & Roof DM. Kinesin-related KIP3 of Saccharomyces cerevisiaeis required for a distinct step in nuclear migration, J Cell Biol, 1997, 138, 1023–1040.
Ding D-Q, Chikashige Y, Haraguchi T & Hiraoka Y. Oscillatory nuclear movement in fission yeast meiotic prophase is driven by astral microtubules, as revealed by continuous observation of chromosomes and microtubules in living cells, J Cell Sci, 1998, 111, 701–712.[Abstract]
Eshel D, Urrestarazu LA, Vissers S, Jauniaux J-C, van Vliet-Reedijk JC, Planta RJ & Gibbons IR. Cytoplasmic dynein is required for normal nuclear segregation in yeast, Proc Natl Acad Sci USA, 1993, 90, 11172–11176.
Euteneuer U & McIntosh JR. Polarity of some motility-related microtubules, Proc Natl Acad Sci USA, 1981, 78, 372–376.
Funabiki H, Hagan I, Uzawa S & Yanagida M. Cell cycle-dependent specific positioning and clustering of centrosome and telomeres in fission yeast, J Cell Biol, 1993, 121, 961–976.
Fussell, C.P. 1987. The Rabl orientation: a prelude to synapsis. In Meiosis. P.B. Moens, editor. Academic Press, Orlando, FL. 275–299.
Gutz H. Site specific induction of gene conversion in Schizosaccharomyces pombe. , Genetics, 1971, 69, 317–337.
Gygax A & Thuriaux P. A revised chromosome map of the fission yeast Schizosaccharomyces pombe. Curr. , Genetics, 1984, 8, 85–92.
Hagan I & Yanagida M. The product of the spindle formation gene sad1+associates with the fission yeast spindle pole body and is essential for viability, J Cell Biol, 1995, 129, 1033–1047.
Hagan IM & Hyams JS. The use of cell cycle mutants to investigate the control of microtubule distribution in the fission yeast Schizosaccharomyces pombe. , J Cell Sci, 1988, 89, 343–357.
Heim R, Cubitt AB & Tsien RY. Improved green fluorescence, Nature, 1995, 373, 663–664.[Medline]
Hiraoka T. Studies of mitosis and meiosis in comparison. IV. A contribution to the study of the origin of the "bouquet" and its formation, Cytologia, 1941, 11, 483–492.
Hiraoka T. Observational and experimental studies of meiosis with special reference to the bouquet stage. XI. Locomotory movement of the nucleolus in the bouquet stage, Cytologia, 1952a, 17, 201–209.
Hiraoka T. Observational and experimental studies of meiosis with special reference to the bouquet stage. XIV. Some considerations on a probable mechanism of the bouquet formation, Cytologia, 1952b, 17, 292–299.
Hirata A & Tanaka K. Nuclear behavior during conjugation and meiosis in the fission yeast Schizosaccharomyces pombe. , J Gen Appl Microbiol, 1982, 28, 263–274.
Hoheisel JD, Maier E, Mott R, McCarthy L, Grigoriev AV, Schalkwyk LC, Nizetic D, Francis F & Lehrach H. High resolution cosmid and P1 maps spanning the 14 Mb genome of the fission yeast S. pombe. , Cell, 1993, 73, 109–120.[Medline]
Holzbaur ELF & Vallee RB. Dyneins: molecular structure and cellular function, Annu Rev Cell Biol, 1994, 10, 339–372.[Medline]
Inoue S, Turgeon BG, Yorder OC & Aist JR. Role of fungal dynein in hyphal growth, microtubule organization, spindle pole body motility and nuclear migration, J Cell Sci, 1998, 111, 1555–1566.[Abstract]
John, B. 1990. Meiosis. Cambridge University Press, Cambridge, UK.
Kohli J. Telomeres lead chromosome movement, Curr Biol, 1994, 4, 724–727.[Medline]
Kohli J, Hottinger H, Munz P, Strauss A & Thuriaux P. Genetic mapping in Schizosaccharomyces pombeby mitotic and meiotic analysis and induced haplodization, Genetics, 1977, 87, 471–489.
Koonce MP, Grissom PM & McIntosh JR. Dynein from Dictyostelium: primary structure comparisons between a cytoplasmic motor enzyme and flagellar dynein, J Cell Biol, 1992, 119, 1597–1604.
Li Y, Yeh E, Hays T & Bloom K. Disruption of mitotic spindle orientation in a yeast dynein mutant, Proc Natl Acad Sci USA, 1993, 90, 10096–10100.
