|
||
Original Article |
Correspondence to: Paul Anderson, Division of Rheumatology and Immunology, Brigham and Women's Hospital, Smith 652, One Jimmy Fund Way, Boston, MA 02115. Tel:(617) 525-1202 Fax:(617) 525-1310 E-mail:panderson{at}rics.bwh.harvard.edu.
| Abstract |
|---|
|
|
|---|
Mammalian stress granules (SGs) harbor untranslated mRNAs that accumulate in cells exposed to environmental stress. Drugs that stabilize polysomes (emetine) inhibit the assembly of SGs, whereas drugs that destabilize polysomes (puromycin) promote the assembly of SGs. Moreover, emetine dissolves preformed SGs as it promotes the assembly of polysomes, suggesting that these mRNP species (i.e., SGs and polysomes) exist in equilibrium. We used green flourescent proteintagged SG-associated RNA-binding proteins (specifically, TIA-1 and poly[A] binding protein [PABP-I]) to monitor SG assembly, disassembly, and turnover in live cells. Fluorescence recovery after photobleaching shows that both TIA-1 and PABP-I rapidly and continuously shuttle in and out of SGs, indicating that the assembly of SGs is a highly dynamic process. This unexpected result leads us to propose that mammalian SGs are sites at which untranslated mRNAs are sorted and processed for either reinitiation, degradation, or packaging into stable nonpolysomal mRNP complexes. A truncation mutant of TIA-1 (TIA-1
RRM), which acts as a transdominant inhibitor of SG assembly, promotes the expression of cotransfected reporter genes in COS transfectants, suggesting that this process of mRNA triage might, directly or indirectly, influence protein expression.
Key Words:
TIA-1, stress granules, protein translation, eIF-2
, PABP-1
| Introduction |
|---|
|
|
|---|
Stress granules (SGs)1 are phase dense particles that appear in the cytoplasm of plant and animal cells subjected to environmental stress (![]()
![]()
![]()
![]()
(![]()
![]()
![]()
inhibits translational initiation (![]()
![]()
![]()
![]()
Assembly of SGs in response to the phosphorylation of eIF-2
is dependent on the related RNA-binding proteins TIA-1 and TIAR (![]()
![]()
![]()
![]()
![]()
![]()
mRNA (![]()
![]()
RRM) prevents arsenite-induced assembly of SGs in COS transfectants (![]()
RRM forms cytoplasmic aggregates that sequester endogenous TIA-1 and TIAR (![]()
![]()
A major unanswered question is whether SGs actively participate in stress-induced translational arrest by sequestering selected mRNAs away from the translational machinery, as has been proposed for plant heat shock granules (![]()
RRM enhances the expression of cotransfected reporter genes as it prevents the assembly of SGs. Interestingly, the opposing effects of translational inhibitors that stabilize or destabilize polysomes suggest that SGs are in a dynamic equilibrium with polysomes. Surprisingly, photobleaching studies indicate that the major protein components of SGs (TIA-1 and poly[A]+ binding protein I [PABP-1]) are in constant and extremely rapid flux, despite the relatively stable appearance of individual SGs visualized using time lapse photomicroscopy. These observations indicate that mammalian SGs do not passively sequester mRNA from the translational machinery but are highly active cytoplasmic sorting sites for mRNPs. We conclude that SGs are dynamic microdomains that influence the fate of the untranslated mRNAs that accumulate in stressed cells.
