|
||


* Fred Hutchinson Cancer Research Center, Seattle, Washington 98109;
Department of Medicine, Division of Dermatology,
University of Washington, Seattle, Washington 98198;
Department of Pathobiology, University of Washington, Seattle,
Washington 98198; and § Hormone Research Center, Chonnam National University, Kwangju 500-757, South Korea
| |
Abstract |
|---|
|
|
|---|
Laminin 5 regulates anchorage and motility
of epithelial cells through integrins
6
4 and
3
1, respectively. We used targeted disruption of the LAMA3
gene, which encodes the
3 subunit of laminin 5 and
other isoforms, to examine developmental functions that are regulated by adhesion to the basement membrane (BM). In homozygous null animals, profound epithelial abnormalities were detected that resulted in
neonatal lethality, consistent with removal of all
3-laminin isoforms from epithelial BMs. Alterations in
three different cellular functions were identified. First, using a novel tissue adhesion assay, we found that the
mutant BM could not induce stable adhesion by integrin
6
4, consistent with the presence of junctional
blisters and abnormal hemidesmosomes. In the absence
of laminin 5 function, we were able to detect a new
ligand for integrin
3
1 in the epidermal BM, suggesting that basal keratinocytes can utilize integrin
3
1 to
interact with an alternative ligand. Second, we identified a survival defect in mutant epithelial cells that
could be rescued by exogenous laminin 5, collagen, or
an antibody against integrin
6
4, suggesting that signaling through
1 or
4 integrins is sufficient for survival. Third, we detected abnormalities in ameloblast
differentiation in developing mutant incisors indicating
that events downstream of adhesion are affected in mutant animals. These results indicate that laminin 5 has
an important role in regulating tissue organization, gene expression, and survival of epithelium.
| |
Introduction |
|---|
|
|
|---|
LAMININS are multifunctional extracellular matrix (ECM)1
proteins that regulate adhesion, motility, gene expression, and apoptosis. Genetically distinct
,
,
and
subunits of laminin form specialized heterotrimers
that maintain the function of neuromuscular junctions (Noakes et al., 1995a
), striated muscle (Xu et al., 1994
;
Helbling-Leclerc et al., 1995
), renal glomeruli (Noakes et
al., 1995b
), and skin (Verrando et al., 1987
; Carter et al.,
1991
; Rousselle et al., 1991
). We have focused on skin to
examine regulatory functions in the epidermis mediated
by adhesion to the basement membrane (BM), which led
to the identification of laminin 5 (
3
3
2) as the major adhesive ligand present in the BM of stratified squamous epithelium (Carter et al., 1991
). Laminin 5 differentially regulates anchorage and motility of epithelial cells through
integrins
6
4 and
3
1, respectively (Carter et al., 1990
;
Xia et al., 1996
; Goldfinger et al., 1998
). Proper regulation
of these functions is essential for normal wound repair that
requires keratinocyte activation followed by cell motility
for reepithelialization of the epidermis. Upregulation of
laminin
3 chain mRNA and protein indicates that newly
synthesized laminin 5 may be required for cell migration
and repair of the BM in vivo (Ryan et al., 1994
; Lampe,
1998; Nguyen and Carter, manuscript in preparation).
To investigate the role of laminin 5 in migratory and homeostatic epithelium, we performed targeted ablation of
the LAMA3 gene, which encodes the
3 subunit of laminin 5. Laminin 5 is expressed in a variety of epithelial tissues (Carter et al., 1991
; Aberdam et al., 1994
) indicating
that LAMA3 null animals can be used to study multiple
developmental systems. Biochemical studies have identified the
3 chain as a subunit in laminin 6 (Marinkovich et al., 1992
; Gil et al., 1994
) and laminin 7 (Champliaud et al., 1996
), suggesting that other laminin trimers derived from
the LAMA3 gene can be analyzed for loss of function.
Furthermore, because basal keratinocytes use laminin 5 as
a preferred ligand (Carter et al., 1990
), we anticipated that
removal of laminin 5 might allow for the identification of
other BM ligands that could not be detected in the presence of laminin 5.
In this report, we show that LAMA3 null animals
develop a lethal blistering condition similar to human
junctional epidermolysis bullosa (JEB; Christiano and
Uitto, 1996
). Our results demonstrate that ablation of the
LAMA3 gene perturbs the formation of hemidesmosomes (HDs) in homeostatic epithelium and disrupts the functional interaction between laminin 5 and integrin
6
4.
We found that in the absence of laminin 5 basal cells can
utilize integrin
3
1 to interact with an alternative BM
ligand. Despite evidence for an alternative
3
1 ligand
and the presence of multiple laminin isoforms in the BM
of mutant skin, homozygous null animals fail to survive. In vitro studies indicate that laminin 5 deficient epithelial
cells have a survival disadvantage when compared with
wild-type cells and we identified conditions that will allow
for the rescue of mutant cells. Finally, our data indicate
that events downstream of adhesion are effected in mutant
animals. In particular, we show that ameloblast differentiation is impaired in the developing incisors of mutant animals. These studies provide a basis to examine the influence of endogenous and exogenous laminin 5 on cell
survival and gene expression in epithelium. In addition,
because all laminin trimers containing the
3 chain have
been removed in mutant animals, this animal model has
implications for widespread defects in BM stemming from
the removal of laminins 5-7.
| |
Materials and Methods |
|---|
|
|
|---|
Materials
Restriction enzymes, TaqI polymerase, and RadPrime DNA labeling system was purchased from GIBCO BRL. The Biotechnology Core Lab (Fred Hutchinson Cancer Research Center, Seattle, WA) prepared oligonucleotide primers used for PCR. The multiple tissue Northern blot and hybridization buffer were purchased from CLONTECH Laboratories, Inc. FBS was from Summit. Other cell culture reagents included BSA, trypsin, and hydrocortisone (Sigma Chemical Co.); cholera toxin (Calbiochem-Novabiochem Corp.); aminoguanidine (Aldrich Chemical Co.); EGF (Collaborative Biomedical Products); and keratinocyte growth medium (KGM; Clonetics).
Cloning of the Murine LAMA3 Gene
A 600-bp cDNA clone (Ep-1) corresponding to the helical region of the
human
3 laminin chain (Ryan et al., 1994
) was used to screen a murine
fetal kidney library. Based on sequence homology, the resulting cDNAs
were confirmed to be the murine equivalent of the
3-laminin chain. The
clones were later found to be compatible with published sequence for the
murine laminin
3 chain (Galliano et al., 1995
). The
3 laminin cDNAs
were then used to screen a 129Sv genomic library (kindly provided by Dr.
Phil Soriano, Fred Hutchinson Cancer Center, Seattle, WA) and multiple
clones corresponding to the LAMA3 gene were identified.
Targeted Disruption of the LAMA3 Gene
A 1.2-kb NsiI/SacI genomic fragment that contained the murine equivalent of exon A3 from the LAMA3 gene (Pulkkinen et al., 1998a
) was replaced with a neo cassette driven by the PGK promoter. The construct
was flanked 5' and 3' by a 0.8-kb BglII/NsiI fragment and a 5-kb SacI/SacI
fragment, respectively. Both flanking sequences were derived from genomic fragments corresponding to the LAMA3 gene. A PGK-driven
diphtheria toxin expression cassette was placed 5' to the 0.8-Kb BglII/NsiI
fragment. The construct was linearized with XhoI and electroporated into
embryonic stem (ES) cells. Colonies were selected for G418 resistance
and screened for homologous recombination using PCR as described (Soriano et al., 1991
). The PCR strategy included an oligonucleotide from the
neo gene (5' TCGCAGCGCATCGCCTTCTA 3') and an oligonucleotide
specific for the LAMA3 gene (5' AACCCTGGCTAGTCTGGAAC 3')
upstream of the 0.8-kb NsiI/BglII fragment used in the targeting construct.
PCR was performed in a DNA Thermal Cycler (Perkin-Elmer Corp.) for
40 cycles as follows: 93°C for 30 s; 55°C for 30 s; 65°C for 3 min. Positive clones were further characterized by Southern blot analysis using genomic
DNA digested with NsiI and hybridized with an XbaI fragment that is 5'
to the PGKneo insert. Tissue culture and blastocyst injections were performed as previously described (Soriano et al., 1991
).
