|
||
© The Rockefeller University Press,
0021-9525/1999//891 $5.00
The Journal of Cell Biology, Volume 147, Number 4,
, 1999 891-903
Original Article |
Manner of Interaction of Heterogeneous Claudin Species within and between Tight Junction Strands
htsukita{at}mfour.med.kyoto-u.ac.jp
In tight junctions (TJs), TJ strands are associated laterally with those of adjacent cells to form paired strands to eliminate the extracellular space. Claudin-1 and -2, integral membrane proteins of TJs, reconstitute paired TJ strands when transfected into L fibroblasts. Claudins comprise a multigene family and more than two distinct claudins are coexpressed in single cells, raising the questions of whether heterogeneous claudins form heteromeric TJ strands and whether claudins interact between each of the paired strands in a heterophilic manner. To answer these questions, we cotransfected two of claudin-1, -2, and -3 into L cells, and detected their coconcentration at cell–cell borders as elaborate networks. Immunoreplica EM confirmed that distinct claudins were coincorporated into individual TJ strands. Next, two L transfectants singly expressing claudin-1, -2, or -3 were cocultured and we found that claudin-3 strands laterally associated with claudin-1 and -2 strands to form paired strands, whereas claudin-1 strands did not interact with claudin-2 strands. We concluded that distinct species of claudins can interact within and between TJ strands, except in some combinations. This mode of assembly of claudins could increase the diversity of the structure and functions of TJ strands.
Key Words: tight junction strand claudin cell adhesion freeze-fracture
© 1999 The Rockefeller University Press
TIGHT junctions (TJs) are the most apical component of the junctional complex in vertebrate epithelial and endothelial cells, and circumscribe individual cells as a belt-like structure. Ultrathin section and freeze-fracture EM have provided three-dimensional structural images of TJs ( Farquhar and Palade 1963; Staehelin 1973, Staehelin 1974). In the belt-like region of TJs, two apposing membranes lie close together, and within the lipid bilayer of each membrane, the so-called TJ strands, which are probably composed of linearly aggregated integral membrane proteins, form networks through their ramification. Each TJ strand laterally and tightly associates with that in the apposing membrane of adjacent cells to form a paired strand, where the intercellular distance becomes almost zero (see Fig. 1 A).
|
To date, two distinct types of integral membrane proteins, occludin and claudins, bearing four transmembrane domains have been identified as components of TJ strands ( Furuse et al. 1993, Furuse et al. 1998a; Ando-Akatsuka et al. 1996; Tsukita and Furuse 1999). Recently, JAM, a member of the immunoglobulin superfamily, was also reported to be localized at TJs, but its involvement in the formation of TJ strands, per se, still remains unclear ( Martin-Padura et al. 1998). Occludin, with a molecular mass of
65 kD, was shown to be exclusively localized at TJ strands in various types of epithelial cells ( Fujimoto 1995; Saitou et al. 1997) and to be involved not only in the barrier, but also in the fence functions of TJs ( Balda et al. 1996; McCarthy et al. 1996; Chen et al. 1997; Wong and Gumbiner 1997). However, occludin was undetectable in most endothelial cells of mammalian nonneuronal tissues and in Sertoli cells of the guinea pig/human testis, where TJs were observed ( Hirase et al. 1997; Saitou et al. 1997; Moroi et al. 1998). Overexpression of mutant occludin resulted in changes in the distribution of occludin without affecting the structure or distribution of TJ strands ( Balda et al. 1996). Furthermore, when occludin-deficient embryonic stem cells were established and differentiated into epithelium-like cells (visceral endoderm cells), well-developed networks of TJ strands were still formed between adjacent cells ( Saitou et al. 1998). Considering that isoforms of occludin have not been found, these findings indicated that TJ strands can be formed without occludin.
Claudin-1 and -2 with molecular masses of
23 kD were identified from the isolated junctional fraction from the liver as proteins that were copartitioned with occludin during sonication and density gradient centrifugation of the TJ-enriched fraction ( Furuse et al. 1998a). These molecules showed no sequence similarity to occludin. Claudins comprise a multigene family, and to date 15 species of claudins have been identified ( Furuse et al. 1998a; Morita et al. 1999a; Tsukita and Furuse 1999). When claudins were introduced into mouse L fibroblasts, they were concentrated at cell–cell contact planes as an elaborate network, where well-developed networks of TJ strand-like structures were reconstituted (in this study, we tentatively call these reconstituted TJ strand-like structures in L cells rTJ strands). On the other hand, introduction of occludin induced only a small number of short TJ strand-like structures ( Furuse et al. 1998b). When claudin and occludin were cotransfected into L cells, occludin appeared to be integrated into claudin-based rTJ strands.
