|
||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
© The Rockefeller University Press,
0021-9525/2000//889 $5.00
The Journal of Cell Biology, Volume 149, Number 4,
, 2000 889-900
Original Article |
Role of Tetanus Neurotoxin Insensitive Vesicle-Associated Membrane Protein (Ti-Vamp) in Vesicular Transport Mediating Neurite Outgrowth
thierry.galli{at}curie.fr
How vesicular transport participates in neurite outgrowth is still poorly understood. Neurite outgrowth is not sensitive to tetanus neurotoxin thus does not involve synaptobrevin-mediated vesicular transport to the plasma membrane of neurons. Tetanus neurotoxin-insensitive vesicle-associated membrane protein (TI-VAMP) is a vesicle-SNARE (soluble N-ethylmaleimide-sensitive fusion protein [NSF] attachment protein [SNAP] receptor), involved in transport to the apical plasma membrane in epithelial cells, a tetanus neurotoxin-resistant pathway. Here we show that TI-VAMP is essential for vesicular transport-mediating neurite outgrowth in staurosporine-differentiated PC12 cells. The NH2-terminal domain, which precedes the SNARE motif of TI-VAMP, inhibits the association of TI-VAMP with synaptosome-associated protein of 25 kD (SNAP25). Expression of this domain inhibits neurite outgrowth as potently as Botulinum neurotoxin E, which cleaves SNAP25. In contrast, expression of the NH2-terminal deletion mutant of TI-VAMP increases SNARE complex formation and strongly stimulates neurite outgrowth. These results provide the first functional evidence for the role of TI-VAMP in neurite outgrowth and point to its NH2-terminal domain as a key regulator in this process.
Key Words: membrane traffic neurite outgrowth SNAREs TI-VAMP SNAP25
© 2000 The Rockefeller University Press
| Introduction |
|---|
|
|
|---|
Membrane traffic can be envisioned as a succession of vesicle budding, maturation, vectorial transport, tethering, docking, and lipid bilayer fusion events. Vesicular transport to and fusion at the plasma membrane, i.e., exocytosis, is responsible for the release of soluble compounds, such as neurotransmitters in the extracellular medium, and for surface expression of plasma membrane proteins and lipids. Overwhelming evidence accumulated over the last years shows that soluble N-ethylmaleimide–sensitive fusion protein (NSF) attachment protein (SNAP) receptors (SNAREs) are key proteins of membrane traffic, most likely involved in lipid bilayer fusion (Weber et al. 1998; Nickel et al. 1999; Parlati et al. 1999; Bock and Scheller 1999). Clostridial neurotoxins (NTs) carry a proteolytic activity, which selectively cleaves defined SNAREs. Hence they have been extensively used to demonstrate the involvement of NT-sensitive SNAREs in vesicular transport (for review, see Johannes and Galli 1998).
Surprisingly, several exocytotic pathways are resistant to NTs, particularly to tetanus neurotoxin (TeNT), which cleaves several members of the synaptobrevin (also called vesicle-associated membrane protein, VAMP) family of SNAREs. TeNT resistance of the transport to the apical plasma membrane, in epithelial cells, was originally interpreted as the occurrence of SNARE-independent exocytosis (Ikonen et al. 1995; Simons and Ikonen 1997). A breakthrough resulted from the cloning of synaptobrevin-like gene 1 (D'Esposito et al. 1996) and the finding that its product is insensitive to TeNT and Botulinum NTs (BoNTs) B, D, F, and G (Galli et al. 1998). This protein, called TeNT-insensitive VAMP (TI-VAMP) or VAMP7, forms apical SNARE complexes and mediates fusion of vesicles with the apical plasma membrane (Galli et al. 1998; Lafont et al. 1999). It is also present in the degradation pathway of EGF in fibroblasts (Advani et al. 1999). TI-VAMP is a likely candidate for vesicle SNARE (v-SNARE) of NT-resistant exocytotic pathways. Interestingly, neurite outgrowth is resistant to TeNT, thus does not involve synaptobrevin and synaptic vesicles (SVs; Osen-Sand et al. 1996; AhnertHilger et al. 1996). Genetic evidences confirm this. First, in fly and nematode, elimination of the neuronal synaptobrevin leads to severe impairment of neurotransmitter release but has no effect on neurite outgrowth (Deitcher et al. 1998; Nonet et al. 1998). Second, neurite outgrowth is normal in a PC12 clone lacking synaptobrevins 1 and 2 (Leoni et al. 1999). In a previous study, we have shown that TI-VAMP–containing vesicular compartment excludes synaptobrevin 2 and other markers of well-characterized exocytic and endocytic compartments and it concentrates in the leading edge of axonal and dendritic processes in hippocampal neurons in primary culture (Coco et al. 1999). In this paper, we show that TI-VAMP fulfills the criteria to be the v-SNARE implicated in neurite outgrowth.
| Materials and Methods |
|---|
|
|
|---|
Cell Culture
PC12 cells were cultured in RPMI supplemented with 10% horse serum (HS) and 5% FCS as described (Greene and Tischler 1976). Cells were plated either on collagen-coated plastic dishes or on poly-L-lysine plus collagen-coated glass coverslips (Chilcote et al. 1995). HeLa cells were cultured in DME supplemented with 10% FCS.
