JCB logo
MBL International Tel: 800.200.5459 CLICK HERE
  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents

Published online 18 September 2000. doi:10.1083/jcb.150.6.1375
This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 626K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sachs, M.
Right arrow Articles by Birchmeier, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sachs, M.
Right arrow Articles by Birchmeier, W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?

© The Rockefeller University Press, 0021-9525/2000//1375 $5.00
The Journal of Cell Biology, Volume 150, Number 6, , 2000 1375-1384


Original Article

Essential Role of Gab1 for Signaling by the C-Met Receptor in Vivo



Martin Sachsa, Henning Brohmannb, Dietmar Zechnera, Thomas Müllerb, Jörg Hülskena, Ingrid Walthera, Ute Schaepera, Carmen Birchmeierb, and Walter Birchmeiera

a Department of Growth and Differentiation, Max-Delbrueck-Center for Molecular Medicine, 13092 Berlin, Germany
b Department of Medical Genetics, Max-Delbrueck-Center for Molecular Medicine, 13092 Berlin, Germany
Max-Delbrueck-Center for Molecular Medicine, Robert-Roessle-Strasse 10, 13092 Berlin, Germany.49-30-9406-265649-30-9406-3810

The docking protein Gab1 binds phosphorylated c-Met receptor tyrosine kinase directly and mediates signals of c-Met in cell culture. Gab1 is phosphorylated by c-Met and by other receptor and nonreceptor tyrosine kinases. Here, we report the functional analysis of Gab1 by targeted mutagenesis in the mouse, and compare the phenotypes of the Gab1 and c-Met mutations. Gab1 is essential for several steps in development: migration of myogenic precursor cells into the limb anlage is impaired in Gab1–/– embryos. As a consequence, extensor muscle groups of the forelimbs are virtually absent, and the flexor muscles reach less far. Fewer hindlimb muscles exist, which are smaller and disorganized. Muscles in the diaphragm, which also originate from migratory precursors, are missing. Moreover, Gab1–/– embryos die in a broad time window between E13.5 and E18.5, and display reduced liver size and placental defects. The labyrinth layer, but not the spongiotrophoblast layer, of the placenta is severely reduced, resulting in impaired communication between maternal and fetal circulation. Thus, extensive similarities between the phenotypes of c-Met and HGF/SF mutant mice exist, and the muscle migration phenotype is even more pronounced in Gab1–/–:c-Met+/– embryos. This is genetic evidence that Gab1 is essential for c-Met signaling in vivo. Analogy exists to signal transmission by insulin receptors, which require IRS1 and IRS2 as specific docking proteins.

Key Words: hepatocyte growth factor • gene targeting • migration of muscle precursors • placenta development • liver development



© 2000 The Rockefeller University Press


   Introduction
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
In the last decade, various receptor tyrosine kinases and their ligands have been molecularly characterized (for reviews see Schlessinger and Ullrich 1992; van der Geer et al. 1994). In cell culture, the activated receptors elicit specific cellular responses (e.g., proliferation, motility, morphogenesis, differentiation, or survival). In vivo, the receptor tyrosine kinases and their ligands regulate decisive events in development (Birchmeier and Birchmeier 1993; Lemke 1996; Pachnis et al. 1998; Holder and Klein 1999).

Various cellular responses are observed when the c-Met receptor is activated by its specific ligand HGF/SF in cell culture that depend on the cell type used as well as on the exact culture condition. Epithelial cells can respond by scattering, motility or invasiveness, by growth, as well as by formation of branched tubular structures (Stoker et al. 1987; Weidner et al. 1990, Weidner et al. 1993; Gherardi and Stoker 1991; Montesano et al. 1991). The c-Met receptor was initially identified because of its oncogenic potential when mutated (Park et al. 1986), and various evidence implies HGF/SF and c-Met in tumorigenesis and metastasis (Di Renzo et al. 1991; Jeffers et al. 1996, Jeffers et al. 1997; Sakata et al. 1996; Meiners et al. 1998; Takayama et al. 1997). Activating mutations in the c-Met gene are observed in hereditary renal papillary carcinomas in humans (Schmidt et al. 1998; Zhuang et al. 1998).

Two phosphorylated tyrosyl residues in c-Met, Y1349 and Y1356, are essential for its function in vitro and in vivo (Ponzetto et al. 1994; Fixman et al. 1995; Weidner et al. 1995; Maina et al. 1996; Sachs et al. 1996; Giordano et al. 1997). These residues constitute a bivalent docking site that recruits various signaling and adapter proteins like PI(3) kinase, phospholipase C{gamma}, Src, Shc, Grb2, and Gab1 (Ponzetto et al. 1994; Zhu et al. 1994; Fixman et al. 1995; Pelicci et al. 1995; Weidner et al. 1996). Gab1 requires Y1349 and, to a lesser degree Y1356, for binding to the c-Met receptor (Holgado-Madruga et al. 1996; Weidner et al. 1996). Gab1 is a member of the family of docking proteins that include insulin receptor substrates (IRS-1, IRS2, and IRS-3), FGF receptor substrate (FRS-2/SNT1), the p62dok subfamily, Drosophila DOS (daughter of sevenless), and linker for activation of T cells (Voliovitch et al. 1995; Herbst et al. 1996; Raabe et al. 1996; Carpino et al. 1997; Kouhara et al. 1997; Yamanashi and Baltimore 1997; Gu et al. 1998; Zhang et al. 1998). These proteins are characterized by an NH2-terminal pleckstrin homology (PH) domain or myristilation sequence, a central phosphotyrosyl binding domain (usually PTP) and multiple tyrosyl residues that function as docking sites for SH2 domain–containing molecules. Unique to Gab1 is a novel phosphotyrosyl recognition domain that mediates the binding to phosphorylated c-Met (Weidner et al. 1996; Schaeper et al. 2000). Gab1 is not only phosphorylated by c-Met, but is also indirectly activated by other tyrosine kinases. Extracellular stimuli like EGF, insulin, IL3, IL6, Epo1, or the activation of the B cell receptor result in phosphorylation of Gab1 (Holgado-Madruga et al. 1996; Ingham et al. 1998; Takahashi-Tezuka et al. 1998; Lecoq-Lafon et al. 1999; Rodrigues et al. 2000). PI(3) kinase, Shc, Shp2, and CRKL are direct interaction partners of Gab1 (Holgado-Madruga et al. 1996; Bardelli et al. 1997; Maroun et al. 1999; Schaeper et al. 2000). Association of Gab1 with Shp-2 is essential for the formation of branched tubules by cultured MDCK epithelial cells (Schaeper et al. 2000). Association of Gab1 with PI(3) kinase is important for the prevention of apoptosis (Holgado-Madruga et al. 1997). The PH domain of Gab1 mediates Gab1 translocation to the plasma membrane in response to EGF (Maroun et al. 1999; Rodrigues et al. 2000). Together, these data obtained by in vitro experiments imply Gab1 in the signaling of different tyrosine kinases, which recruit Gab1 either directly or indirectly. Indeed, whether Gab1 plays a functional role in various pathways in vivo is the focus of this work.

