|
||
© The Rockefeller University Press,
0021-9525/2000//1375 $5.00
The Journal of Cell Biology, Volume 150, Number 6,
, 2000 1375-1384
Original Article |
Essential Role of Gab1 for Signaling by the C-Met Receptor in Vivo
The docking protein Gab1 binds phosphorylated c-Met receptor tyrosine kinase directly and mediates signals of c-Met in cell culture. Gab1 is phosphorylated by c-Met and by other receptor and nonreceptor tyrosine kinases. Here, we report the functional analysis of Gab1 by targeted mutagenesis in the mouse, and compare the phenotypes of the Gab1 and c-Met mutations. Gab1 is essential for several steps in development: migration of myogenic precursor cells into the limb anlage is impaired in Gab1–/– embryos. As a consequence, extensor muscle groups of the forelimbs are virtually absent, and the flexor muscles reach less far. Fewer hindlimb muscles exist, which are smaller and disorganized. Muscles in the diaphragm, which also originate from migratory precursors, are missing. Moreover, Gab1–/– embryos die in a broad time window between E13.5 and E18.5, and display reduced liver size and placental defects. The labyrinth layer, but not the spongiotrophoblast layer, of the placenta is severely reduced, resulting in impaired communication between maternal and fetal circulation. Thus, extensive similarities between the phenotypes of c-Met and HGF/SF mutant mice exist, and the muscle migration phenotype is even more pronounced in Gab1–/–:c-Met+/– embryos. This is genetic evidence that Gab1 is essential for c-Met signaling in vivo. Analogy exists to signal transmission by insulin receptors, which require IRS1 and IRS2 as specific docking proteins.
Key Words: hepatocyte growth factor gene targeting migration of muscle precursors placenta development liver development
© 2000 The Rockefeller University Press
| Introduction |
|---|
|
|
|---|
Various cellular responses are observed when the c-Met receptor is activated by its specific ligand HGF/SF in cell culture that depend on the cell type used as well as on the exact culture condition. Epithelial cells can respond by scattering, motility or invasiveness, by growth, as well as by formation of branched tubular structures (Stoker et al. 1987; Weidner et al. 1990, Weidner et al. 1993; Gherardi and Stoker 1991; Montesano et al. 1991). The c-Met receptor was initially identified because of its oncogenic potential when mutated (Park et al. 1986), and various evidence implies HGF/SF and c-Met in tumorigenesis and metastasis (Di Renzo et al. 1991; Jeffers et al. 1996, Jeffers et al. 1997; Sakata et al. 1996; Meiners et al. 1998; Takayama et al. 1997). Activating mutations in the c-Met gene are observed in hereditary renal papillary carcinomas in humans (Schmidt et al. 1998; Zhuang et al. 1998).
Two phosphorylated tyrosyl residues in c-Met, Y1349 and Y1356, are essential for its function in vitro and in vivo (Ponzetto et al. 1994; Fixman et al. 1995; Weidner et al. 1995; Maina et al. 1996; Sachs et al. 1996; Giordano et al. 1997). These residues constitute a bivalent docking site that recruits various signaling and adapter proteins like PI(3) kinase, phospholipase C
, Src, Shc, Grb2, and Gab1 (Ponzetto et al. 1994; Zhu et al. 1994; Fixman et al. 1995; Pelicci et al. 1995; Weidner et al. 1996). Gab1 requires Y1349 and, to a lesser degree Y1356, for binding to the c-Met receptor (Holgado-Madruga et al. 1996; Weidner et al. 1996). Gab1 is a member of the family of docking proteins that include insulin receptor substrates (IRS-1, IRS2, and IRS-3), FGF receptor substrate (FRS-2/SNT1), the p62dok subfamily, Drosophila DOS (daughter of sevenless), and linker for activation of T cells (Voliovitch et al. 1995; Herbst et al. 1996; Raabe et al. 1996; Carpino et al. 1997; Kouhara et al. 1997; Yamanashi and Baltimore 1997; Gu et al. 1998; Zhang et al. 1998). These proteins are characterized by an NH2-terminal pleckstrin homology (PH) domain or myristilation sequence, a central phosphotyrosyl binding domain (usually PTP) and multiple tyrosyl residues that function as docking sites for SH2 domain–containing molecules. Unique to Gab1 is a novel phosphotyrosyl recognition domain that mediates the binding to phosphorylated c-Met (Weidner et al. 1996; Schaeper et al. 2000). Gab1 is not only phosphorylated by c-Met, but is also indirectly activated by other tyrosine kinases. Extracellular stimuli like EGF, insulin, IL3, IL6, Epo1, or the activation of the B cell receptor result in phosphorylation of Gab1 (Holgado-Madruga et al. 1996; Ingham et al. 1998; Takahashi-Tezuka et al. 1998; Lecoq-Lafon et al. 1999; Rodrigues et al. 2000). PI(3) kinase, Shc, Shp2, and CRKL are direct interaction partners of Gab1 (Holgado-Madruga et al. 1996; Bardelli et al. 1997; Maroun et al. 1999; Schaeper et al. 2000). Association of Gab1 with Shp-2 is essential for the formation of branched tubules by cultured MDCK epithelial cells (Schaeper et al. 2000). Association of Gab1 with PI(3) kinase is important for the prevention of apoptosis (Holgado-Madruga et al. 1997). The PH domain of Gab1 mediates Gab1 translocation to the plasma membrane in response to EGF (Maroun et al. 1999; Rodrigues et al. 2000). Together, these data obtained by in vitro experiments imply Gab1 in the signaling of different tyrosine kinases, which recruit Gab1 either directly or indirectly. Indeed, whether Gab1 plays a functional role in various pathways in vivo is the focus of this work.