DNA constructions: for production of NH2-terminal GFP fusion proteins, the distinct cDNAs were cloned into the pEGFP-C3 vector (CLONTECH Laboratories, Inc.). The same empty vector was also used as a control in some of the neurite outgrowth assays. Full-length TI-VAMP (TIVAMP), NH2-terminal domain-TIVAMP (Nter-TIVAMP, from M to N120), cytosolic domain-TIVAMP (Cyt-TIVAMP, from M to K188),
NH2-terminal domain-TIVAMP (
Nter-TIVAMP, from M102 to the end), and full-length synaptobrevin 2 (Sb2), were obtained by PCR using standard procedures and the following sets of oligonucleotides: 5'-ATGGCGATTCTTTTTGCTGTTGTTGCC-3' and 5'-CTATTTCTTCACACAGCTTGGCCATGT-3' for TIVAMP; 5'-ATGGCGATTCTTTTTGCTGTTGTTGCC-3' and 5'-CTTATTCTCAGAGTGATGCTTCAG-CTG-3' for Nter-TIVAMP; 5'-ATGGCGATTCTTTTTGCTGTTGTTGCC-3' and 5'-ATCCTACTTGAGGTTCTTCATACACATGGCTC for Cyt-TIVAMP; 5'-ATGAATAGCGAGTTCTCAAGTGTCTTA-3' and 5'-CTATTTCTTCACACAGCTTGGCCATGT-3' for
Nter-TIVAMP; 5'-ATGTCGGCTACCGCTGCCACCGTCCCG-3' and 5'- TTAAGAGCTGAAGTAAACTATGATGAT for Sb2. TIVAMP, Nter-TIVAMP, Cyt-TIVAMP, and Sb2 were cloned in pEGFP-C3 using the KpnI-XbaI sites, while
Nter-TIVAMP was cloned in HindIII-XbaI sites.
For production of the COOH-terminal GFP (ratiometic pHLuorin in this case) fusion protein of TI-VAMP, TI-VAMP cDNA bearing a BamHI site in its 3' was obtained by PCR using the 5'-GGATCCTTTCTTCACACAGCTTGGCCA-3' and 5'-CTATTTCTTCACACAGCTTGGCCATGT-3' oligonucleotides, and cloned in the pCR3.1-Uni vector (CLONTECH Laboratories, Inc.). Ratiometric pHLuorin was then cloned in the BamHI-EcoRI sites. Nter-TIVAMP, Cyt-TIVAMP, and coiled-coiled domain of TIVAMP (CC-TIVAMP; from E119 to K188) were fused to GST gene by cloning in pGEX4T vector (Amersham Pharmacia Biotech).
Overlay Assay
The corresponding GST fusion proteins and GST alone were produced and purified as described (Galli et al. 1998). 6xhis-tagged SNAP25A (6xhisSNAP25, bacterial strain was a generous gift from G. Schiavo, ICRF, London, UK) was purified as described (Weber et al. 1998). 6xhisSNAP25 was run on SDS-PAGE and Western blotted onto Immobilon-P membrane (Millipore). The amount of 6xhisSNAP25 corresponds to 1.25 µg/mm of membrane. 4-mm strips of the membrane were cut and incubated in 150 mM NaCl, 5% nonfat dry milk, 50 mM phosphate, pH 7.5, for buffer for 1 h at room temperature. The strips were then incubated with 10 nM of the GST fusion proteins overnight at 4°C in buffer B (3% BSA, 0.1% Tween 20, 20 mM Tris, pH 7.5) containing 1 mM DTT. The strips were rinsed three times in buffer B at room temperature, incubated with anti-GST antibodies in buffer B for 1 h, rinsed in buffer B three times and incubated with alkaline phosphatase-coupled sheep anti–mouse antibodies. The detection was carried out simultaneously for all the strips, for the same time, using a kit from Promega.
Cell Transfection
PC12 or HeLa cells were trypsinized, washed, and resuspended at a density of 7.5–10 x 106 cells/ml in Optimix (Equibio). Electroporation was performed with 10 µg DNA in a final volume of 0.8 ml cell suspension using a Gene Pulser II device (Bio-Rad) with one shock at 950 µF and 250 V. When GFP was cotransfected with TeNT or BoNTE for monitoring the transfected cells, the plasmid carrying the GFP gene was added at double concentration in order to ensure that all the cells that uptake it also uptake the plasmid carrying the toxin. Immediately after electroporation, cells were washed with 5 ml of complete medium before plating them for immunoprecipitation or immunofluorescence microscopy analysis. 5 h later, the outgrowth medium was removed and replaced with fresh medium containing 100 nM staurosporine (Sigma-Aldrich). PC12 and HeLa cells were processed 24 or 48 h after transfection, respectively. For enhanced expression of the exogenous proteins, 5 mM sodium butyrate was added in all the cases during the last 6 h before processing the cells.
