|
||
© The Rockefeller University Press,
0021-9525/2000//1107 $5.00
The Journal of Cell Biology, Volume 149, Number 5,
, 2000 1107-1116
Original Article |
Ges, a Human Gtpase of the Rad/Gem/Kir Family, Promotes Endothelial Cell Sprouting and Cytoskeleton Reorganization
david.silberstein{at}astrazeneca.com
Rad, Gem/Kir, and mRem (RGK) represent a unique GTPase family with largely unknown functions (Reynet, C., and C.R. Kahn. 1993. Science. 262:1441–1444; Cohen, L., R. Mohr, Y. Chen, M. Huang, R. Kato, D. Dorin, F. Tamanoi, A. Goga, D. Afar, N. Rosenberg, and O. Witte. Proc. Natl. Acad. Sci. USA. 1994. 91:12448–12452; Maguire, J., T. Santoro, P. Jensen, U. Siebenlist, J. Yewdell, and K. Kelly. 1994. Science. 265:241–244; Finlin, B.S., and D.A. Andres. 1997. J. Biol. Chem. 272:21982–21988). We report that Ges (GTPase regulating endothelial cell sprouting), a human RGK protein expressed in the endothelium, functions as a potent morphogenic switch in endothelial cells (ECs). Ges function is sufficient to substitute for angiogenic growth factor/extracellular matrix (ECM) signals in promoting EC sprouting, since overexpression of Ges in ECs cultured on glass leads to the development of long cytoplasmic extensions and reorganization of the actin cytoskeleton. Ges function is also necessary for Matrigel-induced EC sprouting, since this event is blocked by its dominant negative mutant, GesT94N, predicted to prevent the activation of endogenous Ges through sequestration of its guanine nucleotide exchange factor. Thus, Ges appears to be a key transducer linking extracellular signals to cytoskeleton/morphology changes in ECs.
Key Words: angiogenesis actin morphology change Matrigel
© 2000 The Rockefeller University Press
| Introduction |
|---|
|
|
|---|
Despite their highly conserved structural and biochemical properties, functional evidence to suggest a unified mechanism of action for the RGK proteins has been limited. It was reported that Rad overexpression inhibited glucose uptake in muscle and fat cells (Moyers et al. 1996), that Gem overexpression significantly reduced the number of selectable colonies in NIH 3T3 (Maguire et al. 1994; Vanhove et al. 1997), and that Kir overexpression induced invasive pseudohyphal growth in Saccharomyces cerevisiae (Dorin et al. 1995). However, the underlying biological functions for this family of GTPases are still largely unknown.
In this paper, we report the identification and characterization of Ges (GTPase regulating endothelial cell sprouting), a human RGK protein expressed in the endothelium. We show that Ges function in ECs is both sufficient and necessary to promote EC sprouting, a phenotype that mimics EC morphology change during angiogenesis in vivo and is induced in vitro only by combined signals from extracellular matrix (ECM) and angiogenic growth factors. Our findings indicate that Ges is a key transducer linking extracellular signals to downstream events, including EC sprouting, one of the hallmarks of angiogenesis.
| Materials and Methods |
|---|
|
|
|---|
gt10 cDNA library (CLONTECH Laboratories, Inc.) were screened according to manufacturer's protocol, and three positive clones were obtained.
|
6.0 x 108 cpm/µg), washed (20 min/wash) twice at room temperature with 2x SSC, 0.05% SDS, twice at 50°C with 0.1x SSC, 0.1% SDS, and exposed on X-ray film at –70°C for 1 wk. The blot was then stripped by boiling in 0.5% SDS for 10 min, and hybridized with a β-actin probe (CLONTECH Laboratories, Inc.) following the same procedure.
In Situ Hybridization (ISH)
These studies were carried out under contract with LifeSpan BioScience Inc. Ges antisense and sense control riboprobes corresponding to nucleotide 1,064–1,277 in the Ges sequence (Fig. 1 a) were generated and labeled with digoxigenin. Tissue sections from paraffin blocks were digested with proteinase K, hybridized with the labeled probe (1 µg/ml) at 60°C for 20 h, and washed with 2x SSC and 0.1x SSC at 47°C. Hybridization signals were visualized as a blue-black NBT/BCIP deposit against a methyl green nuclear counterstain.