Targeted mutations of the HGF/SF and c-Met genes in mice cause identical phenotypes, i.e., embryonal lethality due to a severe deficit in development of the placenta (Bladt et al. 1995; Schmidt et al. 1995; Uehara et al. 1995). Such animals also display a reduced liver size and, remarkably, lack particular muscle groups like the muscles of extremities, diaphragm, and tongue. These muscles derive from a migrating precursor population. In c-Met or HGF/SF mutant mice, migration of myogenic precursor cells is defective: the precursors remain in the dermomyotome, a derivative of the somite, and do not migrate to their targets in the limbs, branchial arches, and the septum transversum (Bladt et al. 1995; Dietrich et al. 1999).

Here, we examined the function of Gab1 in mice by generating a targeted mutation using embryonic stem (ES) cell technology. A fundamental role of Gab1 for c-Met–specific signaling was found: Gab1–/– mutant embryos are characterized by embryonal lethality (because of placental defects), by reduced liver size, and by reduced and delayed migration of myogenic precursor cells. This is reminiscent of the phenotype of HGF/SF–/– and c-Met–/– mutant embryos. Therefore, our data demonstrate that in vivo Gab1 is an essential mediator of c-Met receptor signals.


   Materials and Methods
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Generation of Gab1-deficient Mice
For the construction of the Gab1 targeting vector, genomic fragments isolated from a {lambda}FIXII 129/Ola library were introduced into the pTV0 vector (Riethmacher et al. 1995). The Gab1 vector contained at the 5' end a 1.5-kb genomic sequence ending with codon 26 of Gab1, which was fused in-frame with the β-galactosidase gene that harbors a nuclear localization signal. At the 3' end, a genomic 10-kb BamHI fragment is present in the vector. Linearized targeting vector was introduced into E14-1 ES cells by electroporation. Homologous recombination events were enriched by selection with G418 and gancyclovir. The structure of the mutant locus and the absence of additional integration events were verified by Southern hybridization. Several independent ES cell clones were used to generate chimeric mice by blastocyst injection as previously described (Riethmacher et al. 1995). Two independent mouse lines with mutated Gab1 were obtained, and analyzed on a mixed 129/C57Bl6 background.

Mice and embryos were genotyped by β-galactosidase staining of ear tissue as previously described (Hogan et al. 1994) or by PCR using DNA from the tail or visceral yolk sac. PCR primers, PCR1 (CCCTTTGTGGATGGCTTCTTTGT, 300 nM) and PCR2 (TTCTTGGCATGATCGTTTTTGTAA, 300 nM) specific for the wild-type allele, and KO2s (GGATCCCGTCGTTTTACAACG, 240 nM) and KO2as (ACCACAGATGAAACGCGGAGT, 240 nM) specific for the mutated allele were used in a combined reaction in Taq buffer (1.5 mM MgCl2, 0.2 mM dNTPs, and 1.6 U Taq polymerase; GIBCO BRL). Amplification of mutant and wild-type Gab1 alleles generated diagnostic bands of 450 and 336 bp, respectively.

Western Blot Analysis
E14.5 embryos were lysed in Triton buffer (50 mM Hepes, pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 1 mM EDTA, and 1 mM PMSF). 10 µg of the lysate was subjected to 7.5% SDS-PAGE and transferred to nitrocellulose membranes. Membranes were blocked with PBS-milk (PBS with 5% nonfat dry milk), washed, and incubated overnight with anti–mouse Gab1 antibodies ({alpha}-mGab1, 1:500; see below) or anti–human Gab1 ({alpha}-hGab1, 1:400, against the COOH-terminal amino acids 664–694; Upstate Biotechnology). HRP-conjugated goat anti–rabbit IgG (1:1,500) and enhanced chemiluminescence substrate (Amersham Pharmacia Biotech) were used for detection of Gab1 protein. The antiserum against mouse Gab1 was produced in rabbits, using the Met binding domain of mouse Gab1 (amino acids 391–541) as the antigen, and affinity-purified.

In Situ Hybridization Analysis and Histological Analysis
Whole mount in situ hybridization using Lbx1 and SHH as probes was performed as previously described (Wilkinson 1992; Echelard et al. 1993; Brohmann et al. 2000). Placentas of E13.5 embryos were immediately frozen in Tissue Tek and cryo-sectioned (12 µm). In situ hybridization was performed with 35S-labeled probes (Dlx3 or Gcm1) or digoxyginin-labeled probes (Flt1) as previously described (Sonnenberg-Riethmacher et al. 1996). For monitoring development, tissues were fixed in 4% formaldehyde, embedded in paraplast (Oxford Labware), and 7-µm sections were prepared and counterstained with hematoxylin-eosin. Immunohistochemistry of muscle tissue was performed using a 1:2,000 dilution of monoclonal anti–skeletal fast myosin antibody (Sigma M4276) and a 1:100 dilution of the secondary antibody, alkaline phosphatase conjugated anti–mouse IgG (Jackson ImmunoResearch Laboratories). 1% orange G was used as a histological counterstain. The sections were examined by light microscopy (Zeiss Axiovert), scanned by a ProgRes 3012 videocamera (Jenaoptik), and processed using Adobe Photoshop 4.0 software.


   Results
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
Phenotype of Gab1-deficient Mice
We generated a Gab1 mutation by homologous recombination in ES cells. In the targeting vector, a lacZ cassette was fused in-frame to the exon that encodes the major part of the NH2-terminal PH domain of Gab1, replacing a 1.5-kb fragment of genomic DNA (Fig. 1, a and b). Homologous recombination events were identified by Southern blot analysis, yielding a novel fragment of 4.7 kb (Fig. 1 c). Using two lines of mutant ES cells, we generated chimeric and Gab1 heterozygous mice, which were largely healthy and fertile. Approximately 5% of the Gab1+/– mice of both lines showed spasms after 2–3 mo and died; we did not examine these mice further. Matings between heterozygous animals produced no live Gab1–/– offspring, implying that the mutant embryos die during embryogenesis. To determine the time of death, embryos from different developmental stages were dissected and genotyped by Southern blot and PCR (Table and Fig. 1 c). Up to day 12.5 of embryogenesis, the expected Mendelian ratio of homozygous mutant embryos was observed. At E13.5 to E18.5, the proportion of viable Gab1–/– embryos declined, and the surviving embryos showed a gradual delay in growth and development. No Gab1–/– embryos were observed at P0 (Table ). Frequently, Gab1–/– embryos were found dead in utero, as judged by the absence of a heartbeat or by signs of resorption. These data indicate that Gab1–/–, c-Met–/–, or HGF/SF–/– mutants die during similar time windows (Schmidt et al. 1995; Uehara et al. 1995; Bladt et al. 1995). To test for Gab1 protein in the mutants, we prepared lysates from E12.5 embryos and analyzed them by immunoblotting using antiserum against the c-Met–binding domain of mouse Gab1 or the COOH terminus of human Gab1. Compared with wild-type embryos, Gab1 protein levels were reduced in Gab1+/– mice. Both antisera did not detect Gab1 protein in lysates from Gab1–/– embryos (Fig. 1 d). Thus, the introduced mutation in the Gab1 gene corresponds to a null mutation.