Antibody Uptake Assay
PC12 cells processed as indicated above were incubated in the presence of 5 µg/ml anti-GFP antibody in culture medium for 15 min on ice, 15 min on ice then 15 min at 37°C, or 15 min on ice then 60 min at 37°C, 24 h after transfection with GFP-TIVAMP or TIVAMP-GFP. The cells were then washed twice with culture medium and twice with PBS, fixed with PFA, and processed for immunofluorescence.
Immunocytochemistry
Cells were fixed with 4% PFA and processed for immunofluorescence as previously described (Coco et al. 1999). Optical conventional microscopy was performed on a Leica microscope equipped with a MicroMax CCD camera (Princeton Instruments). Confocal laser scanning microscopy was performed using a TCS confocal microscope (Leica). Images were assembled without modification using Adobe Photoshop.
Neurite Outgrowth Assay
Cells were fixed 24 h after transfection. Between 20 and 100 randomly chosen fields for each condition were taken with a MicroMax CCD camera (Princeton Instruments), resulting in the analysis of at least 50 GFP-positive cells. A neurite was defined as a thin process longer than 5 µm. Using the Metamorph software (Princeton Instruments) two parameters were scored in each case: the number of neurites per cell (from 0 to 4 or more neurites), and the length of each neurite, from the cell body limit until the tip of the process. The obtained data were analyzed for their statistical significance with SigmaStat (SPSS, Inc.). All the recordings and the Metamorph analysis were done in blind.
Videomicroscopy
Living PC12 cells transfected and treated with staurosporine as described above were placed in complete medium in an appropriate chamber equilibrated at 37°C and 5% CO2. Cells were monitored with a MicroMax CCD camera (Princeton Instruments) for as much as 9 h, taking images both through phase contrast and FITC fluorescence every 2 min or every 15 s. Images were assembled using Metamorph (Princeton Instruments).
Immunoprecipitation
Immunoprecipitation from rat brain was performed using a Triton X-100–soluble membrane fraction prepared as follows: two adult rat brains were homogenized with a glass/teflon homogenizer (9 strokes at 900 rpm) in 25 ml of 0.32 M sucrose containing a protease inhibitor cocktail. All the steps were carried out at 4°C. After 10 min centrifugation at 800 g the supernatant was centrifuged at 184,000 g for 1 h, obtaining a cytosolic and a membrane fraction in the supernatant and the pellet, respectively. The pellet was resuspended in TSE (50 mM Tris, pH 8.0, 0.5 mM EDTA, and 150 mM NaCl) containing 1% Triton X-100 for 30 min and finally the insoluble material was removed by centrifugation at 184,000 g for 1 h. Immunoprecipitation with anti-SNAP25 antibodies and mouse control IgGs was performed from 2 mg of proteins from the soluble extract. Immunoprecipitations from transfected PC12 or HeLa cells were performed using a total Triton X-100–soluble fraction prepared as follows: after two washes with cold TSE, cells were lysed for 1 h under continuous shaking with TSE containing 1% Triton X-100 and protease inhibitors. The supernatant resulting from centrifugation at 20,000 g for 30 min was used for immunoprecipitation. After overnight incubation of the brain and cell extracts with the antibodies, 50 µl of magnetic beads (Dynabeads; Dynal) were added for 2–4 h. The magnetic beads were washed four times with TSE containing 1% Triton X-100, eluted with gel sample buffer and the eluates were boiled for 5 min and run on SDS-PAGE gels (Schagger and von Jagow 1987).
Online Supplemental Material
To better visualize GFP-TIVAMP dynamics in staurosporine-differentiated PC12 cells, we advise the reader to consult the supplementary video available online at http://www.jcb.org/cgi/content/full/149/4/889/DC1. This video corresponds to the same GFP-TIVAMP–expressing cell as presented in Fig. 2, shown here during a longer period of time (6 h), with images taken every 2 min (8 images/s). The movie shows the dynamics of GFP-TIVAMP (bottom) in the course of neurite outgrowth (as seen by transmission light [TL], top). Note that most movements of GFP-TIVAMP–containing vesicles are anterograde.