These findings suggested that claudins are polymerized linearly within plasma membranes to constitute the backbone of TJ strands, and that occludin is copolymerized into these claudin-based strands. It is interesting to speculate that the existence of multiple claudin species can explain the diversity of the barrier function of TJs. To evaluate this speculation, however, it is necessary to understand in what manner multiple claudin species are incorporated into TJ strands. Northern blotting showed that the tissue distribution pattern varied significantly, depending on claudin species, and that many tissues expressed multiple claudin species ( Furuse et al. 1998a; Morita et al. 1999a). Furthermore, immunofluorescence microscopy revealed that epithelial cells in distal tubules of the kidney expressed at least claudin-4 and -8, indicating that single cells coexpressed more than two species of claudins to constitute TJs. These observations have raised questions regarding whether in TJs in situ multiple distinct species of claudins are copolymerized linearly to form TJ strands as heteropolymers ( Fig. 1 B), and whether claudins interact between each of the paired strands in a homophilic or heterophilic manner ( Fig. 1 B). To address these questions, we established and examined L transfectants expressing claudin-1, -2, and -3 singly or in combination by immunofluorescence microscopy and conventional/immunolabeled freeze-fracture EM. This study provided new insight into the structure and function of TJ strands.
| Materials and Methods |
|---|
|
|
|---|
) and purified with the glutathione-Sepharose 4B beads (Amersham Pharmacia Biotech). Rat anti–mouse claudin-1 mAb and rat anti–mouse claudin-2 mAb were produced as described previously ( Itoh et al. 1991). Wistar rats were immunized with GST fusion proteins with the COOH-terminal cytoplasmic domain of respective claudins, and the lymphocytes were fused with P3 myeloma cells to obtain hybridoma cells. Fusion plates were screened by immunofluorescence staining of L transfectants expressing claudin-1 or -2 or by immunoblotting of GST fusion proteins. Mouse anti-FLAG mAb (M2) was purchased from Eastman Kodak Co.
Expression Vectors
To construct plasmids for the expression of GST/claudin-1 and GST/claudin-2 fusion proteins in E. coli, cDNAs encoding the COOH-terminal cytoplasmic region of claudin-1 (amino acid 188–211) and that of claudin-2 (amino acid 189–230) were amplified by PCR. Each cDNA fragment was subcloned into pGEX4T-1 (Amersham Pharmacia Biotech) to produce pGEX-IN (GST/claudin-1) and pGEX-IU (GST/claudin-2). The plasmid for the expression of GST/claudin-3 was constructed as described previously ( Morita et al. 1999a).
The mammalian expression vectors for claudin-1, -2, and -3 were constructed as follows. The cDNA fragment containing the whole open reading frame of claudin-1 or -2 was excised from pGTCL-1 or pGTCL-2 ( Furuse et al. 1998b) by SacI or EcoRI digestion, respectively. Each DNA fragment was subcloned into pCAGGSneodelEcoRI ( Niwa et al. 1991) to produce the expression vectors pCCL-1 (claudin-1) and pCCL-2 (claudin-2). Similarly the whole open reading frame of claudin-3 cDNA was subcloned into pCAGGSneodelEcoRI to construct the expression vector pCCL-3 ( Morita et al. 1999a). To construct the expression vector for the claudin-1 mutant lacking its COOH-terminal cytoplasmic domain, the cDNA fragment of claudin-1 corresponding to amino acid 148–188 was obtained by PCR using primers GGCGACATTAGTGGCCACAGCATG (sense) and CGCGGATCCTTTCCGGGGACAGGAGCA (antisense), followed by EcoRI and BamHI digestion. The cDNA fragment of claudin-1 encoding amino acid 148–211 was removed from the plasmid pSKCL-1F, which contained FLAG-tagged claudin-1 cDNA ( Furuse et al. 1998a), by EcoRI and BamHI digestion and was replaced by this PCR-amplified truncated cDNA fragment. Then the FLAG-tagged COOH-terminal cytoplasmic domain-deleted claudin-1 cDNA was subcloned into the expression vector pCAGGSneodelEcoRI to make pCCL-1
CF.
