|
||
© The Rockefeller University Press,
0021-9525/2000//343 $5.00
The Journal of Cell Biology, Volume 148, Number 2,
, 2000 343-352
Original Article |
Homeobox B3 Promotes Capillary Morphogenesis and Angiogenesis
nancyjb{at}itsa.ucsf.edu
Endothelial cells (EC) express several members of the Homeobox (Hox) gene family, suggesting a role for these morphoregulatory mediators during angiogenesis. We have previously established that Hox D3 is required for expression of integrin
vβ3 and urokinase plasminogen activator (uPA), which contribute to EC adhesion, invasion, and migration during angiogenesis. We now report that the paralogous gene, Hox B3, influences angiogenic behavior in a manner that is distinct from Hox D3. Antisense against Hox B3 impaired capillary morphogenesis of dermal microvascular EC cultured on basement membrane extracellular matrices. Although levels of Hox D3-dependent genes were maintained in these cells, levels of the ephrin A1 ligand were markedly attenuated. Capillary morphogenesis could be restored, however, by addition of recombinant ephrin A1/Fc fusion proteins. To test the impact of Hox B3 on angiogenesis in vivo, we constitutively expressed Hox B3 in the chick chorioallantoic membrane using avian retroviruses that resulted in an increase in vascular density and angiogenesis. Thus, while Hox D3 promotes the invasive or migratory behavior of EC, Hox B3 is required for the subsequent capillary morphogenesis of these new vascular sprouts and, together, these results support the hypothesis that paralogous Hox genes perform complementary functions within a particular tissue type.
Key Words: endothelial cells Hox neovascularization extracellular matrix ephrin
© 2000 The Rockefeller University Press
| Introduction |
|---|
|
|
|---|
To this end, we have been investigating a potential role for homeobox genes during angiogenesis, a process which involves extensive, coordinated changes in cell–cell and cell–ECM interactions. In response to angiogenic stimulators, including the tumor or wound microenvironment, normally quiescent endothelial cells (EC) upregulate expression of proteinases, including matrix metalloproteinases and urokinase plasminogen activator (uPA), which degrade the surrounding basement membrane (BM) ECM (for review see Werb et al. 1999). As EC reenter the cell cycle, they also upregulate expression of adhesion molecules, including
vβ3 integrin, which allows the cells to adhere and migrate into the adjacent stromal matrix environment ( Brooks et al. 1994). After this, EC must then resynthesize and deposit a new BM ECM and undergo morphological reorganization into tubular structures complete with a lumen ( Stromblad and Cheresh 1996). Maturation of the newly formed capillaries follows via recruitment of pericytes, which strengthen and stabilize the vascular wall ( Hirschi and D'Amore 1996; Maisonpierre et al. 1997).
We previously identified several class I Homeobox genes expressed in cultured EC and showed that one of these, namely Hox D3, is required for expression of the β3 subunit of the
vβ3 integrin, as well as for expression of the uPA. When constitutively expressed in EC in vivo, Hox D3 produced endothelioma-like structures, consistent with a role for this gene in mediating the invasive and migratory behavior of EC during the early stages of neovascularization ( Boudreau et al. 1997). Recent work by others has also shown that EC upregulate the expression of several members of the Hox B cluster or splice variants of Hox A9 in response to a variety of angiogenic cytokines ( Belotti et al. 1998; Patel et al. 1999). The role of these genes during angiogenesis, however, remains to be established. Given the complex multistep nature of angiogenesis and the coordinate changes in cell–cell and cell–ECM interactions, it is likely that many of the Hox genes expressed in EC contribute to this process. Having established a role for Hox D3 during the early stages of angiogenesis, we are particularly interested in establishing a role for Hox genes that may act at later stages of angiogenesis, which involve resynthesis of BM ECM and/or acquisition of a tubular three-dimensional capillary morphology.