Figure 1
View larger version (48K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 1 Outline of the strategy used to disrupt the Gab1 gene. (a) Schematic representation of the Gab1 protein structure. Gab1 contains all of the following: an NH2-terminal PH domain; a crk binding region (CBR); two SH3 consensus binding sites for Grb2 (GBS1 and GBS2, dark gray); the Met binding domain (MBD), with amino acids essential for c-Met binding (MBS, black box); and consensus binding sites for SH2 domains of PI(3) kinase and Shp2 (Schaeper et al. 2000). (b) Schematic representation of the Gab1 targeting vector and the wild-type and mutant Gab1 alleles. Exon sequences are represented by black boxes; the lacZ cassette was fused in-frame to codon 26 of Gab1. The neomycin resistance (neo) gene and thymidine kinase (tk) gene from the herpes simplex virus are shown in gray boxes, with arrowheads indicating the direction of transcription. The open box indicates the probe used for Southern hybridization analysis. The sizes of the restriction fragments generated by NdeI in wild-type and mutant DNA are indicated. (c) Southern blot analysis of genomic DNA from wild-type (+/+) and Gab1 heterozygous (+/–) ES cells and from E12.5 wild-type, heterozygous, and homozygous (–/–) mutant embryos. DNA molecular mass standard: 9.4, 6.6, and 4.4 kb, respectively. A PCR analysis of the Gab1 locus of wild-type, heterozygous, and homozygous mutant embryos is shown on the right. (d) Western blot analysis from extracts of each of two embryos at E12.5 of the indicated genotypes. Two different antibodies directed against MBD and the COOH terminus of Gab1 (anti–mouse and anti–human Gab1) were used (see Materials and Methods).

 

View this table:
[in this window]
[in a new window]

 
Table 1 Summary of Genotypes Resulting from Gab1+/– Intercrosses

 
We examined the structure of the placenta of control, Gab1 and c-Met mutant embryos at E13.5. Macroscopically, the placental labyrinth layer of mutant embryos contained less blood than the one of controls (not shown). Cryosections of placentas at E13.5 were analyzed by in situ hybridization with probes for the trophoblast-specific transcription factors Dlx3 and Gcm1, which mark the labyrinth layer (Morasso et al. 1999; Anson-Cartwright et al. 2000). Compared with controls, a reduced thickness and severe disorganization of the placental labyrinth layer is apparent in Gab1–/– and c-Met–/– embryos (L in Fig. 2d, Fig. e, Fig. g, and Fig. h, compare with placenta from control in Fig. 2, a and b) The labyrinthine layer of wild-type placenta consists of a dense network of numerous, fine embryonic blood vessels and larger maternal sinuses filled with enucleated maternal blood cells. Sections of placentas were also stained with isolectin B4 from Bandeiraea simplicifolia, which visualizes the extracellular matrix surrounding fetal blood vessels that are particularly abundant in the labyrinthine layer (Ohlsson et al. 1999). In the labyrinth layer of Gab1 mutants, the isolectin B4–stained matrix around fetal blood vessels is fragmented, trophoblast cells are reduced in number, and fewer blood cells are detectable in the labyrinth layer. Occasionally, fetal blood cells are infiltrating the trophoblast layer of Gab1 mutant placentas, indicating a breakdown of the endothelial lining of embryonic blood vessels (data not shown). In contrast, the normal distribution of Flt-1 mRNA (Breier et al. 1995) indicates that the spongiotrophoblast layer of the placenta is not affected in Gab1 and c-Met mutant embryos (Sp in Fig. 2c, Fig. f, and Fig. i). Since the labyrinth layer is required for the exchange of oxygen and nutrients between maternal and fetal circulation, impaired development of the placenta is a likely cause of the embryonic lethality of Gab1–/– and c-Met–/– embryos (Schmidt et al. 1995; Uehara et al. 1995; Bladt et al. 1995).


Figure 2
View larger version (125K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 2 Analysis of the placenta from control (a–c), Gab1–/– (d–f), and c-Met–/– embryos (g–i). In situ hybridization with probes Dlx3 (a, d, and g) and Gcm1 (b, e, and h) specific for trophoblast cells in the labyrinth layer (L) and probe Flt1 (c, f, and i) specific for the spongiotrophoblast layer (Sp). Note the reduced size of the labyrinth but not the spongiotrophoblast layer and the reduced numbers of trophoblast cells of Gab1–/– and c-Met–/– placentas. Bar, 1 mm.

 
We also compared the liver size of control and Gab1–/– embryos at E14.5. The ratio of liver to bodyweight was 8.8 x 10–2 in wild-type, 7.8 x 10–2 in Gab1+/–, and 5.0 x 10–2 in Gab1–/– embryos (each SD ≤ 1.4 x 10–2). Thus, the size of the liver is markedly reduced in Gab1–/– embryos. A similar reduction in the ratio of liver to bodyweight is observed in c-Met–/– embryos at E14.5 (10.6 x 10–2, 9.8 x 10–2, and 5.3 x 10–2 in wild-type, c-Met+/–, and c-Met–/– embryos, respectively; C. Birchmeier, unpublished data).

Long-range Migration of Muscle Precursor Cells in Gab1 Mutant Embryos
Muscles of limbs, diaphragm, and the hypoglossal cord are generated by migrating precursor cells that delaminate from lateral dermomyotome, a derivative of the somite (Chevallier et al. 1977; Christ et al. 1977). The Lbx1 gene encodes a homeobox-containing transcription factor that is strongly expressed in migrating muscle precursor cells. These cells form distinct streams in the wild-type E10.25 embryo (Fig. 3, a and b, the upper arrowhead marks the hypoglossal stream, the lower arrowhead, the forelimb, and the arrow mark muscle precursors cells retained in the dermomyotome; Jagla et al. 1995; Dietrich et al. 1998). In c-Met or HGF/SF mutant mice, the muscle precursor cells remain in the dermomyotome and do not take up long-range migration (Fig. 3 d; Bladt et al. 1995). In Gab1–/– embryos, some delamination of myogenic precursor cells occurs, but is strongly reduced in efficiency (Fig. 3 c). Compared with control embryos, less cells have left the occipitally located somites in Gab1 mutants, and the precursor stream headed towards the floor of the branchial arches contains a reduced number of cells. Moreover, the occipital stream does not extend as far distally as in control embryos (Fig. 3 c, upper arrowhead). Similarly, much less precursor cells have reached the forelimb bud (Fig. 3 c, lower arrowhead). Impaired migration of muscle precursor cells into the forelimbs of Gab1–/– embryos is also evident in a dorsal view of the embryos (Fig. 3 f, compare with control embryos in e). Sections reveal a particularly pronounced reduction of precursor cells in the dorsal forelimb (Fig. 3g and Fig. h, arrow).


