|
||
© The Rockefeller University Press,
0021-9525/1999//471 $5.00
The Journal of Cell Biology, Volume 147, Number 3,
, 1999 471-480
Original Article |
Hcp-1, a Protein Involved in Chromosome Segregation, Is Localized to the Centromere of Mitotic Chromosomes in Caenorhabditis elegans
mroth{at}fred.fhcrc.org
To learn more about holocentric chromosome structure and function, we generated a monoclonal antibody (mAb), 6C4, that recognizes the poleward face of mitotic chromosomes in Caenorhabditis elegans. Early in mitosis, mAb 6C4 stains dots throughout the nucleoplasm. Later in prophase, mAb 6C4 stains structures on opposing faces of chromosomes which orient towards the centrosomes at metaphase. Colocalization with an antibody against a centromeric histone H3–like protein and the MPM-2 antibody, which identifies a kinetochore-associated phosphoepitope present in a variety of organisms, shows that the mAb 6C4 staining is present adjacent to the centromere.
Expression screening using mAb 6C4 identified a protein in C. elegans that we named HCP-1 (for holocentric protein 1). We also identified a second protein from the C. elegans genome sequence database, HCP-2, that is 54% similar to HCP-1. When expression of HCP-1 is reduced by RNA interference (RNAi), staining with mAb 6C4 is eliminated, indicating that hcp-1 encodes the major mAb 6C4 antigen. RNAi with hcp-1 and hcp-2 together results in aberrant anaphases and embryonic arrest at
100 cells with different amounts of DNA in individual nuclei. These results suggest that HCP-1 is a centromere-associated protein that is involved in the fidelity of chromosome segregation.
Key Words: Caenorhabditis elegans chromosome mitosis centromere kinetochore
© 1999 The Rockefeller University Press
DURING anaphase of mitosis, sister chromatids are moved to opposite sides of the dividing daughter cells. In insects of the hemipteran order, various plants, and nematodes, the separating sister chromatids orient parallel to the poles and move as a whole. This type of movement was defined as holokinetic and reflects that these chromosomes attach to the mitotic spindle all along their length (Schrader 1935). Subsequent EM of these chromosomes revealed that this holokinetic movement was due to a diffuse or nonlocalized kinetochore structure that extends over the entire poleward surface of each chromosome (Buck 1967; Comings and Okada 1972; Albertson and Thomson 1982; Goday et al. 1985, Goday et al. 1992). The kinetochore is an ultrastructure located on the chromosome that is responsible for attachment of the chromosome to the mitotic spindles and regulating the progression of mitosis (for reviews see Pluta et al. 1995; Allshire 1997). Further indications that a diffuse kinetochore is present on holokinetic chromosomes was obtained when chromosome fragments generated in these organisms by irradiation were shown to be capable of proper segregation during mitosis, indicating that each chromosomal fragment had a functioning kinetochore associated with it (Hughs-Schrader and Ris 1941; Ris 1942; Hughs-Schrader and Schrader 1961). These chromosomes are generally referred to as holocentric to denote that the kinetochore structure extends over most of the chromosome (Reider 1982). By contrast, monocentric chromosomes like those of mammals have a discrete or localized kinetochore structure, and chromosome fragments generated from monocentric chromosomes lack the ability to segregate properly when separated from the centromere (Mather and Stone 1933).
Consistent with their function, the kinetochores of both holocentric and monocentric chromosomes resemble one another, at least at the ultrastructural level. Monocentric chromosomes are described with the site of spindle attachment localized to a distinct region of the chromosome, the primary constriction which is observed as a narrowing of the chromosome. EM studies of the primary constriction revealed that the kinetochore is composed of a trilaminar disk structure adjacent to each sister chromatid during metaphase (Jokelaninen 1967; Comings and Okada 1971; Roos 1973; Ris and Witt 1981; Reider 1982). However, holocentric chromosomes lack a primary constriction, and EM revealed that they also have a trilaminar kinetochore which extends nearly the entire length of the chromosome (Buck 1967; Comings and Okada 1972; Albertson and Thomson 1982; Goday et al. 1985, Goday et al. 1992). The similarity in kinetochore ultrastructure between monocentric and holocentric chromosomes suggests that the kinetochore is a conserved organelle and that differences attributed to each chromosome organization are due to the amount of the chromosome encompassed by the kinetochore (Albertson and Thomson 1982).