Evidence gathered from single and compound Hox null mice have suggested that paralogous Hox genes (i.e., those with similar numerical designations, but located on different chromosomes such as Hox D3, Hox B3, and Hox A3) may play complementary, overlapping, or synergistic roles in a particular tissue ( Condie and Capecchi 1994; Manley and Capecchi 1997). For example, whereas deletion of a single member of Hox 9 paralogous group did not significantly impact postnatal mammary gland development, deletion of Hox A9, B9, and D9 dramatically impaired the normal branching morphogenesis and differentiation of this tissue ( Chen and Capecchi 1999). Therefore, we wished to investigate whether paralogues of Hox D3 also contribute to angiogenic behavior in EC and whether these genes acted at the same or later stages of neovascularization. We had previously observed that the paralogous gene Hox B3 is highly expressed in adult EC ( Boudreau et al. 1997) and thus wished to establish whether this gene acted in concert with Hox D3 and/or via distinct mechanisms to influence endothelial cell behavior.
| Materials and Methods |
|---|
|
|
|---|
and Matrigel were obtained from Collaborative Research. Endothelial cell culture on BM (Matrigel) was performed as previously described ( Boudreau et al. 1997). To release cells from Matrigel for protein or mRNA determination, cultures were suspended in PBS without Ca2+ or Mg2+, containing 0.5 mM EDTA and incubated on ice for 1 h to allow the Matrigel to disperse. Cells were then pelleted by centrifugation at 500 g for 5 min at 4°C. For the ephrin add back experiments, 250 ng/ml recombinant mouse ephrin A1 fused to human IgG was diluted in serum-free MCDB 131 and preclustered for 1 h at room temperature using 25 ng/ml of an antibody against the Fc region of human IgG (Sigma Chemical Co.) as described ( Wang and Anderson 1997). Clustered ephrins were added to cells at the time of plating on Matrigel.
RNA Isolation and Northern Blot Analysis
Total RNA was isolated from HMEC-1 using the Qiagen RNEasy kit. For Northern blot analysis, a total of 10 or 20 µg total RNA was electrophoresed through 1% agarose formaldehyde gels as previously described using standard methods ( Boudreau et al. 1997). Ribosomal RNA was visualized by staining with 1% ethidium bromide. 32P{dCTP} probes were prepared using the Ambion Decaprime Kit and purified using Sephadex G-25 columns (Boehringer Mannheim Corp.). Blots were probed with 1 x 106 cpm/ml of hybridization buffer (Hybridsol I; Oncor) and exposed to Kodak M5 X-Omat film at –70°C. cDNA for integrin β3 was a gift from David Cheresh (The Scripps Research Institute, La Jolla, CA).
Reverse Transcriptase PCR Measurement of Hox B3 in EC
1 µg of total RNA was reverse transcribed using MMuLV RT for 1 h in total volume of 25 µl. 0.1, 1, 2, and 10 µl of this RT reaction was then amplified for 20, 30, or 35 cycles of 95, 58, and 72°C for 30, 30, and 90 s, respectively, with the following primers: forward primer 5' cgatgcagaaagccacctactacgac 3' corresponding to bp 362–387 of human Hox B3, and reverse primer 5' cgccgaccccggggggctcttct 3' corresponding to nucleotides 1,666–1,682 of the published sequence. The expected 1.32-kb PCR product was visualized by electrophoresis on 1% agarose gels containing ethidium bromide. From this analysis, it was determined that amplification of 1 µl of the total 25 µl RT reaction for 30 cycles gave optimal, reproducible results within the linear range for amplification. To normalize for total RNA, 1 µl of the same RT reaction was diluted 1:800 in water and amplified under the same conditions with commercially available primer sets for human GAPDH or β-actin (Stratagene). The 1.32-kb PCR product corresponding to Hox B3 was subsequently ligated into the TOPO II TA cloning vector (Invitrogen Corp.) and the identity confirmed as Hox B3 by dideoxy sequencing using the USB Sequenase 2 kit (Nycomed Amersham, Inc.).