Transfection
To establish L transfectants singly expressing claudin-1, -2, or -3 (C1L, C2L, and C3L, respectively), mouse L cells cultured in 35-mm dishes were transfected with 1 µg of pCCL-1, pCCL-2, or pCCL-3 in 1 ml of Opti-MEM using lipofectamine plus (GIBCO BRL). After 14–16-d selection in DME containing 500 µg/ml of G418, resistant colonies were picked up. Isolated clones were screened by immunofluorescence microscopy. C1C2L cells coexpressing claudin-1 and -2 were established by transfection of C1L cells with a mixture of 1 µg of pCCL-2 and 0.1 µg of pPGKpuro, and then selected in DME containing 8 µg/ml of puromycin. Similarly, C1C3L and C2C3L cells were produced by transfecting C3L cells with pCCL-1 and pCCL-2, respectively, together with pGKpuro. C1FC2L cells coexpressing claudin-1 with a FLAG tag at its COOH terminus and claudin-2 were established by transfecting C1FL cells expressing FLAG-claudin-1 ( Furuse et al. 1998b) with 1 µg of pCCL-2 and 0.1 µg of pSV2hph ( Santerre et al. 1984), followed by selection in 200 µg/ml of hygromycin B. C1
CFL cells expressing COOH-terminal cytoplasmic domain-truncated claudin-1 with FLAG-tag was produced by transfecting L cells with pCCL-1
CF, followed by G418 selection. Several stable clones were isolated for each transfection experiment. Among these, clone 16 of C1L, clone 12 of C2L, clone 17 of C3L, clone 1 of C1C2L, clone 12 of C1C3L, clone 15 of C2C3L, clone 11 of C1FC2L, and clone 16 of C1
CFL were recloned and used for this study, since they expressed relatively large amounts of introduced proteins. Mouse L cells and transfectants were cultured in DME supplemented with 10% FCS.
SDS-PAGE and Immunoblotting
SDS-PAGE was performed according to the method of Laemmli 1970, and proteins were electrophoretically transferred from gels onto polyvinylene difluoride membranes. The membranes were soaked in 5% skimmed milk and incubated with the primary antibodies. After washing, the membranes were incubated with the second antibodies for rat, rabbit (Amersham Pharmacia Biotech), or guinea pig (Chemicon International, Inc.) IgG, followed by incubation with streptavidin-conjugated alkaline phosphatase (Amersham Pharmacia Biotech). Nitroblue tetrazolium and bromochloroindolyl phosphate were used as substrates to visualize the enzyme reaction.
Immunofluorescence Microscopy
L transfectants (1.5 x 106 cells) were plated on 60-mm culture dishes with coverslips. For coculture, 7.5 x 105 cells of each transfectant were mixed and plated. After a 48-h culture, cells on coverslips were fixed with 1% formaldehyde in PBS for 10 min at room temperature, washed with PBS, and treated with 0.2% Triton X-100 in PBS for 10 min. Cells were then washed with PBS, soaked in 1% BSA in PBS, and incubated with primary antibodies for 30 min in a moist chamber. After washing with PBS three times, cells were incubated with the fluorescently labeled second antibodies for 30 min. FITC-conjugated goat anti–rat IgG (BioSource International), Cy3-conjugated goat anti–rabbit IgG (Amersham Pharmacia Biotech), Cy3-conjugated goat anti–mouse IgG (Amersham Pharmacia Biotech), rhodamine-conjugated goat anti–guinea pig IgG, and FITC-conjugated goat anti–rabbit IgG (Chemicon International, Inc.) were used as secondary antibodies. Cells were washed three times with PBS and then mounted in 90% glycerol-PBS containing para-phenylenediamine and 1% n-propylgalate. Frozen sections of mouse liver were stained immunofluorescently, as described previously ( Furuse et al. 1993). Specimens were observed using a fluorescence Zeiss Axiophot photomicroscope, and the images were recorded with a SensysTM cooled CCD camera system (Photometrics).
Freeze-fracture Electron Microscopy
For conventional freeze-fracture EM, L transfectants cultured on 60-mm dishes were fixed with 2% glutaraldehyde in 0.1 M sodium cacodylate buffer (pH 7.3) overnight at 4°C, washed with 0.1 M sodium cacodylate buffer three times, immersed in 30% glycerol in 0.1 M sodium cacodylate buffer for 2 h, and then frozen in liquid nitrogen. Frozen samples were fractured at –100°C and platinum-shadowed unidirectionally at an angle of 45° in Balzers Freeze Etching System (BAF060, BAL-TEC). Samples were then immersed in household bleach, the replicas floating off the samples were picked up on formvar-filmed grids and examined with a JEOL 1200 EX electron microscope at an acceleration voltage of 100 kV.