|
| Results |
|---|
|
|
|---|
|
|
|
Protein sequence analysis of TI-VAMP shows that the protein has an original NH2-terminal (Nter) domain of 120 amino acids, located upstream of the coiled-coiled domain (also called R-SNARE motif; Galli et al. 1998; Jahn and Sudhof 1999). This Nter domain includes three regions predicted to be
helical by Hydrophobic Cluster Analysis (Callebaut et al. 1997) and Jpred (Cuff et al. 1998; data not shown). This is reminiscent of the Nter domain of syntaxin 1, which comprises 3
helices (Fernandez et al. 1998) and inhibits lipid bilayer fusion (Parlati et al. 1999). The Nter domain of Sso1p, the yeast homologue of syntaxin 1, inhibits the rate of SNARE complex formation (Nicholson et al. 1998). Similar Nter domains are present in the other plasma membrane but not in intracellular syntaxins (Fernandez et al. 1998), indicating that this function may be specific for exocytosis. This led us to prepare the following GST fusion proteins: full cytoplasmic domain of TI-VAMP (GST-Cyt-TIVAMP), coiled-coiled domain alone (GST-CC-TIVAMP), and Nter domain alone (GST-Nter-TIVAMP; Fig. 4 B), and to measure the binding of the corresponding proteins to immobilized 6xhis-SNAP25 in an overlay assay. GST-CC-TIVAMP bound very efficiently immobilized his-SNAP25 whereas GST-Cyt-TIVAMP bound very poorly. As controls, GST alone and GST-Nter-TIVAMP did not bind immobilized his-SNAP25 (Fig. 4 C). To perform in vivo experiments, we constructed the following GFP-tagged forms of TI-VAMP: TI-VAMP deleted of its Nter domain (GFP-
Nter-TIVAMP) and Nter domain alone (GFP-Nter-TIVAMP; Fig. 4 B). HeLa cells do not express endogenous SNAP25, so we used them to study the association of SNAP25 with GFP-TIVAMP, GFP-
Nter-TIVAMP, GFP-Nter-TIVAMP (Fig. 4 B), or GFP, in vivo, after cotransfection. We measured the amount of GFP-tagged proteins coimmunoprecipitating with SNAP25 from Triton X-100–soluble extracts. GFP-
Nter-TIVAMP formed more abundant SNAP25-containing SNARE complexes than GFP-TIVAMP. As controls, GFP and GFP-Nter-TIVAMP did not bind SNAP25 (Fig. 4 D). Altogether, we propose that the Nter domain exerts an intramolecular inhibition of the SNARE complex formation activity of TI-VAMP's coiled-coiled domain.
TI-VAMP Mediates Neurite Outgrowth
An assay was set up to measure the effect of transfection of NTs and TI-VAMP mutants on staurosporine-induced neurite outgrowth in PC12 cells. First, we showed that when cells were electroporated with two plasmids, virtually all cells expressed both transgenes. This was demonstrated by transfection with GFP-cellubrevin (GFP-Cb) alone, TeNT alone, or both. Cotransfection of TeNT with GFP-Cb resulted in total proteolysis of GFP-Cb (not shown). Second, the activities of transfected TeNT and BoNT E were demonstrated by complete proteolysis of endogenous synaptobrevin 2 and SNAP25, respectively (not shown).
In a first set of experiments, PC12 cells were transfected with GFP alone, GFP plus TeNT, GFP plus BoNT E or GFP-Nter-TIVAMP. The cells were then treated with staurosporine and fixed after 24 h. Fig. 5 A shows a representative field observed in each condition. Neurites from cells transfected with GFP or GFP plus TeNT were similar to neurites from untransfected cells. Neurites from cells transfected with GFP plus BoNT E or GFP-Nter-TIVAMP were fewer and shorter. The length of neurites and the number of neurites per cell were measured in each GFP-positive cell, in each condition. GFP plus TeNT had no effect on neurite number and length compared with GFP alone. BoNT E reduced by 45% the number of neurites longer than 20 µm and strongly increased the number of cells without neurites (Fig. 5B and Fig. C). Expression of the Nter domain of TI-VAMP had an effect that was similar to that of BoNT E. GFP-Nter-TIVAMP reduced by 42% the number of neurites longer than 20 µm and strongly increased the number of cells without neurites (Fig. 5B and Fig. C). The effects of GFP plus BoNT E and GFP-Nter-TIVAMP were statistically different from GFP alone with P = 0.027 and 0.017 (Student's t test), respectively. The effects of BoNT E and GFP-Nter-TIVAMP were not additive (not shown), indicating that they act on the same exocytotic mechanism. In a different set of experiments, we measured the effect of GFP and the cytoplasmic domain (Nter and coiled-coiled domains) of TI-VAMP fused to GFP (GFP-Cyt-TIVAMP, Fig. 4 B). GFP-Cyt-TIVAMP (neurites longer than 20 µm: 50.2% ± 0.25) had no effect on neurite length compared with GFP (neurites longer than 20 µm: 50.7% ± 3.5). GFP-Cyt-TIVAMP had no effect on the number of neurites per cell (not shown). These results demonstrated that neurite outgrowth in staurosporine-treated cells is insensitive to TeNT but sensitive to BoNT E as in neurons. The fact that GFP-Nter-TIVAMP inhibited neurite outgrowth as strongly as BoNT E suggests that TI-VAMP plays a major role in neurite outgrowth.