| Materials and Methods |
|---|
|
|
|---|
Cells and Antibodies
DU-145 prostate cancer cells and COS7 cells were obtained from American Type Culture Collection. Goat antiTIA-1 polyclonal antibody was obtained from Santa Cruz Biotechnology, Inc., and anti-hemagglutinin (HA) was obtained from BAbCo. Antiluciferase polyclonal antibody was obtained from Cortex Biochem, antiphosphorylated eIF-2
was obtained from Research Genetics, and antiß-galactosidase was obtained from Promega. AntieIF-2
mAb was a kind gift from Dr. Richard Panniers (National Institutes of Health, Bethesda, MD). The antiPABP antibody 10E10 was a kind gift from Dr. Gideon Dreyfuss (University of Pennsylvania, School of Medicine, Philadelphia, PA). Antibodies against the small ribosomal proteins S3 and S19 were a kind gift from Dr. Joachim Stahl (Max Delbruck Centre for Molecular Medicine, Berlin, Germany). Secondary antibodies (all ML grade, both fluorochrome-tagged and HRP-tagged) were obtained from Jackson ImmunoResearch Laboratories.
COS Cell Transfections
COS7 cells were transfected using SuperFect (QIAGEN) according to the manufacturer's instructions. Cells plated in 6-well plates (2 x 105 cells/well plated 20 h before transfection) were transfected for 24 h, then trypsinized and replated into parallel plates for both immunofluorescence (24-well plates containing 11-mm coverslips) and Western blotting or immunoprecipitation (12-well plates). This allowed us to ascertain by immunofluorescence that similar transfection efficiencies were obtained with different constructs (i.e., <20% variation within individual experiments), in order to confirm that differences in protein expression seen by Western blot were not due to differences in transfection efficiency.
Western Blot Analysis
Cells were lysed in SDS sample buffer, boiled, and sonicated to shear DNA. Proteins were resolved on 420% gradient gels (Invitrogen) using SDS-PAGE. Proteins were transferred to nitrocellulose, and the protein loading was assessed by Ponceau red staining. Blots were then blocked in 5% milk or 5% horse serum and probed using standard procedures. Proteins were detected using HRP-conjugated secondary antibodies (Jackson ImmunoResearch Laboratories), chemiluminescence (Far Western; Pierce Chemical Co.), and BioMax MR film (Eastman Kodak Co.).
Inhibition of Protein Synthesis
Cells were washed with HBSS and incubated in cysteine/methionine-free media (DME containing 5% dialyzed FBS) for 30 min. During this time, cells were exposed to the drugs at concentrations indicated in the figure legends. Immediately after the 30-min drug treatment period, one set of cells was metabolically labeled by the addition of 35S Trans-label (NEN Life Science Products) for 30 min, harvested by trypsinization, and lysed in SDS-PAGE sample buffer. After sonication, aliquots of cell lysates were separated using SDS-PAGE and stained to insure equal protein recovery from each sample. Aliquots of each sample were precipitated using 60% acetone, washed, resuspended in 1% SDS, then counted in Hydrofluor (National Diagnostics) using a liquid scintillation counter. A parallel set of cells was preincubated with either emetine, puromycin, or no drugs for 30 min, at which point SGs were induced by the addition of arsenite (0.5 mM) to the media, and the incubation was continued for 30 min. Cells were then processed for immunofluorescence staining using antiTIA-1 as described below, and the percentage of cells with SGs was determined microscopically. To assess the ability of different drugs to reverse SGs, cells were exposed to arsenite for 30 min, various concentrations of emetine, puromycin, or media alone were added, and the cells were incubated for an additional 1 h before fixation and staining. Results shown are typical of three independent experiments.