Targeted mutations of the HGF/SF and c-Met genes in mice cause identical phenotypes, i.e., embryonal lethality due to a severe deficit in development of the placenta (Bladt et al. 1995; Schmidt et al. 1995; Uehara et al. 1995). Such animals also display a reduced liver size and, remarkably, lack particular muscle groups like the muscles of extremities, diaphragm, and tongue. These muscles derive from a migrating precursor population. In c-Met or HGF/SF mutant mice, migration of myogenic precursor cells is defective: the precursors remain in the dermomyotome, a derivative of the somite, and do not migrate to their targets in the limbs, branchial arches, and the septum transversum (Bladt et al. 1995; Dietrich et al. 1999).
Here, we examined the function of Gab1 in mice by generating a targeted mutation using embryonic stem (ES) cell technology. A fundamental role of Gab1 for c-Met–specific signaling was found: Gab1–/– mutant embryos are characterized by embryonal lethality (because of placental defects), by reduced liver size, and by reduced and delayed migration of myogenic precursor cells. This is reminiscent of the phenotype of HGF/SF–/– and c-Met–/– mutant embryos. Therefore, our data demonstrate that in vivo Gab1 is an essential mediator of c-Met receptor signals.
| Materials and Methods |
|---|
|
|
|---|
FIXII 129/Ola library were introduced into the pTV0 vector (Riethmacher et al. 1995). The Gab1 vector contained at the 5' end a 1.5-kb genomic sequence ending with codon 26 of Gab1, which was fused in-frame with the β-galactosidase gene that harbors a nuclear localization signal. At the 3' end, a genomic 10-kb BamHI fragment is present in the vector. Linearized targeting vector was introduced into E14-1 ES cells by electroporation. Homologous recombination events were enriched by selection with G418 and gancyclovir. The structure of the mutant locus and the absence of additional integration events were verified by Southern hybridization. Several independent ES cell clones were used to generate chimeric mice by blastocyst injection as previously described (Riethmacher et al. 1995). Two independent mouse lines with mutated Gab1 were obtained, and analyzed on a mixed 129/C57Bl6 background. Mice and embryos were genotyped by β-galactosidase staining of ear tissue as previously described (Hogan et al. 1994) or by PCR using DNA from the tail or visceral yolk sac. PCR primers, PCR1 (CCCTTTGTGGATGGCTTCTTTGT, 300 nM) and PCR2 (TTCTTGGCATGATCGTTTTTGTAA, 300 nM) specific for the wild-type allele, and KO2s (GGATCCCGTCGTTTTACAACG, 240 nM) and KO2as (ACCACAGATGAAACGCGGAGT, 240 nM) specific for the mutated allele were used in a combined reaction in Taq buffer (1.5 mM MgCl2, 0.2 mM dNTPs, and 1.6 U Taq polymerase; GIBCO BRL). Amplification of mutant and wild-type Gab1 alleles generated diagnostic bands of 450 and 336 bp, respectively.
Western Blot Analysis
E14.5 embryos were lysed in Triton buffer (50 mM Hepes, pH 7.5, 150 mM NaCl, 1% Triton X-100, 10% glycerol, 1 mM EDTA, and 1 mM PMSF). 10 µg of the lysate was subjected to 7.5% SDS-PAGE and transferred to nitrocellulose membranes. Membranes were blocked with PBS-milk (PBS with 5% nonfat dry milk), washed, and incubated overnight with anti–mouse Gab1 antibodies (
-mGab1, 1:500; see below) or anti–human Gab1 (
-hGab1, 1:400, against the COOH-terminal amino acids 664–694; Upstate Biotechnology). HRP-conjugated goat anti–rabbit IgG (1:1,500) and enhanced chemiluminescence substrate (Amersham Pharmacia Biotech) were used for detection of Gab1 protein. The antiserum against mouse Gab1 was produced in rabbits, using the Met binding domain of mouse Gab1 (amino acids 391–541) as the antigen, and affinity-purified.