Immunoelectron microscopy for examining freeze-fracture replicas was performed as described by Fujimoto 1995. Mouse liver was cut into small pieces and quickly frozen in high pressure liquid nitrogen with an HPM010 high pressure freezing machine (BAL-TEC). L transfectants were fixed with 1% paraformaldehyde in 0.1 M phosphate buffer (pH 7.3) for 5 min at room temperature, washed three times in 0.1 M phosphate buffer, immersed in 30% glycerol in 0.1 M phosphate buffer for 3 h, and then frozen in liquid nitrogen. Frozen samples were then fractured and shadowed as described. Samples were immersed and stirred in lysis buffer containing 2.5% SDS, 10 mM Tris-HCl, and 0.6 M sucrose (pH 8.2) for 12 h at room temperature, then replicas floating off the samples were washed with PBS containing 5% BSA. The replicas were incubated with primary antibodies for 2 h, washed with PBS-BSA, incubated with colloidal gold-conjugated secondary antibodies, washed with PBS-BSA, and then picked up on formvar-filmed grids. Goat anti–rabbit IgG coupled with 5-nm gold, goat anti–mouse IgG coupled with 15-nm gold (Amersham Pharmacia Biotech), and goat anti–guinea pig IgG coupled with 15-nm gold (British BioCell International) were used as secondary antibodies.
| Results |
|---|
|
|
|---|
|
|
|
|
|
To confirm this speculation, the freeze-fracture replicas obtained from confluent C1C2L cells were double immunolabeled with guinea pig anticlaudin-1 pAb and rabbit anticlaudin-2 pAb. As shown in Fig. 6 a, the 15- and 5-nm gold particles representing the localization of claudin-1 and -2, respectively, appeared to be admixed along individual rTJ strands. Similar results were also obtained in C1C3L cells ( Fig. 6 b). However, as described above, the labeling ability of anticlaudin-1 pAb for freeze-fracture replicas was fairly low (see Fig. 3 e). Therefore, we obtained L transfectants coexpressing claudin-2 and FLAG-tagged claudin-1 (C1FC2L cells), and the freeze-fracture replicas obtained from confluent C1FC2L cells were double labeled with anti-FLAG mAb (15-nm gold particles) and anticlaudin-2 pAb (5-nm gold particles; Fig. 6c and Fig. d). In these images, numerous 15- and 5-nm gold particles appeared to distribute evenly and specifically along individual rTJ strands. Taken together with Fig. 5, we concluded that in the model system of L transfectants, distinct species of claudins can be copolymerized to form rTJ strands as heteropolymers (see Fig. 1 B, Model C or D).
|
As shown in Fig. 7 a–c, when C1L and C3L cells were cocultured and double stained with anticlaudin-1 mAb and anticlaudin-3 pAb, three types of cell–cell contact planes were distinguished in terms of immunofluorescence staining: the claudin-1–positive/claudin-3–negative planes, which would be formed between adjacent C1L cells; the claudin-1–negative/claudin-3–positive planes, which would be formed between adjacent C3L cells; and the claudin-1–positive/claudin-3–positive planes, which would be formed between adjacent C1L and C3L cells. At higher magnification, in the claudin-1–positive/claudin-3–positive planes, both claudin-1 and claudin-3 in C1L and C3L cells, respectively, were concentrated in an elaborate network pattern ( Fig. 7j and Fig. k), and their networks were mostly overlapped ( Fig. 7 l). The same results were obtained in cocultures of C2L and C3L cells ( Fig. 7, d–f and m–o). These findings indicated that claudin-3–based homopolymers (rTJ strands) can associate laterally with claudin-1– and claudin-2–based homopolymers through the heterophilic interactions of claudin-3 with claudin-1 and claudin-2, respectively. In contrast, when C1L and C2L cells were cocultured and double stained with anticlaudin-1 mAb and anticlaudin-2 pAb, the claudin-1–positive/claudin-2–positive planes were not formed ( Fig. 7, g–i). Therefore, it was likely that, at least in L transfectants, claudin-1 cannot interact with claudin-2 in a heterophilic manner. In conclusion, in L transfectants, paired strands can be formed not only by homophilic interactions, but also by heterophilic interactions of claudins, except for some combinations of claudins.