Histology and Immunohistochemistry
For histology, samples were fixed using 10% formalin, rinsed in PBS, dehydrated through graded alcohol, and embedded in paraffin. Sections
were stained with hematoxylin and eosin. For immunohistochemistry, frozen tissues were embedded directly in Tissue-Tek O.C.T. Compound (Sakura Finetek USA, Inc.). Cryostat sections (8-10 microns) were extracted with 1% Triton in PBS and fixed with 2% formaldehyde in PBS
(20 min). Tissue sections were either stained using a Vectastain ABC kit
(Vector Labs) or processed for immunofluorescence. For the ABC kit,
sections were blocked with 10% goat serum, incubated with primary antibody for 2 h, washed, incubated with a biotinylated secondary antibody,
washed, incubated with peroxidase-conjugated avidin, washed, and developed using diaminobenzidine plus nickel chloride. For immunofluorescence, tissue sections were blocked, incubated with primary antibody for 2 h,
washed, incubated with FITC or rhodamine-conjugated secondary antibodies, and washed. Sections were mounted in a solution containing 25 mg/ml of 1,4-diazobicyclo-(2,2,2)octane in glycerol (Johnson et al., 1982
)
and visualized for immunofluorescence using a Zeiss Microscope.
Electron Microscopy
Tissue was fixed with half strength Karnovsky's fixative plus 0.1% tannic
acid, rinsed in 0.1 M cacodylate buffer, and post-fixed in 2% osmium
tetroxide (Sakai and Keene, 1994
). Samples were dehydrated in graded
ethanols and propyleneoxide and then embedded in Polybed 812 resin.
Thin sections (80-90 nm) were cut and stained with uranyl acetate. A
JEOL 100-SX electron microscope was used for examining and photographing the samples.
Culturing of Mouse Epidermal Keratinocytes
Neonatal mouse pups were killed by decapitation, rinsed in 70% ethanol
and PBS, and skinned. The skin was digested in 0.25% trypsin overnight
at 4°C for 14 h. The epidermis was separated from the dermis and placed
in N-medium according to the protocol of Hager et al. (1999)
. N-medium
is MEM (0.06 mM Ca2+) plus 7.3% chelexed FBS supplemented with culture supernatant from freshly isolated fibroblasts. N-medium also contains
hydrocortisone, cholera toxin, aminoguanidine, and EGF. Cells are released from the epidermis into N-medium by shaking. The cells were directly seeded onto dishes that were untreated or coated with 10 µg/ml of
type IV collagen (Collaborative Biochemical Products; Becton Dickinson
Labware). Immortalized mouse epidermal keratinocytes (MEKs) were
cultured in KGM containing 0.06 mM calcium chloride (Clonetics Corp.).
Tissue Adhesion Assays
Adhesion assays on tissue sections were as follows: cryostat sections of
split skin from wild-type and mutant animals were attached to the lid of a
petri dish. Tissue sections were washed with PBS and blocked with 0.5%
BSA. Trypsinized human foreskin keratinocytes (HFKs; Carter et al.,
1991
) that had been resuspended in KGM (Clonetics Corp.) were labeled
with calcein-AM (Molecular Probes, Inc.) for 15 min at room temperature
(Lampe, 1998). Cells were washed with PBS and incubated with tissue sections for 1 h in the presence or absence of inhibitory antibodies. After incubation, cells were gently washed once using PBS, fixed with 2% formaldehyde in 0.1 M sucrose cacodylate buffer for 20 min, washed three times in PBS, and rinsed with distilled water. Sections were mounted with a solution containing 25 mg/ml of 1,4-diazobicyclo-(2,2,2)octane in glycerol
(Johnson et al., 1982
) and visualized for fluorescence using a Zeiss microscope.
Antibodies
Rat mAbs against mouse
1 and
1 laminin were purchased from Chemicon International, Inc. A rat mAb against
4 integrin was purchased from
PharMingen. Dr. Takashi Hashimoto (Kurume University, Kurume,
Fukuoka, Japan) kindly supplied human mAb 5E against bullous pemphigoid antigen 230 (BP230; Hashimoto et al., 1993
). Dr. Eva Engvall (Burnham Institute, La Jolla, CA) provided polyclonal antibodies for
1 and
2
laminin chains, which were made against the E3 fragment of EHS laminin
and recombinant domain VI from the
2 chain, respectively. A polyclonal
antibody prepared against recombinant
5 laminin was prepared by Dr.
Jeffery Miner (Washington University, St. Louis, MO) as previously described (Miner et al., 1997
). A polyclonal antiserum that was prepared
against laminin 5 isolated from rat 804G cells was supplied by Dr. Jonathon Jones (Northwestern University, Chicago, IL; Langhofer et al.,
1993
). A mouse mAb, D3-4, that cross-reacts with mouse laminin 5 was prepared in this lab by Susana Gil as previously described (Gil et al.,
1994
). Secondary antibodies were purchased from Vector Labs, Southern
Biotechnology Associates Inc., and Jackson ImmunoResearch Laboratories, Inc.
| |
Results |
|---|
|
|
|---|
Analysis and Strategy for Targeted Disruption of the LAMA3 Gene
Northern blot analysis showed that two major transcripts
for the laminin
3 chain are expressed in multiple mouse
tissues (Fig. 1). The schematic illustration in Fig. 1 indicates that multiple laminin trimers can be derived from
these gene products. Therefore, to introduce a mutation
into the LAMA3 gene, we developed a strategy that would
ablate all possible
3-laminin trimers. We removed the
murine equivalent of exon A3 of the LAMA3 gene (Pulkkinen et al., 1998a
) and flanking sequence from the 5' NsiI site (Ns*) to the 3' SacI site (S*) replacing it with a PGK-driven neomycin (neo) cassette (Fig. 2 A). The coding sequence of exon A3 is common to both the
3a and
3b
transcripts (Ryan et al., 1994
). Consequently, removal of
exon A3 will cause a frame shift mutation followed by a
premature stop codon that will disrupt the
3a and
3b
transcripts produced by the LAMA3 gene (Ryan et al.,
1994
).
|
|
The targeting construct (Fig. 2 A) was introduced into 129Sv ES cells by electroporation and homologous recombination occurred at a frequency of 12%. Southern blot analysis on genomic DNA digested with NsiI confirmed the presence of the mutant allele (Fig. 2 B). Five clones that contained the mutant allele were used for blastocyst injection resulting in the generation of multiple chimeric animals. Chimeric animals generated from ES clones 5-2, 15-4, and 19-1 (Fig. 2 B) were crossed with C57BL/6J females. ES-agouti coat color identified pups with germline transmission of the mutant gene. Mice heterozygous for the LAMA3 mutation were crossed to obtain homozygous null offspring. Homozygous null animals derived from ES clones 5-2, 15-4, and 19-1 displayed similar phenotypes, so we continued our studies with the animals generated from ES clone 5-2. PCR analysis was used to determine the genotype of the offspring by using primers designed to detect the wild-type and mutant alleles (Fig. 2 C).
Phenotype of LAMA3 Null Mice
Homozygous
3
/
null animals appeared indistinguishable from
3+/
and
3+/+ wild-type littermates at birth
(Fig. 3 A). After birth, homozygous
3
/
null animals,
referred to as mutant animals, develop progressive blistering of the forepaws, limbs, and oral mucosa (Fig. 3, B and
E). 25% of the newborn pups were homozygous null, suggesting that failure to express
3 did not cause embryonic lethality in the C57BL/6J genetic background. However,
the animal in Fig. 3 C showed more extensive blistering
than most of the mutant littermates, suggesting that the
skin phenotype may be more severe in some of the affected animals. In most cases, the limbs and paws of the
mutant animals were visibly red and bleeding (Fig. 3 F),
even when blistering lesions were not detected. It was
noted that the content of the mutant stomach was substantially smaller (Fig. 3 D) and the mutant animals weighed
40-50% less than wild-type littermates. The presence of
milk in the intestine of mutant animals indicates that there
was no gastric obstruction, such as pyloric atresia, which
can occur in JEB patients with mutations in integrin
6
4
(Vidal et al., 1995
; Brown et al., 1996
). The mutant animals
died 2-3 d after birth from a failure to thrive, possibly
caused by dehydration and malnutrition.
|
Paraffin-embedded sections of skin from wild-type and
mutant animals were analyzed using hematoxylin and eosin staining (Fig. 4, A-C). The lesions present in mutant
skin were confirmed to be junctional blisters caused by a
separation at the dermal-epidermal junction (Fig. 4 C).