Construction of Hox B3 Sense and Antisense Expression Vectors
The insert containing the entire cDNA encoding human Hox B3 was subcloned into the expression vector PCR 3.1 containing a CMV promoter (Invitrogen Corp.). The orientation was confirmed by restriction digest and the ends were resequenced to confirm the identity and orientation. Clones in the antisense orientation were directly transfected into HMEC-1 using a CaP04 method and stable transfectants selected in the presence of 50 µg/ml G418. To achieve high levels of translation and expression of Hox B3 in the sense orientation, we introduced a Kozak consensus sequence on the 5' end by reamplifying the cDNA with the primer 5' ggaattcggccaccatgcaga 3'. The resulting cDNA was religated into the same PCR 3.1 expression in the sense orientation, stably transfected into HMEC-1, and stable pools were selected as described above. To allow us to distinguish transgene expression from endogenous Hox B3, we have also added a COOH-terminal 6xHis epitope tag by deleting the stop codon and cloning into the PCR 3.1 mycHis vector (Invitrogen Corp.). This construct was subsequently cloned into the CK proviral vector described below.
Western Blotting
Total protein was isolated from EC using ice-cold 10 mM Tris/150 mM NaCl in the presence of 10 µg/ml aprotinin, pepstatin, and leupeptin, and 0.02 M PMSF. Protein concentration was determined using a protein assay kit (BioRad). For Western analysis, a total of 20 or 50 µg protein lysates were run on SDS-PAGE and transferred to PVDF membranes (Immobilon; Nycomed Amersham Inc.). Membranes were blocked in 5% milk protein in 10 mM TBS, pH 7.6. Polyclonal antibodies against Hox B3 were purchased from Berkeley Antibody Co. Polyclonal rabbit anti–human antibodies against ephrin A1 were purchased from Santa Cruz Biotechnology (sc-911). For Western Blot analysis, a 1:2,000 or 1:500 dilution was used as indicated, followed by incubation with HRP-conjugated goat anti–rabbit antibodies (Nycomed Amersham Inc.). To reduce nonspecific background, blots were washed in 1 M NaCl followed by several washes in TBS, pH 7.6. Bands were visualized by enhanced chemiluminescence (ECL Plus; Nycomed Amersham Inc.).
cDNA Probes for Ephrin A1 and Ephrin B1
A cDNA probe corresponding to ephrin A1 was isolated using the following primer pairs: forward 5' ggaacccagacccataggagac 3'' corresponding to nucleotides 17–38, and the reverse primer 5' ttcagcctgtccctctttaaga 3' corresponding to nucleotides 711–732 of the human sequence (GenBank/EMBL/DDBJ accession numbers M57730 and M37476). The resulting 0.7-kb PCR product was ligated into the TOPO cloning vector and the identity confirmed by sequencing as described. The entire 700-bp insert was used for Northern blot analysis. A probe for ephrin B1 was also generated by RT-PCR from 1 µg total RNA for 30 cycles at 95, 58, and 72°C for 30, 30, and 90 s, respectively, using the following primer pairs: forward 5' ttg gtg agg agg cgc caa gg 3' corresponding to nucleotides 653–672, and the reverse primer 5'' ggg cac tca gac ctt gta gta ga 3' corresponding to nucleotides 1,748–1,726 of the published sequence of human ephrin B1 (GenBank/EMBL/DDBJ accession number NM_004429). The 1,095-bp PCR product was ligated into the TOPO II PCR cloning vector (Invitrogen Corp.) and the identity of the PCR product confirmed as ephrin B1 by dideoxy sequencing as described above.
Immunoprecipitation of Eph A2 Receptor
EphA2 receptor was measured by immunoprecipitation of equal amounts of protein lysates of HMEC-1 using a polyclonal antibody against human Eph A2 (sc-924; Santa Cruz Biotechnology). HMEC-1 were lysed in ice-cold 10 mM Tris-HCl/150 mM NaCl, pH 7.6, in the presence of 2 mM NaF, 2 mM orthovanadate, 10 µg/ml aprotinin, pepstatin, and leupeptin, and 0.02 M PMSF. After determination of protein concentrations, 300 µg of cellular lysate was diluted in RIPA containing 2 mM NaF and 2 mM orthovanadate, and immune complexes precipitated using 25 µl of a 10% wt/vol solution of protein A–Sepharose (Sigma Chemical Co.). Pellets were washed three times in RIPA, followed by two additional washes in PBS, and resuspended in 2x Laemmli sample buffer. After separation on 7.5% SDS-PAGE and transfer to PVDF membranes, blots were probed with antibodies against Eph A2 or antibodies against total phosphotyrosine (clone 4G10; Upstate Biotechnology).