|
TJ Strand Formation by Polymerization of Claudin-1 Lacking Its COOH-terminal Cytoplasmic Domain
In this study, we discussed the formation of TJ strands from the viewpoint of claudin–claudin interaction. However, we should consider the possible involvement of peripheral membrane proteins in TJ strand formation. Since the COOH-terminal cytoplasmic domain of claudins was thought to be responsible for their interactions with peripheral membrane proteins, we constructed a claudin-1 mutant lacking its COOH-terminal cytoplasmic domain (claudin-1
C), and obtained L transfectants expressing FLAG-tagged claudin-1
C (C1
CFL cells; Fig. 9 A). These claudin mutants were concentrated at cell–cell borders as shown immunofluorescently in Fig. 9 B. Freeze-fracture replicas obtained from C1
CFL cells revealed that this claudin-1 mutant still bore well-developed network of rTJ strands ( Fig. 9 C), and interestingly, these rTJ strands were largely associated with the P-face as mostly continuous structures with vacant grooves at the E-face. These findings suggested that the interaction between claudins and peripheral membrane proteins was not required for the formation of TJ strands, per se, as well as their P-face association.
|
| Discussion |
|---|
|
|
|---|
The thickness of TJ strands is
10-nm in freeze-fracture replica images ( Staehelin 1973, Staehelin 1974). Interestingly, the gap junction channel consisting of six connexins is also
10-nm in diameter ( Kumar and Gilula 1996; Jiang and Goodenough 1996). Since connexin also has four transmembrane domains with the same membrane topology as claudins, it is tempting to speculate that oligomers of claudins are also unit structures in TJs, and that these unit structures are arranged linearly to form individual TJ strands. This raises a new question as to whether these unit structures themselves are homomeric or heteromeric, further subdividing the above four models; heteropolymers can be formed by linearly aligned heteromeric unit structures, as well as distinct homomeric unit structures. This type of discussion has been reported in detail for gap junctions, in which the unit structures have been determined ( Kumar and Gilula 1996; Jiang and Goodenough 1996), but in TJ strands the clarification of unit structures is a prerequisite for further discussion.
Northern blotting showed that most tissues expressed more than two species of claudins ( Furuse et al. 1998a; Morita et al. 1999a). Immunofluorescence microscopy revealed that TJs in situ contained claudin-4 and -8 in the kidney ( Morita et al. 1999a) and claudin-1, -2, and -3 in the liver ( Fig. 3). Therefore, taking the results obtained from the cotransfection experiments (see Fig. 5 and Fig. 6), it is likely that in situ most TJ strands are heteropolymers of claudins, although specialized TJ strands in myelin sheaths of oligodendrocytes and in Sertoli cells in the testis appeared to be mainly composed of a single species of claudin, claudin-11 ( Morita et al. 1999b). As shown in this study, not only homophilic, but also heterophilic interactions of claudins between each of the paired TJ strands are allowed. Thus, in the paired TJ strands of heteropolymers in situ homophilic interactions of various claudin species, as well as heterophilic interactions between various combinations of claudin species, are expected to occur, as shown in Model D ( Fig. 1 B). It is reasonable to postulate that the strength of these interactions varies depending on the claudin species involved and their combinations, and that the tightness of each TJ strand is determined as a whole by the number/type of species of claudins and their mixing ratio in the strand. For example, MDCK I cells have a fairly tighter TJ barrier than MDCK II cells, but no difference was detected in the number of TJ strands between these two distinct clones of MDCK cells ( Stevenson et al. 1988). These observations suggested a qualitative difference of the paired TJ strands in their tightness between these two clones, and this difference could be explained as postulated above.