The epidermis of mutant skin showed distinct organizational changes in lesional areas when compared with nonlesional areas. In lesional areas, the epidermis contained
clusters of cells in the superbasal layer that maintained an
undifferentiated morphology (Fig. 4 C) similar to the pearl
cells described in
4 null animals (Dowling et al., 1996
). It
was noted that the basal cells present in lesional regions
were sparse and contained flattened nuclei (Fig. 4 C).
These alterations contrasted with the organization of the
epidermis in nonlesional regions. In nonlesional regions of
mutant skin (Fig. 4 B), the morphology of the basal cells
and the organization of the epidermis were similar to that of the wild-type skin (Fig. 4 A).
|
Laminin Expression in Wild-type and Mutant Skin
Immunostaining confirmed the absence of laminin 5 from
the epidermal BM of mutant skin (Fig. 4 E), consistent
with the blistering phenotype. Using mAb D3-4, we
sought to examine the expression of all
3-laminin heterotrimers in skin. mAb D3-4 immunoprecipitates multiple
3-containing heterotrimers from human keratinocytes (Gil et al., 1994
), including laminin 5 (
3
3
2) and
laminin 6 (
3
1
1), suggesting that it interacts with
3
chain. Immunostaining showed that mAb D3-4 was positive in wild-type skin, but absent from the epidermal BM
of mutant skin (Fig. 4, F and G). The absence of staining in
the mutant BM with mAb D3-4 (Fig. 4 G) shows that we
have removed all laminin trimers containing the
3 chain
from the BM of mutant skin. We also found that
3-laminin was absent from multiple tissues in late stage mutant
embryos including the tissues that were shown by Northern blot analysis to express the
3a and
3b transcripts
(data not shown). In contrast, immunostaining showed
that the expression of the
1 and
1 laminin chains were maintained in the wild-type and mutant tissues (Table I).
The
1 and
1 subunits of laminin form trimers with different
chains to generate tissue-specific laminin isoforms
(Engvall et al., 1990
; Miner et al., 1997
). Therefore, we
used antibodies against the
1-,
2-, and
5-laminin chains
to identify which laminin isoforms are present in the epidermal BM of wild-type and mutant skin. Strong staining
for
5 laminin is maintained in wild-type (Fig. 4 H) and
mutant (Fig. 4 I) skin, indicating that laminin 10 (
5
1
1)
or 11 (
5
2
1) may be present in the epidermal BM. The
results, summarized in Table I, indicate that multiple laminin isoforms remain in the BM of mutant skin. However,
none of the other laminins are sufficient to stabilize the
adhesion of epithelium to the BM.
|
Structure and Composition of HDs
The skin phenotype of mutant animals is consistent with
an autosomal recessive disorder in humans known as
junctional epidermolysis bullosa-gravis (JEB-G; Christiano and Uitto, 1996
). The loss of anchorage function in
mutant epidermis led us to examine the organization and
composition of HDs in mutant skin. HDs link the laminin
5-rich BM to the keratin cytoskeletal through integrin
6
4 (Carter et al., 1990
; Stepp et al., 1990
). BP230 stabilizes the adhesion plaque on the cytoplasmic side (Tanaka
et al., 1991
). Immunohistochemical staining showed that
integrin
6
4 and BP230 are expressed and are polarized
in the basal cells of wild-type (Fig. 5, A and B) and mutant
(Fig. 5, C and D) skin. Integrin
6
4 and BP230 both displayed an unexpected discontinuous organization in
blistered and nonblistered regions of mutant skin when
compared with the wild-type (Fig. 5, E and F). This discontinuity suggests that the absence of laminin 5 effects organization of HD components in basal cells, even in nonlesional areas. Furthermore, these results identify a novel
phenotypic alteration in HDs that may be diagnostic in
cell adhesion defects stemming from abnormalities in the
basement membrane zone (BMZ).
|
We used transmission electron microscopy to examine
the ultrastructure of HDs in tissue. HDs appear normal in
wild-type animals, containing a basal and subbasal electron dense plaque (Fig. 6, A and B). Anchoring filaments
extend from the basal lamina toward the HD. In the cytoplasm, keratin filaments accumulate near the subbasal
plaque (Fig. 6 B). This fine structural organization was
lacking in mutant animals. The epidermis of mutant skin
contained electron dense plaques at the plasma membrane, but lacked discernible subbasal plaques (Fig. 6, C
and D). Intermittently, rudimentary HDs formed at the
plasma membrane in the mutant animals (Fig. 6 D). Consistent with our immunostaining results, there was discontinuity in the formation of electron dense plaques resulting
in a complete absence of HDs in some regions of the basal
cells in mutant skin (Fig. 6 D). Taken together, these findings indicate that the formation and stability of continuous
HDs at the basal surface requires laminin 5, whereas basal
polarization of integrin
6
4 and BP230 proceed in the
absence of laminin 5.
|
Detection of a Ligand for Integrin
3
1
To evaluate the adhesive properties of the BM in vivo,
short term adhesion assays were done on cryostat sections
of split skin from wild-type and mutant animals (Gil, S.G.,
T.A. Brown, and W.G. Carter, manuscript in preparation).
Previous studies have indicated that the function of
4 integrin can be more effectively evaluated when the function
of
1 integrins are suppressed (Niessen et al., 1994
; Xia et
al., 1996
). Therefore, we used cytochalasin D to suppress
the function of
1 integrins by inhibiting the organization of the actin cytoskeleton, which allowed the function of
1 and
4 integrins to be distinguished. Tissue adhesion
assays were done using human foreskin keratinocytes
(HFKs) instead of mouse keratinocytes because some of
the inhibitory antibodies do not cross-react with mouse
cells. Fig. 7 A shows that HFKs adhere well to the BM of
wild-type tissue regardless of whether they are untreated
(Fig. 7 A, a) or pretreated with cytochalasin D (Fig. 7
A, b). The cytochalasin D-resistant adhesion could be blocked using an inhibitory antibody against
6 integrin
(Fig. 7 A, c) indicating that this interaction is dependent
on integrin
6
4. In contrast, pretreatment of HFKs with
cytochalasin D resulted in complete inhibition of adhesion
to the BM of mutant tissue (Fig. 7 A, h) demonstrating the
loss of a functional interaction between integrin
6
4 and
laminin 5. However, in untreated HFKs, we were able to
detect adhesion to the mutant BM (Fig. 7 A, g), suggesting
that a ligand for
1 integrin is present in the BM of mutant
tissue. This led us to investigate which
1-integrin receptor
was required for adhesion to the mutant BM. The results showed that mAb P1B5, an inhibitory antibody against integrin
3, significantly reduced adhesion to the BM of mutant tissue (Fig. 7 B, h) when compared with the control
(Fig. 7 A, g). A comparison of several representative areas
indicated that the inhibition observed in the presence of
P1B5 was ~80%. A combination of anti-
3 and anti-
6 inhibitory antibodies allowed for complete inhibition of adhesion to the BM of mutant skin (Fig. 7 B, i). The nature
of any contribution from integrin
6, if significant, awaits
further investigation. It is sufficient that in the presence of
mAb P1B5 adhesion of HFKs to the mutant BM is reduced by >80% demonstrating that a ligand for integrin
3
1 is detectable in laminin 5 deficient tissue. In contrast,
mAb P1B5 (Fig. 7 B, b) did not effect adhesion of HFKs to
the wild-type BM due to the interaction of laminin 5 with
integrin
6
4. This was confirmed by using a combination
of GoH3 and P1B5, which completely blocked adhesion of
HFKs to the wild-type tissue (Fig. 7 B, c). Therefore, in
mutant tissue, we were able to detect a ligand for integrin
3
1 that could not be detected in wild-type tissue because of the dominant interaction of laminin 5 with integrin
3
1 and integrin
6
4. These results provide evidence that other endogenous BM proteins can serve as a
ligand for
3
1, but not for the anchorage function mediated by integrin
6
4 in the epidermis.
|
Reduced Survival of Laminin 5 Deficient Keratinocytes
MEKs were isolated from wild-type and mutant skin. The
yield of cells and seeding density was comparable for normal and mutant MEKs. However, in contrast to normal
MEKs, mutant MEKs failed to survive when plated on an
untreated culture dish (Fig. 8, compare A and B). Survival
of mutant MEKs was restored when cells were plated on
an exogenous ligand such as collagen (Fig. 8, compare B
and D). These results show that ablation of laminin 5 is
sufficient to prevent the survival of mutant MEKs in the
absence of an exogenous ligand. This concept was further
reinforced with the generation of a laminin 5 deficient cell
line. Using the E6/E7 transforming genes from papilloma
virus (Kaur et al., 1989
) we immortalized wild-type and
mutant epithelial cells. The mutant epithelial cells remained dependent on exogenous ligand for survival and
this dependence was confirmed in a growth curve (Fig. 9).