The molecular composition of the centromere is beginning to be elucidated. Antibodies have been useful in probing the structure of, and identifying gene products localized to the centromere. Antisera from patients with certain autoimmune diseases recognize the primary constriction of monocentric chromosomes, and by immunoelectron microscopy, identify the kinetochore (Moroi et al. 1980; Brenner et al. 1981). Further support that these antibodies recognize components of the centromere comes from the injection of purified antibodies from anticentromere serum into HeLa cells (Bernat et al. 1990, Bernat et al. 1991). In these experiments, kinetochore structure is disrupted and chromosome segregation is blocked. Several centromeric proteins (CENPs)1 have been identified using these autoantibodies and have been subsequently shown to be important for kinetochore structure and function (for reviews see Earnshaw and Mackay 1994; Pluta et al. 1995).
We have used a similar immunocytological approach to study the structure and function of holocentric chromosomes in the nematode Caenorhabditis elegans (Herman et al. 1976, Herman et al. 1979; Albertson and Thomson 1982). We generated a mAb, 6C4, which recognizes the centromere region of mitotic chromosomes in C. elegans. Using mAb 6C4, we have identified a protein, holocentric protein (HCP)-1, that together with a related protein, HCP-2, is important for proper chromosome segregation.
| Materials and Methods |
|---|
|
|
|---|
High Resolution Microscopy
Samples were examined by three-dimensional multiple wavelength fluorescence microscopy using Deltavision (Applied Precision). Images were collected at the indicated wavelengths for 30 0.2-µm optical sections per nucleus and were subsequently deconvolved mathematically (Hiraoka et al. 1991; Carrington et al. 1995). The limit of detection (resolution between two points) was 90 nm. Data were examined as either optical sections or as a projection of the entire stack.
Expression Library Screening
The mixed stage C. elegans cDNA library in
gt11 was a gift from Dr. Pete Okema (University of Illinois at Chicago, Chicago, IL). Immunoscreening of the cDNA library was carried out by the method of Young and Davis 1983, using mAb 6C4 ascites fluid at 1:200 dilution. Detection of immunopositive plaques was by Vectastain ABC (Vector Labs Inc.).
RNA-mediated Inhibition
Oligos forward T7 (TAATACGACTCACTATAGGGggtggcgacgactcctgg), forward (ggtggcgacgactcctgg), reverse T7 (TAATACGACTCACTATAGGGttgacaccagaccaactgg), and reverse (ttgacaccagaccaactgg) were used to generate PCR products corresponding to the cDNA inserts obtained from the expression screening. This region included the COOH-terminal 324 amino acids of HCP-1 and 3'UTR. Each T7 oligo contains a T7 polymerase promoter (shown in capital letters) and sequence complementary to the flanking polylinker region of
gt11. Oligos HCP2-1 T7 (TAATACGACTCACTATAGGGgacctgaatgcgaagcttg), HCP2-1 (gacctgaatgcgaagcttg), HCP2-2 T7 (TAATACGACTCACTATAGGGgctggttgcagtttgagcgg), and HCP2-2 (gctggttgcagtttgagcgg) were used to PCR amplify a region of the HCP-2 mRNA corresponding to the COOH-terminal 384 amino acids of HCP-2, from total RNA, after first strand cDNA synthesis as described (Sambrook et al. 1989). 1 µg of PCR product was used to synthesize double-stranded RNA (dsRNA) using T7 polymerase as described (Grodberg and Dunn 1988). dsRNA was resuspended in water at a concentration of 5 mg/ml. dsRNA derived from the COOH-terminal region of HCP-1 or from the corresponding region of HCP-2 was injected into the syncytial gonad of wild-type hermaphrodites as described (Guo and Kemphues 1995; Fire et al. 1998).
| Results |
|---|
|
|
|---|
|
|
The mAb 6C4 Antigen Is HCP-1
To identify the antigen recognized by mAb 6C4, we screened a
gt11 C. elegans cDNA expression library with mAb 6C4. Three overlapping cDNAs were isolated that correspond to a predicted gene, ZK1055.1. We refer to this gene as hcp-1. The hcp-1 gene can encode a 1,475–amino acid protein predicted to be composed primarily of coiled-coil domains (Fig. 3 A). HCP-1 has a direct repeat of 132 amino acids that is 45% similar to a direct repeat of 179 amino acids present in CENP-F (Fig. 3 B) (Liao et al. 1995; Zhu et al. 1995). A search of C. elegans sequence databases with the HCP-1 amino acid sequence revealed a second C. elegans coiled-coil protein, T06E4.2, that is 54% similar to HCP-1. We refer to T06E4.1 as HCP-2. The highest levels of similarity between HCP-1 and HCP-2 is seen at the two termini. HCP-2 lacks the tandem repeats observed in HCP-1 and CENP-F. A low level (<20%) of similarity is observed between HCP-1 and HCP-2 with several other coiled-coil proteins in the databases, probably due to conservation of the coiled-coil structure.