Sucrose Gradient Analysis
Cells were plated and used 48 h after plating. Cells were treated with various agents as indicated in the figure legends for the times indicated. Monolayers were washed with cold HBSS, incubated in cold HBSS containing 10 µg/ml cycloheximide for 10 min, and scrape harvested and centrifuged. Cell pellets were lysed in 1.0 ml of ice-cold lysis buffer (140 mM KCl, 1 mM DTT, 20 mM Tris, pH 8.5, mM MgCl2, 0.5% NP-40, 0.5 U/ml RNAsin [Promega], 10 mM cycloheximide, 1 mM PMSF, 5 µM leupeptin, 5 mM benzamidine, 5 µg/ml aprotinin) and mechanically disrupted using 12 strokes of a teflonglass homogenizer at low speed. Nuclei and debris were removed by microfuge centrifugation at 1,000 g for 10 min, and the postnuclear supernatant was then centrifuged at 15,000 g for 20 min. The final supernatants were layered onto preformed 11-ml 2047% linear sucrose gradients (containing a 60% sucrose cushion) made up in 140 mM KCl, 1 mM DTT, 20 mM Tris, pH 7.8, 1.5 mM MgCl2. Centrifugation was performed at 40,000 rpm for 2 h 45 min using a Beckman Coulter SW40Ti rotor. Fractions were eluted from the top of the gradient using an ISCO gradient elution system,
1-ml fractions were collected, and OD was measured at 260 nm to obtain the polysome profile. Aliquots of individual fractions were acetone-precipitated to remove sucrose and to concentrate the proteins, which were resuspended in reducing SDS sample buffer, and processed for Western blot analysis.
Plasmid Constructs
pMT2-TIA-1 and pMT2-TIA-1
RRM have been described previously (![]()
HA-GFP (a kind gift from Michel Streuli, Dana Farber Cancer Institute, Boston, MA), using a PCR strategy to produce the fusion proteins HA-GFPTIA-1 and HA-GFPPABP. In brief, TIA-1 was amplified from pMT2TIA-1 for 25 cycles (94°C for 1 min, 50°C for 1 min, and 74°C for 1 min) using Tli polymerase (Promega) and primers with EcoRI and XbaI cloning sites (CCGGAATTCATGGAGGACGAGATGCCCA and GCTCTAGATTCACTGGGTTTCATACCCTGC, respectively). PABP was similarly amplified from pMA-PABP using primers with XbaI and KpnI cloning sites (CTAGTCTAGAATGAACCCCAGTGCCCCC and CGGGGTACCTTAAACAGTTGGAACACC, respectively). The inserts were cut with EcoRI and XbaI or XbaI and KpnI, respectively, and cloned in-frame with a fusion HA-GFP tag in pSR
HA-GFP that was similarly cut. The final clones were verified by sequencing. pcDNA3ß-galactosidase was obtained from Invitrogen. Plasmids encoding luciferase followed by the TNF-
3' untranslated region, either with or without its AU-rich element (ARE), were a kind gift from Veronique Kruys (Université Libre de Bruxelles, Brussels, Belgium).
Fluorescence Microscopy
Cells were grown, fixed, and stained as described previously (![]()
![]()
Video Fluorescence Microscopy
Epifluorescence video microscopy was used to obtain digitized fluorescence images of live COS cells transfected with plasmids encoding GFPTIA-1, GFP-PABP, or GFP only. Cells were treated as indicated in the figure legends, placed on a temperature-controlled microscope stage (37 ± 0.5°C), and observed using a ZEISS Axioskop microscope. The illumination source was a 100-W mercury arc lamp. Illuminating light was passed through heat and dichroic filters and focused on the sample through a 25x/0.8 NA oil immersion objective. Fluorescence emission was imaged using a cooled CCD camera (Roper Scientific) and processed for pseudocolor by a Metamorph image processor (Universal Imaging Corp.). Background intensity was subtracted from each image. The final images were compiled using Adobe Photoshop® (v5.5).
FRAP
COS cells were transiently transfected as described above, stimulated with arsenite for 30 min at 37°C, and viewed using a 40x/0.85 NA oil objective. FRAP experiments (![]()
0.5 mW, and the bleaching time was 1 s. The photobleaching beam was positioned directly over each SG. The fractional recovery (i.e., the fraction of GFP-conjugated protein that was capable of diffusion into the bleached SG) was obtained by using nonlinear least squares analysis of fluorescence recovery curves (![]()
Online Supplemental Material
Digitized images were captured every 2 min as described above (Video Fluorescence Microscopy), and pseudocolored using Metamorph software. Images were overlaid using Adobe Photoshop® (v5.5) and animated using Adobe ImageReadyTM (v2.0) software, using a 0.1-s delay between frames taken 2 min apart. Intensity scale is the same as shown in Fig 6. Videos containing animated versions of the data also shown in Fig 5 and Fig 6 are available at http://www.jcb.org/cgi/content/full/151/6/1257/DC1.