Using flow cytometry, there was no accumulation of a pre-G1 peak (Dou et al., 1995
), suggesting that extensive
apoptosis was not occurring in the mutant cells (data not
shown). Studies were initiated to identify receptor/ligand interactions that could rescue the survival defect in mutant
MEKs. Laminin 5-enriched ECM (Fig. 8, compare F and
H) or immobilized anti-integrin
4 antibody (Fig. 8, compare F and J) were able to rescue mutant MEKs, suggesting that interactions of laminin 5 with integrin
6
4
contribute to the survival of epithelial cells. Because keratinocytes use integrin
3
1 and
6
4 to interact with laminin 5, both receptors may be contributing to the enhanced survival observed on laminin 5 (Fig. 8, compare F and H).
We could not evaluate the contribution from integrin
3
1 separately because antibodies that react with mouse
are not available. However, rescue of mutant MEKs on
collagen (Fig. 9) or immobilized anti-
2 antibody (data
not shown) indicate that ligation of
1 integrins is also sufficient to rescue survival of mutant MEKs. In contrast to
mutant cells, the MEKs derived from normal animals retained a high survival rate and characteristic epithelial
morphology regardless of whether they were plated on untreated culture dishes, exogenous ligand, or immobilized
antibody (Fig. 8 E, G, I, and Fig. 9). Therefore, within the
limits of this assay, we found that ligation of
1 or
4 integrins are sufficient to rescue the survival defect resulting from ablation of laminin 5. These results confirm the proposal that laminin 5 secreted into the ECM by cultured keratinocytes is the primary adhesive ligand produced by
these cells, even though an additional ligand for integrin
3
1 resides in the BM.
|
|
Ameloblast Differentiation Is Dependent on Laminin 5
Laminin 5 is expressed in a variety of epithelial BMs. In
skin, we observed severe defects in basal keratinocytes resulting in abnormal HDs and loss of anchorage function in
the BM of the mutant epidermis. We predicted that if
laminin 5 were involved in late stage differentiation we
would be able to detect abnormalities in other target organs that develop late in gestation. Examination of cross-sections from neonatal mice revealed gross abnormalities in the developing incisors of mutant animals. Therefore,
developing incisors of wild-type and mutant animals were
selected for further investigation. Cross-sections from medial to lateral regions of the head were taken to evaluate
histogenesis of the incisors at different stages of maturation (Fig. 10 A). Progressive differentiation is identifiable
from the base of the tooth (region I) to the tip (region III
and VI). The stages of differentiation are outlined for
ameloblasts (Fig. 10, B and C), which are the specialized
epithelial population that deposit enamel on one side of
the developing rodent incisor (Fig. 10 C, a). Mitotic preameloblasts of the inner dental epithelium located at the
base of the tooth in region I (Fig. 10, B and C) develop
into post-mitotic, secretory ameloblasts in region II (Fig.
10, B and C) and produce the enamel layer of the tooth. A
sharp boundary is visible at the junction between the ameloblasts and the stratum intermedium (Fig. 10 F,
boundary between a and si). This boundary corresponds to
cytoplasmic filaments, not a BM. The BM is located between the developing tooth and the ameloblast (Fig. 10 F,
bm). As a result, the nuclei of the ameloblast become polarized away from the BM (Fig. 10 G). Consistently, immunostaining with mAb D3-4 showed intense deposition
of the laminin
3 chain between the secretory ameloblasts
and the enamel boundary in the wild-type incisor (Fig. 10
D). Positive staining with mAb D3-4 was absent from a
comparable region of the mutant tooth (Fig. 10 E) confirming the removal of laminin
3 chain trimers from the developing incisor.
|
Cross-sections from comparable regions of the wild-type teeth (Fig. 10, F-I and N) and mutant teeth (Fig. 10, J-M and O) were evaluated. In wild-type incisors, secretory ameloblasts of region II were discernible as elongated epithelial cells with Tomes' processes extending toward the deposited enamel (Fig. 10 G). Differentiation continued normally with the appearance of ruffled edge mature ameloblasts in region III (Fig. 10 H) followed by the formation of the reduced enamel epithelium in region IV (Fig. 10, I and N). A discrete morphological change occurs in region IV: the stratum intermedium no longer marks a discrete boundary (Fig. 10 N, arrow) because the ameloblasts, stratum intermedium, stellate reticulum, and outer dental epithelium become incorporated into the stratified epithelium referred to as the reduced enamel epithelium.
In mutant animals, incisor development appeared normal until the onset of enamel secretion. Presecretory
ameloblasts in region I of wild-type (Fig. 10 F) and mutant
animals (Fig. 10 J) are indistinguishable. At the onset of
enamel secretion in region II, the ameloblasts of mutant
incisors (Fig. 10 K) were shorter with visible undulations at the edges when compared with wild-type incisors (Fig.
10 G). As differentiation proceeded, the ameloblasts of
the mutant incisor continued to be reduced in size relative
to the wild-type teeth (Fig. 10, H and L; compare height of
ameloblasts relative to double arrows in H and L) and
enamel deposition did not appear normal. The enamel
edge of mutant incisors appeared frayed in comparison to
the enamel deposited in wild-type incisors (Fig. 10, compare H and L). The abnormal appearance and size of the
mutant ameloblasts made it difficult to distinguish the
transition from secretory ameloblasts of region II to mature ameloblasts of region III. In region IV, where the
ameloblasts and the adjacent stratum intermedium form
the reduced enamel epithelium, tissue organization was
completely disrupted (Fig. 10, compare N to O). This disorganization corresponded precisely with the point where
the stratum intermedium no longer formed a discrete
boundary (Fig. 10 O, arrow). At this junction between region III and IV the reduced enamel epithelium should form a stratified epithelium. This does not occur in the
mutant tissue (Fig. 10 O). These results define a role for
the
3 subunit of laminin 5 in murine tooth development
and provide a biological basis for the hypoplastic enamel
that has been described in human JEB-G (Wright et al.,
1993
).
| |
Discussion |
|---|
|
|
|---|
Laminin 5 Regulates the Organization of HDs
Our results show that loss of
6
4-laminin 5 anchorage
functions have profound effects on HD organization. Discontinuities in localization of integrin
6
4 and BP230
were so prominent in mutant tissue that they could easily
be detected at the light microscope level by immunohistochemical staining with anti-
4, -
6, or -BP230 antibodies. Analysis with other cellular markers, such as keratin-1
or keratin-14, did not display alterations that would allow
us to distinguish between wild-type and mutant skin (data
not shown). In contrast, the discontinuous staining of
6
4 and BP230 was reproducible in 100% of the homozygous
null pups allowing us to readily identify wild-type and mutant skin. Because the discontinuity of
4-integrin and
BP230 staining occurred in both lesional and nonlesional
regions, our data suggests that HD alterations are a primary consequence of laminin 5 deficiency rather than a
secondary effect caused by the lesion. Consistently, a subpopulation of patients lacking either laminin 5 or bullous pemphigoid antigen 180 (BP180) display a similar disorganization of HD proteins (Brown, T.A., and W.G. Carter,
unpublished observation), suggesting that this phenotypic
alteration may have diagnostic value in patients with structural abnormalities in the BMZ. It was noteworthy that
the discontinuity of
6
4 and BP230 appeared to occur at
cell-cell boundaries, suggesting that stability of cell-cell
junctions may be reduced in these regions. The notion that
cell-substrate adhesion can regulate interactions at cell- cell junctions has been established in epithelial cells.