Migration Assays
Endothelial cell migration assays were performed using a modification of the method described by Klemke et al. 1997. In brief, migration assays were performed using tissue culture-treated Transwell chambers of 6.5-mm diam, with 8-µm pores (Costar Corp.). The bottom surfaces of the chambers were coated with 20 µg/ml of bovine fibrinogen (Sigma Chemical Co.) or 1% BSA for controls. Before the assay, wells were rinsed twice with migration buffer (fibroblast basal medium + 0.5% BSA; Clonetics). EC were serum-starved for 18 h and removed from the culture dishes by harvesting with Ca2+- and Mg2+-free PBS containing 0.53 mM EDTA, and resuspended in migration buffer. 50,000 cells were added to each well and the assay was allowed to proceed for 5 h at 37°C. Nonmigratory cells were removed from the upper chambers with a cotton swab and cells that had migrated to the bottom of the membrane were visualized by fixing and staining with Diff-Quick (VWR Scientific Products). The total number of cells that had migrated was determined by counting at least five different fields using a Nikon inverted TMS microscope. Alternatively, quantitative analysis of migration was performed by measuring absorbance of methylene blue stained cells at 600 nm. Each determination represents the average of three individual wells and error bars represent SD.
Construction and Application of Avian Replication-defective Retroviruses Expressing Hox B3 in Chick Chorioallantoic Membrane
To produce replication defective retroviruses encoding Hox B3, the cDNA encoding the entire human Hox B3 sequence was excised with HindIII and PmeI and inserted into the proviral vector CK at the HindIII site and an XbaI site that was blunted with Klenow polymerase. The viral packaging cell line, Q4dh, derived from the QT6 quail fibrosarcoma cells line ( Stoker and Bissell 1988), was maintained in M199 containing 4% FCS, 1% chicken serum, and 1x tryptose phosphate broth. Stable transfectants expressing either human Hox B3 proviral vectors or empty vector (CK) were performed using CaP04, and pools of stable transfectants producing infectious virus were selected in the presence of 200 µg/ml G418 as described ( Stoker and Bissell 1988; Boudreau et al. 1997). To induce angiogenesis, we grafted 5 x 106 Q4dh cells in a volume of 50 µl of medium M199 onto the chick chorioallantoic membranes (CAMs) of 10-day chick SPAFAS pathogen-free chick embryos as previously described ( Boudreau et al. 1997). After 72 h, CAMs were harvested and vascular density, morphology, and immunohistochemical analysis were performed. Angiogenesis was quantitated by counting the number of branch points arising from the tertiary vessels in a 6-mm square area on the underside of the tumors. Measurements were made in 12 samples infected with control virus and 12 samples infected with Hox B3 expressing virus from three separate experiments. Statistical significance was assessed using a paired t test.
Tissue Fixation and Immunofluorescence
CAMs were fixed in situ in 4% paraformaldehyde, embedded in OCT medium, and frozen in a dry ice/ethanol bath and stored at –70°C. 7-µm sections of the CAMS were used for immunohistochemistry. After brief acetone fixation, sections were air-dried and subsequently blocked in PBS containing 2% BSA for 1 h, followed by staining with appropriate antibodies. A 1:200 dilution of a monoclonal anti–his-6 antibody (Boehringer Mannheim Corp.) diluted in PBS containing 0.025% Triton X-100, 0.1% BSA, or a 1:200 dilution of a polyclonal rabbit anti–human antibody against von Willebrand factor were used, followed by incubation for 1 h with FITC-conjugated goat anti–mouse (Cappel Laboratories) or Texas red-conjugated goat anti–rabbit secondary antibody (Calbiochem-Novabiochem Corp.).