|
|
|
|
|
|
| Results |
|---|
|
|
|---|
Components of Polysomes and SGs Are in Equilibrium
In tomato cells, mRNA moves from polysomes to SGs in cells exposed to heat shock and from SGs to polysomes in cells allowed to recover from heat shock (![]()
![]()
![]()
The accumulation of untranslated mRNA at SGs could be static or dynamic. If it is static, mRNA (and associated proteins) will move into SGs during stress and out of SGs during recovery. In this case, addition of emetine to stressed cells should prevent further growth of preformed SGs. If it is dynamic, mRNA and associated proteins will continuously shuttle in and out of SGs during both stress and recovery. In this case, addition of emetine to stressed cells might disassemble preformed SGs by trapping mRNA at polysomes. As shown in Fig 2, emetine dissolves preformed TIA-1+ SGs in the continued presence of stress. Although TIA-1 and TIAR are concentrated in the nucleus of DU-145 cells under control conditions (Fig 2 A), these proteins move to cytoplasmic SGs in response to arsenite (Fig 2 B; 0.5 mM, 30 min). In contrast, treatment with emetine at 10 µg/ml, which completely abrogates protein synthesis (see Fig 1), increases the amount of cytoplasmic TIA-1/R but does not induce its aggregation into SGs (Fig 2 C). The addition of emetine to arsenite-stressed cells (0.5 mM arsenite for 30 min, followed by the addition of 10 µg/ml emetine for an additional 60 min) dissolves preformed SGs in the continued presence of arsenite (Fig 2 D; similar results were obtained using cycloheximide, data not shown). In contrast, addition of puromycin (20 µg/ml, a concentration that inhibits protein synthesis to a similar extent as 10 µg/ml emetine, see Fig 1) to arsenite-stressed cells causes SGs to increase in size (Fig 2 F). Puromycin alone induces the assembly of SGs in rare cells (Fig 2 E, arrow), the percentage of which increases with time (data not shown).
To confirm that poly(A)+ RNA is also recruited to SGs, we used in situ hybridization to monitor the subcellular localization of poly(A)+ RNA under these same conditions. As shown in Fig 3, emetine dissolves preformed poly(A) RNA+ SGs despite the continued presence of stress (compare Fig 3B with D). In contrast, puromycin causes arsenite-induced poly(A) RNA+ SGs to increase in size (Fig 3 F). Although emetine alone does not affect the subcellular localization of poly(A)+ RNA (Fig 3 C), puromycin alone induces the formation of poly(A) RNA+ SGs in rare cells (Fig 3 E, arrow). The differential effects of drugs that stabilize or destabilize polysomes on the accumulation of poly(A)+RNA at SGs suggest that mRNA may be in a dynamic equilibrium between SGs and polysomes.
Phosphorylation of eIF-2
is necessary and sufficient to induce the assembly of SGs (![]()
. Therefore, we measured the phosphorylation of eIF-2
in DU-145 cells subjected to arsenite-induced oxidative stress in the absence or presence of emetine. As shown in Fig 4 A, immunoblots of total cell extracts probed with antibodies against phosphorylated eIF-2
or total eIF-2
reveal that eIF-2
is not significantly phosphorylated in untreated cells (Fig 4 A, lane C). Arsenite (0.5 mM) induces a time-dependent phosphorylation of eIF-2
(A30, 30-min treatment; A90, 90-min treatment). Addition of emetine to cells pretreated with arsenite for 30 min does not reduce the phosphorylation of eIF-2
(Fig 4 A, lane A+E) and, instead, appears to increase it. Neither emetine (Fig 4 A, lane E) nor puromycin (Fig 4 A, lane P) significantly induces the phosphorylation of eIF-2
in the absence of arsenite. These data indicate that emetine does not dissolve preformed SGs by promoting eIF-2
dephosphorylation, nor does puromycin enhance the assembly of SGs by promoting eIF-2
phosphorylation.