Tiam1/Rac signaling in epithelial cells can promote either
cell-cell adhesion or cell migration depending on the type
of matrix used for cell adhesion (Sander et al., 1998
). Similarly, laminin 5 interactions with integrin
3
1 selectively
promote intercellular communication of basal keratinocytes through gap junctions (Lampe, 1998).
Ablation of LAMA3 Results in JEB and Survival Defects
Ablation of the LAMA3 gene causes a phenotype similar
to a lethal variant of human epidermolysis bullosa, JEB-G.
Clinical features of JEB-G include mechanical fragility of
the skin, growth retardation, oral erosions, gastrointestinal
and genitourinary tract involvement, dental abnormalities,
hypoplastic HDs, and high morbidity (Fine et al., 1991
).
JEB-G is an autosomal recessive disorder that has been
associated with mutations in the LAMA3 (Kivirikko et al.,
1995
), LAMB3 (Pulkkinen et al., 1994b
), and LAMC2
(Pulkkinen et al., 1994a
) genes of laminin 5. Mutations in
the LAMA3 gene have been documented in only a small
fraction of the JEB-G cases, which led us to wonder if null
mutations in the LAMA3 gene would result in embryonic
lethality, particularly since we removed all trimers containing the
3 chain from the BM, including laminins 5-7.
On the contrary, we found that mice homozygous for the
null mutation were born at the expected frequency of
25%, suggesting that embryonic lethality did not occur in
the C57/BL6 genetic background. The reduced number of
patients with mutations in the LAMA3 gene relative to the
other genes that encode laminin 5 may be due in part to a
reported hotspot in the LAMB3 gene (Kivirikko et al.,
1996
).
In vitro studies on primary and immortalized keratinocytes (Figs. 8 and 9) have indicated that laminin 5 contributes to keratinocyte survival, which may have relevance to pathology of human JEB-G. Jonkman et al.
(1997)
described an individual who is mosaic for mutations
in the COL17A1 gene encoding BP180, a component of
HDs. Surprisingly, the subpopulation of keratinocytes
from this mosaic individual that express BP180 display a
survival advantage in culture and in the skin of the individual (Jonkman et al., 1997
). Thus, both laminin 5 and
BP180 provide a survival advantage for keratinocytes. Curiously, keratinocytes from individuals with JEB-pyloric
atresia with inherited defects in
4 appear to survive in
culture as well as or better than wild-type keratinocytes
(Gil and Carter, unpublished observation). Additional experiments will be necessary to determine if the survival advantage observed in wild-type cells is due to a direct effect
of laminin 5 on cell cycle regulation through integrins. It
has been shown that adhesion of primary keratinocytes to
laminin 5 promotes entry into the cell cycle through signaling pathways that are generated by ligation of integrin
6
4 (Mainiero et al., 1997
; Murgia et al., 1998
). Laminin
5 may also promote cell proliferation through a second signaling pathway involving integrin
3
1 (Gonzales et al.,
1999
). Consistently, our results indicate that exogenous
ligands are not adequate for longterm survival of mutant
MEKs (Ryan, M.C., unpublished observation), suggesting
that the survival contributions from laminin 5 may not
simply be due to adhesion. Whether or not exogenous
laminin 5 is sufficient to rescue defective cellular functions
caused by the absence of endogenous laminin 5 remains to
be determined, particularly since endogenous and exogenous laminin 5 may have different biological functions.
Exogenous laminin 5 is a scatter factor for carcinoma cells
that do not make endogenous laminin 5, but not for carcinomas that deposit endogenous laminin 5 (Kikkawa et al.,
1994
). Similarly, we have observed that keratinocytes from
JEB-G patients with defective laminin 5 expression and
MEKs from LAMA3 null animals will both scatter in response to exogenous laminin 5 while normal cells do not
(Gil, S.G., M.C. Ryan, and W.G. Carter, unpublished observation). Future studies will determine if exogenous
laminin 5 or transfection with
3-laminin cDNAs can rescue
cellular defects stemming from the removal of laminin 5.
Relationship to Other Knock-Out Animals
The integrity of the epidermis of LAMA3 null animals remained intact during development and birth indicating
that adhesion independent of laminin 5 may provide sufficient developmental instruction and stability for survival
before birth. Junctional blisters developed in the affected
pups several hours after birth and were usually restricted
to the forepaws, limbs, and oral mucosa. A similar blistering phenotype was found in mice carrying a disruption in
the
3 subunit of laminin 5 that was caused by insertion of an intracisternal-A particle into the LAMB3 gene (Kuster
et al., 1997
). The relatively restricted blistering phenotype
of the LAMA3 null animals contrasts with the phenotype
of pups lacking integrin
6
4, the anchorage receptor for
laminin 5. Pups lacking either integrin
6 or
4 displayed
extensive blisters over the entire body surface and died
within hours of birth (Dowling et al., 1996
; Georges-Labouesse et al., 1996
; van der Neut et al., 1996
). The extensive skin fragility may have been caused by weakening
in the cytoplasm and at the BMZ that resulted in the formation of both simplex and junctional blisters in these animals (Dowling et al., 1996
; Georges-Labouesse et al., 1996
;
van der Neut et al., 1996
). The epithelium in
4 null animals was also susceptible to apoptotic cell death. Using a
tunnel staining assay (data not shown), we did not detect
apoptosis in LAMA3 null animals. The accelerated and
heightened severity of the blistering in the
4 null animals
may also have contributed to the onset of apoptosis in
these animals. We noted organization changes in the epidermis of LAMA3 null animals that were similar to the
4
null animals. In particular, we identified cell clusters that
appeared undifferentiated in the superbasal cell layer similar to the pearl cells described in the
4 null animals
(Dowling et al., 1996
). Immunostaining of skin with anti-
4 antibodies identified positive staining in the superbasal
cell layer (data not shown), suggesting that cellular differentiation in lesional regions of the epidermis may be abnormal in LAMA3 null animals.
Laminin 5 can regulate both anchorage and motility of
epithelial cells through integrin
6
4 and
3
1, respectively (Carter et al., 1990
; Xia et al., 1996
; Goldfinger et al.,
1998
). Consistently, analysis of skin from integrin
3 null
animals has revealed alterations in the epidermis stemming from the absence of integrin
3
1 function (DiPersio
et al., 1997
). In particular, the integrin
3 null animals showed a disorganized BM and blister formation at the
dermal-epidermal junction (DiPersio et al., 1997
). Similar
to LAMA3 null animals, bleeding was identifiable in the
paws of integrin
3 null pups (Hodivala-Dilke et al., 1998
).
Whether these two observations are connected remains to
be determined. The bleeding that occurred in the paws of
the LAMA3 null pups was detectable even before a blister
had formed, suggesting that it was a primary defect. The
bleeding may be an indication of an abnormality stemming
from the role of
3-laminin in an alternative trimer such as
laminin 6 or 7.
The BM of Mutant Tissue Supports
1-Integrin
Function, but Not
6
4-Anchorage
Using a novel adhesion assay to directly assay BM function in vivo we found that the mutant BM could no longer
induce adhesion by integrin
6
4. These results confirm
that functional interactions between integrin
6
4 and
laminin 5 have been eliminated in homozygous null animals. This data has implications for the organism as a whole because it indicates that integrin
6
4 may be unligated or no longer functional in multiple tissues, which
may contribute to the neonatal lethality in homozygous
null animals. In contrast to loss of
6
4 function, cell adhesion via integrin
3
1 was retained in the mutant BM.