|
|
|
|
To determine whether the synthetic lethality correlates with a defect in chromosome segregation, we stained hcp-1 (RNAi)/hcp-2 (RNAi) embryos with an antitubulin antibody and DAPI. In these experiments, we observed that 80% (n = 60) of all anaphases showed signs of defective chromosome segregation, including lagging chromosomes and anaphase bridges (Fig. 6B and Fig. C). This defect was observed as early as the first mitotic cleavage (Fig. 6 B). In these anaphase nuclei, the spindle as observed by antitubulin staining appeared wild-type, in that a normal bipolar orientation is present (Fig. 6 A). As observed by DAPI, chromosome condensation appeared to also not be grossly altered, as chromosomal structures are visible (Fig. 6 C). In many instances, some chromosomes were not located between the centrosomes; for example, Fig. 6 C shows an early embryo in which the four ABxx blastomeres are in prophase. Several chromosomes are located outside of the spindles and along the previous spindle axis, indicating that they failed to segregate at the previous division (see Fig. 6 D for orientation). The hcp-1 (RNAi)/hcp-2 (RNAi) embryos arrested with
50–100 cells. At this stage, the DNA content of individual nuclei was variable, suggesting that some nuclei have more and others have less than the diploid set of chromosomes (Fig. 7). In contrast, DNA content in wild-type embryos was uniform among nuclei. These results further support the idea that HCP-1 and HCP-2 function together in chromosome segregation.
|
|
| Discussion |
|---|
|
|
|---|
To test whether mAb 6C4 stains at or near the kinetochore, we performed a colocalization experiment using an antibody (MPM-2) previously shown to stain the kinetochore in many different organisms, and an antibody directed against a centromeric histone H3–variant, HCP-3, (Vandre et al. 1984; Renzi et al. 1997; Buchwitz et al. 1999). MPM-2 recognizes a highly conserved phosphoepitope present on kinetochore-associated proteins during mitosis (Taagepera et al. 1997). MPM-2 antibody did cross-react in C. elegans, further indicating the conserved nature of its epitope. MPM-2 staining was observed to be strongest in the region adjacent to the mitotic chromosomes in a pattern overlapping with that observed for mAb 6C4. This overlap was specific for the region adjacent to the mitotic chromosomes, although both antibodies showed staining not associated with the chromosomes. Elimination of the mAb 6C4 antigen by RNAi did not affect the staining with MPM-2, indicating that the colocalization is not due to the presence of the MPM-2 epitope on HCP-1 (data not shown). Thus, the colocalization of MPM-2 and mAb 6C4 is likely the result of their epitopes being present at the same cytological structure, the kinetochore.
Furthermore, mAb 6C4 staining is present adjacent, but not coincident with the staining of chromatin by anti–HCP-3 antibody. Both staining with anti–HCP-3 and mAb 6C4 is analogous to that observed on monocentric chromosomes by anticentromeric antibodies that recognize different regions of the trilaminar kinetochore (Pluta et al. 1995). Taken together, these two colocalization experiments indicate that the staining pattern observed with mAb 6C4 along mitotic chromosomes in C. elegans represents the kinetochore of the holocentric chromosomes.
HCP-1 and HCP-2 Are Involved in Kinetochore Function
We have used mAb 6C4 to identify two proteins, HCP-1 and HCP-2, which together are involved in kinetochore function. When we reduced the expression of both HCP-1 and HCP-2 by RNA-mediated inhibition, we observed that embryos arrested with
50–100 nuclei containing variable amounts of DNA. By observing embryos at earlier stages, we observed that chromosomes were often found to be unattached to the mitotic spindle. Not all chromosomes failed to attach to the spindle. This may reflect low levels of expression of HCP-1 or HCP-2. The inability of chromosomes to attach to the mitotic spindle does not appear to be the result of a defect in chromosome condensation. When viewed by DAPI staining, chromosomes are observed and appear normal when compared with wild-type. This is consistent with the localization of HCP-1 to the chromosomes occurring after chromosome condensation has begun, suggesting HCP-1 is not generally required for chromosome condensation.