|
|
Nter-TIVAMP expression and compared it with that of GFP-TIVAMP on neurite outgrowth. We observed the occurrence of unusually long neurites with an increased number of filopodia. Staining of actin filaments with fluorescent phalloidin showed that the neurites of GFP-
Nter-TIVAMP–transfected cells showed cortical actin localization similar to GFP-TIVAMP–transfected cells (Fig. 7 A). The pattern of staining of tubulin, synaptobrevin 2, synaptotagmin I, SNAP25, and syntaxin 1 was the same in GFP-
Nter-TIVAMP as in GFP-TIVAMP–transfected and in untransfected cells (data not shown). The effect of GFP-
Nter-TIVAMP was quantified as in the case of GFP-Nter-TIVAMP. GFP-
Nter-TIVAMP expression doubled the number of neurites longer than 30 µm and multiplied by 5 the number of neurites longer than 50 µm when compared with the expression of GFP-TIVAMP (Fig. 7 B). GFP-TIVAMP had no effect on neurite length and number per cell compared with GFP alone (not shown). We observed no effect of GFP-
Nter-TIVAMP on the number of neurites per cell (not shown). We checked that GFP-
Nter-TIVAMP formed more abundant SNARE complexes with endogenous SNAP25 by measuring the amount of SNAP25 and syntaxin 1 that was coimmunoprecipitated with GFP-
Nter-TIVAMP, GFP-TIVAMP, and GFP-Sb2. GFP-
Nter-TIVAMP–SNAP25 complex was 2.5 times more abundant than GFP-TIVAMP–SNAP25. Accordingly, GFP-
Nter-TIVAMP coimmunoprecipitated more syntaxin 1 than GFP-TIVAMP (Fig. 7 C). These results showed that a form of TI-VAMP, which had a higher SNARE complex formation activity, strongly enhanced neurite outgrowth.
|
| Discussion |
|---|
|
|
|---|
A main conclusion from our work is that TI-VAMP is involved in neurite outgrowth in PC12 cells. Our finding that TI-VAMP interacts with SNAP25 in PC12 cells and in the brain is consistent with the involvement of SNAP25 in neurite outgrowth (Osen-Sand et al. 1993, Osen-Sand et al. 1996). The TI-VAMP–dependent vesicular transport mediating neurite outgrowth in PC12 cells likely corresponds to the outgrowth of axons and dendrites in developing neurons. Indeed, TI-VAMP concentrates in the leading edge of axonal and dendritic growth cones of hippocampal neurons in primary culture (Coco et al. 1999). In support of this conclusion, preliminary experiments have shown a decreased number of neurites in young hippocampal neurons, which were microinjected with anti-TIVAMP antibodies (Coco, S., M. Matteoli, and T. Galli, unpublished observations). Neurite outgrowth may be also very active in differentiated neurons because it may participate to post-synaptic morphological changes related to plasticity and learning (MaleticSavatic et al. 1999). A role for SNAP25 in neuronal plasticity and learning has been proposed (Catsicas et al. 1994; Boschert et al. 1996). Therefore, the TI-VAMP– and SNAP25-dependent vesicular transport mechanism described here could also mediate activity-dependent exocytosis involved in dendrite elongation and post-synaptic receptor expression at the plasma membrane in mature neurons (MaleticSavatic et al. 1999; Noel et al. 1999; Shi et al. 1999). This could account for the distribution of TI-VAMP–containing vesicles throughout the dendrites (Coco et al. 1999) and of SNAP25 in the dendritic plasma membrane (Galli et al. 1995; Garcia et al. 1995) of mature neurons.
In a previous study, we proposed that TI-VAMP defines a novel tubulovesicular compartment, which excludes SV and endosomal markers, partially overlaps with CD63 and could correspond to a constitutive-like secretory compartment in neuronal cells (Coco et al. 1999). Interestingly, CD63 was recently found in Weibel-Palade bodies, which secrete von Willebrand factor and transport P-selectin, in endothelial cells (Kobayashi et al. 2000). In fibroblasts, TI-VAMP partially overlaps with lysosome-associated membrane protein 1 (LAMP1) and antibodies against TI-VAMP inhibit the degradation of EGF (Advani et al. 1999). These findings together with the present data showing that TI-VAMP mediates neurite outgrowth could be in favor of the involvement of TI-VAMP in constitutive-like secretion in neurons, a pathway related to secretory lysosomes in non-neuronal cells. Indeed, some of the constitutive secretory proteins are targeted to immature secretory granules in neuronal cells. Then, they are removed from maturing granules and sent to immature secretory granule-derived vesicles, together with lysosomal enzymes. Immature secretory granule-derived vesicles reach the plasma membrane and release their content in the extracellular medium thus defining a constitutive-like secretory pathway in neuronal cells (Thiele et al. 1997). Future studies should aim to determine which cargo proteins and lipids TI-VAMP–containing vesicles transport in neurons. According to our working hypothesis, the proteic and lipidic map of TI-VAMP vesicular compartment is likely to identify factors, which are important for neurite elongation both in developing and mature neurons. The purification of TI-VAMP vesicular compartment will also be important to determine which other proteins are involved in this pathway, particularly rab proteins that have been shown to play a role in neurite outgrowth (Ayala et al. 1990; Huber et al. 1995).