Because we have demonstrated that laminin 5 is absent
from the mutant BM, the most logical conclusion is that
we are detecting an alternative ligand for integrin
3
1 that is present in the BM of mutant skin. Our immunostaining experiments have identified several laminin
isoforms which may be candidate ligands for integrin
3
1
in the epidermal BM (Table I). In a recent study that compared the ligand binding activities of different laminin isoforms, laminin 10/11 was identified as a potent substrate for adhesion of lung carcinoma cells via integrin
3
1
(Kikkawa et al., 1998
). The
3
1-mediated adhesion to
laminin 10/11 was comparable to laminin 5 and found to
be greater than adhesion to laminin 1 or laminin 2/4
(Kikkawa et al., 1998
). Likewise, we have shown that adhesion of HFKs via integrin
3
1 is better on laminin 5 than on laminin 1, suggesting that laminin 1 does not significantly contribute to adhesion of keratinocytes in vivo (Carter et al., 1990
). Accordingly, laminin 10/11 or a new
laminin isoform may contribute to
3
1-mediated adhesion and will be investigated as a possible second ligand
for integrin
3
1 in epidermis.
Laminin 5 Regulates Late Stage Differentiation of Epithelium
We have established a role for laminin 5 in late stage differentiation of ameloblasts in developing incisors of mutant animals. The phenotypic alterations found in mutant
incisors are consistent with the dental abnormalities and
enamel hypoplasia described for JEB-G patients (Brain
and Wigglesworth, 1968
; Gardner and Hudson, 1975
).
Enamel hypoplasia has also been reported for an epidermolysis bullosa patient with a confirmed mutation in the ITGB4 gene (Pulkkinen et al., 1998b
), implicating a role
for integrin
6
4 in amelogenesis. In our studies, ameloblast abnormalities were first detected at the onset of
enamel secretion and continued throughout ameloblast
differentiation, culminating in the disorganization of the
reduced enamel epithelium. The phenotypic alterations
coincided nicely with the deposition of
3-laminin trimers
in the wild-type incisor where we identified positive staining for the laminin
3 chain along the edge of the differentiating ameloblasts. No staining was detected in a comparable region of the mutant incisor, confirming the absence
of laminin 5 in the mutant tooth. Positive staining for integrin
4 (data not shown) suggests that the ameloblast differentiation may be dependent on laminin 5 interactions
with integrin
6
4. The deposition of laminin
3 chain in
the wild-type tooth is consistent with recent studies that
have shown that the subunits of laminin 5 are expressed in
differentiating ameloblasts, even during enamel secretion
when laminin 1 expression has disappeared (Salmivirta et al.,
1997
; K. Yoshiba et al., 1998
; N. Yoshiba et al., 1998
). It is
interesting that abnormalities were detected in the mutant
tooth at the onset of enamel secretion because ultrastructural analysis of developing teeth have shown that the
basal lamina disappears during the secretory stage of
amelogenesis and then reforms during ameloblast maturation (Smith, 1998
). Our results suggest that laminin 5 has a
unique role in regulation of ameloblast differentiation and
that the requirement for laminin 5 may begin at the onset
of enamel secretion. Furthermore, the disorganization that
occurred in the reduced enamel epithelium emphasizes a
role for laminin 5 in the maintenance of stratified epithelium.
| |
Footnotes |
|---|
Address correspondence to Maureen Ryan or William Carter, Fred Hutchinson Cancer Research Center, A3-015, 1100 Fairview Avenue North, Seattle, WA 98109. Tel.: (206) 667-4478. Fax: (206) 667-3331. E-mail: wcarter{at}fhcrc.org or mryan{at}fred.fhcrc.org
Received for publication 4 January 1999 and in revised form 23 April 1999.
The authors would like to acknowledge financial support from the National Institutes of Health Grants CA49259 and AR-21557 to W.G. Carter
and the Dermatology Foundation (M.C. Ryan).
We wish to thank Drs. Phil Soriano and Kevin Foley for helpful advice on preparing the targeting construct, Dr. Leigh Anderson for assistance on the analysis of developing incisors, Katrina Buglai and Josephine Hidalgo for expert technical assistance, Linda O'Neal for preparation and staining of sections used for histology, Dr. Phil Fleckman and Barbara Hager for advice on growing MEKs, Liz Caldwell and Judy Groombridge for assistance with electron microscopy, and Image Analysis for help with figure preparation. We thank Dr. Paul Lampe for critical reading of the manuscript.
We are grateful to Drs. Jonathan Jones, Jeffrey Miner, Takashi Hashimoto, and Eva Engvall for providing antibodies.
| |
Abbreviations used in this paper |
|---|
BM, basement membrane; BMZ, basement membrane zone; BP180, bullous pemphigoid antigen 180; BP230, bullous pemphigoid antigen 230; ECM, extracellular matrix; ES, embryonic stem; HD, hemidesmosome; HFK, human foreskin keratinocyte; JEB-G, junctional epidermolysis bullosa gravis; KGM, keratinocyte growth medium; MEK, mouse epidermal keratinocyte.
| |
References |
|---|
|
|
|---|
| 1. | Aberdam, D., M.F. Galliano, J. Vailly, L. Pulkkinen, J. Bonifas, A.M. Christiano, K. Tryggvason, J. Uitto, E.H. Epstein Jr., J.P. Ortonne, et al . 1994. Herlitz's junctional epidermolysis bullosa is linked to mutations in the gene (LAMC2) for the gamma 2 subunit of nicein/kalinin (LAMININ-5). Nat. Genet. 6: 299-304 [Medline]. |
| 2. | Brain, E.B., and J.S. Wigglesworth. 1968. Developing teeth in epidermolysis bullosa hereditaria letalis. A histological study. Br. Dent. J. 124: 255-260 [Medline]. |
| 3. | Brown, T.A., S.G. Gil, V.P. Sybert, G.G. Lestringant, G. Tadini, R. Caputo, and W.G. Carter. 1996. Defective integrin alpha 6 beta 4 expression in the skin of patients with junctional epidermolysis bullosa and pyloric atresia [published erratum appears in J. Invest. Dermatol. 1997. 108:237]. J. Invest. Dermatol. 107: 384-391 [Medline]. |
| 4. |
Carter, W.G.,
P. Kaur,
S.G. Gil,
P.J. Gahr, and
E.A. Wayner.
1990.
Distinct
functions for integrins 3 1 in focal adhesions and 6 4/bullous pemphigoid
antigen in a new stable anchoring contact (SAC) of keratinocytes: relationship to hemidesmosomes.
J. Cell Biol.
111:
3141-3154
|
| 5. |
Carter, W.G.,
M.C. Ryan, and
P.J. Gahr.
1991.
Epiligrin, a new cell adhesion
ligand for integrin 3 1 in epithelial basement membranes.
Cell.
65:
599-610
[Medline].
|
| 6. |
Champliaud, M.F.,
G.P. Lunstrum,
P. Rousselle,
T. Nishiyama,
D.R. Keene, and
R.E. Burgeson.
1996.
Human amnion contains a novel laminin variant,
laminin 7, which like laminin 6, covalently associates with laminin 5 to promote stable epithelial-stromal attachment.
J. Cell Biol.
132:
1189-1198
|
| 7. | Christiano, A.M., and J. Uitto. 1996. Molecular complexity of the cutaneous basement membrane zone. Revelations from the paradigms of epidermolysis bullosa. Exp. Dermatol. 5: 1-11 [Medline]. |
| 8. |
DiPersio, C.M.,
K.M. Hodivala-Dilke,
R. Jaenisch,
J.A. Kreidberg, and
R.O. Hynes.
1997.
3 1 integrin is required for normal development of the epidermal basement membrane.
J. Cell Biol.
137:
729-742
|
| 9. | Doliana, R., I. Bellina, F. Bucciotti, M. Mongiat, R. Perris, and A. Colombatti. 1997. The human alpha3b is a `full-sized' laminin chain variant with a more widespread tissue expression than the truncated alpha3a. FEBS Lett. 417: 65-70 [Medline]. |
| 10. |
Dou, Q.P.,
B. An, and
P.L. Will.
1995.
Induction of a retinoblastoma phosphatase activity by anticancer drugs accompanies p53-independent G1 arrest
and apoptosis.
Proc. Natl. Acad. Sci. USA.
92:
9019-9023
|
| 11. |
Dowling, J.,
Q.C. Yu, and
E. Fuchs.
1996.
Beta4 integrin is required for
hemidesmosome formation, cell adhesion, and cell survival.