Tissue Culture and Transfection
Primary human ECs (Clonetics) were grown to confluence in EGM complete medium (Clonetics), trypsinized, and resuspended in culture media to a density of 8 x 106/ml. Cells (250 µl) and plasmid DNA (10 µg) were combined into a 0.4-cm cuvette and electroporation was conducted at 0.22 Kv, 0.95 µF for 50–60 ms in a Gene Pulser II unit (BioRad). Cells were resuspended in culture media, plated in flasks or 6-well dishes with glass coverslips, and returned to a CO2 incubator for various length of time before observation and further sample processing.
Reverse Transcription (RT)-PCR
Cells were transfected with EGFP-C3 with or without Ges, and plated in T-75 flasks as described above. After 24 h of incubation, they were washed twice with HBSS, lysed with TRIzol reagent (Life Technologies), and total RNA was isolated according to the manufacturer's protocol. The purified RNA was then treated with RNase-free DNase set/off column kit (Qiagen) to degrade contaminating genomic and plasmid DNA. cDNA was synthesized from 2.5 µg purified DNA-free total RNA and 0.5 µg oligo (dT)12 using Superscript II enzyme (Life Technologies) according to the manufacturer's protocol. As RT minus negative controls to assess contaminating plasmid DNA (EGFP-C3/Ges) in the RNA samples, equal amounts of total RNA used for the RT reactions were subjected to the same RT treatment in the absence of oligo (dT)12 and Superscript II. After termination of the RT reaction by incubation at 70°C for 15 min, the samples were incubated with 2 U RNase H at 37°C for 20 min to degrade RNA.
Pairs of RT-plus and RT-minus PCR reactions were conducted using Advantage-HF 2 Polymerase mix (CLONTECH Laboratories, Inc.). Gene-specific primers for Ges (5' ATGACACTCAACACCGAGCAGGAA 3' and 5' TCAGAGCACGGCCAGATTGTGGCA 3') were chosen from two different exons (genomic sequence data not shown) to amplify an 897-bp Ges cDNA fragment. Gene-specific primers for house-keeping gene hypoxanthine guanine phosphoribosyl transferase (HPRT; 5' GGCGTCGTGATTAGTGATGA 3' and 5' TCACCAGCAAGCTTGCGAC 3') were chosen across intron–exon boundaries to amplify a 479-bp HPRT cDNA fragment. PCR reactions were conducted for 35 cycles at annealing temperature of 60°C for Ges and 55°C for HPRT. Equal amounts of each reaction were run on a 0.8% agarose gel.
Western Blot Analysis
Cells were transfected with EGFP-C3 with or without Ges, and plated in T-75 flasks as described above. After 24 h of incubation, they were washed twice with PBS and lysed in mammalian protein extraction reagent (M-PER; Pierce Chemical Co.) containing protease inhibitors. Two sets of cell lysates (10 µg total protein/sample) were run on one 10% polyacrylamide SDS gel and transferred to a nitrocellulose membrane. The membrane was cut in half, with one half probed with polyclonal antibody against green fluorescent protein (GFP; Molecular Probes), and the other half probed with polyclonal antibody against peptide KPSPAPDDWSSE from the hypervariable Ges NH2-terminal domain. Western blots were developed using a chemiluminescence Western blotting kit (Boehringer) according to the manufacturer's protocol.
Fluorescence Microscopy
For regular fluorescence microscopy, coverslips were fixed for 15 min in 4% paraformaldehyde with PBS wash before and after the treatment, and mounted onto a slide. For visualization of actin, the coverslips were subjected to the following sequential treatment: 15 min fixation in 4% paraformaldehyde, 10 min permeabilization in 0.2% Triton-X 100, 10-min blocking in 1% BSA, and 20-min staining with rhodamine phalloidin conjugate (Molecular Probes), with PBS wash before and after each treatment, and then mounted onto slides. For vinculin visualization, the coverslips were sequentially incubated in mouse anti–human vinculin and goat anti–mouse IgG conjugated with TRITC each (Sigma Chemical Co.) for 30 min, with PBS wash before and after each treatment, and then mounted onto slides. Images were taken onto slide films either directly from culture with an Olympus IX-70 inverted fluorescence microscope or from the slides using an Olympus AX-70 fluorescence microscope, digitized in a Nikon LS-1000 35-mm Slide Scanner, and image contrast was adjusted using Adobe Photoshop.