To avoid further complexity, we have not discussed occludin. Immunoreplica analyses indicated that occludin was also incorporated into TJ strands in situ in most types of epithelial cells ( Fujimoto 1995; Furuse et al. 1996; Saitou et al. 1997). When occludin was cotransfected into L cells, together with claudin-1, they were coincorporated into rTJ strands (and of course also paired rTJ strands; Furuse et al. 1998b). Occludin singly introduced into L cells was concentrated at cell–cell borders in a punctate manner, indicating that occludins interact with each other in a homophilic manner between adjacent cells ( Furuse et al. 1998b). Furthermore, when L transfectants expressing occludin were cocultured with C1L cells, neither occludin or claudin-1 was concentrated at cell–cell borders, suggesting that occludin does not interact with claudin-1 in a heterophilic manner between adjacent cells (Furuse, M., and S. Tsukita, unpublished data). Therefore, at present it is very difficult to postulate how occludin is incorporated into the paired heteropolymers of claudins (TJ strands) in situ. Occludin may be incorporated into claudin-based TJ strands in the same manner as claudins, and in the paired TJ strands occludin may be positioned opposite to occludin, which allows occludin–occludin interaction ( Furuse et al. 1998b). Alternatively, it may be positioned opposite to a claudin which may result in the formation of small pores. It is also possible that occludin is involved in TJ strand formation differently from claudins.
Finally, we should discuss the possible role of peripheral membrane proteins, such as ZO-1 ( Stevenson et al. 1986), ZO-2 ( Gumbiner et al. 1991), and ZO-3 ( Balda et al. 1993; Haskins et al. 1998) in the formation of TJ strands. ZO-1, but not ZO-2 or ZO-3, was expressed endogenously in L cells, and this endogenous ZO-1 was coconcentrated with claudin-1 and -2 at cell–cell borders as an elaborate network in C1L and C2L cells, respectively (Itoh, M., M. Furuse, K. Morita, and S. Tsukita, unpublished data). In our previous study ( Furuse et al. 1998b), we reported that claudin-1 and -2 with a FLAG tag at their COOH-termini also formed a well-developed network of rTJ strands in L transfectants. Interestingly, however, endogenous ZO-1 was not recruited to these FLAG-claudin-1 or FLAG-claudin-2–based rTJ strands, probably because the FLAG sequence affected the claudin/ZO-1 interaction (Furuse, M., and S. Tsukita, unpublished data). These findings indicated that ZO-1 (and also ZO-2 and ZO-3) was not required for the formation of rTJ strands in L transfectants. Furthermore, Fig. 9 showed that a claudin-1 deletion mutant lacking almost all of its COOH-terminal cytoplasmic domain still formed a well-developed network of rTJ strands in L transfectants, favoring the notion that the peripheral membrane proteins are not involved in the polymerization of claudins within plasma membranes. Therefore, we interpreted the data presented in this study without considering the possible involvement of peripheral membrane proteins.
The model system of L transfectants used in this study was very useful to analyze the properties of each claudin species. To date, 15 members of the claudin family have been identified, but it remains unclear how many claudins will be identified in the future. It is thus very difficult, by the use of epithelial cells, to clarify the nature and function of each claudin species, partly because we cannot determine exactly all the types of claudins expressed in certain epithelial cells. Therefore, to further understand the structure and functions of claudins and TJ strands, the L transfectant system will continue to be used towards the reconstitution of TJs as a complementary technique to the knockout of each claudin gene.
Note Added in Proof. Positional cloning has identified a new member of the claudin family (paracellin-1/claudin-16) in which mutations cause hereditary renal hypomagnesemia in humans (Simon, D.B., Y. Lu, K.A. Choate, H. Velazquez, E. Al-Sabban, M. Praga, G. Casari, A. Bettinelli, G. Colussi, J. Rodriguez-Soriano, et al. 1999. Paracellin-1, a renal tight junction protein required for paracellular Mg2+ resorption. Science. 285:103–106). This finding favors the idea that claudins possibly are involved in the formation of aqueous pores within TJ strands.
| Acknowledgments |
|---|
This study was supported in part by a grant-in-aid for Cancer Research and a grant-in-aid for Scientific Research (A) from the Ministry of Education, Science, and Culture of Japan to S. Tsukita and in part by a grant from the Kazato Research Foundation to M. Furuse.
Submitted: 15 June 1999
Revised: 28 September 1999
Accepted: 30 September 1999
Abbreviations used in this paper: E-face, extracellular face; pAb, polyclonal antibody; P-face, protoplasmic face; rTJ strand, reconstituted tight junction strand; TJ, tight junction.
| References |
|---|
|
|
|---|
Anderson J.M. & van Itallie C.M.. Tight junctions and the molecular basis for regulation of paracellular permeability, Am. J. Physiol., 269, 1995, G467–G475 .[Medline]
Ando-Akatsuka Y., Saitou M., Hirase T., Kishi M., Sakakibara A., Itoh M., Yonemura S., Furuse M. & Tsukita Sh.. Interspecies diversity of the occludin sequencecDNA cloning of human, mouse, dog, and rat-kangaroo homologues, J. Cell Biol., 133, 1996, 43–47 .