In Situ Hybridization Analysis and Histological Analysis
Whole mount in situ hybridization using Lbx1 and SHH as probes was performed as previously described (Wilkinson 1992; Echelard et al. 1993; Brohmann et al. 2000). Placentas of E13.5 embryos were immediately frozen in Tissue Tek and cryo-sectioned (12 µm). In situ hybridization was performed with 35S-labeled probes (Dlx3 or Gcm1) or digoxyginin-labeled probes (Flt1) as previously described (Sonnenberg-Riethmacher et al. 1996). For monitoring development, tissues were fixed in 4% formaldehyde, embedded in paraplast (Oxford Labware), and 7-µm sections were prepared and counterstained with hematoxylin-eosin. Immunohistochemistry of muscle tissue was performed using a 1:2,000 dilution of monoclonal anti–skeletal fast myosin antibody (Sigma M4276) and a 1:100 dilution of the secondary antibody, alkaline phosphatase conjugated anti–mouse IgG (Jackson ImmunoResearch Laboratories). 1% orange G was used as a histological counterstain. The sections were examined by light microscopy (Zeiss Axiovert), scanned by a ProgRes 3012 videocamera (Jenaoptik), and processed using Adobe Photoshop 4.0 software.
| Results |
|---|
|
|
|---|
|
|
|
1.4 x 10–2). Thus, the size of the liver is markedly reduced in Gab1–/– embryos. A similar reduction in the ratio of liver to bodyweight is observed in c-Met–/– embryos at E14.5 (10.6 x 10–2, 9.8 x 10–2, and 5.3 x 10–2 in wild-type, c-Met+/–, and c-Met–/– embryos, respectively; C. Birchmeier, unpublished data).
Long-range Migration of Muscle Precursor Cells in Gab1 Mutant Embryos
Muscles of limbs, diaphragm, and the hypoglossal cord are generated by migrating precursor cells that delaminate from lateral dermomyotome, a derivative of the somite (Chevallier et al. 1977; Christ et al. 1977). The Lbx1 gene encodes a homeobox-containing transcription factor that is strongly expressed in migrating muscle precursor cells. These cells form distinct streams in the wild-type E10.25 embryo (Fig. 3, a and b, the upper arrowhead marks the hypoglossal stream, the lower arrowhead, the forelimb, and the arrow mark muscle precursors cells retained in the dermomyotome; Jagla et al. 1995; Dietrich et al. 1998). In c-Met or HGF/SF mutant mice, the muscle precursor cells remain in the dermomyotome and do not take up long-range migration (Fig. 3 d; Bladt et al. 1995). In Gab1–/– embryos, some delamination of myogenic precursor cells occurs, but is strongly reduced in efficiency (Fig. 3 c). Compared with control embryos, less cells have left the occipitally located somites in Gab1 mutants, and the precursor stream headed towards the floor of the branchial arches contains a reduced number of cells. Moreover, the occipital stream does not extend as far distally as in control embryos (Fig. 3 c, upper arrowhead). Similarly, much less precursor cells have reached the forelimb bud (Fig. 3 c, lower arrowhead). Impaired migration of muscle precursor cells into the forelimbs of Gab1–/– embryos is also evident in a dorsal view of the embryos (Fig. 3 f, compare with control embryos in e). Sections reveal a particularly pronounced reduction of precursor cells in the dorsal forelimb (Fig. 3g and Fig. h, arrow).
|
|
|
|
| Discussion |
|---|
|
|
|---|
Our work places Gab1 into the genetic hierarchy that controls the development of muscle derived from migratory precursors. The transcription factor Pax3 is essential for the formation and specification of migratory muscle precursors in the dermomyotome. It also induces expression of the Lbx1 and the c-Met genes. The precursor cells are primed to receive the HGF/SF signal, which is provided by mesenchymal cells close to the somites and along the migration routes (Cossu et al. 1996; Daston et al. 1996; Epstein et al. 1996; Yang et al. 1996; Mennerich et al. 1998; Dietrich et al. 1999). Our data suggest that the transmission of the c-Met signals that induces delamination of hypaxial muscle precursors and long-range migration requires the docking protein Gab1. The multiadaptor Gab1 binds directly and specifically to c-Met (Weidner et al. 1996) and, thus, is well suited for mediating such a characteristic biological response.
Upon phosphorylation by c-Met, Gab1 associates with several signaling proteins, like PI(3) kinase, Shc, CRKL, and Shp2 (Holgado-Madruga et al. 1996; Maroun et al. 1999; Sakkab et al. 2000; Schaeper et al. 2000). Which substrates are required downstream of Gab1 for the migration of muscle precursor cells in vivo is currently unknown. In vitro studies showed that the association of Gab1 with Shp2 and PI(3) kinase is required for c-Met–induced branching morphogenesis and dissociation/scattering of epithelial cells, respectively (Khwaja et al. 1998; Schaeper et al. 2000). In addition, the ras MAPK pathway is involved in cell scattering (Hartmann et al. 1994; Ridley et al. 1995; Khwaja et al. 1998). Shp2, a tyrosine phosphatase, positively regulates the MAPK cascade and cell migration (Bennett et al. 1996; Saxton et al. 1997; Yu et al. 1998). Gene ablation of Shp2 demonstrates its role in many developmental processes, including morphogenic movements at gastrulation (Saxton et al. 1997; Qu et al. 1998; Saxton and Pawson 1999). However, in Shp2–/– mice, somite differentiation is disturbed (Saxton et al. 1997), which interferes with the analysis of a Shp2 function in migration of muscle precursors. Thus, Shp2 is a candidate substrate, which is downstream of Gab1, for the HGF/SF/c-Met signaling cascade that controls migration in vivo.