J. Cell Biol.
134:
559-572
|
| 12. | Eisenmann, D.R. 1989. Amelogenesis. In Oral Histology: Development, Structure, and Function. A.R. Ten Cate, editor. Mosby Publishing, St. Louis, MO. 197-212. |
| 13. | Engvall, E., D. Earwicker, T. Haaparanta, E. Ruoslahti, and J.R. Sanes. 1990. Distribution and isolation of four laminin variants; tissue restricted distribution of heterotrimers assembled from five different subunits. Cell Regul. 1: 731-740 [Medline]. |
| 14. | Fine, J.D., E.A. Bauer, R.A. Briggaman, D.M. Carter, R.A. Eady, N.B. Esterly, K.A. Holbrook, S. Hurwitz, L. Johnson, A. Lin, et al . 1991. Revised clinical and laboratory criteria for subtypes of inherited epidermolysis bullosa. A consensus report by the Subcommittee on Diagnosis and Classification of the National Epidermolysis Bullosa Registry. J. Am. Acad. Dermatol. 24: 119-135 [Medline]. |
| 15. |
Galliano, M.F.,
D. Aberdam,
A. Aguzzi,
J.P. Ortonne, and
G. Meneguzzi.
1995.
Cloning and complete primary structure of the mouse laminin alpha 3 chain.
Distinct expression pattern of the laminin alpha 3A and alpha 3B chain isoforms.
J. Biol. Chem.
270:
21820-21826
|
| 16. | Gardner, D.G., and C.D. Hudson. 1975. The disturbances in odontogenesis in epidermolysis bullosa hereditaria letalis. Oral Surg. Oral Med. Oral Pathol. 40: 483-493 [Medline]. |
| 17. | Georges-Labouesse, E., N. Messaddeq, G. Yehia, L. Cadalbert, A. Dierich, and M. Le Meur. 1996. Absence of integrin alpha 6 leads to epidermolysis bullosa and neonatal death in mice. Nat. Genet. 13: 370-373 [Medline]. |
| 18. | Gil, S.G., T.A. Brown, M.C. Ryan, and W.G. Carter. 1994. Junctional epidermolysis bullosis: defects in expression of epiligrin/nicein/kalinin and integrin beta 4 that inhibit hemidesmosome formation. J. Invest. Dermatol. 103: 31S-38S [Medline]. |
| 19. |
Goldfinger, L.E.,
M.S. Stack, and
J.C. Jones.
1998.
Processing of laminin-5 and
its functional consequences: role of plasmin and tissue-type plasminogen activator.
J. Cell Biol.
141:
255-265
|
| 20. |
Gonzales, M.,
K. Haan,
S.E. Baker,
M. Fitchmun,
I. Todorov,
S. Weitzman, and
J.C.R. Jones.
1999.
A cell signal pathway involving laminin-5, alpha 3 beta 1 integrin, and mitogen-activated protein kinase can regulate epithelial cell
proliferation.
Mol. Biol. Cell.
10:
259-270
|
| 21. | Hager, B., J.R. Bickenbach, and P. Fleckman. 1999. Long-term culture of murine epidermal keratinocytes. J. Invest. Dermatol. In press. |
| 22. | Hashimoto, T., M. Amagai, T. Ebihara, S. Gamou, N. Shimizu, T. Tsubata, A. Hasegawa, K. Miki, and T. Nishikawa. 1993. Further analysis of epitopes for human monoclonal anti-basement membrane zone antibodies produced by stable human hybridoma cell lines constructed with Epstein-Barr virus transformants. J. Invest. Dermatol. 100: 310-315 [Medline]. |
| 23. | Helbling-Leclerc, A., X. Zhang, H. Topaloglu, C. Cruaud, F. Tesson, J. Weissenbach, F.M. Tome, K. Schwartz, M. Fardeau, K. Tryggvason, et al . 1995. Mutations in the laminin alpha 2-chain gene (LAMA2) cause merosin-deficient congenital muscular dystrophy. Nat. Genet. 11: 216-218 [Medline]. |
| 24. |
Hodivala-Dilke, K.M.,
C.M. DiPersio,
J.A. Kreidberg, and
R.O. Hynes.
1998.
Novel roles for 3 1 integrin as a regulator of cytoskeletal assembly and as a
trans-dominant inhibitor of integrin receptor function in mouse keratinocytes.
J. Cell Biol.
142:
1357-1369
|
| 25. | Johnson, G.D., R.S. Davidson, K.C. McNamee, G. Russell, D. Goodwin, and E.J. Holborow. 1982. Fading of immunofluorescence during microscopy: a study of the phenomenon and its remedy. J. Immunol. Meth. 55: 231-242 [Medline]. |
| 26. | Jonkman, M.F., H. Scheffer, R. Stulp, H.H. Pas, M. Nijenhuis, K. Heeres, K. Owaribe, L. Pulkkinen, and J. Uitto. 1997. Revertant mosaicism in epidermolysis bullosa caused by mitotic gene conversion. Cell. 88: 543-551 [Medline]. |
| 27. |
Kaur, P.,
J.K. McDougall, and
R. Cone.
1989.
Immortalisation of primary human epithelial cells by cloned cervical carcinoma DNA containing human
papillomavirus 16 E6/7 ORFs.
J. Gen. Virol.
70:
1261-1266
|
| 28. |
Kikkawa, Y.,
M. Umeda, and
K. Miyazaki.
1994.
Marked stimulation of cell adhesion and motility by ladsin, a laminin-like scatter factor.
J. Biochem.
116:
862-869
|
| 29. |
Kikkawa, Y.,
N. Sanzen, and
K. Sekiguchi.
1998.
Isolation and characterization
of laminin-10/11 secreted by human lung carcinoma cells: laminin-10/11 mediates cell adhesion through integrin alpha-3-beta-1.
J. Biol. Chem.
273:
15854-15859
|
| 30. |
Kivirikko, S.,
J.A. McGrath,
C. Baudoin,
D. Aberdam,
S. Ciatti,
M.G. Dunnill,
J.R. McMillan,
R.A. Eady,
J.P. Ortonne,
G. Meneguzzi, et al
.
1995.
A homozygous nonsense mutation in the alpha 3 chain gene of laminin 5 (LAMA3) in lethal (Herlitz) junctional epidermolysis bullosa.
Hum. Mol.
Genet.
4:
959-962
|
| 31. |
Kivirikko, S.,
J.A. McGrath,
L. Pulkkinen,
J. Uitto, and
A.M. Christiano.
1996.
Mutational hotspots in the LAMB3 gene in the lethal (Herlitz) type of junctional epidermolysis bullosa.
Hum. Mol. Genet.
5:
231-237
|
| 32. | Kuster, J.E., M.H. Guarnieri, J.G. Ault, L. Flaherty, and P.J. Swiatek. 1997. IAP insertion in the murine LamB3 gene results in junctional epidermolysis bullosa. Mamm. Genome. 8: 673-681 [Medline]. |
| 33. |
Lampe, P.D.,
B.P. Nguyen,
S. Gil,
M. Usui,
J. Olerud,
Y. Takada, and
W.G. Carter.
1998.
Cellular interaction of integrin 3 1 with laminin 5 promotes
gap junctional communication.
J. Cell Biol.
143:
1735-1747
|
| 34. | Langhofer, M., S.B. Hopkinson, and J.C. Jones. 1993. The matrix secreted by 804G cells contains laminin-related components that participate in hemidesmosome assembly in vitro. J. Cell Sci. 105: 753-764 [Abstract]. |
| 35. | Mainiero, F., C. Murgia, K.K. Wary, A.M. Curatola, A. Pepe, M. Blumemberg, J.K. Westwick, C.J. Der, and F.G. Giancotti. 1997. The coupling of alpha6beta4 integrin to Ras-MAP kinase pathways mediated by Shc controls keratinocyte proliferation. EMBO (Eur. Mol. Biol. Organ.) J. 16: 2365-2375 [Medline]. |
| 36. |
Marinkovich, M.P.,
G.P. Lunstrum,
D.R. Keene, and
R.E. Burgeson.
1992.
The
dermal-epidermal junction of human skin contains a novel laminin variant.
J. Cell Biol.
119:
695-703
|
| 37. |
Miner, J.H.,
B.L. Patton,
S.I. Lentz,
D.J. Gilbert,
W.D. Snider,
N.A. Jenkins,
N.G. Copeland, and
J.R. Sanes.