Figure 3
View larger version (80K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 3 Whole-mount in situ hybridization of muscle precursor cells in the control (a, b, e, and g), Gab1–/– (c, f, and h) and c-Met–/– (d) embryos at stage E10.25, as visualized by in situ hybridization with an Lbx1-specific probe. (a–d) Lateral views and (e–g) dorsal views; (g and h) vibratome cross-sections at the forelimb level. Arrowheads in b–d point towards muscle precursor cells migrating into the hypoglossal cord and into the forelimbs; arrows mark remaining precursor cells in the dermomyotome. Arrows in g and h mark muscle precursor cells in the dorsal forelimb. Note that, in Gab1–/– embryos, less muscle precursor cells emigrate, and that migration is less progressed compared with control embryos. In c-Met–/– embryos, no emigration of muscle precursor cells occurs. Bars: (a) 500 µm; (b–f) 400 µm; (g and h) 250 µm.

 
We analyzed differentiated muscle groups in the limbs of E14.5 embryos; at this stage, skeletal muscle cells in the limbs express muscle-specific proteins such as fast myosin heavy chain, which was visualized by immunohistochemistry. The extensor muscle groups of the proximal lower forelimbs are either absent or very small in Gab1–/– mice compared with control mice; flexor muscles are present (Fig. 4, a and c, arrows mark extensors, arrowhead, flexors). In the distal lower forelimb, the phenotype is more pronounced, and only traces of muscle cells can be detected at this site in Gab1–/– embryos; both extensor and flexor muscles groups are strongly affected (Fig. 4b and Fig. d). In the proximal lower hindlimb, some muscle groups are present but reduced in size; distally, the size reduction is again more pronounced (Fig. 4, a'–d'). We also set up cross-breedings of Gab1 and c-Met (Bladt et al. 1995) mutant mice to obtain compound Gab1–/–:c-Met+/– embryos. Remarkably, virtual absence of all muscles was observed in the lower limbs of these embryos (Fig. 4, e–f'). The diaphragm muscle, which is also colonized by migrating muscle precursor cells, was examined. Sagittal sections of wild-type embryos at E13.5 reveal the diaphragm muscle (Fig. 5 a), which is split by the esophagus in this particular section plane. In Gab1 mutant embryos, the diaphragm muscle is strongly reduced in size (Fig. 5 b). No change was observed in the internal tongue muscle also generated by migrating cells (not shown). Note that other muscle groups that do not develop from migrating cells, like intercostal or body wall muscle, are well developed in the Gab1 mutants (Fig. 4 and data not shown). Thus, specific muscle groups that derive from migrating precursor cells are severely impaired in their development in Gab1 mutants. In HGF/SF–/–, c-Met–/–, and Gab1–/–: c-Met+/– embryos, these muscle groups are completely absent (Bladt et al. 1995; Dietrich et al. 1998). Interestingly, the reduced colonization of limbs and diaphragm with muscle precursor cells in Gab1–/– embryos is not markedly compensated at later stages in development.


Figure 4
View larger version (100K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 4 (e–f'), Immunohistological analysis of muscle groups in control (a–b'), Gab1–/– (c–d') and Gab1–/–:c-Met+/– embryos (e–f') as visualized by staining with anti–skeletal fast myosin heavy chain antibodies and HRP. Cross-sections of the proximal (a, c, and e) and distal (b, d, and f) lower forelimbs and proximal (a', c', and e') and distal (b', d', and f') lower hindlimbs of E14.5 embryos are shown. Note the strong reduction of muscles in the lower fore- and hindlimbs in Gab1–/– embryos, and the virtual absence of muscles in compound Gab1/c-Met mutant embryos. Bar, 250 µm.

 

Figure 5
View larger version (69K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 5 Immunohistologi-cal analysis of muscle groups in Gab+/– (a) and Gab1–/– embryos (b), as visualized by staining with anti–skeletal fast myosin heavy chain antibodies and HRP. Sagittal sections of E13.5 embryos show the muscle of the diaphragm, which is split by the esophagus (dotted line). Note the strong reduction of the size of diaphragm muscles in Gab1–/– embryos. Bar, 250 µm.

 
HGF/SF and c-Met have also been suggested to be involved in the formation of hair follicles (Jindo et al. 1998; Lindner et al. 2000). No difference was seen in the initiation of hair follicle morphogenesis between wild-type and Gab1–/– embryos at day E14.5 (Fig. 6, a–d): whole mount in situ hybridization using a sonic hedgehog probe revealed an identical staining pattern in the forming epithelial placodes during stage 1 of hair follicle morphogenesis (Karlsson et al. 1999). At E17.5, Gab1 mutant embryos displayed a retardation of hair follicle outgrowth (Fig. 6e and Fig. f) as well as a reduction of the total number of hair follicles, which may reflect the smaller size of the mutant embryos. In addition, epidermal thickness and keratinization was reduced in mutant embryos.


Figure 6
View larger version (125K):
[in this window]
[in a new window]
[Download PPT slide]
 
Figure 6 Initiation of hair follicle formation in Gab1–/– embryos. Whole-mount in situ hybridizations of wild-type (a and c) and mutant embryos (b and d) with a sonic hedgehog–specific probe at E14.5. (a and b) Side views of the embryos, (c and d) transversal sections of skin demonstrating the correct localization of sonic hedgehog–specific signals in the developing epithelial placodes. Transversal sections of hematoxylin-eosin–stained skin of E17.5 wild-type (e) and mutant (f) embryos. Note the delayed development of the skin of Gab1–/– embryos. Bars: (a and b) 500 µm; (c–f) 50 µm.

 

   Discussion
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 
We identified Gab1 originally in a yeast two-hybrid screen as a direct binding partner of c-Met (Weidner et al. 1996); accumulated evidence indicates an important role of Gab1 in c-Met signaling in cultured cells (Weidner et al. 1996; Bardelli et al. 1997; Maroun et al. 1999; Schaeper et al. 2000). Here, we present evidence for an essential role of Gab1 in the transmission of c-Met signals in vivo. Ablation of the Gab1 gene in mice results in phenotypes that resemble those of mice harboring mutations in the c-Met and HGF/SF genes (Bladt et al. 1995; Schmidt et al. 1995; Uehara et al. 1995; Maina et al. 1996). Placenta and liver development, but also the migration of muscle precursor cells from the dermomyotome to distant targets are affected in all three mutants. Thus, the genetic data demonstrate that Gab1 is an essential and specific mediator of signaling by a particular receptor tyrosine kinase, c-Met.

Our work places Gab1 into the genetic hierarchy that controls the development of muscle derived from migratory precursors. The transcription factor Pax3 is essential for the formation and specification of migratory muscle precursors in the dermomyotome. It also induces expression of the Lbx1 and the c-Met genes. The precursor cells are primed to receive the HGF/SF signal, which is provided by mesenchymal cells close to the somites and along the migration routes (Cossu et al. 1996; Daston et al. 1996; Epstein et al. 1996; Yang et al. 1996; Mennerich et al. 1998; Dietrich et al. 1999). Our data suggest that the transmission of the c-Met signals that induces delamination of hypaxial muscle precursors and long-range migration requires the docking protein Gab1. The multiadaptor Gab1 binds directly and specifically to c-Met (Weidner et al. 1996) and, thus, is well suited for mediating such a characteristic biological response.