In Gab1–/– embryos, the migration of muscle precursor cells into limbs and the diaphragm is strongly reduced, but not completely blocked as it is in HGF/SF–/–, c-Met–/–, and compound Gab1–/–:c-Met+/– embryos, or in embryos that carry homozygous mutations in the bivalent docking site of c-Met (Bladt et al. 1995; Schmidt et al. 1995; Uehara et al. 1995; Maina et al. 1996). Apparently, c-Met can transmit some signals in the absence of Gab1. The multiple docking site of c-Met binds not only Gab1, but can also directly associate with signaling molecules like p85 PI(3) kinase, Shc, phospholipase C
, and Shp2, which are also recruited by Gab1 (Ponzetto et al. 1994; Zhu et al. 1994; Fixman et al. 1995; Pelicci et al. 1995; Schaeper et al. 2000). Moreover, it is possible that additional docking proteins contribute to the transmission of the c-Met signal that controls migration of muscle precursor cells. A Gab1 homologue, p97/Gab2, has been identified recently (Gu et al. 1998). p97/Gab2 does not associate directly with c-Met and would have to be recruited indirectly, possibly via the Grb2 adapter (Schaeper et al. 2000).
In contrast, embryonic death of Gab1–/– mice occurs during a very similar time window as the death of HGF/SF–/–, c-Met–/–, and c-Met point mutant mice, that lack the multiple docking site, Y1349F and Y1356F (Bladt et al. 1995; Schmidt et al. 1995; Uehara et al. 1995; Maina et al. 1996). Also, we detected no differences in the placental and liver phenotypes between Gab1–/– and c-Met–/– mice. In the placenta, the labyrinth layer, but no other layer, is severely affected, which may cause the death of the mutant embryos. Thus, Gab1 is the essential substrate of c-Met in the placenta and liver. Selective mutation of the Grb2 binding site in c-Met, Y1356VNV
Y1356VHV, affects the formation of skeletal muscles derived from migratory precursor cells, but does not cause embryonic lethality and has no effect on liver development (Maina et al. 1996). This suggests that the coupling of c-Met to Gab1 via Y1349, the major Gab1 binding site of c-Met (Weidner et al. 1996), is sufficient for c-Met–induced proliferation and survival, whereas the coupling of c-Met to both Gab1 and Grb2 is required for efficient migration of myogenic precursor cells.
A number of genetic experiments show the importance of specific docking proteins in the signaling of receptor tyrosine kinases. DOS (daughter of sevenless), which encodes a Gab1 homologue in Drosophila (the Drosophila genome does not contain a c-Met gene), was identified in a genetic screen for downstream signaling components of the receptor tyrosine kinase sevenless (Herbst et al. 1996; Raabe et al. 1996). Here, we showed that Gab1 plays an essential role in c-Met signaling in the mouse. Mice with targeted disruption of the IRS-2 gene, which encodes a protein with a similar domain structure as Gab1, develop diabetes, demonstrating a role for this docking protein in the signaling of the insulin and insulin-like growth factor receptors (Withers et al. 1998, Withers et al. 1999). A disruption of the LAT (linker for activation of T cells) gene in mice, which encodes a transmembrane docking protein, demonstrates its essential role in T cell activation and development (Zhang et al. 1998). Thus, evidence obtained by genetic experiments in mammals supports the notion that specific tyrosine kinases use specific docking proteins.
| Acknowledgments |
|---|
We thank the Deutsche Forschungsgemeinschaft for their financial support.
Submitted: 16 March 2000
Revised: 25 July 2000
Accepted: 1 August 2000
Abbreviations used in this paper: ES, embryonic stem; PH, pleckstrin homology.
| References |
|---|
|
|
|---|
Anson-Cartwright L. Dawson K. Holmyard D. Fisher S.J. Lazzarini R.A. Cross J.C. The glial cells missing-1 protein is essential for branching morphogenesis in the chorioallantoic placenta, Nat. Genet., 25, 2000, 311–314.[Medline]
Bardelli A. Longati P. Gramaglia D. Stella M.C. Comoglio P.M.. Gab1 coupling to the HGF/Met receptor multifunctional docking site requires binding of Grb2 and correlates with the transforming potential, Oncogene., 15, 1997, 3103–3111.[Medline]
Bennett A.M. Hausdorff S.F. O'Reilly A.M. Freeman R.M. Neel B.G.. Multiple requirements for SHPTP2 in epidermal growth factor-mediated cell cycle progression, Mol. Cell. Biol., 16, 1996, 1189–1202.[Abstract]
Birchmeier C. Birchmeier W.. Molecular aspects of mesenchymal-epithelial interactions, Annu. Rev. Cell Biol., 9, 1993, 511–540.