| Results |
|---|
|
|
|---|
phage library resulted in three independent clones, each containing the full coding sequence, as judged by comparison with other RGKs, open reading frames, the location of an ATG translation start codon, and an upstream stop codon. The full-length sequence is composed of 897 bp open reading frame, and 280 and 794 bp of 5' and 3' untranslated regions, respectively. The poly-A tails of the four clones (Incyte 724666 and the three clones from library screening) were added at different positions 11–25 bp downstream of two polyadenylation signals (AATAAA) positioned 137 bp apart (Fig. 1 a). The deduced protein, Ges, contains 298 amino acids with a calculated molecular weight of 32,946 D. It shares not only high sequence similarity with Rad (43.8%), Gem (44.1%), and mRem (87.9%), but also all of the unique structural features conserved in the RGKs, which include the unique G domains, extended NH2- and COOH-terminal domains beyond the Ras-like core, a putative calmodulin-binding domain, and the COOH-terminal motif (Fig. 1 b). Ges sequence diverges from other RGK members in four regions (the hypervariable NH2-terminal domain, a variable region in the COOH-terminal domain, and the putative Switch I and Switch II domains that align with the switch domains in Ras), which likely confer functional specificity within this GTPase family (Fig. 1 b). Consistent with predictions from Ges primary sequence, in vitro assays confirmed that recombinant Ges bound GTP and GDP, exhibited low intrinsic GTPase activity, and interacted with calmodulin in Ca2+-dependent manner (data not shown).
Expression Profile of Ges
Northern blot analysis of human multiple tissue samples revealed that Ges was expressed in a wide variety of tissues, most abundantly in uterus and heart, and rarely in brain, liver, bone marrow, and thymus (Fig. 2 a). To elucidate the specific cell types that express Ges in vivo, ISH was conducted on a number of human tissues, including heart, uterus, brain, liver, prostate, lung, pancreas, colon, and breast. These surveys revealed that Ges was expressed predominantly at high levels in the endothelium lining the blood vessels in uterus (Fig. 2 b) and heart, rather low levels in vessels from tissues such as colon and breast, and absent in vessels from brain and liver (data not shown). Ges expression was also detected at various levels in cells with apparent secretory functions, including islets of Langerhans in the pancreas, lobule/duct epithelium in the breast, bile duct epithelium in the liver, surface epithelium in the endometrial glands in the uterus, colon mucosa, and acinar cells in the pancreas and the prostate (data not shown).
|
|
Ges Promotes Cytoskeleton Reorganization in ECs
To investigate possible changes in the cytoskeleton that coincide with Ges-induced EC sprouting, actin filaments were examined by rhodamine phalloidin staining. In HUAECs transfected with the empty vector (Fig. 4 a) or normal untransfected cells (Fig. 4 c), actin stress fibers were arranged into star-like criss-crossing clusters and were oriented in all directions across the cell body. Whereas in cells transfected with Ges (Fig. 4b and Fig. c), actin was reorganized into bundles of long filaments parallel to each other along the axis of the elongated cells, and was also concentrated at the cell periphery. This characteristic change of the actin architecture has been observed previously, when ECs receive combined signals from angiogenic growth factors and ECM proteins in vitro (Grant et al. 1991; Schenk et al. 1999). Concomitant with the rearrangement of the actin fibers, vinculin staining revealed noticeable reduction in the sizes of focal adhesion complexes in the sprouting cells (Fig. 4 d), indicating decreased cell attachment to the culture surface.
|
30%) and untransfected (
70%) cells was then plated on Matrigel and observed over time in culture. In comparison with cells transfected with the empty vector, which exhibited comparable level of sprouting to the untransfected cells, Matrigel-induced EC sprouting was strongly enhanced by wild-type Ges, but blocked completely by GesT94N (Fig. 5). In contrast, cognate mutant of the closely related RGK member GemS89N failed to block EC sprouting on Matrigel (Fig. 5 a). This specific inhibition exerted by GesT94N indicates that endogenous Ges is essential for EC sprouting induced by Matrigel.