Further evidence for a dynamic equilibrium between SGs and polysomes was obtained by comparing polysome profiles in arsenite-stressed cells in the absence or presence of emetine. DU-145 cells were treated as described above before separating cytosolic extracts on sucrose gradients (Fig 4 B). The absorbance of individual fractions clearly distinguishes 80S monosomes (fractions 25) from polysomes (fractions 711) in untreated DU-145 cells (Fig 4 B, black open squares). The location of monosomes and polysomes was confirmed by blotting individual fractions for ribosomal proteins S3 and S19 (Fig 4 C). Emetine treatment alone (10 µg/ml, 1 h) does not significantly change the polysome profile (Fig 4 B, blue squares). As expected, 30 min of arsenite treatment (0.5 mM) results in the disassembly of polysomes (Fig 4 B, blue diamonds), whereas 90 min of arsenite treatment (Fig 4 B, red squares) also disassembles polysomes and appears to shift the monosome peak even further to the top of the gradient, perhaps indicating the accumulation of ribosomal subunits. The addition of emetine to arsenite-stressed cells (0.5 mM arsenite for 30 min followed by 10 µg/ml emetine for an additional 1 h) promotes the assembly of low density polysomes (fractions 810, green diamonds), even though arsenite is present throughout the entire 90-min incubation (compare green diamonds with red squares). These results indicate that SG-associated mRNA can move to polysomes during stress, despite the continued phosphorylation of eIF-2
.
Individual fractions from the sucrose gradients were subjected to immunoblotting analysis to localize TIA-1 and PABP-I, the major protein components of SGs (![]()
In contrast to PABP-I, the bulk of TIA-1 (Fig 4 C, all panels) and TIAR (data not shown) is concentrated at the top of the gradient (i.e., fractions 14) under all conditions, indicating that most TIA-1 protein is present in soluble and low density complexes. The distribution of TIA-1 is not altered in cells treated with arsenite (Fig 4 C, panels 2 and 3) nor in cells treated with arsenite and emetine (Fig 4 D). Significant amounts of TIA-1 migrate with the 80S peak, with trace amounts barely detectable in the polysome region. These results suggest that TIA-1 associates with translationally inactive mRNA rather than polysomal mRNA, consistent with data from our lab (![]()
![]()
![]()
Real Time Imaging of TIA-1+/PABP-I+ SGs
We monitored the assembly and disassembly of SGs in real time in live cells, using cDNA constructs encoding GFP alone, GFPTIA-1, and GFPPABP-I. COS cells were transiently transfected with GFPTIA-1 and cultured for 24 h. The subcellular localization of GFPTIA-1 was then monitored using fluorescence microscopy. Like the endogenous protein, GFPTIA-1 is concentrated in the nuclei of transfected COS cells (Fig 5, time 0). In cells subjected to arsenite-induced oxidative stress, GFPTIA-1 moves from the nucleus to the cytoplasm in a time-dependent manner (Fig 5). At early times (i.e., 6 min), GFPTIA-1 is diffusely distributed throughout the cytoplasm. At later times (
14 min), cytoplasmic GFPTIA-1 accumulates at discrete foci that enlarge and coalesce in the continued presence of stress (time lapse video available at http://www. jcb.org/cgi/content/full/151/6/1257/DC1). Endogenous TIA-1 accumulates at SGs in COS cells with similar kinetics (![]()