Bladt F. Riethmacher D. Isenmann S. Aguzzi A. Birchmeier C.. Essential role for the c-met receptor in the migration of myogenic precursor cells into the limb bud, Nature., 376, 1995, 768–771.[Medline]
Breier G. Clauss M. Risau W.. Coordinate expression of vascular endothelial growth factor receptor-1 (flt-1) and its ligand suggests a paracrine regulation of murine vascular development, Dev. Dyn., 204, 1995, 228–239.[Medline]
Brohmann H. Jagla K. Birchmeier C.. The role of Lbx1 in migration of muscle precursor cells, Development., 127, 2000, 437–445.[Abstract]
Carpino N. Wisniewski D. Strife A. Marshak D. Kobayashi R. Stillman B. Clarkson B.. p62(dok)a constitutively tyrosine-phosphorylated, GAP-associated protein in chronic myelogenous leukemia progenitor cells, Cell., 88, 1997, 197–204.[Medline]
Chevallier A. Kieny M. Mauger A.. Limb-somite relationshiporigin of the limb musculature, J. Embryol. Exp. Morphol., 41, 1977, 245–258.[Medline]
Christ B. Jacob H.J. Jacob M.. Experimental analysis of the origin of the wing musculature in avian embryos, Anat. Embryol., 150, 1977, 171–186.[Medline]
Cossu G. Tajbakhsh S. Buckingham M.. How is myogenesis initiated in the embryo?, Trends Genet., 12, 1996, 218–223.[Medline]
Daston G. Lamar E. Olivier M. Goulding M.. Pax-3 is necessary for migration but not differentiation of limb muscle precursors in the mouse, Development., 122, 1996, 1017–1027.[Abstract]
Dietrich S. Schubert F.R. Healy C. Sharpe P.T. Lumsden A.. Specification of the hypaxial musculature, Development., 125, 1998, 2235–2249.[Abstract]
Dietrich S. Abou R.F. Brohmann H. Bladt F. Sonnenberg-Riethmacher E. Yamaai T. Lumsden A. Brand S.B. Birchmeier C.. The role of SF/HGF and c-Met in the development of skeletal muscle, Development., 126, 1999, 1621–1629.[Abstract]
Di Renzo M.F. Narsimhan R.P. Olivero M. Bretti S. Giordano S. Medico E. Gaglia P. Zara P. Comoglio P.M.. Expression of the Met/HGF receptor in normal and neoplastic human tissues, Oncogene., 6, 1991, 1997–2003.[Medline]
Echelard Y. Epstein D.J. St. Jacques B. Shen L. Mohler J. McMahon J.A. McMahon A.P.. Sonic hedgehog, a member of a family of putative signaling molecules, is implicated in the regulation of CNS polarity, Cell., 75, 1993, 1417–1430.[Medline]
Epstein J.A. Shapiro D.N. Cheng J. Lam P.Y. Maas R.L.. Pax3 modulates expression of the c-Met receptor during limb muscle development, Proc. Natl. Acad. Sci. USA., 93, 1996, 4213–4218.
Fixman E.D. Naujokas M.A. Rodrigues G.A. Moran M.F. Park M.. Efficient cell transformation by the Tpr-Met oncoprotein is dependent upon tyrosine 489 in the carboxy-terminus, Oncogene., 10, 1995, 237–249.[Medline]
Gherardi E. Stoker M.. Hepatocyte growth factor—scatter factormitogen, motogen, and met, Cancer Cells, 3, 1991, 227–232.[Medline]
Giordano S. Bardelli A. Zhen Z. Menard S. Ponzetto C. Comoglio P.M.. A point mutation in the MET oncogene abrogates metastasis without affecting transformation, Proc. Natl. Acad. Sci. USA., 94, 1997, 13868–13872.
Gu H. Pratt J.C. Burakoff S.J. Neel B.G.. Cloning of p97/Gab2, the major SHP2-binding protein in hematopoietic cells, reveals a novel pathway for cytokine-induced gene activation, Mol. Cell., 2, 1998, 729–740.[Medline]
Hartmann G. Weidner K.M. Schwarz H. Birchmeier W.. The motility signal of scatter factor/hepatocyte growth factor mediated through the receptor tyrosine kinase met requires intracellular action of Ras, J. Biol. Chem., 269, 1994, 21936–21939.
Herbst R. Carroll P.M. Allard J.D. Schilling J. Raabe T. Simon M.A.. Daughter of sevenless is a substrate of the phosphotyrosine phosphatase Corkscrew and functions during sevenless signaling, Cell., 85, 1996, 899–909.[Medline]
Hogan B. Beddington R. Costantini F. Lacy E., Manipulating the Mouse EmbryoA Laboratory Manual, 1994 Cold Spring Harbor Laboratory Press Cold Spring Harbor, New Yorkpp. 497.
Holder N. Klein R. Eph receptors and ephrinseffectors of morphogenesis, Development., 126, 1999, 2033–2044.[Abstract]
Holgado-Madruga M. Emlet D.R. Moscatello D.K. Godwin A.K. Wong A.J.. A Grb2-associated docking protein in EGF- and insulin-receptor signalling, Nature., 379, 1996, 560–564.[Medline]
Holgado-Madruga M. Moscatello D.K. Emlet D.R. Dieterich R. Wong A.J.. Grb2-associated binder-1 mediates phosphatidylinositol 3-kinase activation and the promotion of cell survival by nerve growth factor, Proc. Natl. Acad. Sci. USA., 94, 1997, 12419–12424.
