|
||
Original Article |
2ß1 Mediates Isoform-specific Activation of p38 and Upregulation of Collagen Gene Transcription by a Mechanism Involving the
2 Cytoplasmic Tail
Correspondence to: Jyrki Heino, MediCity Research Laboratory, University of Turku, Tykistökatu 6A, FIN-20520 Turku, Finland. Tel:358-2-333-7005 Fax:358-2-333-7000 E-mail:jyrki.heino{at}utu.fi.
| Abstract |
|---|
|
|
|---|
Two collagen receptors, integrins
1ß1 and
2ß1, can regulate distinct functions in cells. Ligation of
1ß1, unlike
2ß1, has been shown to result in recruitment of Shc and activation of the Ras/ERK pathway. To identify the downstream signaling molecules activated by
2ß1 integrin, we have overexpressed wild-type
2, or chimeric
2 subunit with
1 integrin cytoplasmic domain in human osteosarcoma cells (Saos-2) lacking endogenous
2ß1. The chimeric
2/
1 chain formed a functional heterodimer with ß1. In contrast to
2/
1 chimera, forced expression of
2 integrin resulted in upregulation of
1 (I) collagen gene transcription in response to three-dimensional collagen, indicating that the cytoplasmic domain of
2 integrin was required for signaling. Furthermore, signals mediated by
2ß1 integrin specifically activated the p38
isoform, and selective p38 inhibitors blocked upregulation of collagen gene transcription. Dominant negative mutants of Cdc42, MKK3, and MKK4 prevented
2ß1 integrinmediated activation of p38
. RhoA had also some inhibitory effect, whereas dominant negative Rac was not effective. Our findings show the isoform-specific activation of p38 by
2ß1 integrin ligation and identify Cdc42, MKK3, and MKK4 as possible downstream effectors. These observations reveal a novel signaling mechanism of
2ß1 integrin that is distinct from ones previously described for other integrins.
Key Words: collagen, integrin, cytoplasmic domain, p38 MAPK
| Introduction |
|---|
|
|
|---|
INTEGRIN type receptors bind extracellular matrix (ECM)1 molecules and mediate cell adhesion, migration, and invasion during development, tissue repair, tumor invasion, and metastasis. They also act in concert with growth factor or cytokine receptors to regulate cell proliferation, differentiation, and survival (![]()
![]()
and ß subunits do not have any intrinsic enzymatic activity, but integrin signaling is achieved by coupling signaling molecules, such as tyrosine kinases, to the cytoplasmic and transmembrane domains of the integrin subunits (![]()
cytoplasmic domains have highly divergent amino acid sequences (![]()
![]()
![]()
-actinin and talin (![]()
![]()
subunits (![]()
The functions of
cytoplasmic domains of various integrins are distinct. Cytoplasmic domains of
5 and
L are not required for cell adhesion unlike those of
2 and
4. In the context of cell adhesion and migration, some of the
cytoplasmic domains seem to be interchangeable (![]()
cytoplasmic domains (![]()
![]()
Four members of the integrin family are known to bind collagens, namely
1ß1,
2ß1,
3ß1, and
10ß1 (![]()
1ß1 and
2ß1 are considered to be the two major collagen binding integrins, whereas
3ß1 seems to function as an assisting receptor (![]()
10ß1 is expressed on chondrocytes, but little is known about its biology (![]()
1ß1 and
2ß1 are concomitantly expressed by many cell types but they may regulate different functions. Three-dimensional ECM culture systems provide means to study cellmatrix interactions in a more natural environment than the traditional monolayer culture (![]()
2ß1 triggers MMP-1 expression (![]()
![]()
![]()
![]()
and NF
B and that correlates with the upregulation of
2ß1 integrin and MMP-1 gene expression (![]()
2ß1. On the other hand,
1ß1 integrin mediates downregulation of collagen
1(I) mRNA levels both in vitro and in vivo (![]()
![]()
1ß1, have been shown to activate the mitogen-activated protein kinase (MAPK) extracellular signal-related kinase (ERK) via recruitment of Shc and activation of Ras (![]()
![]()
![]()
1ß1 integrin is the collagen receptor that regulates cell proliferation in collagenous matrices. In contrast,
2ß1 appears to be unable to recruit Shc and activate this specific signaling pathway.
We have previously observed that overexpression of
2ß1 integrin prevents
1ß1-mediated downregulation of collagen
1(I) mRNA levels when cells are brought into the contact with collagen (![]()
chain composed of the extracellular and transmembrane domains of
2 and the cytoplasmic domain of
1. Using this construct, we show here that the upregulation of collagen
1(I) mRNA levels is due to active signaling requiring the cytoplasmic domain of
2 subunit.
We have recently shown that in normal dermal fibroblasts three-dimensional collagen activates three distinct classes of MAPKs, i.e., ERK, c-jun NH2-terminal kinase (JNK), and p38 (![]()
1ß1 has been shown to activate the ERK kinase pathway, but
2ß1 has not been previously linked to a specific MAP kinase pathway. Here, we report that the
2 cytoplasmic domaindependent regulation of type I collagen mRNA levels requires p38 activity. We also show that the ligation of
2ß1 leads to the activation of p38 MAPK, especially its p38
isoform. The activation is dependent on the
2 chain cytoplasmic domain and the function of the downstream effectors Cdc42, MKK3, and MKK4 is required. These results indicate a crucial role for the p38 pathway in integrin
2ß1 signaling and provide novel insight on molecular mechanisms of integrin-specific signal transduction.
| Materials and Methods |
|---|
|
|
|---|
Reagents
Herbimycin A, bisindoylmaleimide, KT5720, KT5723, SB 203580, PD 98059, and SKF 86002 were obtained from Calbiochem-Novabiochem Corp. Cycloheximide was obtained from Sigma Chemical Co. (R)-(+)-perillyl alcohol (POH) was obtained from Aldrich and anisomycin was obtained from Boehringer Mannheim.
2 integrin cDNA corresponding to nucleotides 14559 in the published sequence (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
2 integrin, 12F1 (![]()
1 integrin cytoplasmic tail (AB1934) was purchased from Chemicon International, Inc., and antibody against
1 integrin used in flow cytometry, SR-84, was a gift from Dr. W. Rettig (Boehringer Ingelheim, Germany).
Cell Culture
Human osteosarcoma cell line Saos-2 was obtained from the American Type Culture Collection. The cell cultures were maintained in DME supplemented with heat inactivated 10% FCS (GIBCO-BRL), 2 mM glutamine, 100 IU/ml penicillin-G, and 100 µg/ml streptomycin.