The hcp-1 (RNAi)/hcp-2 (RNAi) defects are similar to those observed when human centromere components are inhibited, which include lagging chromosomes in anaphase and inefficient spindle attachment to chromosomes (Bernat et al. 1990). These defects are also similar to defects observed when expression of the C. elegans homologue of the Zeste White 10 protein (CeZW10) is reduced by RNAi (Starr et al. 1997). Homologues of ZW10 have been localized to the kinetochore in both Drosophila and humans (Williams et al. 1992, Williams et al. 1996; Starr et al. 1997). Mutations in Drosophila zw10 result in aberrant chromosome segregation, which is observed during anaphase as lagging chromatids or chromosomes remaining in the vicinity of the metaphase plate during anaphase. Reduction of CeZW10 expression in C. elegans embryos results in a similar phenotype in which chromosomes are often observed to be improperly attached to both spindles and results in anaphase bridges during anaphase. Anaphase bridges and even lagging chromatids or chromosomes are observed with hcp-1 (RNAi)/hcp-2 (RNAi) embryos, suggesting that like ZW10, HCP-1 and HCP-2 are required for proper kinetochore function during mitosis.
mAb 6C4 Defines Intermediates in Mitotic Chromosome Structure
The dynamic mAb 6C4 staining pattern on mitotic chromosomes suggests that there are intermediate stages of holocentric kinetochore assembly. As cells progress from early to late prophase, the mAb 6C4 staining pattern changes from discontinuous points dispersed along chromosomes to structures on opposite sides of each chromosome. The temporal relationship of these images indicates that the dispersed dots may be used to assemble the larger structures seen at late prophase. The visualization of a disperse mAb 6C4 staining pattern is consistent with a model in which there are discrete regions of C. elegans chromosomes that act as the primary points of spindle microtubule capture. This model is similar to the repeat subunit model proposed for the mammalian centromere, which proposes that the centromere is composed of short segments distributed along the DNA that bind spindle microtubules (Zinkowski et al. 1991). These segments are brought into parallel register as a result of chromatin condensation to form the observed kinetochore structure. The C. elegans chromosomes may also contain such repeats discontinuously distributed along the entire chromosome. Our results support the model suggested by Albertson and Thomson 1982 that the holocentric chromosome may be thought of as an extended centromere.
| Acknowledgments |
|---|
L.L. Moore was supported by a National Institutes of Health (NIH) training grant (T32CA09657). M. Morrison was supported by training grant (2T32HD07183-16) from the NIH. This work was supported by an NIH grant (GM48435-01A2) to M.B. Roth.
Submitted: 3 August 1999
Revised: 27 September 1999
Accepted: 29 September 1999
1.used in this paper: CENP, centromeric protein; DAPI, 4',6-diamidino-3-phenylindole dihydrochloride; dsRNA, double-stranded RNA; HCP, holocentric protein; RNAi, RNA interference
| References |
|---|
|
|
|---|
Albertson D.G.. Formation of the first cleavage spindle in nematode embryos, Dev. Biol., 101, 1984, 61–72.[Medline]
Albertson D.G. & Thomson J.N.. The kinetochores of Caenorhabditis elegans, Chromosoma., 86, 1982, 409–428.[Medline]
Albertson D.G. & Thomson J.N.. Segregation of holocentric chromosomes at meiosis in the nematode, Caenorhabditis elegans, Chromosome Res., 1, 1993, 15–26.[Medline]
Allshire R.C.. Centromeres, checkpoints and chromatid cohesion, Curr. Opin. Genet. Dev., 7, 1997, 264–273.[Medline]
Bernat R.L., Borisy G.G., Rothfield N.F. & Earnshaw W.C.. Injection of anticentromeric antibodies in interphase disrupts events required for chromosome movement at mitosis, J. Cell Biol., 111, 1990, 1519–1533.
Bernat R.L., Delannoy M.R., Rothfield N.F. & Earnshaw W.C.. Disruption of centromere assembly during interphase inhibits kinetochore morphogenesis and function in mitosis, Cell., 66, 1991, 1229–1238.[Medline]
Brenner S.. The genetics of Caenorhabditis elegans, Genetics., 77, 1974, 71–94.
Brenner S., Pepper D., Berns M.W., Tan E. & Brinkley B.R.. Kinetochore structure, duplication, and distribution in mammalian cellsanalysis by human autoantibodies from scleroderma patients, J. Cell Biol., 91, 1981, 95–102.