1997.
The laminin chains: expression, developmental transitions, and chromosomal locations of 1-5, identification
of heterotrimeric laminins 8-11, and cloning of a novel 3 isoform.
J. Cell
Biol.
137:
685-701
|
| 38. | Murgia, C., P. Blaikie, N. Kim, M. Dans, H.T. Petrie, and F.G. Giancotti. 1998. Cell cycle and adhesion defects in mice carrying a targeted deletion of the integrin beta4 cytoplasmic domain. EMBO (Eur. Mol. Biol. Organ.) J. 17: 3940-3951 [Medline]. |
| 39. | Niessen, C.M., F. Hogervorst, L.H. Jaspars, A.A. de Melker, G.O. Delwel, E.H. Hulsman, I. Kuikman, and A. Sonnenberg. 1994. The alpha 6 beta 4 integrin is a receptor for both laminin and kalinin. Exp. Cell Res. 211: 360-367 [Medline]. |
| 40. | Noakes, P.G., M. Gautam, J. Mudd, J.R. Sanes, and J.P. Merlie. 1995a. Aberrant differentiation of neuromuscular junctions in mice lacking s-laminin/ laminin beta 2. Nature. 374: 258-262 [Medline]. |
| 41. | Noakes, P.G., J.H. Miner, M. Gautam, J.M. Cunningham, J.R. Sanes, and J.P. Merlie. 1995b. The renal glomerulus of mice lacking s-laminin/laminin beta 2: nephrosis despite molecular compensation by laminin beta 1. Nat. Genet. 10: 400-406 [Medline]. |
| 42. | Pulkkinen, L., A.M. Christiano, T. Airenne, H. Haakana, K. Tryggvason, and J. Uitto. 1994a. Mutations in the gamma 2 chain gene (LAMC2) of kalinin/ laminin 5 in the junctional forms of epidermolysis bullosa. Nat. Genet. 6: 293-297 [Medline]. |
| 43. | Pulkkinen, L., A.M. Christiano, D. Gerecke, D.W. Wagman, R.E. Burgeson, M.R. Pittelkow, and J. Uitto. 1994b. A homozygous nonsense mutation in the beta 3 chain gene of laminin 5 (LAMB3) in Herlitz junctional epidermolysis bullosa. Genomics. 24: 357-360 [Medline]. |
| 44. | Pulkkinen, L., P.B. Cserhalmi-Friedman, M. Tang, M.C. Ryan, J. Uitto, and A.M. Christiano. 1998a. Molecular analysis of the human laminin alpha3a chain gene (LAMA3a): a strategy for mutation identification and DNA-based prenatal diagnosis in Herlitz junctional epidermolysis bullosa. Lab. Invest. 78: 1067-1076 [Medline]. |
| 45. | Pulkkinen, L., D.U. Kim, and J. Uitto. 1998b. Epidermolysis bullosa with pyloric atresia: novel mutations in the beta4 integrin gene (ITGB4). Am. J. Pathol. 152: 157-166 [Abstract]. |
| 46. |
Rousselle, P.,
G.P. Lunstrum,
D.R. Keene, and
R.E. Burgeson.
1991.
Kalinin:
an epithelium-specific basement membrane adhesion molecule that is a
component of anchoring filaments.
J. Cell Biol.
114:
567-576
|
| 47. |
Ryan, M.C.,
R. Tizard,
D.R. VonDevanter, and
W.G. Carter.
1994.
Cloning of
the LamA3 gene encoding the 3 chain of the adhesive ligand epiligrin: expression in wound repair.
J. Biol. Chem.
269:
22779-22787
|
| 48. | Ryan, M.C., A.M. Christiano, E. Engvall, U.M. Wewer, J.H. Miner, J.R. Sanes, and R.E. Burgeson. 1996. The functions of laminins: lessons from in vivo studies. Matrix Biol. 15: 369-381 [Medline]. |
| 49. | Sakai, L.Y., and D.R. Keene. 1994. Fibrillin: monomers and microfibrils. Meth. Enzymol. 245: 29-52 [Medline]. |
| 50. | Salmivirta, K., L.M. Sorokin, and P. Ekblom. 1997. Differential expression of laminin alpha chains during murine tooth development. Dev. Dyn. 210: 206-215 [Medline]. |
| 51. |
Sander, E.E.,
S. van Delft,
J.P. ten Klooster,
T. Reid,
R.A. van der Kammen,
F. Michiels, and
J.G. Collard.
1998.
Matrix-dependent Tiam1/Rac signaling in
epithelial cells promotes either cell-cell adhesion or cell migration and is
regulated by phosphatidylinositol 3-kinase.
J. Cell Biol.
143:
1385-1398
|
| 52. |
Smith, C.E..
1998.
Cellular and chemical events during enamel maturation.
Crit.
Rev. Oral Biol. Med.
9:
128-161
|
| 53. | Soriano, P., C. Montgomery, R. Geske, and A. Bradley. 1991. Targeted disruption of the c-src proto-oncogene leads to osteopetrosis in mice. Cell. 64: 693-702 [Medline]. |
| 54. |
Stepp, M.A.,
S. Spurr-Michaud,
A. Tisdale,
J. Elwell, and
I.K. Gipson.
1990.
Alpha 6 beta 4 integrin heterodimer is a component of hemidesmosomes.
Proc.
Natl. Acad. Sci. USA.
87:
8970-8974
|
| 55. |
Tanaka, T.,
D.A. Parry,
V. Klaus-Kovtun,
P.M. Steinert, and
J.R. Stanley.
1991.
Comparison of molecularly cloned bullous pemphigoid antigen to desmoplakin I confirms that they define a new family of cell adhesion junction
plaque proteins.
J. Biol. Chem.
266:
12555-12559
|
| 56. | van der Neut, R., P. Krimpenfort, J. Calafat, C.M. Niessen, and A. Sonnenberg. 1996. Epithelial detachment due to absence of hemidesmosomes in integrin beta 4 null mice. Nat. Genet. 13: 366-369 [Medline]. |
| 57. | Verrando, P., B.L. Hsi, C.J. Yeh, A. Pisani, N. Serieys, and J.P. Ortonne. 1987. Monoclonal antibody GB3, a new probe for the study of human basement membranes and hemidesmosomes. Exp. Cell Res. 170: 116-128 [Medline]. |
| 58. | Vidal, F., D. Aberdam, C. Miquel, A.M. Christiano, L. Pulkkinen, J. Uitto, J.P. Ortonne, and G. Meneguzzi. 1995. Integrin beta4 mutations associated with junctional epidermolysis bullosa with pyloric atresia. Nat. Genet. 10: 229-234 [Medline]. |
| 59. | Wright, J.T., L.B. Johnson, and J.D. Fine. 1993. Development defects of enamel in humans with hereditary epidermolysis bullosa. Arch. Oral Biol. 38: 945-955 [Medline]. |
| 60. |
Xia, Y.,
S.G. Gil, and
W.G. Carter.
1996.
Anchorage mediated by integrin 6 4
to laminin 5 (epiligrin) regulates tyrosine phosphorylation of a membrane-associated 80-kD protein.
J. Cell Biol.
132:
727-740
|
| 61. |
Xu, H.,
P. Christmas,
X.R. Wu,
U.M. Wewer, and
E. Engvall.
1994.
Defective
muscle basement membrane and lack of M-laminin in the dystrophic dy/dy
mouse.
Proc. Natl. Acad. Sci. USA.
91:
5572-5576
|
| 62. | Yoshiba, K., N. Yoshiba, D. Aberdam, G. Meneguzzi, F. Perrin-Schmitt, C. Stoetzel, J.V. Ruch, and H. Lesot. 1998. Expression and localization of laminin-5 subunits during mouse tooth development. Dev. Dyn. 211: 164-176 [Medline]. |
| 63. | Yoshiba, N., K. Yoshiba, D. Aberdam, G. Meneguzzi, F. Perrin-Schmitt, C. Stoetzel, J.V. Ruch, and H. Lesot. 1998. Expression and localization of laminin-5 subunits in the mouse incisor. Cell and Tissue Research. 292: 143-149 [Medline]. |
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|