Upon phosphorylation by c-Met, Gab1 associates with several signaling proteins, like PI(3) kinase, Shc, CRKL, and Shp2 (Holgado-Madruga et al. 1996; Maroun et al. 1999; Sakkab et al. 2000; Schaeper et al. 2000). Which substrates are required downstream of Gab1 for the migration of muscle precursor cells in vivo is currently unknown. In vitro studies showed that the association of Gab1 with Shp2 and PI(3) kinase is required for c-Met–induced branching morphogenesis and dissociation/scattering of epithelial cells, respectively (Khwaja et al. 1998; Schaeper et al. 2000). In addition, the ras MAPK pathway is involved in cell scattering (Hartmann et al. 1994; Ridley et al. 1995; Khwaja et al. 1998). Shp2, a tyrosine phosphatase, positively regulates the MAPK cascade and cell migration (Bennett et al. 1996; Saxton et al. 1997; Yu et al. 1998). Gene ablation of Shp2 demonstrates its role in many developmental processes, including morphogenic movements at gastrulation (Saxton et al. 1997; Qu et al. 1998; Saxton and Pawson 1999). However, in Shp2–/– mice, somite differentiation is disturbed (Saxton et al. 1997), which interferes with the analysis of a Shp2 function in migration of muscle precursors. Thus, Shp2 is a candidate substrate, which is downstream of Gab1, for the HGF/SF/c-Met signaling cascade that controls migration in vivo.

In Gab1–/– embryos, the migration of muscle precursor cells into limbs and the diaphragm is strongly reduced, but not completely blocked as it is in HGF/SF–/–, c-Met–/–, and compound Gab1–/–:c-Met+/– embryos, or in embryos that carry homozygous mutations in the bivalent docking site of c-Met (Bladt et al. 1995; Schmidt et al. 1995; Uehara et al. 1995; Maina et al. 1996). Apparently, c-Met can transmit some signals in the absence of Gab1. The multiple docking site of c-Met binds not only Gab1, but can also directly associate with signaling molecules like p85 PI(3) kinase, Shc, phospholipase C{gamma}, and Shp2, which are also recruited by Gab1 (Ponzetto et al. 1994; Zhu et al. 1994; Fixman et al. 1995; Pelicci et al. 1995; Schaeper et al. 2000). Moreover, it is possible that additional docking proteins contribute to the transmission of the c-Met signal that controls migration of muscle precursor cells. A Gab1 homologue, p97/Gab2, has been identified recently (Gu et al. 1998). p97/Gab2 does not associate directly with c-Met and would have to be recruited indirectly, possibly via the Grb2 adapter (Schaeper et al. 2000).

In contrast, embryonic death of Gab1–/– mice occurs during a very similar time window as the death of HGF/SF–/–, c-Met–/–, and c-Met point mutant mice, that lack the multiple docking site, Y1349F and Y1356F (Bladt et al. 1995; Schmidt et al. 1995; Uehara et al. 1995; Maina et al. 1996). Also, we detected no differences in the placental and liver phenotypes between Gab1–/– and c-Met–/– mice. In the placenta, the labyrinth layer, but no other layer, is severely affected, which may cause the death of the mutant embryos. Thus, Gab1 is the essential substrate of c-Met in the placenta and liver. Selective mutation of the Grb2 binding site in c-Met, Y1356VNV->Y1356VHV, affects the formation of skeletal muscles derived from migratory precursor cells, but does not cause embryonic lethality and has no effect on liver development (Maina et al. 1996). This suggests that the coupling of c-Met to Gab1 via Y1349, the major Gab1 binding site of c-Met (Weidner et al. 1996), is sufficient for c-Met–induced proliferation and survival, whereas the coupling of c-Met to both Gab1 and Grb2 is required for efficient migration of myogenic precursor cells.

A number of genetic experiments show the importance of specific docking proteins in the signaling of receptor tyrosine kinases. DOS (daughter of sevenless), which encodes a Gab1 homologue in Drosophila (the Drosophila genome does not contain a c-Met gene), was identified in a genetic screen for downstream signaling components of the receptor tyrosine kinase sevenless (Herbst et al. 1996; Raabe et al. 1996). Here, we showed that Gab1 plays an essential role in c-Met signaling in the mouse. Mice with targeted disruption of the IRS-2 gene, which encodes a protein with a similar domain structure as Gab1, develop diabetes, demonstrating a role for this docking protein in the signaling of the insulin and insulin-like growth factor receptors (Withers et al. 1998, Withers et al. 1999). A disruption of the LAT (linker for activation of T cells) gene in mice, which encodes a transmembrane docking protein, demonstrates its essential role in T cell activation and development (Zhang et al. 1998). Thus, evidence obtained by genetic experiments in mammals supports the notion that specific tyrosine kinases use specific docking proteins.


   Acknowledgments
 
We thank Drs. Michael Wegner and Dieter Riethmacher (Zentrum für Molekulare Neurobiologie, Hamburg, Germany), Dr. Uwe Borgmeyer (Department of Cell Biology, Emory University, Atlanta, GA) and Dr. Georg Breier (Max-Planck-Institute for Physiological and Clinical Research, Bad Nauheim, Germany) for providing cDNA probes for in situ hybridization.

We thank the Deutsche Forschungsgemeinschaft for their financial support.

Submitted: 16 March 2000

Revised: 25 July 2000

Accepted: 1 August 2000

Abbreviations used in this paper: ES, embryonic stem; PH, pleckstrin homology.


   References
 Top
 Abstract
 Introduction
 Materials and Methods
 Results
 Discussion
 References
 

Anson-Cartwright L. Dawson K. Holmyard D. Fisher S.J. Lazzarini R.A. Cross J.C. The glial cells missing-1 protein is essential for branching morphogenesis in the chorioallantoic placenta, Nat. Genet., 25, 2000, 311–314.[Medline]

Bardelli A. Longati P. Gramaglia D. Stella M.C. Comoglio P.M.. Gab1 coupling to the HGF/Met receptor multifunctional docking site requires binding of Grb2 and correlates with the transforming potential, Oncogene., 15, 1997, 3103–3111.[Medline]

Bennett A.M. Hausdorff S.F. O'Reilly A.M. Freeman R.M. Neel B.G.. Multiple requirements for SHPTP2 in epidermal growth factor-mediated cell cycle progression, Mol. Cell. Biol., 16, 1996, 1189–1202.[Abstract]

Birchmeier C. Birchmeier W.. Molecular aspects of mesenchymal-epithelial interactions, Annu. Rev. Cell Biol., 9, 1993, 511–540.