| Results |
|---|
|
|
|---|
|
vβ3. In addition, we also observed that blocking either Hox D3 or Hox B3 using antisense did not influence expression of the paralogous genes ( Boudreau et al. 1997; data not shown). Together, these results indicate that the paralogous Hox B3 and Hox D3 genes have distinct effects on EC behavior.
|
|
|
vβ3, show a significantly enhanced ability to migrate in this environment ( Fig. 5 E). These results again emphasize that Hox B3 and Hox D3 specifically modulate expression of different angiogenic effector molecules in cultured EC, which in turn, contribute to different aspects of the angiogenic process.
|
|
|
|
| Discussion |
|---|
|
|
|---|
vβ3, which in turn facilitate endothelial cell migration, adhesion, and invasion, Hox B3 induced expression of ephrin A1 and promoted capillary morphogenesis of sprouting EC. Furthermore, this phenotype was reiterated in vivo as Hox B3 promoted branching and angiogenic behavior, in contrast to the hemangioma-like structures generated by Hox D3 ( Boudreau et al. 1997). Together, these findings support earlier observations made in mice lacking two or more paralogous Hox genes, which suggested that, although individual Hox genes performed distinct functions in a given tissue type, together, paralogous Hox genes acted in concert to more dramatically influence overall tissue phenotype and morphology ( Condie and Capecchi 1994; Manley and Capecchi 1997; Chen and Capecchi 1999). The requirement for Hox B3 during BM-induced capillary morphogenesis appears to stem in large part from regulation of the expression of the ephrin A1 ligand. Although previous studies have linked both Hox A1 and Hox B1 to expression of the ephA2 receptor ( Chen and Ruley 1998; Studer et al. 1998), this is the first report that expression of the ephrin ligands may also be regulated by homeobox genes. It is of interest to note, however, that another ephrin ligand, ephrin B1 (Lerk 2), was identified previously in a screen for retinoic acid-inducible genes ( Bouillet et al. 1995), as retinoic acid is amongst the most potent inducers of anterior class I Homeobox genes known ( Langston and Gudas 1994).
Recent work has established morphoregulatory roles for the large family of ephrin ligands and their tyrosine kinase Eph receptors in both neural pathfinding and vascular development, and angiogenesis (for review see Holder and Klein 1999). In cultured adult EC, the type of ephrin ligand required for BM-induced capillary morphogenesis depends upon the vascular site of origin of the EC. For example, branching morphology in renal microvascular cells requires ephrin B1, whereas capillary morphogenesis of umbilical vein EC depended on the addition of ephrin A1 ( Daniel et al. 1996). Our results using EC derived from the dermal microvasculature indicate that ephrin A1 is a potent mediator of capillary morphogenesis in EC derived from this tissue.
Although interaction with, and subsequent phosphorylation of, a corresponding Eph receptor are required for the morphological effects induced by ephrins, it is not clear whether these interactions enhance EC migration or adhesion, or alternatively induce cellular repulsion (and perhaps promote branching of vascular sprouts), as has been observed with cultured neurons ( Wang and Anderson 1997). One recent report also suggested that ephrin B1 may stimulate migration of renal microvascular EC via activation of
vβ3 integrin-mediated attachment ( Huynh-Do et al. 1999). However, as
vβ3 is not required for adhesion to BM ECM, and blocking
vβ3 does not influence BM-induced capillary morphogenesis in culture, it is unlikely that the ephrin A1-induced morphological changes we observed arose via activation of
vβ3. It is intriguing, however, to consider the possibility that ephrin A1 may activate integrins that mediate EC adhesion to laminin, the major component of BMs required for capillary morphogenesis ( Kubota et al. 1988).
Our results suggest that, in addition to ephrin A1, Hox B3 may also induce expression of other genes that promote capillary morphogenesis. For example, although addition of recombinant ephrin A1 helped restore normal capillary-like morphology in many of the EC lacking Hox B3, a small proportion of cells consistently remained in clusters and failed to elongate or form tubules, despite the intense phosphorylation of the ephA2 receptor that followed addition of ephrin A1. Although the incomplete responsiveness to exogenous ephrin A1 may be attributed to heterogeneity amongst the EC population, it is also worth noting that since Hox genes are considered to be master regulatory mediators ( Botas 1993; Duboule 1998), expression of several, different morphoregulatory genes may be regulated by Hox B3 in EC. Our preliminary results indicate that EC lacking Hox B3 also show decreased expression of laminin β2 (LAMB2; data not shown). A role for this laminin isoform in BM-induced capillary morphogenesis is currently under investigation.