The mechanism of action of the NH2-terminal domain of TI-VAMP has not been yet fully resolved but it is reminiscent of the inhibitory effects of NH2-terminal domains of Sso1p and syntaxin 1. NH2-terminal deletion mutant of Sso1p has an increased SNARE complex formation rate. The NH2-terminal domain of Sso1p binds to its SNARE motif and inhibits SNARE complex formation in vitro, thus acting as an intramolecular inhibitor of the SNARE motif (Nicholson et al. 1998). Removal of the NH2-terminal domain of syntaxin 1 decreases SNARE-dependent liposome fusion half time from 40 to 10 min. In this case, no effect is observed on SNARE complex formation rate (Parlati et al. 1999). We found that the cytoplasmic domain of TI-VAMP, which comprises the NH2-terminal domain plus the R-SNARE motif, had no effect on neurite outgrowth, whereas the NH2-terminal domain alone strongly inhibited it. This demonstrates that the full cytoplasmic domain is inactive in vivo. The coiled-coiled domain of TI-VAMP bound more efficiently SNAP25 than the cytoplasmic domain by overlay assay. Therefore, our observations would favor a model in which the NH2-terminal domain of TI-VAMP inhibits the capacity of the R-SNARE motif to form SNARE complexes and promote fusion, maybe because the NH2-terminal domain folds over the R-SNARE motif or by a yet unknown mechanism. Cytosolic or membrane proteins can be expected to act on the NH2-terminal domain of TI-VAMP to permit fusion at maximal rate. The inhibitory effect on neurite outgrowth resulting from expression of the NH2-terminal domain of TI-VAMP could be due to the sequestration of such factor(s). Conversely, the activatory effect of the
Nter-TIVAMP could be explained by the fact that it bypassed control by such factors. Hence, identifying the signal transduction pathway(s) and factors, able to activate TI-VAMP, will be of crucial importance to further understand how neurite outgrowth is controlled.
Finally, our finding that the NH2-terminal domain of TI-VAMP plays an important function in the control of neurite outgrowth, suggests that this protein is a potential target of pharmacological agents that could modulate the activity of TI-VAMP by releasing the inhibition of this domain. Such agents could specifically activate TI-VAMP–mediated exocytosis thus stimulate neurite outgrowth. Once identified, such drugs could be used in the treatment of nerve traumatisms such as spinal cord injury.
| Acknowledgments |
|---|
S. Martinez-Arca is a recipient of a post-doctoral fellowship from Fondation pour la Recherche Médicale. This work was supported in part by Action Concertée Incitative-Jeunes Chercheurs (no. 5254) from the Ministère de la Recherche et des Technologies to T. Galli.
Submitted: 29 February 2000
Revised: 7 April 2000
Accepted: 11 April 2000
The online version of this article contains supplemental material.
Nter-TIVAMP,
NH2-terminal domain-TIVAMP; BoNTs, Botulinum NTs; Cyt-TIVAMP, cytosolic domain-TIVAMP; GFP, green fluorescent protein; GFP-Cb, GFP-cellubrevin; GST, glutathione-S-transferase; LAMP1, lysosome-associated membrane protein 1; NSF, N-ethylmaleimide–sensitive fusion protein; NTs, neurotoxins; Nter-TIVAMP, NH2-terminal domain-TIVAMP; SNAP, NSF attachment protein; SNARE, SNAP receptors; SVs, synaptic vesicles; TeNT, tetanus neurotoxin; TeNT-LC, TeNT light chain; TI-VAMP, TeNT-insensitive VAMP; t-SNARE, target SNARE; VAMP, vesicle-associated membrane protein; v-SNARE, vesicle SNARE.
| References |
|---|
|
|
|---|
Advani R.J. Yang B. Prekeris R. Lee K.C. Klumperman J. Scheller R.H. VAMP-7 mediates vesicular transport from endosomes to lysosomes, J. Cell Biol. 146, 1999 765–775.
AhnertHilger G. Kutay U. Chahoud I. Rapoport T. Wiedenmann B. Synaptobrevin is essential for secretion but not for the development of synaptic processes, Eur. J. Cell Biol. 70, 1996 1–11.[Medline]
Ayala J. Touchot N. Zahraoui A. Tavitian A. Prochiantz A. The product of rab2, a small GTP binding protein, increases neuronal adhesion, and neurite growth in vitro, Neuron. 4, 1990 797–805.[Medline]
Bock J.B. Scheller R.H. SNARE proteins mediate lipid bilayer fusion, Proc. Natl. Acad. Sci. USA. 96, 1999 12227–12229.