Bladt F. Riethmacher D. Isenmann S. Aguzzi A. Birchmeier C.. Essential role for the c-met receptor in the migration of myogenic precursor cells into the limb bud, Nature., 376, 1995, 768–771.[Medline]

Breier G. Clauss M. Risau W.. Coordinate expression of vascular endothelial growth factor receptor-1 (flt-1) and its ligand suggests a paracrine regulation of murine vascular development, Dev. Dyn., 204, 1995, 228–239.[Medline]

Brohmann H. Jagla K. Birchmeier C.. The role of Lbx1 in migration of muscle precursor cells, Development., 127, 2000, 437–445.[Abstract]

Carpino N. Wisniewski D. Strife A. Marshak D. Kobayashi R. Stillman B. Clarkson B.. p62(dok)a constitutively tyrosine-phosphorylated, GAP-associated protein in chronic myelogenous leukemia progenitor cells, Cell., 88, 1997, 197–204.[Medline]

Chevallier A. Kieny M. Mauger A.. Limb-somite relationshiporigin of the limb musculature, J. Embryol. Exp. Morphol., 41, 1977, 245–258.[Medline]

Christ B. Jacob H.J. Jacob M.. Experimental analysis of the origin of the wing musculature in avian embryos, Anat. Embryol., 150, 1977, 171–186.[Medline]

Cossu G. Tajbakhsh S. Buckingham M.. How is myogenesis initiated in the embryo?, Trends Genet., 12, 1996, 218–223.[Medline]

Daston G. Lamar E. Olivier M. Goulding M.. Pax-3 is necessary for migration but not differentiation of limb muscle precursors in the mouse, Development., 122, 1996, 1017–1027.[Abstract]

Dietrich S. Schubert F.R. Healy C. Sharpe P.T. Lumsden A.. Specification of the hypaxial musculature, Development., 125, 1998, 2235–2249.[Abstract]

Dietrich S. Abou R.F. Brohmann H. Bladt F. Sonnenberg-Riethmacher E. Yamaai T. Lumsden A. Brand S.B. Birchmeier C.. The role of SF/HGF and c-Met in the development of skeletal muscle, Development., 126, 1999, 1621–1629.[Abstract]

Di Renzo M.F. Narsimhan R.P. Olivero M. Bretti S. Giordano S. Medico E. Gaglia P. Zara P. Comoglio P.M.. Expression of the Met/HGF receptor in normal and neoplastic human tissues, Oncogene., 6, 1991, 1997–2003.[Medline]

Echelard Y. Epstein D.J. St. Jacques B. Shen L. Mohler J. McMahon J.A. McMahon A.P.. Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity, Cell., 75, 1993, 1417–1430.[Medline]

Epstein J.A. Shapiro D.N. Cheng J. Lam P.Y. Maas R.L.. Pax3 modulates expression of the c-Met receptor during limb muscle development, Proc. Natl. Acad. Sci. USA., 93, 1996, 4213–4218.[Abstract/Free Full Text]

Fixman E.D. Naujokas M.A. Rodrigues G.A. Moran M.F. Park M.. Efficient cell transformation by the Tpr-Met oncoprotein is dependent upon tyrosine 489 in the carboxy-terminus, Oncogene., 10, 1995, 237–249.[Medline]

Gherardi E. Stoker M.. Hepatocyte growth factor—scatter factormitogen, motogen, and met, Cancer Cells, 3, 1991, 227–232.[Medline]

Giordano S. Bardelli A. Zhen Z. Menard S. Ponzetto C. Comoglio P.M.. A point mutation in the MET oncogene abrogates metastasis without affecting transformation, Proc. Natl. Acad. Sci. USA., 94, 1997, 13868–13872.[Abstract/Free Full Text]

Gu H. Pratt J.C. Burakoff S.J. Neel B.G.. Cloning of p97/Gab2, the major SHP2-binding protein in hematopoietic cells, reveals a novel pathway for cytokine-induced gene activation, Mol. Cell., 2, 1998, 729–740.[Medline]

Hartmann G. Weidner K.M. Schwarz H. Birchmeier W.. The motility signal of scatter factor/hepatocyte growth factor mediated through the receptor tyrosine kinase met requires intracellular action of Ras, J. Biol. Chem., 269, 1994, 21936–21939.[Abstract/Free Full Text]

Herbst R. Carroll P.M. Allard J.D. Schilling J. Raabe T. Simon M.A.. Daughter of sevenless is a substrate of the phosphotyrosine phosphatase Corkscrew and functions during sevenless signaling, Cell., 85, 1996, 899–909.[Medline]

Hogan B. Beddington R. Costantini F. Lacy E., Manipulating the Mouse EmbryoA Laboratory Manual, 1994 Cold Spring Harbor Laboratory Press Cold Spring Harbor, New Yorkpp. 497.

Holder N. Klein R. Eph receptors and ephrinseffectors of morphogenesis, Development., 126, 1999, 2033–2044.[Abstract]

Holgado-Madruga M. Emlet D.R. Moscatello D.K. Godwin A.K. Wong A.J.. A Grb2-associated docking protein in EGF- and insulin-receptor signalling, Nature., 379, 1996, 560–564.[Medline]

Holgado-Madruga M. Moscatello D.K. Emlet D.R. Dieterich R. Wong A.J.. Grb2-associated binder-1 mediates phosphatidylinositol 3-kinase activation and the promotion of cell survival by nerve growth factor, Proc. Natl. Acad. Sci. USA., 94, 1997, 12419–12424.[Abstract/Free Full Text]

Ingham R.J. Holgado-Madruga M. Siu C. Wong A.J. Gold M.R.. The Gab1 protein is a docking site for multiple proteins involved in signaling by the B cell antigen receptor, J. Biol. Chem., 273, 1998, 30630–30637.[Abstract/Free Full Text]

Jagla K. Dolle P. Mattei M.G. Jagla T. Schuhbaur B. Dretzen G. Bellard F. Bellard M.. Mouse Lbx1 and human LBX1 define a novel mammalian homeobox gene family related to the Drosophila lady bird genes, Mech. Dev., 53, 1995, 345–356.[Medline]

Jeffers M. Rong S. Anver M. Vande-Woude G.F.. Autocrine hepatocyte growth factor/scatter factor-Met signaling induces transformation and the invasive/metastastic phenotype in C127 cells, Oncogene., 13, 1996, 853–856.[Medline]

Jeffers M. Schmidt L. Nakaigawa N. Webb C.P. Weirich G. Kishida T. Zbar B. Vande-Woude G.F.. Activating mutations for the met tyrosine kinase receptor in human cancer, Proc. Natl. Acad. Sci. USA., 94, 1997, 11445–11450.[Abstract/Free Full Text]

Jindo T. Tsuboi R. Takamori K. Ogawa H.. Local injection of hepatocyte growth factor/scatter factor (HGF/SF) alters cyclic growth of murine hair follicles, J. Invest. Dermatol., 110, 1998, 338–342.[Medline]

Karlsson L. Bondjers C. Betsholtz C.. Roles for PDGF-A and sonic hedgehog in development of mesenchymal components of the hair follicle, Development., 126, 1999, 2611–2621.[Abstract]

Khwaja A. Lehmann K. Marte B.M. Downward J.. Phosphoinositide 3-kinase induces scattering and tubulogenesis in epithelial cells through a novel pathway, J. Biol. Chem., 273, 1998, 18793–18801.[Abstract/Free Full Text]

Kouhara H. Hadari Y.R. Spivak K.T. Schilling J. Bar S.D. Lax I. Schlessinger J.. A lipid-anchored Grb2-binding protein that links FGF-receptor activation to the Ras/MAPK signaling pathway, Cell., 89, 1997, 693–702.[Medline]