Ingham R.J. Holgado-Madruga M. Siu C. Wong A.J. Gold M.R.. The Gab1 protein is a docking site for multiple proteins involved in signaling by the B cell antigen receptor, J. Biol. Chem., 273, 1998, 30630–30637.
Jagla K. Dolle P. Mattei M.G. Jagla T. Schuhbaur B. Dretzen G. Bellard F. Bellard M.. Mouse Lbx1 and human LBX1 define a novel mammalian homeobox gene family related to the Drosophila lady bird genes, Mech. Dev., 53, 1995, 345–356.[Medline]
Jeffers M. Rong S. Anver M. Vande-Woude G.F.. Autocrine hepatocyte growth factor/scatter factor-Met signaling induces transformation and the invasive/metastastic phenotype in C127 cells, Oncogene., 13, 1996, 853–856.[Medline]
Jeffers M. Schmidt L. Nakaigawa N. Webb C.P. Weirich G. Kishida T. Zbar B. Vande-Woude G.F.. Activating mutations for the met tyrosine kinase receptor in human cancer, Proc. Natl. Acad. Sci. USA., 94, 1997, 11445–11450.
Jindo T. Tsuboi R. Takamori K. Ogawa H.. Local injection of hepatocyte growth factor/scatter factor (HGF/SF) alters cyclic growth of murine hair follicles, J. Invest. Dermatol., 110, 1998, 338–342.[Medline]
Karlsson L. Bondjers C. Betsholtz C.. Roles for PDGF-A and sonic hedgehog in development of mesenchymal components of the hair follicle, Development., 126, 1999, 2611–2621.[Abstract]
Khwaja A. Lehmann K. Marte B.M. Downward J.. Phosphoinositide 3-kinase induces scattering and tubulogenesis in epithelial cells through a novel pathway, J. Biol. Chem., 273, 1998, 18793–18801.
Kouhara H. Hadari Y.R. Spivak K.T. Schilling J. Bar S.D. Lax I. Schlessinger J.. A lipid-anchored Grb2-binding protein that links FGF-receptor activation to the Ras/MAPK signaling pathway, Cell., 89, 1997, 693–702.[Medline]
Lecoq-Lafon C. Verdier F. Fichelson S. Chretien S. Gisselbrecht S. Lacombe C. Mayeux P.. Erythropoietin induces the tyrosine phosphorylation of GAB1 and its association with SHC, SHP2, SHIP, and phosphatidylinositol 3-kinase, Blood., 93, 1999, 2578–2585.
Lemke G.. Neuregulins in development, Mol. Cell. Neurosci., 7, 1996, 247–262.[Medline]
Lindner G. Menrad A. Gherardi E. Merlino G. Welker P. Handjiski B. Roloff B. Paus R.. Involvement of hepatocyte growth factor/scatter factor and met receptor signaling in hair follicle morphogenesis and cycling, FASEB (Fed. Am. Soc. Exp. Biol.) J., 14, 2000, 319–332.
Maina F. Casagranda F. Audero E. Simeone A. Comoglio P.M. Klein R. Ponzetto C.. Uncoupling of Grb2 from the Met receptor in vivo reveals complex roles in muscle development, Cell., 87, 1996, 531–542.[Medline]
Maroun C.R. Holgado M.M. Royal I. Naujokas M.A. Fournier T.M. Wong A.J. Park M.. The Gab1 PH domain is required for localization of Gab1 at sites of cell-cell contact and epithelial morphogenesis downstream from the met receptor tyrosine kinase, Mol. Cell. Biol., 19, 1999, 1784–1799.
Meiners S. Brinkmann V. Naundorf H. Birchmeier W.. Role of morphogenetic factors in metastasis of mammary carcinoma cells, Oncogene., 16, 1998, 9–20.[Medline]
Mennerich D. Schafer K. Braun T.. Pax-3 is necessary but not sufficient for lbx1 expression in myogenic precursor cells of the limb, Mech. Dev., 73, 1998, 147–158.[Medline]
Montesano R. Matsumoto K. Nakamura T. Orci L.. Identification of a fibroblast-derived epithelial morphogen as hepatocyte growth factor, Cell., 67, 1991, 901–908.[Medline]
Morasso M.I. Grinberg A. Robinson G. Sargent T.D. Mahon K.A.. Placental failure in mice lacking the homeobox gene Dlx3, Proc. Natl. Acad. Sci. USA., 96, 1999, 162–167.