Boschert U. O'Shaughnessy C. Dickinson R. Tessari M. Bendotti C. Catsicas S. Pich E.M. Developmental and plasticity-related differential expression of two SNAP-25 isoforms in the rat brain, J. Comp. Neurol. 367, 1996 177–193.[Medline]
Bradke F. Dotti C.G. Neuronal polarityvectorial cytoplasmic flow precedes axon formation, Neuron. 19, 1997 1175–1186.[Medline]
Callebaut I. Labesse G. Durand P. Poupon A. Canard L. Chomilier J. Henrissat B. Mornon J.P. Deciphering protein sequence information through hydrophobic cluster analysis (HCA)current status and perspectives, Cell Mol. Life Sci. 53, 1997 621–645.[Medline]
Catsicas S. Grenningloh G. Pich E.M. Nerve-terminal proteinsto fuse to learn, Trends Neurosci. 17, 1994 368–373.[Medline]
Chilcote T.J. Galli T. Mundigl O. Edelmann L. McPherson P.S. Takei K. De Camilli P. Cellubrevin and synaptobrevinssimilar subcellular localization and biochemical properties in PC12 cells, J. Cell Biol. 129, 1995 219–231.
Coco S. Raposo G. Martinez S. Fontaine J.J. Takamori S. Zahraoui A. Jahn R. Matteoli M. Louvard D. Galli T. Subcellular localization of tetanus neurotoxin-insensitive vesicle-associated membrane protein (VAMP)/VAMP7 in neuronal cellsEvidence for a novel membrane compartment, J. Neurosci. 19, 1999 9803–9812.
Cuff J.A. Clamp M.E. Siddiqui A.S. Finlay M. Barton G.J. JPreda consensus secondary structure prediction server, Bioinformatics. 14, 1998 892–893.
D'Esposito M. Ciccodicola A. Gianfrancesco F. Esposito T. Flagiello L. Mazzarella R. Schlessinger D. D'Urso M. A synaptobrevin-like gene in the Xq28 pseudoautosomal region undergoes X inactivation, Nat. Genet. 13, 1996 227–229.[Medline]
Deitcher D.L. Ueda A. Stewart B.A. Burgess R.W. Kidokoro Y. Schwarz T.L. Distinct requirements for evoked and spontaneous release of neurotransmitter are revealed by mutations in the Drosophila gene neuronal-synaptobrevin, J. Neurosci. 18, 1998 2028–2039.
Fernandez I. Ubach J. Dulubova I. Zhang X.Y. Sudhof T.C. Rizo J. Three-dimensional structure of an evolutionarily conserved N-terminal domain of syntaxin 1A, Cell. 94, 1998 841–849.[Medline]
Futerman A.H. Banker G.A. The economics of neurite outgrowth—the addition of new membrane to growing axons, Trends Neurosci. 19, 1996 144–149.[Medline]
Galli T. Garcia E.P. Mundigl O. Chilcote T.J. DeCamilli P. v- and t-SNAREs in neuronal exocytosisa need for additional components to define sites of release, Neuropharmacol. 34, 1995 1351–1360.[Medline]
Galli T. Zahraoui A. Vaidyanathan V.V. Raposo G. Tian J.M. Karin M. Niemann H. Louvard D. A novel tetanus neurotoxin-insensitive vesicle-associated membrane protein in SNARE complexes of the apical plasma membrane of epithelial cells, Mol. Biol. Cell. 9, 1998 1437–1448.
Garcia E.P. McPherson P.S. Chilcote T.J. Takei K. De Camilli P. rbSec1A and B colocalize with syntaxin 1 and SNAP-25 throughout the axon, but are not in a stable complex with syntaxin, J. Cell Biol. 129, 1995 105–120.
Greene L.A. Tischler A.S. Establishment of a noradrenergic clonal line of rat adrenal pheochromocytoma cells which respond to nerve growth factor, Proc. Natl. Acad. Sci. USA. 73, 1976 2424–2428.
Huber L.A. Dupree P. Dotti C.G. A deficiency of the small GTPase rab8 inhibits membrane traffic in developing neurons, Mol. Cell Biol. 15, 1995 918–924.[Abstract]
Ikonen E. Tagaya M. Ullrich O. Montecucco C. Simons K. Different requirements for NSF, SNAP, and rab proteins in apical and basolateral transport in MDCK cells, Cell. 81, 1995 571–580.[Medline]
Jahn R. Sudhof T.C. Membrane fusion and exocytosis, Annu. Rev. Biochem. 68, 1999 863–911.[Medline]
Johannes L. Galli T. ExocytosisSNAREs drum up, Eur. J. Neurosci. 10, 1998 415–422.[Medline]
Kobayashi T. Vischer U.M. Rosnoblet C. Lebrand C. Lindsay M. Parton R.G. Kruithof E.K.O. Gruenberg J. The tetraspanin CD63/lamp3 cycles between endocytic and secretory compartments in human endothelial cells, Mol. Biol. Cell. 11, 2000 1829–1843.