We also monitored the disassembly of GFPTIA-1+ SGs that had formed in response to a sublethal dose of arsenite (0.5 mM for 30 min). In cells allowed to recover in the absence of arsenite, GFPTIA-1+ SGs are disassembled within 6090 min (Fig 6). Although small SGs are dissolved faster than large SGs, the rate of dissolution appears to be similar regardless of the initial size. During the disassembly process, GFPTIA-1+ SGs slowly dissolve while maintaining their position in the cytoplasm. GFPTIA-1+ SGs that are adjacent to the nucleus appear to move towards the nuclear envelope as they slowly disperse. A time lapse video of this process is available at http://www.jcb.org/cgi/content/full/151/6/1257/DC1. As expected, cycloheximide enhances the disassembly rate of GFPTIA-1+ SGs in COS transfectants allowed to recover from a sublethal dose of arsenite (data not shown). Similar results were obtained using GFPPABP-I (data not shown), another invariant marker of SGs (![]()
FRAP
We used FRAP analysis to determine whether GFPTIA-1 and GFPPABP-I shuttle in and out of SGs. COS cells expressing either GFPTIA-1 or GFPPABP-I were subjected to arsenite-induced oxidative stress to induce the assembly of SGs. Confocal microscopy was used to select SGs for FRAP analysis (Fig 7, right, arrows point to targeted SGs). Graphical representations of fluorescence intensity were obtained by scanning an argon beam in a linear pattern across the selected field (Fig 7, left). COS (GFPTIA-1) transfectants were arsenite-treated and then fixed with paraformaldehyde and postfixed with methanol (Fig 7 A). These cells exhibit diffuse cytoplasmic fluorescence of 400600 arbitrary units with peaks that correspond to SGs (Fig 7 A, the scanned field includes the targeted SG and two adjacent SGs). Before photobleaching, fluorescence from the targeted SG peaks at 2,200 arbitrary units (Fig 7 A, red). Photobleaching (achieved by irradiating the targeted peak for 1 s using a 1-µm-diameter argon laser beam at 488 nm) eliminates both diffuse cytoplasmic and SG-associated fluorescence (i.e., the fluorescence intensity dips below the background), as revealed by a scan taken 0.65 s after photobleaching (Fig 7 A, purple). A second scan taken 22 s after photobleaching is similar to the initial postphotobleaching scan (Fig 7 A, blue), as is the scanned image (Fig 7 A, right) taken 6 min later, indicating that unirradiated GFPTIA-1 does not reconstitute the SG in fixed cells. In live COS (GFPTIA-1) transfectants treated with arsenite, fluorescence from the targeted SG peaks at 800 arbitrary units (Fig 7 B, red). Although the photobleaching treatment eliminates most (72%) of the SG-associated fluorescence as revealed by a scan taken 0.65 s after irradiation (Fig 7 B, purple), a second scan taken 22 s after photobleaching reveals that the fluorescence intensity has recovered to that of the prephotobleached SG (Fig 7 B, blue). This recovery of fluorescence must be due to the recruitment of unbleached GFPTIA-1 from outside of the photobleached field. Similar results are observed using GFPPABP-I (Fig 7 C) (before bleaching, red; 0.65 s after bleaching, purple; 22 s after bleaching, blue). The kinetics of fluorescence recovery in fixed and unfixed cells are compared in Fig 8. The recovery of GFPTIA-1 and GFPPABP-I is biphasic, with a rapid early phase (t1/2
1 s) and a slower late phase (t1/2
5 s). During the early phase, GFPTIA-1 returns to the SG faster than GFPPABP-I. During the late phase, the rates at which GFPTIA-1 and GFPPABP-I recover are similar. Overall recovery of GFPTIA-1 is greater than that of GFPPABP-I (99 vs. 61%). These results are representative of data obtained from photobleaching of 10 GFPTIA-1+ SGs and 8 GFPPABP-I+ SGs.