Ohlsson R. Falck P. Hellstrom M. Lindahl P. Bostrom H. Franklin G. Ahrlund R.L. Pollard J. Soriano P. Betsholtz C.. PDGFB regulates the development of the labyrinthine layer of the mouse fetal placenta, Dev. Biol., 212, 1999, 124–136.[Medline]
Pachnis V. Durbec P. Taraviras S. Grigoriou M. Natarajan D.. III. Role of the RET signal transduction pathway in development of the mammalian enteric nervous system, Am. J. Physiol, 275, 1998, G183–G186.[Medline]
Park M. Dean M. Cooper C.S. Schmidt M. O'Brien S.J. Blair D.G. Vande-Woude G.F.. Mechanism of met oncogene activation, Cell, 45, 1986, 895–904.[Medline]
Pelicci G. Giordano S. Zhen Z. Salcini A.E. Lanfrancone L. Bardelli A. Panayotou G. Waterfield M.D. Ponzetto C. Pelicci P.G.. The motogenic and mitogenic responses to HGF are amplified by the Shc adaptor protein, Oncogene., 10, 1995, 1631–1638.[Medline]
Ponzetto C. Bardelli A. Zhen Z. Maina F. Dallazonca P. Giordano S. Graziani A. Panayotou G. Comoglio P.M.. A multifunctional docking site mediates signaling and transformation by the hepatocyte growth factor scatter factor receptor family, Cell., 77, 1994, 261–271.[Medline]
Qu C.K. Yu W.M. Azzarelli B. Cooper S. Broxmeyer H.E. Feng G.S.. Biased suppression of hematopoiesis and multiple developmental defects in chimeric mice containing Shp-2 mutant cells, Mol. Cell Biol., 18, 1998, 6075–6082.
Raabe T. Riesgo E.J. Liu X. Bausenwein B.S. Deak P. Maroy P. Hafen E.. DOS, a novel pleckstrin homology domain-containing protein required for signal transduction between sevenless and Ras1 in Drosophila, Cell., 85, 1996, 911–920.[Medline]
Ridley A.J. Comoglio P.M. Hall A.. Regulation of scatter factor/hepatocyte growth factor responses by Ras, Rac, and Rho in MDCK cells, Mol. Cell. Biol., 15, 1995, 1110–1122.[Abstract]
Riethmacher D. Brinkmann V. Birchmeier C.. A targeted mutation in the mouse E-cadherin gene results in defective preimplantation development, Proc. Natl. Acad. Sci. USA., 92, 1995, 855–859.
Rodrigues G.A. Falasca M. Zhang Z. Ong S.H. Schlessinger J.. A novel positive feedback loop mediated by the docking protein Gab1 and phosphatidylinositol 3-kinase in epidermal growth factor receptor signaling, Mol. Cell. Biol., 20, 2000, 1448–1459.
Sachs M. Weidner K.M. Brinkmann V. Walther I. Obermeier A. Ullrich A. Birchmeier W.. Motogenic and morphogenic activity of epithelial receptor tyrosine kinases, J. Cell Biol., 133, 1996, 1095–1107.
Sakata H. Takayama H. Sharp R. Rubin J.S. Merlino G. LaRochelle W.J.. Hepatocyte growth factor/scatter factor overexpression induces growth, abnormal development, and tumor formation in transgenic mouse livers, Cell Growth Differ., 7, 1996, 1513–1523.[Abstract]
Sakkab D. Lewitzky M. Posern G. Schaeper U. Sachs M. Birchmeier W. Feller S.M.. Signaling of hepatocyte growth factor/scatter factor (HGF) to the small GTPase Rap1 via the large docking protein Gab1 and the adapter protein CRKL, J. Cell Biol., 275, 2000, 10772–10778.
Saxton T.M. Pawson T.. Morphogenetic movements at gastrulation require the SH2 tyrosine phosphatase Shp2, Proc. Natl. Acad. Sci. USA., 96, 1999, 3790–3795.
Saxton T.M. Henkemeyer M. Gasca S. Shen R. Rossi D.J. Shalaby F. Feng G.S. Pawson T.. Abnormal mesoderm patterning in mouse embryos mutant for the SH2 tyrosine phosphatase Shp-2, EMBO (Eur. Mol. Biol. Organ.) J., 16, 1997, 2352–2364.[Medline]
Schaeper U. Gehring N.H. Fuchs K.-P. Sachs M. Kempkes B.B.W.. Coupling of Gab1 to c-Met, Grb2 and downstream effectors mediates biological responses, J. Cell Biol., 149, 2000, 1419–1432.
Schlessinger J. Ullrich A.. Growth factor signaling by receptor tyrosine kinases, Neuron., 9, 1992, 383–391.[Medline]
Schmidt C. Bladt F. Goedecke S. Brinkmann V. Zschiesche W. Sharpe M. Gherardi E. Birchmeier C.. Scatter factor/hepatocyte growth factor is essential for liver development, Nature., 373, 1995, 699–702.[Medline]
Schmidt L. Junker K. Weirich G. Glenn G. Choyke P. Lubensky I. Zhuang Z. Jeffers M. Vande-Woude G. Neumann H.. Two North American families with hereditary papillary renal carcinoma and identical novel mutations in the MET proto-oncogene, Cancer Res., 58, 1998, 1719–1722.
Sonnenberg-Riethmacher E. Walter B. Riethmacher D. Goedecke S. Birchmeier C.. The c-ros tyrosine kinase receptor controls regionalization and differentiation of epithelial cells in the epididymis, Genes Dev., 10, 1996, 1184–1193.