Lecoq-Lafon C. Verdier F. Fichelson S. Chretien S. Gisselbrecht S. Lacombe C. Mayeux P.. Erythropoietin induces the tyrosine phosphorylation of GAB1 and its association with SHC, SHP2, SHIP, and phosphatidylinositol 3-kinase, Blood., 93, 1999, 2578–2585.[Abstract/Free Full Text]

Lemke G.. Neuregulins in development, Mol. Cell. Neurosci., 7, 1996, 247–262.[Medline]

Lindner G. Menrad A. Gherardi E. Merlino G. Welker P. Handjiski B. Roloff B. Paus R.. Involvement of hepatocyte growth factor/scatter factor and met receptor signaling in hair follicle morphogenesis and cycling, FASEB (Fed. Am. Soc. Exp. Biol.) J., 14, 2000, 319–332.[Abstract/Free Full Text]

Maina F. Casagranda F. Audero E. Simeone A. Comoglio P.M. Klein R. Ponzetto C.. Uncoupling of Grb2 from the Met receptor in vivo reveals complex roles in muscle development, Cell., 87, 1996, 531–542.[Medline]

Maroun C.R. Holgado M.M. Royal I. Naujokas M.A. Fournier T.M. Wong A.J. Park M.. The Gab1 PH domain is required for localization of Gab1 at sites of cell-cell contact and epithelial morphogenesis downstream from the met receptor tyrosine kinase, Mol. Cell. Biol., 19, 1999, 1784–1799.[Abstract/Free Full Text]

Meiners S. Brinkmann V. Naundorf H. Birchmeier W.. Role of morphogenetic factors in metastasis of mammary carcinoma cells, Oncogene., 16, 1998, 9–20.[Medline]

Mennerich D. Schafer K. Braun T.. Pax-3 is necessary but not sufficient for lbx1 expression in myogenic precursor cells of the limb, Mech. Dev., 73, 1998, 147–158.[Medline]

Montesano R. Matsumoto K. Nakamura T. Orci L.. Identification of a fibroblast-derived epithelial morphogen as hepatocyte growth factor, Cell., 67, 1991, 901–908.[Medline]

Morasso M.I. Grinberg A. Robinson G. Sargent T.D. Mahon K.A.. Placental failure in mice lacking the homeobox gene Dlx3, Proc. Natl. Acad. Sci. USA., 96, 1999, 162–167.[Abstract/Free Full Text]

Ohlsson R. Falck P. Hellstrom M. Lindahl P. Bostrom H. Franklin G. Ahrlund R.L. Pollard J. Soriano P. Betsholtz C.. PDGFB regulates the development of the labyrinthine layer of the mouse fetal placenta, Dev. Biol., 212, 1999, 124–136.[Medline]

Pachnis V. Durbec P. Taraviras S. Grigoriou M. Natarajan D.. III. Role of the RET signal transduction pathway in development of the mammalian enteric nervous system, Am. J. Physiol, 275, 1998, G183–G186.[Medline]

Park M. Dean M. Cooper C.S. Schmidt M. O'Brien S.J. Blair D.G. Vande-Woude G.F.. Mechanism of met oncogene activation, Cell, 45, 1986, 895–904.[Medline]

Pelicci G. Giordano S. Zhen Z. Salcini A.E. Lanfrancone L. Bardelli A. Panayotou G. Waterfield M.D. Ponzetto C. Pelicci P.G.. The motogenic and mitogenic responses to HGF are amplified by the Shc adaptor protein, Oncogene., 10, 1995, 1631–1638.[Medline]

Ponzetto C. Bardelli A. Zhen Z. Maina F. Dallazonca P. Giordano S. Graziani A. Panayotou G. Comoglio P.M.. A multifunctional docking site mediates signaling and transformation by the hepatocyte growth factor scatter factor receptor family, Cell., 77, 1994, 261–271.[Medline]

Qu C.K. Yu W.M. Azzarelli B. Cooper S. Broxmeyer H.E. Feng G.S.. Biased suppression of hematopoiesis and multiple developmental defects in chimeric mice containing Shp-2 mutant cells, Mol. Cell Biol., 18, 1998, 6075–6082.[Abstract/Free Full Text]

Raabe T. Riesgo E.J. Liu X. Bausenwein B.S. Deak P. Maroy P. Hafen E.. DOS, a novel pleckstrin homology domain-containing protein required for signal transduction between sevenless and Ras1 in Drosophila, Cell., 85, 1996, 911–920.[Medline]

Ridley A.J. Comoglio P.M. Hall A.. Regulation of scatter factor/hepatocyte growth factor responses by Ras, Rac, and Rho in MDCK cells, Mol. Cell. Biol., 15, 1995, 1110–1122.[Abstract]

Riethmacher D. Brinkmann V. Birchmeier C.. A targeted mutation in the mouse E-cadherin gene results in defective preimplantation development, Proc. Natl. Acad. Sci. USA., 92, 1995, 855–859.[Abstract/Free Full Text]

Rodrigues G.A. Falasca M. Zhang Z. Ong S.H. Schlessinger J.. A novel positive feedback loop mediated by the docking protein Gab1 and phosphatidylinositol 3-kinase in epidermal growth factor receptor signaling, Mol. Cell. Biol., 20, 2000, 1448–1459.[Abstract/Free Full Text]

Sachs M. Weidner K.M. Brinkmann V. Walther I. Obermeier A. Ullrich A. Birchmeier W.. Motogenic and morphogenic activity of epithelial receptor tyrosine kinases, J. Cell Biol., 133, 1996, 1095–1107.[Abstract/Free Full Text]

Sakata H. Takayama H. Sharp R. Rubin J.S. Merlino G. LaRochelle W.J.. Hepatocyte growth factor/scatter factor overexpression induces growth, abnormal development, and tumor formation in transgenic mouse livers, Cell Growth Differ., 7, 1996, 1513–1523.[Abstract]

Sakkab D. Lewitzky M. Posern G. Schaeper U. Sachs M. Birchmeier W. Feller S.M.. Signaling of hepatocyte growth factor/scatter factor (HGF) to the small GTPase Rap1 via the large docking protein Gab1 and the adapter protein CRKL, J. Cell Biol., 275, 2000, 10772–10778.