Balda M.S., González-Mariscal L., Matter K., Cereijido M. & Anderson J.M.. Assembly of the tight junctionthe role of diacylglycerol, J. Cell Biol., 123, 1993, 293–302 .
Balda M.S., Whitney J.A., Flores C., González S., Cereijido M. & Matter K.. Functional dissociation of paracellular permeability and transepithelial electrical resistance and disruption of the apical–basolateral intramembrane diffusion barrier by expression of a mutant tight junction membrane protein, J. Cell Biol., 134, 1996, 1031–1049 .
Chen Y.-H., Merzdorf C., Paul D.L. & Goodenough D.A.. COOH terminus of occludin is required for tight junction barrier function in early Xenopus embryos, J. Cell Biol., 138, 1997, 891–899 .
Claude P.. Morphological factors influencing transepithelial permeabilitya model for the resistance of the zonula occludens, J. Membr. Biol., 10, 1978, 219–232 .
Farquhar M.G. & Palade G.E.. Junctional complexes in various epithelia, J. Cell Biol., 17, 1963, 375–412 .
Fujimoto K.. Freeze-fracture replica electron microscopy combined with SDS digestion for cytochemical labeling of integral membrane proteins. Application to the immunogold labeling of intercellular junctional complexes, J. Cell Sci., 108, 1995, 3443–3449 .[Abstract]
Furuse M., Hirase T., Itoh M., Nagafuchi A., Yonemura S., Tsukita Sa. & Tsukita Sh.. Occludina novel integral membrane protein localizing at tight junctions, J. Cell Biol., 123, 1993, 1777–1788 .
Furuse M., Fujimoto K., Sato N., Hirase T., Tsukita Sa. & Tsukita Sh.. Overexpression of occludin, a tight junction-associated integral membrane protein, induces the formation of intracellular multilamellar bodies bearing tight junction-like structures, J. Cell Sci., 109, 1996, 429–435 .[Abstract]
Furuse M., Fujita K., Hiiragi T., Fujimoto K. & Tsukita Sh.. Claudin-1 and -2novel integral membrane proteins localizing at tight junctions with no sequence similarity to occludin, J. Cell Biol., 141, 1998, 1539–1550a .
Furuse M., Sasaki H., Fujimoto K. & Tsukita Sh.. A single gene product, claudin-1 or -2, reconstitutes tight junction strands and recruits occludin in fibroblasts, J. Cell Biol., 143, 1998, 391–401b .
Gumbiner B.. Breaking through the tight junction barrier, J. Cell Biol., 123, 1993, 1631–1633 .
Gumbiner B., Lowenkopf T. & Apatira D.. Identification of a 160 kDa polypeptide that binds to the tight junction protein ZO-1, Proc. Natl. Acad. Sci. USA., 88, 1991, 3460–3464 .
Haskins J., Gu L., Wittchen E.S., Hibbard J. & Stevenson B.R.. ZO-3, a novel member of the MAGUK protein family found at the tight junction, interacts with ZO-1 and occludin, J. Cell Biol., 141, 1998, 199–208 .
Hirase T., Staddon J.M., Saitou M., Ando-Akatsuka Y., Itoh M., Furuse M., Fujimoto K., Tsukita Sh. & Rubin L.L.. Occludin as a possible determinant of tight junction permeability in endothelial cells, J. Cell Sci., 110, 1997, 1603–1613 .[Abstract]
Itoh M., Yonemura S., Nagafuchi A., Tsukita Sa. & Tsukita Sh.. A 220-kD undercoat-constitutive proteinits specific localization at cadherin-based cell–cell adhesion sites, J. Cell Biol., 115, 1991, 1449–1462 .
Jiang J.X. & Goodenough D.A.. Heteromeric connexons in lens gap junction channels, Proc. Natl. Acad. Sci. USA., 93, 1996, 1287–1291 .