Other potential targets of Hox B3 include the thyroid transcription factor, TTF-1. Studies in HeLa and NIH 3T3 cells showed that TTF-1 expression was specifically activated by Hox B3, but not the paralogous Hox D3 ( Guazzi et al. 1994). Whether TTF-1 is also a target of Hox B3 in EC is not known. Studies that examined the effects of Hox B3 during hematopoietic differentiation indicated that Hox B3 can exhibit distinct effects on different cell populations. For example, whereas overexpression of Hox B3 impaired differentiation of B cells, it also promoted expansion of a subset of granulocyte/macrophage cells ( Savageau et al. 1997). Thus, the Hox genes may exert tissue-specific influences on gene expression. Indeed, our previous work using Hox D3 expressing retrovirus indicated that upregulation of
vβ3 integrin was restricted to endothelial and blood cells, as infected epithelial and fibroblast cells did not express
vβ3 ( Boudreau et al. 1997).
Although compound mutants of the Hox 3 paralogous group have also been generated, the embryonic lethal phenotype makes it impossible to study the contribution of these genes to EC-specific gene expression or angiogenesis in adult organisms ( Manley and Capecchi 1997). Furthermore, as evidence from compound mutants for Hox 9 members indicates, embryonic and adult tissues are differentially effected by the same Hox genes ( Chen and Capecchi 1999) and embryonic and adult angiogenesis may be subject to different modes of regulation ( Bader et al. 1998). These genetic models may not help clarify the role of Hox genes in pathologically induced angiogenesis in differentiated adult EC.
Nonetheless, our findings suggest that the multistep process of neovascularization requires participation from at least two paralogous members of the Hox 3 gene family. Whereas Hox D3 is necessary to initiate vascular sprouting and migration in response to angiogenic stimuli such as bFGF, Hox B3 is subsequently required by sprouting EC to undergo capillary morphogenesis. Whether the combined expression of Hox D3 and Hox B3 will also reveal additional synergistic interactions is currently not known, but is the subject of current investigations in our laboratory.
| Acknowledgments |
|---|
N. Boudreau is recipient of a March of Dimes Basil O'Connor Scholar Award.
Submitted: 13 September 1999
Revised: 19 November 1999
Accepted: 13 December 1999
Abbreviations used in this paper: bFGF, basic fibroblast growth factor; BM, basement membrane; CAM, chick chorioallantoic membrane; EC, endothelial cells; ECM, extracellular matrix; HMEC, human microvascular endothelial cells; HMEC-1, human dermal microvascular endothelial cells; Hox, Homeobox; RT, reverse transcriptase; uPA, urokinase plasminogen activator.
| References |
|---|
|
|
|---|
Adams R.H., Wilkinson G.A., Weiss C., Diella F., Gale N.W., Deutsch U., Risau W. & Klein R.. Roles of ephrin B1 and EphB receptors in cardiovascular developmentdemarcation of arterial venous domains, vascular morphogenesis and sprouting angiogenesis, Genes. Dev, 18, 1999, 2165–2173.