Lafont F. Verkade P. Galli T. Wimmer C. Louvard D. Simons K. Raft association of SNAP receptors acting in apical trafficking in Madin-Darby canine kidney cells, Proc. Natl. Acad. Sci. USA. 96, 1999 3734–3738.
Leoni C. Menegon A. Benfenati F. Toniolo D. Pennuto M. Valtorta F. Neurite extension occurs in the absence of regulated exocytosis in PC12 subclones, Mol. Biol. Cell. 10, 1999 2919–2931.
Li S.H. Cheng A.L. Li H. Li X.J. Cellular defects and altered gene expression in PC12 cells stably expressing mutant huntingtin, J. Neurosci. 19, 1999 5159–5172.
Luckenbill-Edds L. Van Horn C. Greene L.A. Fine structure of initial outgrowth of processes induced in a pheochromocytoma cell line (PC12) by nerve growth factor, J. Neurocytol. 8, 1979 493–511.[Medline]
MaleticSavatic M. Malinow R. Svoboda K. Rapid dendritic morphogenesis in CA1 hippocampal dendrites induced by synaptic activity, Science. 283, 1999 1923–1927.
Nicholson K.L. Munson M. Miller R.B. Filip T.J. Fairman R. Hughson F.M. Regulation of SNARE complex assembly by an N-terminal domain of the t-SNARE Sso1p, Nat. Struct. Biol. 5, 1998 793–802.[Medline]
Nickel W. Weber T. McNew J.A. Parlati F. Sollner T.H. Rothman J.E. Content mixing and membrane integrity during membrane fusion driven by pairing of isolated v-SNAREs and t-SNAREs, Proc. Natl. Acad. Sci. USA. 96, 1999 12571–12576.
Noel J. Ralph G.S. Pickard L. Williams J. Molnar E. Uney J.B. Collingridge G.L. Henley J.M. Surface expression of AMPA receptors in hippocampal neurons is regulated by an NSF-dependent mechanism, Neuron. 23, 1999 365–376.[Medline]
Nonet M.L. Saifee O. Zhao H.J. Rand J.B. Wei L.P. Synaptic transmission deficits in Caenorhabditis elegans synaptobrevin mutants, J. Neurosci. 18, 1998 70–80.
Osen-Sand A. Catsicas M. Staple J.K. Jones K.A. Ayala G. Knowles J. Grenningloh G. Catsicas S. Inhibition of axonal growth by SNAP-25 antisense oligonucleotides in vitro and in vivo, Nature. 364, 1993 445–448.[Medline]
Osen-Sand A. Staple J.K. Naldi E. Schiavo G. Rossetto O. Petitpierre S. Malgaroli A. Montecucco C. Catsicas S. Common and distinct fusion proteins in axonal growth and transmitter release, J. Comp. Neurol. 367, 1996 222–234.[Medline]
Parlati F. Weber T. McNew J.A. Westermann B. Sollner T.H. Rothman J.E. Rapid and efficient fusion of phospholipid vesicles by the alpha-helical core of a SNARE complex in the absence of an N-terminal regulatory domain, Proc. Natl. Acad. Sci. USA. 96, 1999 12565–12570.
Prochiantz A. Neuronal polaritygiving neurons heads and tails, Neuron. 15, 1995 743–746.[Medline]
Schagger H. von Jagow G. Tricine-sodium dodecyl sulfate-polyacrylamide gel electrophoresis for the separation of proteins in the range from 1 to 100 kDa, Anal. Biochem. 166, 1987 368–379.[Medline]
Shi S.H. Hayashi Y. Petralia R.S. Zaman S.H. Wenthold R.J. Svoboda K. Malinow R. Rapid spine delivery and redistribution of AMPA receptors after synaptic NMDA receptor activation, Science. 284, 1999 1811–1816.
Simons K. Ikonen E. Functional rafts in cell membranes, Nature. 387, 1997 569–572.[Medline]
Thiele C. Gerdes H.H. Huttner W.B. Protein secretionpuzzling receptors, Curr. Biol. 7, 1997 R496–R500.[Medline]
Weber T. Zemelman B.V. McNew J.A. Westermann B. Gmachl M. Parlati F. Sollner T.H. Rothman J.E. SNAREpinsminimal machinery for membrane fusion, Cell. 92, 1998 759–772.[Medline]
Yao R. Yoshihara M. Osada H. Specific activation of a c-Jun NH2-terminal kinase isoform and induction of neurite outgrowth in PC-12 cells by staurosporine, J. Biol. Chem. 272, 1997 18261–18266.
Related Article
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|