Kubota K., Furuse M., Sasaki H., Sonoda N., Fujita K., Nagafuchi A. & Tsukita Sh.. Ca++-independent cell adhesion activity of claudins, integral membrane proteins of tight junctions, Curr. Biol., 9, 1999, 1035–1038 .[Medline]
Kumar N.M. & Gilula N.B.. The gap junction communication channel, Cell., 84, 1996, 381–388 .[Medline]
Laemmli U.K.. Cleavage of structural proteins during the assembly of the head of bacteriophage T4, Nature., 227, 1970, 680–685 .[Medline]
Martin-Padura I., Lostaglio S., Schneemann M., Williams L., Romano M., Fruscella P., Panzeri C., Stoppacciaro A., Ruco L. & Villa A.. Junctional adhesion molecule, a novel member of the immunoglobulin superfamily that distributes at intercellular junctions and modulates monocyte transmigration, J. Cell Biol., 142, 1998, 117–127 .
McCarthy K.M., Skare I.B., Stankewich M.C., Furuse M., Tsukita S., Rogers R.A., Lynch R.D. & Schneeberger E.E.. Occludin is a functional component of the tight junction, J. Cell Sci., 109, 1996, 2287–2298 .[Abstract]
Moroi S., Saitou M., Fujimoto K., Sakakibara A., Furuse M., Yoshida O. & Tsukita Sh.. Occludin is concentrated at tight junctions of mouse/rat but not human/guinea pig Sertoli cells in testes, Am. J. Physiol., 274, 1998, C1708–C1717 .[Medline]
Morita K., Furuse M., Fujimoto K. & Tsukita Sh.. Claudin multigene family encoding four-transmembrane domain protein components of tight junction strands, Proc. Natl. Acad. Sci. USA., 96, 1999, 511–516a .
Morita K., Sasaki H., Fujimoto K., Furuse M. & Tsukita Sh.. Claudin-11/OSP-based tight junctions in myelinated sheaths of oligodendrocytes and Sertoli cells in testis, J. Cell Biol., 145, 1999, 579–588b .
Niwa H., Yamamura K. & Miyazaki J.. Efficient selection for high-expression transfectants with a novel eukaryotic vector, Gene., 108, 1991, 193–200 .[Medline]
Powell D.W.. Barrier function of epithelia, Am. J. Physiol., 241, 1981, G275–G288 .[Medline]
Saitou M., Ando-Akatsuka Y., Itoh M., Furuse M., Inazawa J., Fujimoto K. & Tsukita Sh.. Mammalian occludin in epithelial cellsits expression and subcellular distribution, Eur. J. Cell Biol., 73, 1997, 222–231 .[Medline]
Saitou M., Fujimoto K., Doi Y., Itoh M., Fujimoto T., Furuse M., Takano H., Noda T. & Tsukita Sh.. Occludin-deficient embryonic stem cells can differentiate into polarized epithelial cells bearing tight junctions, J. Cell Biol., 141, 1998, 397–408 .
Santerre R.F., Allen N.E., Hobbs J.N. Jr., Rao R.N. & Schmidt R.J.. Expression of prokaryotic genes for hygromycin B and G418 resistance as dominant-selection markers in mouse L cells, Gene., 30, 1984, 147–156 .[Medline]
Schneeberger E.E. & Lynch R.D.. Structure, function, and regulation of cellular tight junctions, Am. J. Physiol., 262, 1992, L647–L661 .[Medline]
Staehelin L.A.. Further observations on the fine structure of freeze-cleaved tight junctions, J. Cell Sci., 13, 1973, 763–786 .
Staehelin L.A.. Structure and function of intercellular junctions, Int. Rev. Cytol., 39, 1974, 191–283 .[Medline]
Stevenson B.R., Anderson J.M., Goodenough D.A. & Mooseker M.S.. Tight junction structure and ZO-1 content are identical in two strains of Madin-Darby canine kidney cells which differ in transepithelial resistance, J. Cell Biol., 107, 1988, 2401–2408 .
Stevenson B.R., Siliciano J.D., Mooseker M.S. & Goodenough D.A.. Identification of ZO-1a high molecular weight polypeptide associated with the tight junction (zonula occludens) in a variety of epithelia, J. Cell Biol., 103, 1986, 755–766 .
Tsukita Sh. & Furuse M.. Occludin and claudins in tight junction strandsleading or supporting players?, Trends Cell Biol., 9, 1999, 268–273 .[Medline]
Wong V. & Gumbiner B.M.. A synthetic peptide corresponding to the extracellular domain of occludin perturbs the tight junction permeability barrier, J. Cell Biol., 136, 1997, 399–409 .
Yap A.S., Mullin J.M. & Stevenson B.R.. Molecular analysis of tight junction physiologyinsights and paradoxes, J. Membr. Biol., 163, 1998, 159–167.[Medline]
This article has been cited by other articles:
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|