Saxton T.M. Pawson T.. Morphogenetic movements at gastrulation require the SH2 tyrosine phosphatase Shp2, Proc. Natl. Acad. Sci. USA., 96, 1999, 3790–3795.[Abstract/Free Full Text]

Saxton T.M. Henkemeyer M. Gasca S. Shen R. Rossi D.J. Shalaby F. Feng G.S. Pawson T.. Abnormal mesoderm patterning in mouse embryos mutant for the SH2 tyrosine phosphatase Shp-2, EMBO (Eur. Mol. Biol. Organ.) J., 16, 1997, 2352–2364.[Medline]

Schaeper U. Gehring N.H. Fuchs K.-P. Sachs M. Kempkes B.B.W.. Coupling of Gab1 to c-Met, Grb2 and downstream effectors mediates biological responses, J. Cell Biol., 149, 2000, 1419–1432.[Abstract/Free Full Text]

Schlessinger J. Ullrich A.. Growth factor signaling by receptor tyrosine kinases, Neuron., 9, 1992, 383–391.[Medline]

Schmidt C. Bladt F. Goedecke S. Brinkmann V. Zschiesche W. Sharpe M. Gherardi E. Birchmeier C.. Scatter factor/hepatocyte growth factor is essential for liver development, Nature., 373, 1995, 699–702.[Medline]

Schmidt L. Junker K. Weirich G. Glenn G. Choyke P. Lubensky I. Zhuang Z. Jeffers M. Vande-Woude G. Neumann H.. Two North American families with hereditary papillary renal carcinoma and identical novel mutations in the MET proto-oncogene, Cancer Res., 58, 1998, 1719–1722.[Abstract/Free Full Text]

Sonnenberg-Riethmacher E. Walter B. Riethmacher D. Goedecke S. Birchmeier C.. The c-ros tyrosine kinase receptor controls regionalization and differentiation of epithelial cells in the epididymis, Genes Dev., 10, 1996, 1184–1193.[Abstract/Free Full Text]

Stoker M. Gherardi E. Perryman M. Gray J.. Scatter factor is a fibroblast-derived modulator of epithelial cell mobility, Nature., 327, 1987, 239–242.[Medline]

Takahashi-Tezuka M. Yoshida Y. Fukada T. Ohtani T. Yamanaka Y. Nishida K. Nakajima K. Hibi M. Hirano T.. Gab1 acts as an adapter molecule linking the cytokine receptor gp130 to ERK mitogen-activated protein kinase, Mol. Cell. Biol., 18, 1998, 4109–4117.[Abstract/Free Full Text]

Takayama H. LaRochelle W.J. Sharp R. Otsuka T. Kriebel P. Anver M. Aaronson S.A. Merlino G.. Diverse tumorigenesis associated with aberrant development in mice overexpressing hepatocyte growth factor/scatter factor, Proc. Natl. Acad. Sci. USA., 94, 1997, 701–706.[Abstract/Free Full Text]

Uehara Y. Minowa O. Mori C. Shiota K. Kuno J. Noda T. Kitamura N.. Placental defect and embryonic lethality in mice lacking hepatocyte growth factor/scatter factor, Nature., 373, 1995, 702–705.[Medline]

van der Geer P. Hunter T. Lindberg R.A.. Receptor protein-tyrosine kinases and their signal transduction pathways, Annu. Rev. Cell Biol., 10, 1994, 251–337.

Voliovitch H. Schindler D.G. Hadari Y.R. Taylor S.I. Accili D. Zick Y.. Tyrosine phosphorylation of insulin receptor substrate-1 in vivo depends upon the presence of its pleckstrin homology region, J. Biol. Chem., 270, 1995, 18083–18087.[Abstract/Free Full Text]

Weidner K.M. Behrens J. Vandekerckhove J. Birchmeier W.. Scatter factormolecular characteristics and effect on the invasiveness of epithelial cells, J. Cell Biol., 111, 1990, 2097–2108.[Abstract/Free Full Text]

Weidner K.M. Sachs M. Birchmeier W.. The Met receptor tyrosine kinase transduces motility, proliferation, and morphogenic signals of scatter factor/hepatocyte growth factor in epithelial cells, J. Cell Biol., 121, 1993, 145–154.[Abstract/Free Full Text]

Weidner K.M. Sachs M. Riethmacher D. Birchmeier W.. Mutation of juxtamembrane tyrosine residue 1001 suppresses loss-of-function mutations of the met receptor in epithelial cells, Proc. Natl. Acad. Sci. USA., 92, 1995, 2597–2601.[Abstract/Free Full Text]

Weidner K.M. Di Cesare S. Sachs M. Brinkmann V. Behrens J. Birchmeier W.. Interaction between Gab1 and the c-Met receptor tyrosine kinase is responsible for epithelial morphogenesis, Nature., 384, 1996, 173–176.[Medline]

Wilkinson D.G., In Situ HybridizationA Practical Approach, 1992 Oxford University Press/IRL Press Oxfordpp. 163.

Withers D.J. Gutierrez J.S. Towery H. Burks D.J. Ren J.M. Previs S. Zhang Y. Bernal D. Pons S. Shulman G.I. Bonner W.S. White M.F. Disruption of IRS-2 causes type 2 diabetes in mice, Nature., 391, 1998, 900–904.[Medline]

Withers D.J. Burks D.J. Towery H.H. Altamuro S.L. Flint C.L. White M.F.. Irs-2 coordinates Igf-1 receptor-mediated beta-cell development and peripheral insulin signalling, Nat. Genet., 23, 1999, 32–40.[Medline]

Yamanashi Y. Baltimore D.. Identification of the Abl- and rasGAP-associated 62 kDa protein as a docking protein, Dok, Cell., 88, 1997, 205–211.[Medline]

Yang X.M. Vogan K. Gros P. Park M.. Expression of the met receptor tyrosine kinase in muscle progenitor cells in somites and limbs is absent in Splotch mice, Development., 122, 1996, 2163–2171.[Abstract]

Yu D.H. Qu C.K. Henegariu O. Lu X. Feng G.S.. Protein-tyrosine phosphatase Shp-2 regulates cell spreading, migration, and focal adhesion, J. Biol. Chem., 273, 1998, 21125–21131.[Abstract/Free Full Text]

Zhang W. Sloan L.J. Kitchen J. Trible R.P. Samelson L.E.. LATthe ZAP-70 tyrosine kinase substrate that links T cell receptor to cellular activation, Cell., 92, 1998, 83–92.[Medline]

Zhu H. Naujokas M.A. Fixman E.D. Torossian K. Park M.. Tyrosine 1356 in the carboxyl-terminal tail of the HGF SF receptor is essential for the transduction of signals for cell motility and morphogenesis, J. Biol. Chem., 269, 1994, 29943–29948.[Abstract/Free Full Text]

Zhuang Z. Park W.S. Pack S. Schmidt L. Vortmeyer A.O. Pak E. Pham T. Weil R.J. Candidus S. Lubensky I.A.. Trisomy 7-harboring non-random duplication of the mutant MET allele in hereditary papillary renal carcinomas, Nat. Genet., 20, 1998, 66–69.[Medline]


Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Facebook Facebook   Add to Reddit Reddit   Add to Technorati Technorati   Add to Twitter Twitter    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF, 626K)
Right arrow PPT slides of all figures
Right arrow Alert me when this article is cited
Right arrow Citation Map
Services
Right arrow Email this article
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new content in the JCB
Right arrow Download to citation manager
Citing Articles
Right arrow Citing Articles via CrossRef
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sachs, M.
Right arrow Articles by Birchmeier, W.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sachs, M.
Right arrow Articles by Birchmeier, W.
Right arrowPubmed/NCBI databases
*Gene*GEO Profiles
*HomoloGene*Protein
*UniGene
*Substance via MeSH
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Facebook   Add to Reddit   Add to Technorati   Add to Twitter  
What's this?


  Home | Help | Feedback | Subscriptions | Archive | Search | Table of Contents