|
| Discussion |
|---|
|
|
|---|
Rho, Rac, and CDC42 constitute a family of ubiquitously expressed Ras-like GTPases that coordinately regulate the functions of the actin cytoskeleton, as well as many other cellular activities (Tapon and Hall 1997; Hall 1998). In fibroblasts, Rho, Rac, and CDC42 each promote distinctive actin cytoskeleton/cell shape changes, characterized as stress fiber/focal adhesion, lamellipodia/membrane ruffle, and filopodia, respectively. In other cells, effects exerted by each of the Rho family members are modified by parameters characteristic of the specific cell types. In comparison to Rho/Rac/CDC42, Ges clearly promotes distinctive EC morphology change and actin cytoskeleton reorganization, exhibits rather restricted in vivo expression pattern, and its ability to promote cell morphology change in vitro is also limited to a subset of cell types. Among all the non-ECs and cell lines studied, Ges promotes significant morphology changes in primary human bladder smooth muscle cells and coronary artery smooth muscle cells, ECV 304, and fibroblast cell lines IMR-90 and NIH3T3. It had no obvious effect on cell morphology in carcinoma cell lines (HeLa, A-431 and A549), myeloma cell lines (G-361 and DU-145), and a neuronal precursor cell line (NT-2; data not shown). In depth studies are needed to determine how the Ges signaling pathway operates in cell type-specific manner, whether and how it cross-talks with the Rho GTPases, and whether other members of the RGK family exert their observed function also through regulation of the actin cytoskeleton organization.
Angiogenesis, the process of new blood vessel formation, is characterized by a series of events including increased vascular permeability, proteolytic degradation of basement membrane, chemotactic sprouting, migration and proliferation of ECs, lumen formation, and functional maturation of the endothelium. A large array of pro- and antiangiogenic factors, as well as ECM molecules, has been identified to regulate different steps of angiogenesis by transmitting signals simultaneously across EC membrane through cell surface receptors and integrins, respectively (Klagsbrun and D'Amore 1991). Nonetheless, very little is known about the intracellular signaling pathways that link signals at the cell surface to the angiogenic phenotypes. The correlation between predominant Ges expression in the uterus endothelium (where there is active angiogenesis) and the potent ability of Ges to promote EC sprouting (one of the hallmarks of angiogenesis) strongly suggests a crucial involvement of Ges in blood vessel formation. Thus, further dissection of the Ges pathway should provide much insight into the molecular mechanism of angiogenesis and its regulation.
| Acknowledgments |
|---|
Submitted: 31 January 2000
Revised: 18 April 2000
Accepted: 21 April 2000
Mark M. Egerton's current address is Incyte Pharmaceuticals, 3174 Porter Drive, Palo Alto, CA 94304.
| References |
|---|
|
|
|---|
Baatout S.. Endothelial differentiation using Matrigel, Anticancer Res., 17, 1997, 451–455.[Medline]
Belotti D., Vergani V., Drudis T., Borsotti P., Pitelli M.R., Viale G., Giavazzi R. & Taraboletti G.. The microtubule-affecting drug paclitaxel has antiangiogenic activity, Clin. Cancer Res, 2, 1996, 1843–1849.[Abstract]
Bilan P.J., Moyers J.S. & Kahn C.R.. The Ras-related protein Rad associates with the cytoskeleton in a non-lipid-dependent manner, Exp. Cell Res., 242, 1998, 391–400.[Medline]
Bourne H.R., Sanders D.A. & McCormick F.. The GTPase superfamilyconserved structure and molecular mechanism, Nature, 349, 1991, 117–127.[Medline]
Cockerill G.W., Varcoe L., Meyer G.T., Vadas M.A. & Gamble J.R.. Early events in angiogenesiscloning an alpha-prolyl 4-hydroxylase-like gene, Int. J. Oncol, 13, 1998, 595–600.[Medline]
Cohen L., Mohr R., Chen Y.Y., Huang M., Kato R., Dorin D., Tamanoi F., Goga A., Afar D., Rosenberg N. & Witte O.. Transcriptional activation of a ras-like gene (kir) by oncogenic tyrosine kinases, Proc. Natl. Acad. Sci. USA., 91, 1994, 12448–12452.