Buchwitz B.J., Ahmad K., Moore L.L., Roth M.B. & Henikoff S.. A histone H3-like protein in C. elegans, Nature., 401, 1999, 547, .[Medline]
Buck R.C.. Mitosis and meiosis in Rhodnius prolixusthe fine structure of the spindle and diffuse kinetochore, J. Ultrastruct. Res., 18, 1967, 489–501.[Medline]
Carrington W.A., Lynch R.M., Moore E.D.W., Isenberg G., Fogarty K.E. & Fay F.S.. Superresolution three-dimensional images of fluorescence in cells with minimal light exposure, Science., 268, 1995, 1483–1487.
Comings D.E. & Okada T.A.. Fine structure of the kinetochore in the Indian muntjac, Exp. Cell Res., 67, 1971, 97–110.[Medline]
Comings D.E. & Okada T.A.. Holocentric chromosomes in Oncopeltuskinetochore plates are present in mitosis but absent in meiosis, Chromosoma., 37, 1972, 177–192.[Medline]
Davis F.M., Tsao T.Y., Fowler S.K. & Rao P.N.. Monoclonal antibodies to mitotic cells, Proc. Natl. Acad. Sci. USA., 80, 1983, 2926–2930.
Deppe U., Schierenberg E., Cole T., Krieg C., Schmitt D., Yoder B. & von Ehrenstein G.. Cell lineages of the embryo of the nematode Caenorhabditis elegans, Proc. Natl. Acad. Sci. USA., 75, 1978, 376–380.
Earnshaw W.C. & Mackay A.M.. Role of nonhistone proteins in the chromosomal events of mitosis, FASEB J., 8, 1994, 947–956.[Abstract]
Fire A., Xu S., Montgomery M.K., Kostas S.A., Driver S.E. & Mello C.C.. Potent and specific genetic interference by double-stranded RNA in Caenorhabditis elegans, Nature (Lond.)., 391, 1998, 806–811.[Medline]
Goday C., Ciofi-Luzzatto A. & Pimpinelli S.. Centromere ultrastructure in germ-line chromosomes of Parascaris, Chromosoma., 91, 1985, 121–125.[Medline]
Goday C., González-García J.M., Estban M.R., Giovinazzo G. & Pimpinelli S.. Kinetochores and chromatin diminution in early embryos of Parascarus univalins, J. Cell Biol., 118, 1992, 23–32.
Grodberg J. & Dunn J.J.. ompT encodes the Escherichia coli outer membrane protease that cleaves T7 RNA polymerase during purification, J. Bacteriol., 170, 1988, 1245–1253.
Guo S. & Kemphues K.J.. par-1, a gene required for establishing polarity in C. elegans embryos, encodes a putative Ser/Thr kinase that is asymmetrically distributed, Cell., 81, 1995, 611–620.[Medline]
Harlow E. & Lane D., AntibodiesA Laboratory Manual, 1988, Cold Spring Harbor Laboratory Press, Plainview, NYpp. 726.
Herman R.K., Albertson D.G. & Brenner S.. Chromosome rearrangements in Caenorhabditis elegans, Genetics., 83, 1976, 91–105.
Herman R.K., Madl J.E. & Kari C.K.. Duplications in Caenorhabditis elegans, Genetics., 92, 1979, 419–435.
Hiraoka Y., Swedlow J.R., Paddy M.R., Agard D.A. & Sedat J.W.. Three dimensional multiple-wavelength fluorescence microscopy for the structural analysis of biological phenomena, Semin. Cell Biol., 2, 1991, 153–165.[Medline]
Hughs-Schrader S. & Ris H.. The diffuse spindle attachment of coccids verified by the mitotic behavior of induced chromosome fragments, J. Exp. Zool., 87, 1941, 429–456.
Hughs-Schrader S. & Schrader F.. The kinetochore of the Hemiptera, Chromosoma., 12, 1961, 327–350.[Medline]
Jokelaninen P.T.. The ultrastructure and spatial organization of the metaphase kinetochore in mitotic rat cells, J. Ultrastruct. Res., 19, 1967, 19–44.[Medline]
Liao H., Winkfein R.J., Mack G., Rattner J.B. & Yen T.J.. CENP-F is a protein of the nuclear matrix that assembles onto kinetochores at late G2 and is rapidly degraded after mitosis, J. Cell Biol., 130, 1995, 507–518.
Mather K. & Stone L.H.A.. The effect of X-radiation upon somatic chromosomes, J. Genet., 28, 1933, 1–24.
Moroi Y., Peebles C., Fitzler M.J., Steigerwald J. & Tan E.M.. Autoantibody to centromere (kinetochore) in scleroderma sera, Proc. Natl. Acad. Sci. USA., 77, 1980, 1627–1631.