Plasmid Constructs and Stable Transfections
The
2 integrin expression construct was prepared as described previously (![]()
2 subunit, in which the cytoplasmic tail has been replaced with the corresponding
1 integrin sequence, was prepared in the following way. A silent point mutation (nucleotide 3488 in the published sequence; ![]()
2 cDNA was digested with NheI and SacI cleaving the region corresponding to the
2 cytoplasmic tail. The
1 DNA was obtained by annealing sense and antisense synthetic nucleotides corresponding to nucleotides 35063543 in the published
1 sequence (![]()
2 sequences; antisense oligo (TTTTGCTGCTAGCTCTGGTTGCAATTTTATGGAAGCTCGGATTCTTCAAAAGACCA-CTGAAAAAGAAAATGGAGAAATGAGAGCTCAGTAGCTG), sense oligo (TCAGCTACTGAGCTCTCATTTCTCCATTTTCTTTTTCAGTGGTCTTTTGAAGAATCCGAGCTTCCATAAAATTGCAACCAGAGCTAGCAGCAAAA). This synthetic DNA fragment was digested with NheI and SacI restriction enzymes and ligated with the cleaved
2 cDNA. The correctness of the construct was checked by sequencing. Stable transfections were performed with the calcium polybren/DNA method on confluent 60-mm dishes. Incubation with 5 µg DNA and 5 µg polybren in 1 ml 10% FCS/DME per dish was carried out for 6 h, agitating the dishes once an hour. DMSO (30% in FCS) shock was done for 3 min, cells were washed twice with PBS, and culture medium was added. Neomycin analogue G418 (Life Technologies, Inc.) was added to the culture medium in a concentration of 400 mg/ml. G418-resistant cell clones were selected for 23 wk, isolated, and analyzed for their expression of
2 integrin. Control cells were transfected with the pAWneo2 plasmid only. Transfected cells were cultured in 10% FCS/DME containing 2 mM glutamine, 100 IU/ml penicillin-G, 100 µg/ml of streptomycin and 200 mg/ml G418.
Collagen Gels and Gel Contractions
Collagen gels were prepared from bovine dermal collagen, which contains 95% type I collagen and 5% type III collagen (Cellon). 8 vol of Cellon were mixed with 1 vol of 10x concentrated DME and 1 vol of 10x concentrated NaOH (0.05 M) in Hepes buffer (0.2 M) and kept on ice. Cells were trypsinized, resuspended in 1/10 gel volume culture media DME supplemented with 10% FCS, mixed into neutralized Cellon solution, and transferred into 6-well plates. The collagen was allowed to polymerize for 2 h at 37°C, after which the culture media containing 10% FCS was added, the gels were detached from the sides of the wells, and incubation was continued for the times indicated. Cells were also cultured on plastic as a monolayer in culture media containing 10% FCS. In experiments involving inhibitors, the cells were pretreated with the inhibitor for 30 min at room temperature before mixing the cells with the neutralized Cellon solution, also supplemented with the inhibitor at the concentrations indicated. After polymerization, culture media containing 10% FCS and the inhibitor was added and the gels were detached from the sides of the dishes. Incubation was continued for 48 h. When studying collagen gel contraction, cell culture wells were photographed after 48 h and the surface areas of the gels were measured from the prints.
Immunofluorescence
The cells grown on immunofluorescence glass slides (CML) covered or uncovered with collagen film (Cellon) were rinsed with PBS and fixed with methanol at -20°C for 5 min. The cells grown inside collagen gels were excised from culture wells, embedded in OCT compound (Tissue-Tek; Miles Scientific), and frozen in isopentane chilled with liquid nitrogen. Sections of 10-µM thickness were cut and picked up onto microscope slides and treated as described above. The slides containing the fixed samples were incubated in 2% BSA in PBS and monoclonal antiCD49b antibody (Chemicon International Inc.) was added to the same solution and incubated 30 min at room temperature. After rinsing, the cells were incubated with antimouseFITC conjugate (Dako A/S) for 30 min and mounted before observation and photography. For staining of the actin filaments, plastic coverslips (Nunc) were coated with PBS containing 16 µg/ml type I collagen overnight at 4°C and blocked with 1% BSA in PBS for 1 h at 37°C. Cells were allowed to adhere and spread on collagen coated coverslips for 24 h in DME. Coverslips were washed once with PBS and fixed with 2% paraformaldehyde, permeabilized with 0.5% Triton X-100 in PBS for 10 min, and incubated with rhodamine-conjugated phalloidin (Sigma Chemical Co.) 1:1,000 in PBS for 30 min. Cells were washed with PBS and mounted before observation and photography.
Northern Blot Hybridizations
Total cellular RNA was isolated using the Qiagen RNeasy kit. Total RNA was separated in formaldehyde-containing agarose gels, transferred to nylon membranes (Zeta-probe; Bio-Rad Laboratories), and hybridized with 32P-labeled (Amersham) cDNA probes. The following cDNAs were used: human
2 integrin (![]()
1(I) (![]()
2(I) (![]()
![]()
Flow Cytometry
Cells were grown to early confluence, detached with trypsin-EDTA, and trypsin activity was inhibited by medium supplemented with serum. Cells were washed with PBS, pH 7.4, and then incubated with PBS containing 10 mg/ml BSA, 1 mg/ml glycine, and 0.02% NaN3 for 20 min at 4°C. Cells were collected by centrifugation, exposed to saturating concentration of mAb against
2 integrin (12F1) or
1 integrin (SR-84) in BSA/PBS (BSA concentration 1 mg/ml) containing NaN3 for 30 min at +4°C, and stained with rabbit antimouse IgG coupled to fluorescein (1:20 dilution; Dako A/S) for 30 min at 4°C. Cells were washed twice with PBS containing NaN3 and suspended in the same buffer. To measure the amount of
2 integrin on the cell surfaces, the fluorescent excitation spectra were analyzed by using a FACScan apparatus (Becton Dickinson). Control samples were prepared by treating the cells without primary antibodies.