Stoker M. Gherardi E. Perryman M. Gray J.. Scatter factor is a fibroblast-derived modulator of epithelial cell mobility, Nature., 327, 1987, 239–242.[Medline]
Takahashi-Tezuka M. Yoshida Y. Fukada T. Ohtani T. Yamanaka Y. Nishida K. Nakajima K. Hibi M. Hirano T.. Gab1 acts as an adapter molecule linking the cytokine receptor gp130 to ERK mitogen-activated protein kinase, Mol. Cell. Biol., 18, 1998, 4109–4117.
Takayama H. LaRochelle W.J. Sharp R. Otsuka T. Kriebel P. Anver M. Aaronson S.A. Merlino G.. Diverse tumorigenesis associated with aberrant development in mice overexpressing hepatocyte growth factor/scatter factor, Proc. Natl. Acad. Sci. USA., 94, 1997, 701–706.
Uehara Y. Minowa O. Mori C. Shiota K. Kuno J. Noda T. Kitamura N.. Placental defect and embryonic lethality in mice lacking hepatocyte growth factor/scatter factor, Nature., 373, 1995, 702–705.[Medline]
van der Geer P. Hunter T. Lindberg R.A.. Receptor protein-tyrosine kinases and their signal transduction pathways, Annu. Rev. Cell Biol., 10, 1994, 251–337.
Voliovitch H. Schindler D.G. Hadari Y.R. Taylor S.I. Accili D. Zick Y.. Tyrosine phosphorylation of insulin receptor substrate-1 in vivo depends upon the presence of its pleckstrin homology region, J. Biol. Chem., 270, 1995, 18083–18087.
Weidner K.M. Behrens J. Vandekerckhove J. Birchmeier W.. Scatter factormolecular characteristics and effect on the invasiveness of epithelial cells, J. Cell Biol., 111, 1990, 2097–2108.
Weidner K.M. Sachs M. Birchmeier W.. The Met receptor tyrosine kinase transduces motility, proliferation, and morphogenic signals of scatter factor/hepatocyte growth factor in epithelial cells, J. Cell Biol., 121, 1993, 145–154.
Weidner K.M. Sachs M. Riethmacher D. Birchmeier W.. Mutation of juxtamembrane tyrosine residue 1001 suppresses loss-of-function mutations of the met receptor in epithelial cells, Proc. Natl. Acad. Sci. USA., 92, 1995, 2597–2601.
Weidner K.M. Di Cesare S. Sachs M. Brinkmann V. Behrens J. Birchmeier W.. Interaction between Gab1 and the c-Met receptor tyrosine kinase is responsible for epithelial morphogenesis, Nature., 384, 1996, 173–176.[Medline]
Wilkinson D.G., In Situ HybridizationA Practical Approach, 1992 Oxford University Press/IRL Press Oxfordpp. 163.
Withers D.J. Gutierrez J.S. Towery H. Burks D.J. Ren J.M. Previs S. Zhang Y. Bernal D. Pons S. Shulman G.I. Bonner W.S. White M.F. Disruption of IRS-2 causes type 2 diabetes in mice, Nature., 391, 1998, 900–904.[Medline]
Withers D.J. Burks D.J. Towery H.H. Altamuro S.L. Flint C.L. White M.F.. Irs-2 coordinates Igf-1 receptor-mediated beta-cell development and peripheral insulin signalling, Nat. Genet., 23, 1999, 32–40.[Medline]
Yamanashi Y. Baltimore D.. Identification of the Abl- and rasGAP-associated 62 kDa protein as a docking protein, Dok, Cell., 88, 1997, 205–211.[Medline]
Yang X.M. Vogan K. Gros P. Park M.. Expression of the met receptor tyrosine kinase in muscle progenitor cells in somites and limbs is absent in Splotch mice, Development., 122, 1996, 2163–2171.[Abstract]
Yu D.H. Qu C.K. Henegariu O. Lu X. Feng G.S.. Protein-tyrosine phosphatase Shp-2 regulates cell spreading, migration, and focal adhesion, J. Biol. Chem., 273, 1998, 21125–21131.
Zhang W. Sloan L.J. Kitchen J. Trible R.P. Samelson L.E.. LATthe ZAP-70 tyrosine kinase substrate that links T cell receptor to cellular activation, Cell., 92, 1998, 83–92.[Medline]
Zhu H. Naujokas M.A. Fixman E.D. Torossian K. Park M.. Tyrosine 1356 in the carboxyl-terminal tail of the HGF SF receptor is essential for the transduction of signals for cell motility and morphogenesis, J. Biol. Chem., 269, 1994, 29943–29948.
Zhuang Z. Park W.S. Pack S. Schmidt L. Vortmeyer A.O. Pak E. Pham T. Weil R.J. Candidus S. Lubensky I.A.. Trisomy 7-harboring non-random duplication of the mutant MET allele in hereditary papillary renal carcinomas, Nat. Genet., 20, 1998, 66–69.[Medline]
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|