Ades W., Candal F.J., Swerlick R.A., George V.G., Summers S., Bosse D.C. & Lawley T.J.. HMEC-1–establishment of an immortalized human microvascular endothelial cell line, J. Invest. Dermatol, 99, 1992, 683–690 .[Medline]
Bader B.L., Rayburn H., Crowley D. & Hynes R.O.. Extensive vasculogenesis, angiogenesis and organogenesis precede lethality in mice lacking all
v integrins, Cell., 95, 1998, 507–520 .[Medline]
Belotti D., Clausse N., Flagiello D., Alami Y., Daukandt M., Deroanne C., Malfoy B., Boncinelli E., Faiella A. & Castronovo V.. Expression and modulation of homeobox genes from cluster B in endothelial cells, Lab. Invest, 78, 1998, 1291–1299 .[Medline]
Botas J.. Control of morphogenesis and differentiation by Hom/Hox genes, Curr. Opin. Cell Biol, 5, 1993, 1015–1022 .[Medline]
Boudreau N. & Bissell M.J.. Extracellular matrix signalingintegration of form and function in normal and malignant cells, Curr. Opin. Cell Biol, 10, 1998, 640–646 .[Medline]
Boudreau N., Andrews C., Srebrow A., Ravanpay A. & Cheresh D.A.. Hox D3 induces an angiogenic phenotype in endothelial cells, J. Cell Biol, 139, 1997, 257–264 .
Bouillet P., Oulad-Abdelghani M., Vicaire S., Garnier J.-M., Schubaur B., Dolle P. & Chambon P.. Efficient cloning of cDNAs of retinoic acid-responsive genes in P19 embryonal carcinoma cells and characterization of a novel mouse gene Stra1 (mouse Lerk2), Dev. Biol, 170, 1995, 420–433 .[Medline]
Brooks P.C., Montgomery A.M.P., Rosenfeld M., Riesfeld R.A., Hu T., Klier G. & Cheresh D.A.. Integrin
vβ3 antagonists promote tumor regression by inducing apoptosis of angiogenic blood vessels, Cell., 79, 1994, 1157–1164 .[Medline]
Chen F. & Capecchi M.R.. Paralogous mouse Hox genes, Hoxa9, Hoxb9, Hoxd9, function together to control development of the mammary gland in response to pregnancy, Proc. Natl. Acad. Sci. USA., 96, 1999, 541–546 .
Chen J. & Ruley H.E.. An enhancer element in the EphA2 (Eck) gene sufficient for rhombomere-specific expression is activated by Hox A1 and Hox B1 homeobox proteins, J. Biol. Chem, 273, 1998, 24670–24675 .
Cillo C., Faiella A., Cantile M. & Boncinelli E.. Homeobox genes and cancer, Exp. Cell Res, 248, 1999, 1–9 .[Medline]
Condie B.G. & Capecchi M.R.. Mice with targeted disruptions in the paralogous genes hoxa-3 and hoxd-3 reveal synergistic interactions, Nature., 370, 1994, 304–307 .[Medline]
Daniel T.O., Stein E., Cerretti D.P., St P.L., John B., Robert & Abrahamson D.R.. ELK and LERK-2 in developing kidney and microvascular endothelial assembly, Kidney Int. Suppl., 57, 1996, S73–S81 .[Medline]
Duboule D.. Vertebrate hox gene regulationclustering and/or colinearity?, Curr. Opin. Genet. Dev, 8, 1998, 514–518 .[Medline]
Guazzi S., Lonigro R., Pintonello L., Boncinelli E., Di Lauro R. & Mavillo F.. The thyroid transcription factor-1 gene is a candidate target for regulation by Hox proteins, EMBO (Eur. Mol. Biol. Organ.) J, 13, 1994, 3339–3347.[Medline]
Hirschi K.K. & D'Amore P.A.. Pericytes in the microvasculature, Cardiovasc. Res, 32, 1996, 687–698 .[Medline]
Holder N. & Klein R.. Eph receptors and ephrinseffectors of morphogenesis, Development., 126, 1999, 2033–2044 .[Abstract]
Huynh-Do U., Stein E., Lane A.A., Liu H., Cerretti D.P. & Daniel T.O.. Surface densities of ephrin B1 determine EphB-coupled activation of cell attachment through
vβ3 and
5β1 integrins, EMBO (Eur. Mol. Biol. Organ.) J., 18, 1999, 2165–2173.[Medline]
Jones F.S., Chalepakis G., Gruss P. & Edelman G.M.. Activation of the cytotactin promoter by the homeobox containing gene Evx-1, Proc. Natl. Acad. Sci. USA., 89, 1992, 2091–2095 .