Immunoprecipitation of Integrin from Metabolically Labeled Cells
Cells were metabolically labeled with 100 µCi/ml of [35S]methionine (Tran[35S]-label, ICN Biomedicals Inc.) for 16 h in methionine-free minimum essential medium. Cell monolayers were rinsed on ice with a solution containing 150 mM NaCl, 1 mM CaCl2, 1 mM MgCl2, and 25 mM Tris-HCl, pH 7.4, and then detached by scraping. Cell pellets were obtained by centrifugation at 500 g for 5 min. Cells were solubilized in 200 µl of the same buffer containing 100 mM N-octyl-ß-D-glucopyranoside (Sigma Chemical Co.) on ice with occasional vortexing. Insoluble material was removed by centrifugation at 10,000 g for 5 min at 4°C. Radioactivity in cell lysates was counted and an equal amount of radioactivity was used in immunoprecipitation assays. Triton X-100 (0.5% vol/vol) and BSA (0.5 mg/ml) were added to the supernatants, which were precleared by incubation with 50 µl of packed protein ASepharose (Pharmacia LKB Biotechnology Inc.). Supernatants were immunoprecipitated with antiintegrin antibody (12F1 or AB1934) for 12 h at 4°C followed by incubation with secondary antibody (rabbit antimouse, DAKO), when 12F1 was used. Immune complexes were recovered by binding to protein ASepharose and washing the beads four times with 25 mM Tris-buffered isotonic saline, pH 7.4, containing 0.5% Triton X-100 and 1 mg/ml BSA and twice with 0.5 M NaCl and 25 mM Tris-HCl, pH 7.4. The immunoprecipitates were analyzed by electrophoresis on SDS-containing 6% polyacrylamide gels under nonreducing conditions followed by fluorography.
Transcriptional Nuclear Run-on Analyses
The cells were lysed with NP-40 (ICN) and the nuclei were isolated by centrifugation (12,000 g) for 3 s at 4°C. The nuclei were incubated in the presence of 100 µCi of [
-32P]UTP (3,000 Ci/mmol, NEN) for 30 min at room temperature as described previously (![]()
1(I) collagen, human
2(I) collagen, GAPDH, and pBluescript (Stratagene). The hybridization and washing conditions used were as described previously (![]()
Cell Spreading Assays
The coating of a 96-well immunoplate (Maxi Sorp; Nunc) was done by exposure to 0.2 ml of PBS, pH 7.4, containing 0.1 µg/cm2 (1.64 µg/ml) type I collagen (from lathyric rat skin, Boehringer Mannheim) for 12 h at 37°C. Residual protein absorption sites in all wells were blocked with 1% BSA in PBS for 1 h at 37°C. BSA was also used to measure the nonspecific binding. Cells were detached by using 0.01% trypsin and 0.02% EDTA. Trypsin activity was inhibited by washing the cells with 1 mg/ml of soybean trypsin inhibitor (Sigma Chemical Co.). In cell spreading assays, cells were suspended in DME with 50 mM cycloheximide (Sigma Chemical Co.), transferred into each well, and incubated for 35 min at 37°C. The wells were washed with PBS and fixed with 8% formaldehyde and 10% sucrose in PBS for 30 min. The total number of cells attached per one microscopic field and the percentage of spread cells were counted. A spread cell was characterized as one having a clearly visible ring of cytoplasm around the nucleus.
Assay of MAPK Activation
The activation of ERK1 and 2, JNK/SAPK, and p38 MAPK was determined by Western blotting using antibodies specific for the phosphorylated, activated forms of the corresponding MAPKs (New England Biolabs). The control blots for the total (phosphorylated and nonphosphorylated forms) protein levels were done by using antibodies recognizing the corresponding MAPKs (p38, ERK2, New England Biolabs; JNK1, Santa Cruz Biotechnology). Saos cell clones were either grown in monolayer for 24 h or seeded in collagen gels as described earlier. Once polymerized, the gels were detached from the dish and incubated for the time indicated. The cells were released from the gels as described above and lysed in 100 µl of Laemmli sample buffer. Cells grown in monolayer were washed once with warm PBS and lysed in 100 µl of Laemmli sample buffer. The positive control treatment for the JNK Western blot was done by treating cells in suspension with 10 µg/ml anisomycin (Boehringer Mannheim). The samples were sonicated, fractionated by 10% SDS-PAGE, and transferred to a Hybond ECL membrane (Amersham Corp.). Western blotting was performed as described previously (![]()
In Vitro p38 and JNK Kinase Assay and Western Blot Analysis of Flag-tagged Protein
Subconfluent Saos cell clones plated on 60-mm dishes were transfected using 4 µl of Fugene 6 transfection reagent (Boehringer Mannheim) and 2 µg of either eukaryotic expression vector alone (pcDNA3; Invitrogen Corp.) or the same vector containing the flag-tagged p38 isoform (![]()
. 36 h after transfections, the cells were treated with collagen gel for 3 h as described earlier or left untreated. Cells were solubilized with RIPA buffer (1% NP-40, 0.5% sodium deoxycholate, 0.1% SDS, 1 mM EDTA, 1 mM EGTA, 1 mM sodium orthovanadate, 20 mM sodium fluoride, 0.5 mM DTT, 1 mM PMSF in PBS, pH 7.4) supplemented with leupeptin, antipain, and pepstatin, 2 µg/ml each. The extracts were centrifuged 3,000 rpm for 15 min at 4°C. 1 µg of M2 antibody (Eastman Kodak Co.) conjugated to protein GSepharose (Pharmacia-LKB Biotechnology) was used for immunoprecipitation. The immunoprecipitates were washed twice with RIPA buffer, once with LiCl wash buffer (500 mM LiCl, 100 mM Tris, pH 7.6, 0.1% Triton X-100, 1 mM DTT) and once with kinase buffer (20 mM MOPS, pH 7.2, 2 mM EGTA, 10 mM MgCl2, 0.1% Triton X-100, 1 mM DTT). The kinase assay was initiated with 2 µg GST-ATF2 as substrate and 50 mM MgCl2, 25 µM ATP, 3 µCi
-[32P]ATP in a final volume of 50 µl. The reactions were terminated after 30 min at 37°C by the addition of Laemmli sample buffer. The phosphorylation of substrate protein was examined after SDS-PAGE by autoradiography. For Western blotting, samples of lysed cells were fractionated by 10% SDS-PAGE and transferred to Hybond ECL membrane (Amersham Corp.). Western blotting was performed as described previously (![]()
The JNK kinase assay was done as described in ![]()
Immunoprecipitation of FAK and Western Blot Analysis
The cells were brought into suspension, counted, and diluted so that equal number of cells from both clones were used. The cells were either lysed immediately or allowed to adhere to fibronectin (1 µg/cm2 coated on a 60-mm dish overnight at +4°C and blocked with 0.1% heat-inactivated BSA for 1 h at +37°C) or seeded inside collagen for 1 h. The assay was done as described previously (![]()
| Results |
|---|
|
|
|---|
Chimeric
2/
1ß1 Integrin Functions like the Wild-type
2ß1 Receptor in the Formation of Focal Contacts
Initially, we made stable transfectants expressing wild-type
2 or chimeric
2/
1 subunit using Saos-2 cells, which have endogenous
1ß1 but no
2ß1 (![]()
2 mAb (Figure 1 B) confirmed that both the wild-type and the chimeric receptor were expressed on the surface of the transfected cells. Based on the flow cytometric measurements, we selected cell clones with similar expression levels of wild-type
2 or chimeric
2/
1 integrin to be used in the experiments (Figure 1 B). Also, the cell clones used in the experiments and not shown in the Figure 1 B were tested. In addition, we measured the expression levels of
1ß1 from both mock-transfected and
2-transfected cells to ensure that the
2 cDNA transfections did not alter the expression of the endogenous
1ß1. The average levels of
1 integrin on four independent single cell clones tested were 60.8 ± 3.8 (arbitrary units) in mock-transfected cells and 68.3 ± 8.6 in
2-transfected cells. The corresponding values for
2 integrin were 13.5 ± 0.7 (represents negative background level fluorescence) and 362 ± 54. Immunoprecipitation experiments were performed to confirm that the chimeric
2/
1 subunit was associated with the endogenous ß1 subunit to form a typical heterodimeric
ß complex. The chimeric structure of the heterodimer was verified using an antibody recognizing the
1 cytoplasmic tail (not shown).