Loidl J. The initiation of meiotic chromosome pairing: the cytological view, Genome, 1990, 33, 759–778.[Medline]
Maundrell K. Thiamine-repressible expression vectors pREP and pRIP for fission yeast, Gene, 1993, 123, 127–130.[Medline]
McIntosh JR & Euteneuer U. Tubulin hooks as probes for microtubule polarity: an analysis of the method and an evaluation of data on microtubule polarity in the mitotic spindle, J Cell Biol, 1984, 98, 525–533.
Mizukami T, Chang WI, Garkavtsev I, Kaplan N, Lombardi D, Matsumoto T, Niwa O, Kounosu A, Yanagida M, Marr TG et al.. A 13 kb resolution cosmid map of the 14 Mb fission yeast genome by nonrandom sequence-tagged site mapping, Cell, 1993, 73, 121–132.[Medline]
Mizuno K, Emura Y, Baur M, Kohli J, Ohta K & Shibata T. The meiotic recombination hot spot created by the single-base substitution ade6-M26results in remodeling of chromatin structure in fission yeast, Genes Dev, 1997, 11, 876–886.
Molnar M, Bähler J, Sipiczki M & Kohli J. The rec8 gene of Schizosaccharomyces pombeis involved in linear element formation, chromosome pairing and sister-chromatid cohesion during meiosis, Genetics, 1995, 141, 61–73.[Abstract]
Moreno S, Klar A & Nurse P. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. , Methods Enzymol, 1991, 194, 793–823.
Nabeshima K, Nakagawa T, Straight AF, Murray A, Chikashige Y, Yamashita Y, Hiraoka Y & Yanagida Y. Dynamics of centromeres during metaphase-anaphase transition in fission yeast: dis1 is implicated in force balance in metaphase bipolar spindle, Mol Biol Cell, 1998, 9, 3211–3225.
Nimmo ER, Pidoux AL, Perry PE & Allshire RC. Defective meiosis in telomere-silencing mutants of Schizosaccharomyces pombe. , Nature, 1998, 392, 825–828.[Medline]
Niwa O & Yanagida M. Triploid meiosis and aneuploidy in Schizosaccharomyces pombe: an unstable aneuploid disomic for chromosome III, Curr Genet, 1985, 9, 463–470.
Olson LW, Eden U, Egel-Mitani M & Egel R. Asynaptic meiosis in fission yeast? , Hereditas, 1978, 89, 189–199.
Palmer RE, Sullivan DS, Huffaker T & Koshland D. Role of astral microtubules and actin in spindle orientation and migration in the budding yeast, Saccharomyces cerevisiae. , J Cell Biol, 1992, 119, 583–593.
Parvinen M & Söderström K-O. Chromosome rotation and formation of synapsis, Nature, 1976, 260, 534–535.[Medline]
Plamann M, Minke PF, Tinsley JH & Bruno KS. Cytoplasmic dynein and actin-related protein Arp1 are required for normal nuclear distribution in filamentous fungi, J Cell Biol, 1994, 127, 139–149.
Ponticelli AS & Smith GR. Meiotic recombination-deficient mutants of Schizosaccharomyces pombe. , Genetics, 1989, 123, 45–54.
Ponticelli AS, Sena EP & Smith GR. Genetic and physical analysis of the M26 recombination hotspot of Schizosaccharomyces pombe. , Genetics, 1988, 119, 491–497.
Robinett CC, Straight A, Li G, Willhelm C, Sudlow G, Murray A & Belmont AS. In vivolocalization of DNA sequences and visualization of large-scale chromatin organization using lac operator/repressor recognition, J Cell Biol, 1996, 135, 1685–1700.
Salonen K, Paranko J & Parvinen M. A colcemid-sensitive mechanism involved in regulation of chromosome movements during meiotic pairing, Chromosoma, 1982, 85, 611–618.[Medline]
Saraste M, Sibbald PR & Wittinghofer A. The P-loop: a common motif in ATP- and GTP-binding proteins, Trends Biochem Sci, 1990, 15, 430–434.[Medline]
Scherthan H, Bähler J & Kohli J. Dynamics of chromosome organization and pairing during meiotic prophase in fission yeast, J Cell Biol, 1994, 127, 273–285.
Scherthan HS, Weich S, Schwegler H, Heyting C, Härle M & Cremer T. Centromere and telomere movements during early meiotic prophase of mouse and man are associated with the onset of chromosome pairing, J Cell Biol, 1996, 134, 1109–1125.