Del Villar K., Dorin D., Sattler I., Urano J., Poullet P., Robinson N., Mitsuzawa H. & Tamanoi F.. C-terminal motifs found in Ras-superfamily G-proteinsCAAX and C-seven motifs, Biochem. Soc. Trans., 24, 1996, 709–713.[Medline]
Dorin D., Cohen L., Villar K.D., Poullet P., Mohr R., Whiteway M., Witte O. & Tamanoi F.. Kir, a novel Ras-family G-protein, induces invasive pseudohyphal growth in Saccharomyces cerevisiae, Oncogene, 11, 1995, 2267–2271.[Medline]
Feig L.A.. Tools of the tradeuse of dominant-inhibitory mutants of Ras-family GTPases, Nat. Cell Biol., 1, 1999, E25–E27.[Medline]
Finlin B.S. & Andres D.A.. Rem is a new member of the Rad- and Gem/Kir Ras-related GTP-binding protein family repressed by lipopolysaccharide stimulation, J. Biol. Chem., 272, 1997, 21982–21988.
Fischer R., Wei Y., Anagli J. & Berchtold M.W.. Calmodulin binds to and inhibits GTP binding of the ras-like GTPase Kir/Gem, J. Biol. Chem., 271, 1996, 25067–25070.
Gho Y.S., Kleinman H.K. & Sosne G.. Angiogenic activity of human soluble intercellular adhesion molecule-1, Cancer Res, 59, 1999, 5128–5132.
Grant D.S., Lelkes P.I., Fukuda K. & Kleinman H.K.. Intracellular mechanisms involved in basement membrane induced blood vessel differentiation in vitro, In Vitro Cell. Dev. Biol., 27A, 1991, 327–336.[Medline]
Gualandris A., Rusnati M., Belleri M., Nelli E.E., Bastaki M., Molinari-Tosatti M.P., Bonardi F., Parolini S., Albini A. & Morbidelli L.. Basic fibroblast growth factor overexpression in endothelial cellsan autocrine mechanism for angiogenesis and angioproliferative diseases, Cell Growth Differ., 7, 1996, 147–160.[Abstract]
Hall A.. Rho GTPases and the actin cytoskeleton, Science., 279, 1998, 509–514.
Hisa T., Kimura Y., Takada K., Suzuki F. & Takigawa M.. Shikonin, an ingredient of Lithospermum erythrorhizon, inhibits angiogenesis in vivo and in vitro, Anticancer Res, 18, 1998, 783–790.[Medline]
Isaji M., Miyata H., Ajisawa Y., Takehana Y. & Yoshimura N.. Tranilast inhibits the proliferation, chemotaxis and tube formation of human microvascular endothelial cells in vitro and angiogenesis in vivo, Br. J. Pharmacol, 122, 1997, 1061–1066.[Medline]
Klagsbrun M. & D'Amore P.A.. Regulators of angiogenesis, Annu. Rev. Physiol., 53, 1991, 217–239.[Medline]
Koblizek T.I., Weiss C., Yancopoulos G.D., Deutsch U. & Risau W.. Angiopoietin-1 induces sprouting angiogenesis in vitro, Curr. Biol., 8, 1998, 529–532.[Medline]
Lamszus K., Schmidt N.O., Ergun S. & Westphal M.. Isolation and culture of human neuromicrovascular endothelial cells for the study of angiogenesis in vitro, J. Neurosci. Res, 55, 1999, 370–381.[Medline]
Lelkes P.I., Hahn K.L., Sukovich D.A., Karmiol S. & Schmidt D.H.. On the possible role of reactive oxygen species in angiogenesis, Adv. Exp. Med. Biol, 454, 1998, 295–310.[Medline]
Maguire J., Santoro T., Jensen P., Siebenlist U., Yewdell J. & Kelly K.. Geman induced, immediate early protein belonging to the Ras family, Science, 265, 1994, 241–244.