|
Deletion of the
2 cytoplasmic domain has been shown to result in ligand-independent recruitment of the integrin to preformed focal contacts (![]()
2 cytoplasmic domain to the significantly shorter
1 tail results in indiscriminate integrin recruitment into focal adhesion sites formed by other integrins, we studied both wild-type
2 and chimeric
2/
1 in Saos-2 cells spread on serum proteins. Both clones showed a diffuse staining pattern indicating that the receptors do not localize to focal contacts ligand independently (Figure 2 A, a and b). When these clones were allowed to adhere to and spread on collagen in serum-free conditions both wild-type and chimeric receptors were able to form focal contacts (Figure 2 A, c and d) indicating that the
2 chain cytoplasmic tail can be replaced with the corresponding
1 sequence without affecting cellular localization of the receptor. Also, the formation of actin stress fibers on collagen was similar in both clones (Figure 2 B). In cells cultured inside three-dimensional collagen, no aberrant clusters of integrins were seen and both receptors showed a diffuse staining pattern (Figure 2 A, e and f).
|
2 Cytoplasmic Tail Is Required for Fast Spreading on Collagen and Collagen Gel Contraction
Cell adhesion to type I collagen was studied to determine the effect of swapping the tails on the adhesive properties of the integrin. Adhesion mediated by the chimeric
2/
1ß1 receptor was found to be equivalent to that of the wild-type receptor (Figure 3 A). Both the wild-type
2-transfected cells and the
2/
1 chimeratransfected cells adhered to collagen at the early time point studied (1 h) more efficiently than the mock-transfected cells. When studying focal contact formation by
2 wild-type and chimeric
2/
1transfected clones, we noticed that even though cell adhesion to collagen was not influenced by the replacement of the
2 cytoplasmic tail with the
1 tail, the efficiency of the clones to spread on collagen was somewhat different. The cells expressing
2 wild-type receptor spread faster than cells expressing
2/
1 chimeric receptor, so that after 30 min on collagen 61.5 ± 6% of adherent
2-transfected cells had spread, whereas only 43 ± 8.3% of adherent
2/
1transfected cells had spread (Figure 3 B). At this early time point, mock-transfected cells expressing only
1ß1 had just begun to adhere and virtually no spreading was seen. At later time points (i.e., 2 h and later), also the mock-transfected cells spread efficiently on collagen. Since both
2 wild-type and
2/
1 chimeric receptor were expressed at similar levels on the cell surface (Figure 1 B), the small difference seen in cell spreading may indicate that the cytoplasmic tail of
2 functions in linking the integrin to the cytoskeleton in a manner promoting spreading on collagen. Therefore, we wanted to study the ability of
2 cytoplasmic tail to mediate cytoskeleton-dependent events and assayed the ability of
2- and
2/
1transfected cells to contract collagen gels. As expected, vector control cells, having endogenous
1ß1 but no
2ß1, showed very weak contraction during the 72-h experiment (area of the gel 1.8 ± 0.35-fold reduced), whereas wild-type
2ß1-expressing cells contract the gel efficiently (area of the gel 4.0 ± 1.0-fold reduced) (Figure 3 C). The cytoplasmic tail of
2 seemed to be essential for linkage of the integrin to the cytoskeletal machinery since the cells expressing chimeric
2/
1 failed to contract the collagen gel (Figure 3 C).
|
Integrin
2 Cytoplasmic Tail Is Required for the Upregulation of Collagen
1(I) and
2(I) Gene Expression at the Transcriptional Level
Overexpression of the wild-type
2 in Saos-2 cells resulted in upregulation of the mRNA levels of both collagen
1(I) (1.44.3-fold) and
2(I) (3.3-fold) in response to three-dimensional collagen matrix. To test the generality of this observation, all together three independent single cell clones overexpressing
2ß1 were tested (not shown). In contrast, vector control cells showed a downregulation ranging from 0.8 to 2.4-fold for collagen
1(I) mRNA (Figure 4a and Figure b). Interestingly, the chimeric receptor failed to mediate upregulation of the collagen mRNAs in response to three-dimensional collagen matrix as seen with the Northern blot hybridization of total RNA isolated from two single cell clones pooled together. The mRNA levels of collagen
1(I) in cells expressing the chimeric receptor were downregulated by 1.51.8-fold in response to collagen compared with the average 3.6-fold upregulation seen in cells expressing the
2 wild-type receptor (Figure 4a and Figure b). Also, expression of collagen
2(I) was downregulated in the
2/
1transfected cells. These results were again confirmed to be reproducible with RNA from a third independent single cell clone (not shown). Altogether, cells transfected with the chimera responded to collagen identically to the mock-transfected cells. Integrin
1ß1 is known to function as a negative regulator of collagen (![]()
![]()
![]()
1 cytoplasmic domain cannot be excluded. In the
2/
1transfected cells, no further reduction of collagen levels was seen when compared with the mock-transfected cells having endogenous
1ß1 integrin, suggesting that the short
1 cytoplasmic tail is not alone sufficient to regulate collagen gene expression. To test this further, we transfected Saos-2 cells with the X2C5PFNeo plasmid coding for
2 subunit with
5 cytoplasmic tail (![]()
2/
1transfected cells, collagen mRNA levels were decreased in response to collagen (not shown).