|
|
TIA-1
RRM Promotes the Expression of Cotransfected Reporter Genes
A TIA-1 truncation mutant lacking its RNA-binding domains (TIA-1
RRM) prevents the arsenite-induced assembly of SGs and forms cytoplasmic microaggregates that sequester endogenous TIA-1 and TIAR (![]()
RRM truncation is shown in Fig 9 A. COS cells were transfected with plasmids encoding full-length recombinant TIA-1, TIA-1
RRM, or empty vector, and expression of the recombinant proteins was confirmed by immunoblotting analysis (Fig 9 B, panel d). The TIA1
RRM cDNA construct produces two peptides, a consequence of translational initiation at methionines 219 and 230 (Fig 9 A). The effect of these recombinant proteins on the expression of co-transfected ß-galactosidase (Fig 9 B, panel a) or luciferase (Fig 9 B, panels b and c) was determined by blotting the same filters with antibodies specific for the reporter proteins. The relative expression of the reporter proteins, determined by densitometric scanning, revealed that TIA-1
RRM increases the expression of ß-galactosidase (4.2 ± 4fold, n = 5) compared with the vector control. In contrast, full-length TIA-1 slightly reduces the expression of ß-galactosidase (0.9 ± 0.5fold, n = 5) compared with the vector control. Metabolic labeling and immunoprecipitation experiments (data not shown) give similar results. Because TIA-1 binds to AREs in the 3' untranslated region of TNF-
transcripts (![]()
with or without the ARE (Fig 9 B, compare panels b and c). The presence of the ARE does not significantly affect luciferase expression in COS (TIA-1
RRM) transfectants. In contrast, the ARE may enhance the repressive effect of full-length TIA-1 (Fig 9 B, compare panel b with c). These results suggest that TIA-1 normally functions to dampen protein expression, consistent with previous results showing that TIA-1 represses TNF-
expression in macrophages (![]()
|
| Discussion |
|---|
|
|
|---|
Stress-induced translational arrest is initiated by the phosphorylation of eIF-2
, a subunit of the eIF2:GTP:Met-tRNAi ternary complex that is required at the first step of protein synthesis (![]()
(eIF2[
P]) forms an active ternary complex that can initiate a single round of translation (![]()
P):GDP, a competitive inhibitor of the guanine nucleotide exchange factor (eIF2B) that normally regenerates eIF2:GTP (![]()
P)-induced assembly of SGs (![]()
![]()
The sequestration model of translational control implies that SGs are stable depots of untranslated mRNPs; however, the different effects of emetine and puromycin on the assembly of SGs are not consistent with this simple model. Emetine is an elongation inhibitor that freezes ribosomes on their translating mRNA (![]()
. These data indicate that mRNA can shuttle between SGs and polysomes during stress. Emetine reveals this dynamic equilibrium by acting as a polysome trap and verifies that arsenite-induced phosphorylation of eIF-2
(which is not dephosphorylated in response to emetine) reduces (Fig 1 A and 4 B) but does not eliminate translational initiation. Unlike emetine, puromycin is an aminoacyl tRNA analogue that destabilizes polysomes by promoting premature termination (![]()
To address this issue, we used time lapse microscopy and FRAP analysis to monitor the recruitment of GFP-tagged TIA-1 (and PABP-I) to SGs. These experiments reveal that GFPTIA-1 and GFPPABP-I slowly accumulate at SGs in response to arsenite. The kinetics of SG assembly must be determined by the rate at which proteins enter (the "in-rate") and leave (the "out-rate") individual SGs. If SGs are static (i.e., the out-rate is zero in stressed cells), the growth of SGs will be determined by the in-rate. If SGs are dynamic (i.e., components continuously shuttle in and out), the growth of SGs will be determined by the difference between the in-rate and the out-rate. FRAP analysis shows that photobleached GFPTIA-1+ SGs are >70% reconstituted very rapidlywithin 4 s. Thus the in-rate (t1/2
2 s) is two to three orders of magnitude faster than the rate of SG assembly (t1/2
1530 min). This result indicates that the accumulation of GFPTIA-1 at SGs is not a simple function of the in-rate. Rather, the slow accumulation of GFPTIA-1 at SGs indicates that the rapid in-rate is balanced by a slightly less rapid out-rate. Thus, although TIA-1 is necessary for SG assembly, as indicated by the ability of TIA-1
RRM to block SG formation, TIA-1 is not a stable component of SGs themselves. Similarly, PABP-I is not a stable component of SGs, although its turnover within the SG appears less rapid and less complete than that of TIA-1.