Schuchert P & Kohli J. The ade6-M26 mutation of Schizosaccharomyces pombeincreases the frequency of crossing over, Genetics, 1988, 119, 507–515.
Shaw SL, Yeh E, Maddox P, Salmon ED & Bloom K. Astral microtubule dynamics in yeast: a microtubule-based searching mechanisms for spindle orientation and nuclear migration into the bud, J Cell Biol, 1997, 139, 985–994.
Shimanuki M, Miki F, Ding D-Q, Chikashige Y, Hiraoka Y, Horio T & Niwa O. A novel fission yeast gene, kms1+, is required for the formation of meiotic prophase-specific nuclear architecture, Mol Gen Genet, 1997, 254, 238–249.[Medline]
Sikorski RS & Hieter P. A system of shuttle vectors and yeast host strains designed for efficient manipulation of DNA in Saccharomyces cerevisiae. , Genetics, 1989, 122, 19–27.
Straight AF, Belmont AS, Robinett CC & Murray AW. GFP tagging of budding yeast chromosomes reveals that protein–protein interactions can mediate sister chromatid cohesion, Curr Biol, 1996, 6, 1599–1608.[Medline]
Sullivan DS & Huffaker TC. Astral microtubules are not required for anaphase B in Saccharomyces cerevisiae. , J Cell Biol, 1992, 119, 379–388.
Svoboda A, Bähler J & Kohli J. Microtubule-driven nuclear movements and linear elements as meiosis-specific characteristics of the fission yeasts Schizosaccharomyces versatilis and Schizosaccharomyces pombe. , Chromosoma, 1995, 104, 203–214.[Medline]
Szankasi P, Heyer W-D, Schuchert P & Kohli J. DNA sequence analysis of the ade6 gene of Schizosaccharomyces pombe: wild-type and mutant alleles including the recombination hot spot allele ade6-M26. , J Mol Biol, 1988, 204, 917–925.[Medline]
Therman, E., and M. Susman. 1992. Human chromosomes. Springer-Verlag, New York.
Toriyama M, Ohta K, Endo S & Sakai H. 51-kd protein, a component of microtubule-organizing granules in the mitotic apparatus involved in aster formation in vitro, Cell Motil Cytoskel, 1988, 9, 117–128.[Medline]
Trelles-Sticken E, Loidl J & Scherthan H. Bouquet formation in budding yeast: initiation of recombination is not required for meiotic telomere clustering, J Cell Sci, 1999, 112, 651–658.[Abstract]
Uzawa S & Yanagida M. Visualization of centromeric and nucleolar DNA in fission yeast by fluorescence in situhybridization, J Cell Sci, 1992, 101, 267–275.
Vaisberg EA, Koonce MP & McIntosh JR. Cytoplasmic dynein plays a role in mammalian mitotic spindle formation, J Cell Biol, 1993, 123, 849–858.
Walker JE, Saraste M, Runswick MJ & Gay NJ. Distantly related sequences in the alpha- and beta-subunits of ATP synthase, myosin, kinases and other ATP-requiring enzymes and a common nucleotide binding fold, EMBO (Eur Mol Biol Organ) J, 1982, 1, 945–951.[Medline]
Woods A, Sherwin T, Sasse R, MacRae TH, Baines AJ & Gull K. Definition of individual components within the cytoskeleton of Trypanosoma bruceiby a library of monoclonal antibodies, J Cell Sci, 1989, 93, 491–500.
Xiang X, Beckwith SM & Morris NR. Cytoplasmic dynein is involved in nuclear migration in Aspergillus nidulans. , Proc Natl Acad Sci USA, 1994, 91, 2100–2104.
Xiang X, Roghi C & Morris NR. Characterization and localization of the cytoplasmic dynein heavy chain in Aspergillus nidulans. , Proc Natl Acad Sci USA, 1995, 92, 9890–9894.
Yamamoto A, Nagai K, Yamasaki M & Matsuhashi M. Solubilization of aster-forming proteins from yeast: possible constituents of spindle pole body and reconstitution of asters in vitro. , Cell Struct Funct, 1990, 15, 221–228.[Medline]
Yao KTS & Ellingson DJ. Observations on nuclear rotation and oscillation in chinese hamster germinal cells in vitro, Exp Cell Res, 1969, 55, 39–42.[Medline]
Yeh E, Skibbens RV, Cheng JW, Salmon ED & Bloom K. Spindle dynamics and cell cycle regulation of dynein in the budding yeast, Saccharomyces cerevisiae. , J Cell Biol, 1995, 130, 687–700.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|