Malinda K.M., Ponce L., Kleinman H.K., Shackelton L.M. & Millis A.J.. Gp38k, a protein synthesized by vascular smooth muscle cells, stimulates directional migration of human umbilical vein endothelial cells, Exp. Cell. Res, 250, 1999, 168–173.[Medline]
Montesano R. & Orci L.. Tumor-promoting phorbol esters induce angiogenesis in vitro, Cell, 42, 1985, 469–477.[Medline]
Montesano R., Vassalli J.D., Baird A., Guillemin R. & Orci R.. Basic fibroblast growth factor induces angiogenesis in vitro, Proc. Natl. Acad. Sci. USA., 83, 1986, 7297–7301.
Moyers J.S., Bilan P.J., Reynet C. & Kahn C.R.. Overexpression of Rad inhibits glucose uptake in cultured muscle and fat cells, J. Biol. Chem., 271, 1996, 23111–23116.
Moyers J.S., Bilan P.J., Zhu J. & Kahn C.R.. Rad and Rad-related GTPases interact with calmodulin and calmodulin-dependent protein kinase II, J. Biol. Chem., 272, 1997, 11832–11839.
Oikawa T., Sasaki T., Nakamura M., Shimamura M., Tanahashi N., Omura S. & Tanaka K.. The proteasome is involved in angiogenesis, Biochem. Biophys. Res. Commun, 246, 1998, 243–248.[Medline]
Pan J.Y. & Wessling-Resnick M.. GEF-mediated GDP/GTP exchange by monomeric GTPasesa regulatory role for Mg2+?, Bioessays., 20, 1998, 516–521.[Medline]
Pipili-Synetos E., Papadimitriou E. & Maragoudakis M.E.. Evidence that platelets promote tube formation by endothelial cells on matrigel, Br. J. Pharmacol, 125, 1998, 1252–1257.[Medline]
Reynet C. & Kahn C.R.. Rada member of the Ras family overexpressed in muscle of type II diabetic humans, Science, 262, 1993, 1441–1444.
Ribatti D., Presta M., Vacca A., Ria R., Giuliani R., Dell'Era P., Nico B., Roncali L. & Dammacco F.. Human erythropoietin induces a pro-angiogenic phenotype in cultured endothelial cells and stimulates neovascularization in vivo, Blood, 93, 1999, 2627–2636.
Riccioni T., Cirielli C., Wang X., Passaniti A. & Capogrossi M.C.. Adenovirus-mediated wild-type p53 overexpression inhibits endothelial cell differentiation in vitro and angiogenesis in vivo, Gene Ther, 5, 1998, 747–754.[Medline]
Schenk S., Chiquet-Ehrismann R. & Battegay E.J.. The fibrinogen globe of tenascin-C promotes basic fibroblast growth factor-induced endothelial cell elongation, Mol. Biol. Cell, 10, 1999, 2933–2943.
Sheibani N., Newman P.J. & Frazier W.A.. Thrombospondin-1, a natural inhibitor of angiogenesis, regulates platelet–endothelial cell adhesion molecule-1 expression and endothelial cell morphogenesis, Mol. Biol. Cell, 8, 1997, 1329–1341.[Abstract]
Tapon N. & Hall A.. Rho, Rac and Cdc42 GTPases regulate the organization of the actin cytoskeleton, Curr. Opin. Cell Biol., 9, 1997, 86–92.[Medline]
Thaloor D., Singh A.K., Sidhu G.S., Prasad P.V., Kleinman H.K. & Maheshwari R.K.. Inhibition of angiogenic differentiation of human umbilical vein endothelial cells by curcumin, Cell Growth Differ, 9, 1998, 305–312.[Abstract]
Vanhove B., Hofer-Warbinek R., Kapetanopoulos A., Hofer E., Bach F.H. & Martin R.. Gem, a GTP-binding protein from mitogen-stimulated T cells, is induced in endothelial cells upon activation by inflammatory cytokines, Endothelium, 5, 1997, 51–61.[Medline]
Yatsunami J., Turuta N., Wakamatsu K., Hara N. & Hayashi S.. Clarithromycin is a potent inhibitor of tumor-induced angiogenesis, Res. Exp. Med., 197, 1997, 189–197.[Medline]
Zhu J., Reynet C., Caldwell J.S. & Kahn C.R.. Characterization of Rad, a new member of Ras/GTPase superfamily, and its regulation by a unique GTPase-activating protein (GAP)-like activity, J. Biol. Chem., 270, 1995, 4805–4812.
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|