Pluta A.F., Mackay A.M., Ainsztein A.M., Goldberg I.G. & Earnshaw W.C.. The centromerehub of chromosome activities, Science., 270, 1995, 1591–1594.
Reider C.L.. The formation, structure, and composition of the mammalian kinetochore and kinetochore fiber, Int. Rev. Cytol., 79, 1982, 1–58.[Medline]
Renzi L., Gersch M.S., Campbell M.S., Wu L., Osmani S.A. & Gorbsky G.J.. MPM-2 antibody-reactive phophorylations can be created in detergent-extracted cells by kinetochore-bound and soluble kinases, J. Cell Sci., 110, 1997, 2013–2025.[Abstract]
Ris H.. A cytological and experimental analysis of the meiotic behavior of the univalent X chromosome in the bearberry aphid Tamalia (Phyllaphis) coweni (Ck.11), J. Exp. Zool., 90, 1942, 267–330.
Ris H. & Witt P.L.. Structure of the mammalian kinetochore, Chromosoma., 82, 1981, 153–170.[Medline]
Roos U.-P.. Light and electron microscopy of rat kangaroo cells in mitosis. II. Kinetochore structure and function, Chromosoma., 41, 1973, 195–220.[Medline]
Sambrook J., Fritsch E.F. & Maniatis T., Molecular CloningA Laboratory Manual, 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York.
Schrader F.. Notes on the mitotic behavior of long chromosomes, Cytology, 6, 1935, 422–430.
Starr D.A., Williams B.C., Li Z., Etemad-Moghadam B., Dawe R.K. & Goldberg M.L.. Conservation of the centromere/kinetochore protein ZW10, J. Cell Biol., 138, 1997, 1289–1301.
Stoler S., Keith K.C., Curnick K.E. & Fitzgerald-Hayes M.. A mutation in Cse4, an essential gene encoding a novel chromatin-associated protein in yeast, causes chromosome nondisjunction and cell cycle arrest at mitosis, Genes Dev., 9, 1995, 573–586.
Strome S. & Wood W.B.. Generation of asymmetry and segregation of germ-line granules in early Caenorhabditis elegans embryos, Cell., 35, 1983, 5–25.
Sullivan K.F., Hechenberger M. & Masri K.. Human CENP-A contains a histone H3 related histone fold domain that is required for targeting to the centromere, J. Cell Biol., 127, 1994, 581–592.
Taagepera S., Campbell M.S. & Gorbsky G.J.. Cell-cycle-regulated localization of tyrosine and threonine phosphoepitopes at the kinetochores of mitotic chromosomes, Exp. Cell Res., 221, 1997, 249–260.
Thompson J.D., Higgins D.G. & Gibson T.J.. CLUSTAL Wimproving the sensitivity of progressive multiple sequence alignment through sequence weighting, positions-specific gap penalties and weight matrix choice, Nucleic Acids Res., 22, 1994, 4673–4680.
Vandre D.D., Davis F.M., Rao P.N. & Borisy G.G.. Phosphoproteins are components of mitotic microtubule organizing centers, Proc. Natl. Acad. Sci. USA., 81, 1984, 4439–4443.
Williams B.C., Karr T.L., Montgomery J.M. & Goldberg M.L.. The Drosophila l(l)zw10 gene product, required for accurate mitotic chromosome segregation, is redistributed at anaphase onset, J. Cell Biol., 118, 1992, 759–773.
Williams B.C., Gatti M. & Goldberg M.L.. Bipolar spindle attachments affect redistributions of ZW10, a Drosophila centromere/kinetochore component required for accurate chromosome segregation, J. Cell Biol., 134, 1996, 1127–1140.
Young R.A. & Davis R.W.. Efficient isolation of genes by using antibody probes, Proc. Natl. Acad. Sci. USA., 80, 1983, 1194–1198.
Zhu X., Mancini M.A., Chang K.-H., Liu C.-Y., Chen C.-F., Shan B., Jones D., Yang-Feng T.L. & Lee W.-H.. Characterization of a novel 350-kilodalton nuclear phosphoprotein that is specifically involved in mitotic-phase progression, Mol. Cell. Biol., 15, 1995, 5017–5029.[Abstract]
Zinkowski R.P., Meyne J. & Brinkley B.R.. The centromere-kinetochore complexa repeat subunit model, J. Cell Biol., 113, 1991, 1091–1110.
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|