|
To assess the contribution of increased transcription of collagen
1(I) on this elevation seen in mRNA levels, we performed nuclear run-on experiments. Nuclei were isolated from
2- or
2/
1transfected cells grown either in monolayer or in three-dimensional collagen gel for 48 h. The rate of the collagen gene transcription was compared with that of GAPDH. A 1.8-fold increase of transcription was seen in
2-transfected clones cultured in three-dimensional collagen when compared with the rate of transcription in cells grown in monolayer (Figure 4 C). In contrast, cells transfected with the chimeric
2/
1 chain showed a 1.5-fold decrease in transcription rate (Figure 4 C). Even though the increased transcription rate of collagen
1(I) gene accounted for most of the upregulation seen in
2ß1-overexpressing clones, we also wanted to investigate the stability of the mRNAs. We used actinomycin D to block transcription in cell clones grown in monolayer and in collagen gels. Type I collagen mRNAs seem to have relatively long half-lives (>8 h) in Saos-2 cells transfected with wild-type
2, but no obvious difference was seen between the various culture conditions. Both in monolayer and in three-dimensional matrix collagen, mRNA levels were reduced by ~50% after 8 h treatment with actinomycin D (Figure 4 D).
2ß1 Integrin-mediated Upregulation of Collagen
1(I) Expression in Three-Dimensional Collagen Requires p38 MAP Kinase Pathway
To identify the downstream components of
2ß1-mediated upregulation of collagen gene expression, we tested specific inhibitors at concentrations sufficient to inhibit various signaling kinases (![]()
![]()
![]()
1(I) gene expression (5.5-fold) in
2ß1-overexpressing cells grown in three-dimensional collagen gel (Figure 5 A). The compounds that showed some inhibition (about twofold) included tyrosine kinase inhibitor herbimycin A, PKG inhibitor KT5823, PKA inhibitor KT5720, and Ras farnesylation inhibitor (R)-(+)-Perillyl alcohol (POH), whereas MEK inhibitor PD98059 had no effect. High concentrations of the PKC inhibitor bisindolylmaleimide resulted in downregulation of collagen mRNA levels (twofold at 5 µM and 4.1-fold at 20 µM concentrations), but this effect was seen in both
2- and mock-transfected cells and was therefore considered to be nonspecific. In addition, phosphatidyl-inositol-3-kinase (PI-3K) inhibitor, wortmannin treatment resulted in a slight reduction of collagen
1(I) mRNA in
2-transfected cells (not shown) and this effect was smaller in vector-transfected cells (Figure 5 A). The small effects of various inhibitors suggest that corresponding signaling proteins might participate in integrin signaling, but this hypothesis was not studied further. Another specific inhibitor targeting the p38 MAP kinase pathway, SKF86002, was tested to confirm the result obtained with SB203580. Treatment with this compound also resulted in concentration-dependent inhibition of
2ß1-mediated upregulation of collagen
1(I) mRNA levels (6.1-fold at 10 µM and 9.5-fold at 20 µM). 20 µM SB203580 was a potent inhibitor of collagen mRNA levels in
2-transfected cells inside collagen (Figure 5 B), but it had no effect on mRNA levels in mock-transfected cells inside collagen (Figure 5 A) or
2-transfected cells in monolayer (Figure 5 C), excluding the possibility that the compound could function as a general downregulator of collagen gene expression.
|
Three-dimensional Collagen Gel Induce Isoform Specific Activation of p38
in Saos-2 Cells and the Efficient Activation Requires
2 Cytoplasmic Tail
The ability of the selective p38 inhibitors, SB203580 and SKF86002, to inhibit
2 cytoplasmic taildependent upregulation of collagen mRNA levels lead us to study how p38 activity is regulated in response to collagenous matrix in these cells. We examined the activation of p38 by using a phosphospecific antibody that recognizes phosphorylated p38
and p38ß isoforms. The cells expressing wild-type
2 showed a marked activation (fivefold) already at 2 h after seeding the cells inside collagen. The activation gradually decreased during the next 12 h, but remained at levels threefold higher than the 0 h time point (Figure 6 A). To study whether this activation was due to signaling via the
2ß1, we analyzed the levels of phosphorylated p38 in cells expressing chimeric
2/
1 chain. In three separate experiments using different single cell clones, the wild-type
2-expressing cells showed in average 2.3-fold higher levels of active p38 2 h after seeding the cells inside collagen gel than cells expressing chimeric
2/
1 chain. Protein levels of p38 remained constant at all time points, as shown with the control antibody recognizing both activated and inactivated forms of p38ß (Figure 6 B). At a later (24 h) time point, the p38 activation persisted and
2-transfected cells showed a higher level of activation than the cells expressing chimeric
2/
1 chain (Figure 6 C). To confirm this difference in the levels of active p38 at the 24-h time point, the experiment was repeated five times using four or five parallel samples and two individual single cell clones of both transfections. In all experiments, p38 was activated in response to three-dimensional collagen and, in cells expressing the wild-type
2 chain, the levels were on average 1.9-fold higher (range, 1.33.5-fold). The difference in levels of active p38 between the
2 and
2/
1 cells were found to be statistically significant when the results of all five experiments were combined together (two-way analysis of variance; P < 0.0001). Finally, to confirm that this difference is the result of signals dependent on the
2 cytoplasmic tail in response to collagen, we tested the levels of active p38 in the same cell clones when grown in monolayer. The overall levels of active p38 were relatively low and no significant difference between the clones was detected (Figure 7 D).
|
|
To date, the p38 MAP kinase group is known to include five isoforms: p38
(![]()
![]()
![]()
(![]()
(![]()
![]()
2ß1 cytoplasmic tail could specifically activate some isoform of p38, we overexpressed various forms of flag-tagged p38 kinases (![]()
2 or chimeric
2/
1. The transfected cells were seeded inside a collagen gel, after 3 h the cells were collected, flag-tagged p38 was immunoprecipitated, and an in vitro kinase assay was performed. As seen in Figure 6 E, p38
isoform was activated efficiently in
2-transfected cells (activity 0.47 units; arbitrary units = densitometric units - background), whereas in
2/
1transfected cells the activity was 0.03. No activation of p38ß2 was detected (
2 clone 45 = 0.04 and
2
1 clone 12 = 0.02). p38
showed high activity in both cell clones (
2 clone 45 = 0.24 and
2/
1 clone 12 = 0.32) and p38
activity was high in both clones (
2 clone 45 = 0.64 and
2/
1 clone 12 = 0.23). The results were confirmed with two individual
2- or
2/
1expressing clones (Figure 6 F). The expression levels of the transiently transfected kinases in various clones were equal as shown by Western blot analysis done by using antibody against the flag-tag.