Recovery of GFPTIA-1 and GFPPABP-I fluorescence in photobleached SGs is biphasic. During the early phase (<2 s), the net accumulation of GFPTIA-1 is significantly greater than that of GFPPABP-I. During the late phase, the rates at which GFPTIA-1 and GFPPABP-I accumulate in SGs are similar. These results suggest that TIA-1 and PABP-I are not components of the same RNP complex during the early phase of reconstitution. PABP-I associates with mRNA in translated (i.e., polysomes) and untranslated (i.e., SGs) mRNP complexes. In contrast, sucrose gradient analysis reveals that TIA-1 is largely excluded from polysomes in unstressed cells, although a very small fraction of cytoplasmic TIA-1/R can be found in high density, polysome-containing fractions in sucrose gradients. It is therefore possible that TIA-1/R participate in stress-induced translational termination, polysome disassembly and/or delivery of nonpolysomal mRNA to SGs. In the latter case, the later phase of reconstitution of both GFPTIA-1 and GFPPABP-I could occur in association with mRNA.
Our data reveal that SGs are highly dynamic structures despite their apparent stability in time lapse videos. In this respect, SGs resemble several nuclear RNAcontaining structures (e.g., speckles, coiled bodies, Gemini of coiled bodies, and nucleoli) that are sites of active RNA metabolism (![]()
![]()
![]()
![]()
![]()
![]()
![]()
Previously, we described a truncation mutant of TIA-1 (TIA-1
RRM) that lacks the ability to bind RNA (![]()
![]()
in LPS-stimulated macrophages (![]()
and induces the assembly of SGs (![]()
![]()
In conclusion, the data presented indicate that SGs are dynamic microdomains containing translationally inactive mRNA into which TIA-1 and PABP-I rapidly shuttle and which are in equilibrium with polysomes. As TIA-1 is a translational silencer and PABP-I a translational enhancer, we favor the view that SGs constitute mRNA triage domains where mRNAs are converted to silenced mRNPs by the addition of TIA-1. Although the molecular details of this process await further investigation, our data establish that SGs are highly dynamic domains within which mRNA processing, sorting, and/or remodeling events are likely to regulate the expression of specific mRNA transcripts.
| Footnotes |
|---|
The online version of this article contains supplemental material. ![]()
1 Abbreviations used in this paper: ARE, AU-rich element; eIF, eukaryotic initiation factor; HA, hemagglutinin; PABP-I, poly(A)+ binding protein I; PrD, prion-related domain; RRM, RNA recognition motif; SG, stress granule. ![]()
| Acknowledgements |
|---|
|
|
|---|
We thank members of the Anderson laboratory for helpful discussions.
P. Anderson was supported by National Institutes of Health grant AI33600, a Biomedical Science Grant from the Arthritis Foundation, and a Leukemia Scholar Award. D.E. Golan was supported by grants from the National Institutes of Health (HL32854 and HL15157). M.R. Cho was supported by a Whitaker Biomedical Engineering Research grant.
Submitted: 13 June 2000
Revised: 17 October 2000
Accepted: 24 October 2000
| References |
|---|
|
|
|---|
mRNA. J. Biol. Chem 274:2322-2326
to the assembly of mammalian stress granules. J. Cell Biol 147:1431-1441
This article has been cited by other articles:
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
|
|