Klemke R.L., Cai S., Giannini A.L., Gallagher P.J., De Lanerolle P. & Cheresh D.A.. Regulation of cell motility by mitogen-activated protein kinase, J. Cell Biol., 137, 1997, 481–492 .
Kubota Y., Kleinman H.K., Martin G.R. & Lawley T.J.. Role of laminin and basement membrane in the morphological differentiation of human endothelial cells into capillary-like structures, J. Cell Biol, 107, 1988, 1589–1596 .
Langston A.W. & Gudas L.J.. Retinoic acid and homeobox gene regulation, Curr. Opin. Genet. Dev., 4, 1994, 550–555 .[Medline]
Li C. & Gudas L.J.. Murine laminin B1 gene regulation during the retinoic acid and dibutyrl cAMP induced differentiation of embryonic F9 teratocarcinoma stem cells, J. Biol. Chem, 271, 1996, 6810–6818 .
Lorentz O., Duluc I., De Arcangelis A., Simon-Assman P., Kedinger M. & Freund J.-N.. Key role of the CDX2 homeobox gene in extracellular matrix-mediated intestinal cell differentiation, J. Cell Biol, 139, 1997, 1553–1565 .
Maisonpierre P.C., Suri C., Jones P.F., Bartunkova S., Wiegand S.J., Radziejewski C., Compton D., McClain J., Aldrich T.H. & Papadopoulos N.. Angiopoietin-2, a natural antagonist for Tie2 that disrupts in vivo angiogenesis, Science., 277, 1997, 55–60 .
Manley N.R. & Capecchi M.R.. Hox group 3 paralogous genes act synergistically in the formation of somitic and neural crest-derived structures, Dev. Biol, 192, 1997, 274–288 .[Medline]
Pandey A., Shao H., Marks R.M., Polverini P. & Dixit V.M.. Role of B61, the ligand for the Eck receptor tyrosine kinase in TNF
-induced angiogenesis, Science., 268, 1995, 567–569 .
Patel C.V., Sharangpani R., Bandyopadhyay S. & DiCorleto P.E.. Endothelial cells express a novel, tumor necrosis factor–alpha-regulated variant of HOXA9, J. Biol. Chem, 274, 1999, 1415–1422 .
Savageau G., Thorsteindottir U., Hough M.R., Hugo P., Lawrence H.J., Largman C. & Humphries R.K.. Overexpression of Hox B3 in hematopoietic cells causes defective lymphoid development and progressive myeloproliferation, Immunity, 6, 1997, 13–22 .[Medline]
Stelnicki E.J., Arbeit J., Cass D.L., Saner C., Harrison M. & Largman C.. Modulation of the human homebox genes PRX-2 and HOXB13 in scarless fetal wounds, J. Invest. Dermatol, 111, 1998, 57–63 .[Medline]
Stoker A.W. & Bissell M.J.. Development of avian sarcoma and leukosis virus-based vector packaging cell lines, J. Virol, 62, 1988, 1008–1015 .
Stromblad S. & Cheresh D.A.. Cell adhesion and angiogenesis, Trends Cell Biol, 6, 1996, 462–468 .[Medline]
Studer M., Gavalas A., Marshall H., Ariza-McNaughton L., Rijli F.M., Chambon P. & Krumlauf R.. Genetic interactions between Hox A1 and Hox B1 reveal new roles in regulation of early hindbrain patterning, Development., 125, 1998, 1025–1036 .[Abstract]
Wang H.U. & Anderson D.J.. Eph family transmembrane ligands can mediate repulsive guidance of trunk neural crest migration and motor axon outgrowth, Neuron., 18, 1997, 383–396 .[Medline]
Werb Z., Vu T.H., Rinkenberger J.L. & Coussens L.M.. Matrix-degrading proteases and angiogenesis during development and tumor formation, APMIS., 107, 1999, 11–18 .[Medline]
Xu Y., Swerlick R.A., Sepp N., Bosse D., Ades E.A. & Lawley T.J.. Characterization of expression and modulation of cell adhesion molecules on an immortalized dermal microvascular endothelial cell line (HMEC-1), J. Invest. Dermatol, 102, 1994, 833–837.[Medline]
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|