The Effect of p38 Inhibitors SB203580 and SKF86002 on the Various p38 Isoforms Expressed in
2-Transfected Saos-2 Cells
As seen in Figure 6E and Figure F, p38
was activated only in
2-transfected cells and no activation of p38ß2 was seen. However, equally high activity of p38
was seen in both
2- and
2/
1transfected cells and the p38
activity was higher in
2 cells than in
2/
1 cells. To study which of these activated kinases are relevant to the
2-mediated upregulation of collagen, shown to be inhibited by chemical inhibitors (SB203580 and SKF86002), we tested the effect of these inhibitors in an in vitro kinase assay.
2-transfected Saos-2 cells were transiently transfected with flag-tagged p38 isoforms (
, ß2,
, or
), the cells were treated with collagen and the kinase activity of each isoform was measured in the presence or absence of the inhibitory compound. In accordance with previously published experimental data and recent structural evidence (![]()
![]()
![]()
and
isoforms of p38 (Figure 7). Previously, SKF86002 has been shown to inhibit p38
(![]()
and
isoforms. From these results we can conclude that it is the p38
isoform that is essential in the
2ß1 integrindependent upregulation of collagen.
Collagen Gel Induces Transient Activation of ERK1 and 2 but not JNK/SAPK in Both the
2- and
2/
1Transfected Cells
We have recently shown that seeding dermal fibroblasts inside three-dimensional collagen gels results in activation of ERK1 and 2, JNK/SAPK, and p38 MAPKs (![]()
2- and
2/
1transfected Saos-2 cells by Western blot analysis of cellular proteins, using phosphospecific antibodies to detect activated forms of these MAP kinases. The levels of activated ERK2 were increased 2 h after seeding the cells inside collagen (3-fold in
2 and 1.5-fold in
2/
1 cells) and they increased further (up to 4-fold in
2 and 7-fold in
2/
1 cells) at 6 h time point. This activation in response to the collagen gel was transient in both clones since no phosphorylated ERK1 or 2 was detected at 12-h time point. Protein levels of ERK2 remained constant at all time points, as shown with the antibody recognizing all forms of ERK2 (Figure 8 A). Low levels of ERK1 were also detected at 2-, 4-, and 6-h time points. No induction in the levels of phosphorylated JNK/SAPK was seen in these cells in response to three-dimensional collagen. Some activated JNK/SAPK was seen at 0-h time point, immediately after trypsinization but no active protein was detected inside collagen gel. Treatment with anisomycin was used as a positive control for JNK activation. Protein levels of JNK1 remained constant at all time points, as shown with the antibody recognizing all forms of JNK1 (Figure 8 B). The results with the phosphospecific antibodies were confirmed with a JNK in vitro kinase assay. Endogenous kinase was immunoprecipitated with antiJNK1 antibody recognizing also JNK2 and 3 and recombinant c-Jun protein was used as a substrate (Figure 8 C).
|
Three-dimensional Collagenous Matrix Fails to Activate FAK
Ligation of integrins leads to activation of FAK. To check whether FAK would play a role in the activation of p38 in response to three-dimensional collagen, we allowed both
2- and
2/
1transfected cells to interact with collagen gels for 1, 2, or 3 h. (Figure 9 or not shown). The polymerization of the collagen gel takes place in 1 h, so shorter time points could not be studied. No phosphorylated FAK was detected in cells treated with collagen, in contrast to cells from both clones adhering to fibronectin (Figure 9). Some phosphorylation of FAK was seen in cells lyzed immediately after trypsinization. The experiment was repeated with similar results by using antibodies recognizing all phosphorylated forms of FAK (Figure 9). In the lower panel of Figure 9 phosphorylated FAK is the upper band. The lower band seen in all samples could not be recognized by antiFAK antibody and its identity is unknown.
|
Effect of Inhibitors of GTPases and MAPKKs on
2ß1-mediated Activation of p38
To investigate possible downstream effectors of
2ß1 integrin in the activation of p38
, we used dominant negative mutants of the Rho family GTPases and the p38 upstream kinases, MKK3 and MKK4. The effector mutants or an empty vector in control cells were cotransfected with the flag-tagged p38
into the
2-expressing cells and, 36 h after transfection, the cells were exposed to three-dimensional collagen and an in vitro p38 kinase assay was performed. Of the Rho family GTPases Cdc42 seemed essential for
2ß1-mediated signaling since dominant negative Cdc42 constantly resulted in an inhibition of p38
activity (Figure 10 B). Similar inhibition was not seen when the cells were transfected with wild-type Cdc42, used as a control. In three separate experiments, 4 µg/plate dominant negative Rac slightly decreased p38
activity (75 ± 12% of control) and mutant RhoA was only somewhat more effective (70 ± 27% of control). The experiment was also repeated with higher plasmid concentration (8 µg/plate) and p38
activity was unaltered in dominant negative Rac transfected cells (116% of control). Mutant RhoA showed some inhibition (66% of control). Again, dominant negative Cdc42 was the most efficient (17% of control). The dominant negative forms of the MAPK kinases known to function upstream of p38, namely MKK3 and MKK4, both had an inhibitory effect. Dominant negative MKK3 inhibited p38
activity by 9091% and dominant negative MKK4 by 7690% (Figure 10). These results indicate that the activity of Cdc42 and the MAPK kinases MKK3 and MKK4 are necessary for the
2ß1 integrin-mediated p38
activation.
|
| Discussion |
|---|
|
|
|---|
The integrins provide a physical linkage between the cytoskeleton and ECM and they transduce signals initiated by extracellular interactions. Since integrins have no intrinsic kinase activity they need to recruit other proteins, i.e., kinases to trigger signaling (for reviews see ![]()
![]()
![]()
or the ß cytoplasmic tail have been identified. Interactions mediated by the membrane spanning region of integrins have also been shown (![]()
![]()
![]()
![]()
Integrin
subunitspecific interactions with other cellular proteins are of special interest because they may explain the distinct signaling functions of integrin heterodimers sharing a common ß1 subunit (![]()
1ß1 and
2ß1 integrins, have distinct effects on cellular signaling and gene expression (![]()
![]()
![]()
cytoplasmic domains was studied by swapping the
1 tail into
2 and expressing the chimeric integrin in cells negative for
2 integrin.
The swapping of the
1 and
2 subunit cytoplasmic domains did not affect the localization to focal adhesions or the ability to mediate cell adhesion to collagen. This is in agreement with previously published data where the specific sequence of the
tail seemed less important than the number of residues present. Four to seven residues after the conserved GFFKR sequence were needed to be included for optimal adhesive activity (![]()
2/
1 instead of the
2 integrin. Previously,
2,
4, and
5 cytoplasmic tails have been shown to be interchangeable with respect to their positive contributions towards cell adhesion (![]()
cytoplasmic tails (![]()
2ß1 on the cell surface (![]()
![]()
![]()
1ß1 can have an essential role in the contraction process, especially in smooth muscle cells and liver myofibroblasts (![]()
![]()
1 cytoplasmic tail, unlike the ones of
4 and
5, could mediate the same interactions as the
2 tail. In contrast to these reports, our results do not support the idea that
1ß1 or chimeric
2/
1ß1 could mediate collagen gel contraction. This is also the case with
1- and
2/
1transfected CHO cells (Ivaska, J., and J. Heino, unpublished results). One explanation could be that
1ß1 needs an interaction with a certain cytoplasmic structure to be able to mediate contraction, and that this component is only present in a subset of cell types.
Synergy between integrin-mediated signaling and signals initiated by growth factors has been well established (![]()
![]()
![]()
![]()
![]()
![]()
1ß1,
5ß1,
6ß4, and
Vß3, has been shown to activate the Ras-ERK pathway via recruitment of the adaptor protein Shc (![]()
![]()
2ß1,
3ß1, and
6ß1) were unable to induce ERK activation in these studies (![]()
Given the difference between
1ß1 and
2ß1 integrins in activation of Ras-ERK pathway it is not surprising that ligation of these two receptors have different effects on cellular gene expression. Both
1ß1 and
2ß1 have been shown to regulate collagen mRNA levels in response to contact with three-dimensional collagen. Integrin
1ß1 can function as a negative regulator of collagen synthesis (![]()
![]()
![]()
![]()
2ß1 in osteosarcoma cells results in an upregulation of collagen mRNA levels (![]()
2ß1 seems to be a positive regulator of MMP-1 and MMP-13 (collagenase-3) expression as well. Further, supporting the differential signaling by these two receptors,
1ß1 is not involved in MMP-1 upregulation and it seems to be a less potent upregulator of MMP-13 than
2ß1 (![]()
1ß1 integrin may lead to reduced collagen synthesis since Ras-Raf activation has been shown to downregulate type I collagen gene expression (![]()
2ß1 is less well characterized than
1ß1 signaling. MMP-1 upregulation in fibroblasts cultured inside three-dimensional collagen is mediated by PKC-
and NF
B, but these pathways have not been directly connected to
2ß1 (![]()
activation in 4 h in CHO cells even though they lack collagen receptor integrins (Ivaska, J., and J. Heino, unpublished results) proposing that the PKC-
activation might at least partly be due to a change in cell shape rather than active signaling through collagen binding integrins.
Previously, it has been shown that cell contact with either two- or three-dimensional collagen induces activation of ERK1 and ERK2 (![]()
![]()
![]()
2ß1 regulates collagen gene transcription by activating p38
in response to collagen, and that this signaling requires the
2 cytoplasmic domain. First, expression of wild-type
2 chain in cells exposed to collagen leads to upregulation of collagen mRNA levels. Chimeric receptor in which the cytoplasmic domain of
2 is replaced with the corresponding sequence in
1, is not able to upregulate collagen synthesis in response to three-dimensional matrix. Second, regulation of collagen gene transcription was shown to require p38 MAPK activity based on the use of two p38 kinase inhibitors, SB203580 and SKF86002. Third, contact with three-dimensional collagen results in only a transient activation of ERK1 and 2, no evident activation of SAPK/JNK, but persistent activation of p38 kinase. Activation of p38 MAPK requires intact
2 subunit since levels of activated p38 were significantly lower in cells expressing chimeric
2/
1 receptor. Finally, using transient transfections of flag-tagged isoforms of p38 and dominant negative signaling proteins, we were able to show that
2 cytoplasmic domain specifically activates the
isoform and has no effect on the p38ß2 isoform. We also show that the activity of Cdc42 and the MAPK kinases MKK3 and MKK4 is necessary for the
2ß1 integrin-mediated p38
activation.
The data presented clearly show that the p38
isoform is essential in the
2ß1 integrindependent upregulation of collagen expression. The facts to support this areas follows. First, the p38
isoform is activated in response to collagen in the
2-transfected but not the
2/
1transfected cells. Second, the p38ß2 isoform is not activated in these cells. Third, even though p38
showed high activity in both clones and p38
was more efficiently activated in the
2-transfected cells, these isoforms cannot be responsible for the upregulation of collagen gene expression since the p38 inhibitors used have no effect on these kinases (Figure 7). Together, these findings demonstrate that the cytoplasmic sequence of
2 integrin subunit regulates the ability of
2ß1 integrin to activate p38 kinase in an isoform-specific manner and suggest a novel signaling mechanism for
2ß1.
An issue that arises from the data is the mechanism by which
2ß1 integrin activates the p38 pathway. Integrins are known to activate the Rho family of GTPases. Integrin ligation to the ECM leads to the activation of Cdc42 that subsequently activates Rac; Rho, on the other hand, has been shown to be activated independently of Cdc42 by integrin ligation (![]()
![]()
![]()
![]()
![]()
![]()
2ß1-mediated signaling and also show that the MAPK kinases MKK3 and MKK4 may be involved.
The signaling molecules downstream of Cdc42 and upstream of the MAPK kinases remain to be clarified in further studies. The various p38 isoforms seem to be differentially activated by upstream MAPKKs: MKK3, MKK4, and MKK6 (![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
![]()
B (![]()
![]()
2ß1-mediated upregulation of collagen
1(I) thereby leaving open the possibility that PI-3K may be one of the upstream effectors of the signaling pathway described here.
Other candidates for upstream effectors that could mediate
2ß1-related activation of p38 include p21 activated kinases (PAKs), the best characterized effectors of Cdc42 and ACKs (activated Cdc42-binding kinases) recently shown to be activated by cell adhesion via integrin ß1 (![]()
![]()
2-transfected Saos cells in response to collagen. In addition, TAK1 might be an interesting candidate, since it is activated by TGF-ß and has been shown to activate both MKK3 and MKK6 (![]()
![]()
![]()
2ß1 signaling would be the phosphorylation of the
2 cytoplasmic domain. Phosphorylation in response to integrin ligation could generate a binding site for an effector kinase inside the cell. However, our preliminary data have failed to convincingly show
2 phosphorylation in response to binding to collagen (Ivaska, J., and J. Heino, unpublished results).
It is evident that the two collagen receptors studied here function in close collaboration to regulate cell behavior in response to collagenous matrix. Impaired regulation of collagen turnover may lead to pathological conditions. For example, skin fibroblasts from scleroderma patients show upregulated collagen synthesis and concomitantly reduced expression of
1ß1 (![]()
1ß1 and
2ß1 is seen in
1 null mice, in which the absence of
1ß1 leads to enhanced collagen synthesis in skin. However, simultaneously collagenase-3 expression is increased, possibly via increased
2ß1 ligation, leading to a situation in which the collagen accumulation is seen only if the degradation of collagen is prevented (![]()
1ß1 integrin (![]()
![]()
2ß1 integrin to the regulation of p38
via Cdc42 and MAPKKs, MKK3 and MKK4, and show how
2ß1 functions in the regulation of the delicate balance of collagen accumulation in tissues.
| Acknowledgements |
|---|
|
|
|---|
We wish to thank Drs. E. Vuorio (University of Turku, Finland), R. Penttinen, M. Hemler, J.C. Lacal, A. Weiss, E. Marcantonio, R. Davis, P. Fort, and J. Han for cDNAs and vectors used in this study, and Drs. W. Rettig, W. Woods, and E. Coffey for the antibodies and c-Jun protein used in this study. The technical assistance by M. Potila, T. Heikkilä, and U. Paasio is gratefully acknowledged. We also wish to thank Dr. J. Eriksson and I. Elo for their valuable help with the p38 kinase assays and J. Hakalax for statistical evaluation of the results.
J. Ivaska has a fellowship from the Turku Graduate School in Biomedical Science. This study was financially supported by grants from the Pharmacal Research Foundation, the Academy of Finland, the Sigrid Jusélius Foundation, the Finnish Cancer Association, the Turku University Central Hospital, and the Technology Development Centre in Finland.
Submitted: 16 February 1999
Revised: 23 August 1999
Accepted: 2 September 1999
1.Abbreviations used in this paper: ECM, extracellular matrix; ERK, extracellular signalrelated kinase; FAK, focal adhesion kinase; JNK, c-jun NH2-terminal kinase; MAPK, mitogen-activated protein kinase; MAPKK, MAPK kinase; PI-3K, phosphatidylinositol-3-kinase; PK, protein kinase
| References |
|---|
|
|
|---|
B activation. Proc. Natl. Soc. Sci. USA. 96:429-434
to the protein kinases PKB and MAPK. Science. 282:293-296
1 subunit. J. Biol. Chem 268:2989-2996
2ß1-dependent contraction of floating collagen gels and induction of collagenase are inhibited by tyrosine kinase inhibitors. Exp. Cell Res 228:29-35[Medline].
10, a ß1-associated collagen binding integrin expressed on chondrocytes. J. Biol. Chem. 273:20383-20389
3Aß1 integrin localizes to focal contacts in response to diverse extracellular matrix proteins. J. Cell Sci. 108:2321-2336[Abstract].
1ß1 in the mouse causes loss of feedback regulation of collagen synthesis in normal and wounded dermis. J. Cell Sci. 112:263-272[Abstract].
1ß1 integrin is expressed during neointima formation in rat arteries and mediates collagen matrix reorganization. J. Clin. Invest. 97:2469-2477[Medline].
1(I) mRNA and change in pattern of collagen-binding integrins on scleroderma fibroblasts. J. Invest. Dermatol 101:216-221[Medline].
. J. Biol. Chem. 272:30122-30128
chain cytoplasmic domains play a positive role in control of cell adhesion mediated by VLA-4, a ß1 integrin. J. Exp. Med. 178:649-660
chain cytoplasmic tail sequence needed to support integrin-mediated adhesion. J. Biol. Chem. 269:19859-19867
subunit cytoplasmic domain in regulation of adhesive activity mediated by the integrin VLA-2. J. Biol. Chem. 268:16279-16285
2ß1 is upregulated in fibroblasts and highly aggressive melanoma cells in three-dimensional collagen lattices and mediates the reorganization of collagen I fibrils. J. Cell Biol. 115:1427-1436
1ß1 and
2ß1 integrins. J. Cell Biol. 131:1903-1915
in two-dimensional and three-dimensional cultures of human fibroblasts. Exp. Cell Res. 235:22-27[Medline].
5ß3-dependent ligand binding. J. Cell Biol. 123:485-496
6ß4 integrin to Ras-MAP kinase pathways mediated by Shc controls keratinocyte proliferation. EMBO (Eur. Mol. Biol. Organ.) J. 16:2365-2375[Medline].
1(I) collagen: cDNA sequence for the C-propeptide domain. Nucleic Acids Res. 16:349
-actinin and the ß1 integrin subunit in vitro. J. Cell Biol. 111:721-729
1ß1 mediates a unique collagen-dependent proliferation pathway in vivo. J. Cell Biol. 142:587-594
1ß1 integrin in wound contraction. A quantitative analysis of liver myofibroblasts in vivo and in primary culture. J. Biol. Chem. 272:30911-30917
2ß1 is a positive regulator of collagenase (MMP-1) and collagen
1(I) gene expression. J. Biol. Chem. 270:13548-13552
2ß1 integrin expression in osteogenic cells. J. Biol. Chem. 270:376-382
subunit ratios, cytoplasmic domains, and growth factor synergy regulate muscle proliferation and differentiation. J. Cell Biol. 133:169-184
2ß1 (VLA-2) mediates reorganization and contraction of collagen matrices by human cells. Cell. 67:403-410[Medline].
2 subunit (platelet GPIa): homology to other integrins and the presence of a possible collagen-binding domain. J. Cell Biol. 109:397-407
2ß1 in tumorigenic human osteosarcoma cell lines regulates cell adhesion, migration, and invasion by interaction with type I collagen. Cell Growth Differ. 7:439-447[Abstract].
activity: role in
2 integrin and collagenase mRNA expression. J. Cell Biol. 136:473-483
5ß1 integrin supports survival of cells on fibronectin and up-regulates Bcl-2 expression. Proc. Natl. Soc. Sci. USA. 92:6161-6165
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|